Bistro2: analysis of amplicon bisulfite sequencing
Mark Ziemann
2022-05-09
Intro
suppressPackageStartupMessages({
library("reshape2")
library("kableExtra")
library("dplyr")
library("RColorBrewer")
library("GenomicRanges")
library("limma")
library("methylKit")
library("gplots")
library("seqinr")
library("liftOver")
library(rtracklayer)
library(GenomicFeatures)
library(ggbio)
library(Homo.sapiens)
})Notes
Pool1 and pool1 data were merged before analysis.
There is some data named pool14b which was changed to pool14.
My notes from our meeting yesterday:
Percent CpG sites with usable data (done)
Just provide the beta values (done)
remove pool8, pool17 and rerun stats
Adjust by bisulfite conversion
Off target reads
DATADIR="fastq"
oft_name = paste(DATADIR,"/3col_offtarget.tsv",sep="")
oft <- read.table(oft_name)
x <- t( as.matrix(acast(oft, V2~V1, value.var="V3")) )
x <- x[,which(colSums(x)!=0)]
x %>% kbl() %>% kable_styling()| Assigned | Unassigned_Ambiguity | Unassigned_NoFeatures | Unassigned_Unmapped | |
|---|---|---|---|---|
| 101-1023 | 6 | 1 | 56303 | 54 |
| 185-1135 | 40 | 1 | 49810 | 13995 |
| 7185 | 3 | 2 | 41439 | 33 |
| Neg | 0 | 0 | 0 | 0 |
| NTC | 0 | 0 | 0 | 0 |
| pool1 | 38090 | 8382 | 40957 | 25941 |
| pool10 | 12517 | 5445 | 30254 | 322 |
| pool11 | 1704 | 792 | 2644 | 100 |
| pool12 | 30597 | 7399 | 32159 | 6516 |
| pool13 | 13353 | 6554 | 28072 | 23124 |
| pool14 | 12107 | 6142 | 26051 | 482 |
| pool15 | 13567 | 5653 | 23714 | 5248 |
| pool16 | 16359 | 8168 | 29394 | 353 |
| pool17 | 12111 | 5581 | 18616 | 2693 |
| pool18 | 13331 | 6023 | 18734 | 4482 |
| pool19 | 21994 | 8436 | 28257 | 1705 |
| pool2 | 10500 | 8811 | 30452 | 7882 |
| pool20 | 6164 | 3661 | 13226 | 1856 |
| pool21 | 24421 | 10121 | 31503 | 358 |
| pool22 | 13533 | 9907 | 31076 | 7665 |
| pool23 | 13910 | 8316 | 21453 | 2354 |
| pool24 | 16840 | 6651 | 19216 | 5263 |
| pool3 | 11142 | 6649 | 29355 | 8899 |
| pool4 | 12702 | 9295 | 26499 | 4232 |
| pool5 | 14707 | 8075 | 27974 | 13020 |
| pool6 | 18355 | 11346 | 43979 | 841 |
| pool7 | 10369 | 5997 | 25080 | 16083 |
| pool8 | 10254 | 7360 | 38729 | 10582 |
| pool9 | 12772 | 6327 | 20104 | 7550 |
| PoolM | 35540 | 9028 | 46861 | 617 |
| PoolMM | 29923 | 6924 | 42942 | 1431 |
| Undetermined | 24291 | 10479 | 59327 | 75519 |
xx <- t(x/rowSums(x) * 100)
t(xx) %>% kbl() %>% kable_styling()| Assigned | Unassigned_Ambiguity | Unassigned_NoFeatures | Unassigned_Unmapped | |
|---|---|---|---|---|
| 101-1023 | 0.0106451 | 0.0017742 | 99.89177 | 0.0958058 |
| 185-1135 | 0.0626508 | 0.0015663 | 78.01585 | 21.9199323 |
| 7185 | 0.0072329 | 0.0048219 | 99.90838 | 0.0795622 |
| Neg | NaN | NaN | NaN | NaN |
| NTC | NaN | NaN | NaN | NaN |
| pool1 | 33.5979536 | 7.3934903 | 36.12684 | 22.8817147 |
| pool10 | 25.7880424 | 11.2180148 | 62.33055 | 0.6633978 |
| pool11 | 32.5190840 | 15.1145038 | 50.45802 | 1.9083969 |
| pool12 | 39.9068748 | 9.6503241 | 41.94415 | 8.4986501 |
| pool13 | 18.7797983 | 9.2176139 | 39.48075 | 32.5218345 |
| pool14 | 27.0354160 | 13.7153321 | 58.17293 | 1.0763253 |
| pool15 | 28.1578183 | 11.7325972 | 49.21755 | 10.8920344 |
| pool16 | 30.1415042 | 15.0495633 | 54.15853 | 0.6504035 |
| pool17 | 31.0530499 | 14.3098895 | 47.73211 | 6.9049512 |
| pool18 | 31.3154804 | 14.1484614 | 44.00752 | 10.5285412 |
| pool19 | 36.4187310 | 13.9687376 | 46.78931 | 2.8232216 |
| pool2 | 18.2149362 | 15.2849336 | 52.82678 | 13.6733455 |
| pool20 | 24.7480628 | 14.6986791 | 53.10154 | 7.4517204 |
| pool21 | 36.7769528 | 15.2417812 | 47.44213 | 0.5391323 |
| pool22 | 21.7638829 | 15.9325196 | 49.97668 | 12.3269166 |
| pool23 | 30.2174527 | 18.0653010 | 46.60352 | 5.1137228 |
| pool24 | 35.1052741 | 13.8649156 | 40.05837 | 10.9714405 |
| pool3 | 19.8804532 | 11.8636810 | 52.37755 | 15.8783121 |
| pool4 | 24.0896677 | 17.6282051 | 50.25603 | 8.0260962 |
| pool5 | 23.0603989 | 12.6615028 | 43.86290 | 20.4152032 |
| pool6 | 24.6306410 | 15.2252385 | 59.01558 | 1.1285409 |
| pool7 | 18.0239531 | 10.4243077 | 43.59540 | 27.9563351 |
| pool8 | 15.3216287 | 10.9973851 | 57.86926 | 15.8117295 |
| pool9 | 27.3180331 | 13.5328214 | 43.00045 | 16.1486963 |
| PoolM | 38.6111292 | 9.8081394 | 50.91041 | 0.6703170 |
| PoolMM | 36.8419109 | 8.5249938 | 52.87121 | 1.7618813 |
| Undetermined | 14.3211725 | 6.1780728 | 34.97724 | 44.5235119 |
par(mar=c(5, 10, 5, 2))
barplot(rowSums(x),horiz=TRUE,las=1,cex.names=0.7,main="total reads") ; grid()
barplot(x[,1],horiz=TRUE,las=1,cex.names=0.7,main="assigned reads (on target)") ; grid()
barplot(x[,2],horiz=TRUE,las=1,cex.names=0.7,main="unassigned reads (ambiguity)") ; grid()
barplot(x[,3],horiz=TRUE,las=1,cex.names=0.7,main="unassigned reads (off target)") ; grid()
barplot(x[,4],horiz=TRUE,las=1,cex.names=0.7,main="unmapped reads ") ; grid()
par(mar=c(5, 10, 5, 2))
barplot(xx,horiz=TRUE,las=1,cex.names=0.6,xlab="proportion of reads (%)",
legend.text=TRUE,
args.legend = list(x = "topright" , bty = "n", inset=c(0, -0.15), cex=0.8))
grid()
barplot(xx[1,],horiz=TRUE,las=1,cex.names=0.7,main="proportion of reads on target (%)") ; grid()
On target reads
ont_name = paste(DATADIR,"/3col_ontarget.tsv",sep="")
ont <- read.table(ont_name)
y <-t( as.matrix(acast(ont, V2~V1, value.var="V3",fun.aggregate=sum)) )
y %>% kbl() %>% kable_styling()| LEP | NPY_1 | NPY_2 | POMC_1 | POMC_2 | SOCS3 | TNF | |
|---|---|---|---|---|---|---|---|
| 101-1023 | 0 | 0 | 0 | 0 | 2 | 0 | 4 |
| 185-1135 | 4 | 0 | 0 | 1 | 23 | 6 | 6 |
| 7185 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
| Neg | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| NTC | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| pool1 | 192 | 9 | 7 | 16802 | 13978 | 3930 | 3172 |
| pool10 | 1117 | 10 | 10 | 253 | 5316 | 4993 | 818 |
| pool11 | 47 | 14 | 1 | 59 | 813 | 702 | 68 |
| pool12 | 430 | 22 | 10 | 7793 | 15494 | 6124 | 724 |
| pool13 | 344 | 3 | 1 | 98 | 7080 | 5443 | 384 |
| pool14 | 2513 | 1 | 13 | 246 | 5311 | 3815 | 208 |
| pool15 | 252 | 0 | 5 | 561 | 7890 | 4618 | 241 |
| pool16 | 1570 | 1 | 14 | 351 | 7400 | 6714 | 309 |
| pool17 | 439 | 0 | 2 | 24 | 5888 | 5314 | 444 |
| pool18 | 611 | 1 | 3 | 525 | 6870 | 4912 | 409 |
| pool19 | 716 | 1727 | 7 | 637 | 9902 | 8359 | 646 |
| pool2 | 257 | 7 | 3 | 1044 | 2768 | 6087 | 334 |
| pool20 | 366 | 1 | 6 | 183 | 2713 | 2617 | 278 |
| pool21 | 7542 | 8 | 9 | 489 | 6753 | 8498 | 1122 |
| pool22 | 427 | 2 | 3 | 277 | 5266 | 7121 | 437 |
| pool23 | 326 | 0 | 4 | 45 | 7324 | 5902 | 309 |
| pool24 | 105 | 0 | 2 | 238 | 9577 | 6335 | 583 |
| pool3 | 171 | 6 | 11 | 1799 | 3835 | 5104 | 216 |
| pool4 | 308 | 0 | 7 | 406 | 4411 | 7302 | 268 |
| pool5 | 232 | 1 | 0 | 1918 | 6940 | 5429 | 187 |
| pool6 | 3219 | 0 | 7 | 471 | 5741 | 8541 | 376 |
| pool7 | 244 | 92 | 6 | 608 | 5545 | 3716 | 158 |
| pool8 | 193 | 0 | 4 | 621 | 5181 | 4128 | 127 |
| pool9 | 401 | 0 | 1 | 50 | 6098 | 5631 | 591 |
| PoolM | 20993 | 93 | 13 | 4164 | 6773 | 441 | 3063 |
| PoolMM | 14788 | 171 | 8 | 272 | 12343 | 338 | 2003 |
| Undetermined | 472 | 121 | 144 | 4070 | 11482 | 7192 | 810 |
yy <- t(y/rowSums(y) * 100)
par(mar=c(5, 10, 5, 2))
barplot(yy,horiz=TRUE,las=1,cex.names=0.6,xlab="proportion of reads (%)",
legend.text=TRUE,col=brewer.pal(n = 7, name = "Set1"),
args.legend = list(x = "left" , bty = "n", inset=c(-0.3, -0.15), cex=0.8))
grid()
yy <- yy[,which( ! colnames(yy) %in% c("Neg","101-1023","185-1135","7185","NTC","Pool1") )]
colfunc <- colorRampPalette(c("white", "blue"))
heatmap.2(yy,trace="none",scale="none",col=colfunc(25))
Look at on-target reads
Here we have a summary of the reads that were on target for each amplicon for each individual.
myfiles <- list.files("fastq/",pattern="bedgraph.intersect",full.names=TRUE)
ont <- lapply(myfiles, function(x) { y <- read.table(x,header=TRUE) ; y } )
names(ont) <- gsub(".bam.bedgraph.intersect","",gsub("fastq//","",myfiles))
ont## $`101-1023`
## [1] chr start end n_reads chr.1 start.1 end.1 gene overlap
## <0 rows> (or 0-length row.names)
##
## $`185-1135`
## [1] chr start end n_reads chr.1 start.1 end.1 gene overlap
## <0 rows> (or 0-length row.names)
##
## $`7185`
## [1] chr start end n_reads chr.1 start.1 end.1 gene overlap
## <0 rows> (or 0-length row.names)
##
## $Neg
## [1] chr start end n_reads chr.1 start.1 end.1 gene overlap
## <0 rows> (or 0-length row.names)
##
## $NTC
## [1] chr start end n_reads chr.1 start.1 end.1 gene overlap
## <0 rows> (or 0-length row.names)
##
## $pool1
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 3926 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 8075 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168396 8405 2 25168373 25168611 POMC_1 23
## 4 2 25168587 25168608 8389 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 1673 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 8358 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 8358 7 24283796 24283936 NPY_2 140
## 8 7 128241096 128241289 181 7 128241036 128241347 LEP 193
## 9 7 128241325 128241326 100 7 128241036 128241347 LEP 1
## 10 7 128241327 128241330 100 7 128241036 128241347 LEP 3
## 11 7 128241331 128241347 100 7 128241036 128241347 LEP 16
##
## $pool10
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 4990 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 4764 2 25161598 25161833 POMC_2 235
## 3 2 25168588 25168608 163 2 25168373 25168611 POMC_1 20
## 4 6 31575209 31575467 800 6 31575210 31575467 TNF 257
## 5 7 24283596 24283937 5412 7 24283548 24283843 NPY_1 247
## 6 7 24283596 24283937 5412 7 24283796 24283936 NPY_2 140
## 7 7 128241038 128241347 946 7 128241036 128241347 LEP 309
##
## $pool11
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 702 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161833 565 2 25161598 25161833 POMC_2 235
## 3 7 24283795 24283936 789 7 24283548 24283843 NPY_1 48
## 4 7 24283795 24283936 789 7 24283796 24283936 NPY_2 140
##
## $pool12
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 6121 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 8456 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 3898 2 25168373 25168611 POMC_1 22
## 4 2 25168587 25168608 3894 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 680 6 31575210 31575467 TNF 257
## 6 7 24283547 24283571 105 7 24283548 24283843 NPY_1 23
## 7 7 24283572 24283574 105 7 24283548 24283843 NPY_1 2
## 8 7 24283594 24283937 7371 7 24283548 24283843 NPY_1 249
## 9 7 24283594 24283937 7371 7 24283796 24283936 NPY_2 140
## 10 7 128241038 128241347 425 7 128241036 128241347 LEP 309
##
## $pool13
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5441 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5070 2 25161598 25161833 POMC_2 235
## 3 6 31575209 31575467 378 6 31575210 31575467 TNF 257
## 4 7 24283795 24283937 6543 7 24283548 24283843 NPY_1 48
## 5 7 24283795 24283937 6543 7 24283796 24283936 NPY_2 140
## 6 7 128241038 128241347 343 7 128241036 128241347 LEP 309
##
## $pool14
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 3815 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 3527 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 123 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 123 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 197 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 6127 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 6127 7 24283796 24283936 NPY_2 140
## 8 7 128241095 128241289 189 7 128241036 128241347 LEP 194
## 9 7 128241308 128241347 2418 7 128241036 128241347 LEP 39
##
## $pool15
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 4617 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5093 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 283 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 278 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 241 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 5637 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 5637 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 238 7 128241036 128241347 LEP 309
##
## $pool16
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 6713 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 6234 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168399 194 2 25168373 25168611 POMC_1 26
## 4 2 25168587 25168608 191 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 305 6 31575210 31575467 TNF 257
## 6 7 24283547 24283937 8142 7 24283548 24283843 NPY_1 295
## 7 7 24283547 24283937 8142 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 1342 7 128241036 128241347 LEP 309
##
## $pool17
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5312 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5144 2 25161598 25161833 POMC_2 235
## 3 6 31575209 31575467 443 6 31575210 31575467 TNF 257
## 4 7 24283547 24283937 5562 7 24283548 24283843 NPY_1 295
## 5 7 24283547 24283937 5562 7 24283796 24283936 NPY_2 140
## 6 7 128241038 128241347 437 7 128241036 128241347 LEP 309
##
## $pool18
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 4911 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5568 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 266 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 258 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 407 6 31575210 31575467 TNF 257
## 6 7 24283596 24283937 6002 7 24283548 24283843 NPY_1 247
## 7 7 24283596 24283937 6002 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 609 7 128241036 128241347 LEP 309
##
## $pool19
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 8358 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 7748 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 320 2 25168373 25168611 POMC_1 22
## 4 2 25168587 25168608 317 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 641 6 31575210 31575467 TNF 257
## 6 7 24283547 24283579 1798 7 24283548 24283843 NPY_1 31
## 7 7 24283594 24283937 8417 7 24283548 24283843 NPY_1 249
## 8 7 24283594 24283937 8417 7 24283796 24283936 NPY_2 140
## 9 7 128241038 128241347 712 7 128241036 128241347 LEP 309
##
## $pool2
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 6087 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 2676 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168397 523 2 25168373 25168611 POMC_1 24
## 4 2 25168587 25168608 520 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 313 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 8780 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 8780 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 250 7 128241036 128241347 LEP 309
##
## $pool20
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 2617 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 2434 2 25161598 25161833 POMC_2 235
## 3 6 31575209 31575467 260 6 31575210 31575467 TNF 257
## 4 7 24283795 24283937 3641 7 24283548 24283843 NPY_1 48
## 5 7 24283795 24283937 3641 7 24283796 24283936 NPY_2 140
## 6 7 128241038 128241347 364 7 128241036 128241347 LEP 309
##
## $pool21
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 8496 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 6397 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168399 353 2 25168373 25168611 POMC_1 26
## 4 2 25168587 25168608 135 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 1058 6 31575210 31575467 TNF 257
## 6 7 24283594 24283937 10087 7 24283548 24283843 NPY_1 249
## 7 7 24283594 24283937 10087 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 7369 7 128241036 128241347 LEP 309
##
## $pool22
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 7121 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5127 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 139 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 138 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 401 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 9874 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 9874 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 417 7 128241036 128241347 LEP 309
##
## $pool23
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5898 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161836 5988 2 25161598 25161833 POMC_2 235
## 3 6 31575209 31575467 305 6 31575210 31575467 TNF 257
## 4 7 24283795 24283937 8303 7 24283548 24283843 NPY_1 48
## 5 7 24283795 24283937 8303 7 24283796 24283936 NPY_2 140
## 6 7 128241038 128241347 325 7 128241036 128241347 LEP 309
##
## $pool24
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 6334 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 7554 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 121 2 25168373 25168611 POMC_1 22
## 4 2 25168587 25168608 117 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 581 6 31575210 31575467 TNF 257
## 6 7 24283547 24283937 6642 7 24283548 24283843 NPY_1 295
## 7 7 24283547 24283937 6642 7 24283796 24283936 NPY_2 140
## 8 7 128241100 128241250 102 7 128241036 128241347 LEP 150
## 9 7 128241251 128241287 102 7 128241036 128241347 LEP 36
##
## $pool3
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5104 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 2930 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 900 2 25168373 25168611 POMC_1 22
## 4 2 25168587 25168608 896 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 209 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 6628 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 6628 7 24283796 24283936 NPY_2 140
## 8 7 128241096 128241289 162 7 128241036 128241347 LEP 193
##
## $pool4
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 7301 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 3965 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168399 205 2 25168373 25168611 POMC_1 26
## 4 2 25168587 25168608 201 2 25168373 25168611 POMC_1 21
## 5 6 31575209 31575467 265 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 9276 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 9276 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 303 7 128241036 128241347 LEP 309
##
## $pool5
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5429 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 4689 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168399 960 2 25168373 25168611 POMC_1 26
## 4 2 25168587 25168608 959 2 25168373 25168611 POMC_1 21
## 5 6 31575216 31575460 185 6 31575210 31575467 TNF 244
## 6 7 24283795 24283937 8064 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 8064 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 226 7 128241036 128241347 LEP 309
##
## $pool6
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 8539 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 4964 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 239 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 232 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 375 6 31575210 31575467 TNF 257
## 6 7 24283795 24283937 11321 7 24283548 24283843 NPY_1 48
## 7 7 24283795 24283937 11321 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 3042 7 128241036 128241347 LEP 309
##
## $pool7
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 3716 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 3472 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 307 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 303 2 25168373 25168611 POMC_1 20
## 5 6 31575216 31575460 158 6 31575210 31575467 TNF 244
## 6 7 24283547 24283573 107 7 24283548 24283843 NPY_1 25
## 7 7 24283795 24283937 5981 7 24283548 24283843 NPY_1 48
## 8 7 24283795 24283937 5981 7 24283796 24283936 NPY_2 140
## 9 7 128241096 128241289 175 7 128241036 128241347 LEP 193
## 10 7 128241322 128241347 155 7 128241036 128241347 LEP 25
##
## $pool8
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 4125 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 3366 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168395 312 2 25168373 25168611 POMC_1 22
## 4 2 25168588 25168608 309 2 25168373 25168611 POMC_1 20
## 5 6 31575217 31575255 112 6 31575210 31575467 TNF 38
## 6 6 31575442 31575460 111 6 31575210 31575467 TNF 18
## 7 7 24283795 24283937 7347 7 24283548 24283843 NPY_1 48
## 8 7 24283795 24283937 7347 7 24283796 24283936 NPY_2 140
## 9 7 128241096 128241289 173 7 128241036 128241347 LEP 193
## 10 7 128241322 128241347 105 7 128241036 128241347 LEP 25
##
## $pool9
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 5629 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 5752 2 25161598 25161833 POMC_2 235
## 3 6 31575209 31575467 591 6 31575210 31575467 TNF 257
## 4 7 24283596 24283937 6314 7 24283548 24283843 NPY_1 247
## 5 7 24283596 24283937 6314 7 24283796 24283936 NPY_2 140
## 6 7 128241038 128241347 389 7 128241036 128241347 LEP 309
##
## $PoolM
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 401 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161834 6413 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168608 4055 2 25168373 25168611 POMC_1 235
## 4 6 31575209 31575467 2469 6 31575210 31575467 TNF 257
## 5 7 24283547 24283572 148 7 24283548 24283843 NPY_1 24
## 6 7 24283596 24283937 8978 7 24283548 24283843 NPY_1 247
## 7 7 24283596 24283937 8978 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 20618 7 128241036 128241347 LEP 309
##
## $PoolMM
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358468 78358619 330 17 78358469 78358619 SOCS3 150
## 2 2 25161598 25161620 4262 2 25161598 25161833 POMC_2 22
## 3 2 25161811 25161834 8085 2 25161598 25161833 POMC_2 22
## 4 2 25168588 25168608 185 2 25168373 25168611 POMC_1 20
## 5 6 31575209 31575467 1293 6 31575210 31575467 TNF 257
## 6 7 24283547 24283573 208 7 24283548 24283843 NPY_1 25
## 7 7 24283795 24283937 6895 7 24283548 24283843 NPY_1 48
## 8 7 24283795 24283937 6895 7 24283796 24283936 NPY_2 140
## 9 7 128241038 128241347 14608 7 128241036 128241347 LEP 309
##
## $Undetermined
## chr start end n_reads chr.1 start.1 end.1 gene overlap
## 1 17 78358465 78358621 7129 17 78358469 78358619 SOCS3 150
## 2 2 25161596 25161836 8205 2 25161598 25161833 POMC_2 235
## 3 2 25168372 25168608 2184 2 25168373 25168611 POMC_1 235
## 4 6 31575209 31575467 580 6 31575210 31575467 TNF 257
## 5 7 24283547 24283578 174 7 24283548 24283843 NPY_1 30
## 6 7 24283594 24283937 10388 7 24283548 24283843 NPY_1 249
## 7 7 24283594 24283937 10388 7 24283796 24283936 NPY_2 140
## 8 7 128241038 128241347 371 7 128241036 128241347 LEP 309Look at off-target reads
Here we have the details of each of the off-target genomic regions that were identified in this assay. I’ve also got the location of the closest gene.
myfiles <- list.files("fastq/",pattern=".bedgraph.offtarget.genes$",full.names=TRUE)
oft <- lapply(myfiles, function(x) { y <- read.table(x,header=TRUE) ; y } )
names(oft) <- gsub(".bam.bedgraph.offtarget.genes","",gsub("fastq//","",myfiles))
oft## $`101-1023`
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 19 35358874 35358981 27777 19 35358460 35360489 FFAR3 0
## 2 19 35371343 35371444 27968 19 35370929 35372962 GPR42 0
##
## $`185-1135`
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 19 35358949 35359135 24019 19 35358460 35360489 FFAR3 0
## 2 19 35371418 35371604 24643 19 35370929 35372962 GPR42 0
## 3 6 158378467 158378509 113 6 158232236 158511828 TULP4 0
## 4 6 158378467 158378509 113 6 158282841 158428379 AL360169.2 0
##
## $`7185`
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 19 35358949 35359142 20615 19 35358460 35360489 FFAR3 0
## 2 19 35371418 35371611 19032 19 35370929 35372962 GPR42 0
## 3 2 152619971 152620002 102 2 152335174 152649826 FMNL2 0
## 4 7 39369845 39369878 156 7 38977909 39493095 POU6F2 0
## 5 X 112340564 112340598 109 X 112319952 112320417 DPRXP7 20148
##
## $Neg
## [1] chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## <0 rows> (or 0-length row.names)
##
## $NTC
## [1] chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## <0 rows> (or 0-length row.names)
##
## $pool1
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611316 259 1 18595414 18595636 AL031737.1 15620
## 2 1 162034657 162034667 417 1 162039016 162039567 AL590408.1 4350
## 3 1 162034670 162034712 418 1 162039016 162039567 AL590408.1 4305
## 4 10 6307526 6307583 195 10 6271169 6353827 LINC02649 0
## 5 11 65786127 65786205 111 11 65787063 65797214 OVOL1 859
## 6 17 4550782 4550844 593 17 4538897 4555386 MYBBP1A 0
## 7 19 13908861 13908908 118 19 13906201 13930879 CC2D1A 0
## 8 2 35765764 35765776 145 2 35724759 35725142 MRPL50P1 40623
## 9 2 35765778 35765802 146 2 35724759 35725142 MRPL50P1 40637
## 10 2 35765803 35765822 146 2 35724759 35725142 MRPL50P1 40662
## 11 22 46679451 46679485 216 22 46576012 46679790 GRAMD4 0
## 12 3 60181850 60181902 4490 3 59747277 61251459 FHIT 0
## 13 3 186110029 186110063 153 3 186046314 186110318 ETV5 0
## 14 3 186110029 186110063 153 3 186105668 186362234 DGKG 0
## 15 3 186110064 186110092 153 3 186046314 186110318 ETV5 0
## 16 3 186110064 186110092 153 3 186105668 186362234 DGKG 0
## 17 4 8288864 8288951 2355 4 8269754 8307098 HTRA3 0
## 18 5 865245 865502 767 5 850291 892801 BRD9 0
## 19 5 10649438 10649513 15302 5 10564070 10657816 ANKRD33B 0
## 20 5 119023122 119023140 4411 5 119006347 119070902 AC008629.1 0
## 21 5 119023143 119023175 4421 5 119006347 119070902 AC008629.1 0
## 22 5 131945721 131945786 896 5 131807143 132011637 AC034228.3 0
## 23 5 131945721 131945786 896 5 131944408 131968220 AC034228.2 0
## 24 5 131945789 131945799 887 5 131807143 132011637 AC034228.3 0
## 25 5 131945789 131945799 887 5 131944408 131968220 AC034228.2 0
## 26 8 22055623 22055743 4150 8 22048995 22082527 DMTN 0
## 27 8 39240838 39240870 693 8 39106990 39284917 ADAM32 0
## 28 X 13044583 13044596 167 X 13035617 13044682 FAM9C 0
## 29 X 13044599 13044672 174 X 13035617 13044682 FAM9C 0
## 30 Y 12869918 12869975 222 Y 12537650 12860839 USP9Y 9080
##
## $pool10
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 234742415 234742439 763 1 234724042 234736720 LINC01132
## 2 10 10027960 10028013 239 10 10058722 10063502 LINC02670
## 3 12 105330759 105330791 224 12 105235290 105396097 C12orf75
## 4 16 14989690 14989869 168 16 14974591 15139339 PDXDC1
## 5 16 14989690 14989869 168 16 14988259 14990160 AC138932.2
## 6 18 10590130 10590154 759 18 10594590 10604798 AP001099.1
## 7 18 37891155 37891201 3213 18 37960220 37992413 AC108452.1
## 8 19 1600354 1600378 708 19 1578339 1605445 AC005943.1
## 9 19 1600354 1600378 708 19 1597169 1605473 UQCR11
## 10 19 38326060 38326071 139 19 38319845 38332076 KCNK6
## 11 19 38326072 38326126 140 19 38319845 38332076 KCNK6
## 12 19 46791472 46791496 228 19 46787815 46789043 AC008622.2
## 13 19 48855456 48855480 706 19 48837097 48868617 PLEKHA4
## 14 2 119593691 119593715 682 2 119544432 119662251 CFAP221
## 15 22 46679451 46679485 211 22 46576012 46679790 GRAMD4
## 16 4 8288864 8288951 3647 4 8269754 8307098 HTRA3
## 17 4 78422580 78422696 168 4 78057323 78544269 FRAS1
## 18 4 78422698 78422709 163 4 78057323 78544269 FRAS1
## 19 5 865245 865502 1648 5 850291 892801 BRD9
## 20 5 10649438 10649513 6749 5 10564070 10657816 ANKRD33B
## 21 5 131945721 131945786 1352 5 131807143 132011637 AC034228.3
## 22 5 131945721 131945786 1352 5 131944408 131968220 AC034228.2
## 23 5 131945788 131945799 1328 5 131807143 132011637 AC034228.3
## 24 5 131945788 131945799 1328 5 131944408 131968220 AC034228.2
## 25 7 86652471 86652495 233 7 86643914 86864884 GRM3
## 26 8 1974504 1974546 2771 8 1971153 1974637 AC019257.1
## 27 8 1974504 1974546 2771 8 1971397 1976478 KBTBD11-OT1
## 28 8 1974504 1974546 2771 8 1973677 2006936 KBTBD11
## 29 8 22055623 22055743 3445 8 22048995 22082527 DMTN
## dist_bp
## 1 5696
## 2 30710
## 3 0
## 4 0
## 5 0
## 6 4437
## 7 69020
## 8 0
## 9 0
## 10 0
## 11 0
## 12 2430
## 13 0
## 14 0
## 15 0
## 16 0
## 17 0
## 18 0
## 19 0
## 20 0
## 21 0
## 22 0
## 23 0
## 24 0
## 25 0
## 26 0
## 27 0
## 28 0
## 29 0
##
## $pool11
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 4 8288864 8288951 403 4 8269754 8307098 HTRA3 0
## 2 5 865245 865490 213 5 850291 892801 BRD9 0
## 3 5 865491 865502 113 5 850291 892801 BRD9 0
## 4 5 10649439 10649513 955 5 10564070 10657816 ANKRD33B 0
## 5 8 22055623 22055726 402 8 22048995 22082527 DMTN 0
## 6 8 22055727 22055743 401 8 22048995 22082527 DMTN 0
##
## $pool12
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 18611255 18611340 1032 1 18595414 18595636 AL031737.1
## 2 1 58306257 58306325 156 1 56994778 58546734 DAB1
## 3 1 241065370 241065403 653 1 240775514 241357230 RGS7
## 4 10 6307518 6307583 670 10 6271169 6353827 LINC02649
## 5 10 70183632 70183662 141 10 70147289 70170523 SAR1A
## 6 10 83229789 83229800 316 10 83311628 83314475 MARK2P15
## 7 10 83229801 83229848 363 10 83311628 83314475 MARK2P15
## 8 10 100122122 100122149 289 10 100105754 100140151 CYP2C23P
## 9 10 100122170 100122193 284 10 100105754 100140151 CYP2C23P
## 10 11 25874404 25874455 106 11 25924188 25926808 AC013799.1
## 11 11 65726854 65726937 348 11 65726939 65728214 KRT8P26
## 12 15 20074892 20074922 223 15 20073699 20074334 BCAR1P1
## 13 15 21082005 21082035 183 15 21080812 21081447 BCAR1P2
## 14 16 14989693 14989868 116 16 14974591 15139339 PDXDC1
## 15 16 14989693 14989868 116 16 14988259 14990160 AC138932.2
## 16 16 17690789 17690800 208 16 17825252 17826906 AC025277.1
## 17 16 17690802 17690847 210 16 17825252 17826906 AC025277.1
## 18 16 18089070 18089116 109 16 17933189 18151595 AC010601.1
## 19 16 18089070 18089116 109 16 18002806 18173063 AC091489.1
## 20 17 4550782 4550844 206 17 4538897 4555386 MYBBP1A
## 21 2 95526518 95526601 268 2 95525109 95526702 AC009237.14
## 22 2 95526518 95526601 268 2 95525345 95532405 AC009237.3
## 23 22 46679451 46679485 252 22 46576012 46679790 GRAMD4
## 24 3 196196004 196196051 123 3 196197452 196211437 ZDHHC19
## 25 4 8288864 8288951 608 4 8269754 8307098 HTRA3
## 26 5 865245 865502 1154 5 850291 892801 BRD9
## 27 5 10649438 10649513 11895 5 10564070 10657816 ANKRD33B
## 28 5 131945721 131945786 875 5 131807143 132011637 AC034228.3
## 29 5 131945721 131945786 875 5 131944408 131968220 AC034228.2
## 30 5 131945789 131945799 862 5 131807143 132011637 AC034228.3
## 31 5 131945789 131945799 862 5 131944408 131968220 AC034228.2
## 32 5 181195621 181195635 113 5 181193924 181205293 TRIM7
## 33 5 181195621 181195635 113 5 181195496 181203103 TRIM7-AS1
## 34 5 181195639 181195726 116 5 181193924 181205293 TRIM7
## 35 5 181195639 181195726 116 5 181195496 181203103 TRIM7-AS1
## 36 5 181195730 181195744 103 5 181193924 181205293 TRIM7
## 37 5 181195730 181195744 103 5 181195496 181203103 TRIM7-AS1
## 38 6 30466891 30466928 554 6 30466452 30467994 TMPOP1
## 39 6 62467363 62467402 481 6 62460940 62461503 DHFRP5
## 40 6 62467511 62467538 481 6 62460940 62461503 DHFRP5
## 41 8 22055623 22055743 4658 8 22048995 22082527 DMTN
## 42 8 37701095 37701196 243 8 37695782 37700019 ZNF703
## 43 X 54367258 54367275 718 X 54192823 54358642 WNK3
## 44 X 54367276 54367320 740 X 54192823 54358642 WNK3
## 45 Y 12869910 12869975 675 Y 12537650 12860839 USP9Y
## dist_bp
## 1 15620
## 2 0
## 3 0
## 4 0
## 5 13110
## 6 81829
## 7 81781
## 8 0
## 9 0
## 10 49734
## 11 3
## 12 559
## 13 559
## 14 0
## 15 0
## 16 134453
## 17 134406
## 18 0
## 19 0
## 20 0
## 21 0
## 22 0
## 23 0
## 24 1402
## 25 0
## 26 0
## 27 0
## 28 0
## 29 0
## 30 0
## 31 0
## 32 0
## 33 0
## 34 0
## 35 0
## 36 0
## 37 0
## 38 0
## 39 5861
## 40 6009
## 41 0
## 42 1077
## 43 8617
## 44 8635
## 45 9072
##
## $pool13
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611324 187 1 18595414 18595636 AL031737.1 15620
## 2 10 6307518 6307583 183 10 6271169 6353827 LINC02649 0
## 3 10 132135162 132135199 121 10 132036336 132184858 JAKMIP3 0
## 4 2 221871203 221871265 1343 2 221944223 221944612 LLPHP3 72959
## 5 22 46679451 46679485 181 22 46576012 46679790 GRAMD4 0
## 6 4 8288864 8288951 2343 4 8269754 8307098 HTRA3 0
## 7 5 865245 865502 1563 5 850291 892801 BRD9 0
## 8 5 10649438 10649513 9952 5 10564070 10657816 ANKRD33B 0
## 9 5 131945721 131945786 637 5 131807143 132011637 AC034228.3 0
## 10 5 131945721 131945786 637 5 131944408 131968220 AC034228.2 0
## 11 5 131945789 131945799 624 5 131807143 132011637 AC034228.3 0
## 12 5 131945789 131945799 624 5 131944408 131968220 AC034228.2 0
## 13 7 37256513 37256545 105 7 36852906 37449223 ELMO1 0
## 14 7 37256766 37256788 105 7 36852906 37449223 ELMO1 0
## 15 8 22055623 22055743 2591 8 22048995 22082527 DMTN 0
## 16 9 93435058 93435107 109 9 93431441 93453581 FAM120AOS 0
## 17 X 82446629 82446671 4642 X 82497669 82497924 EIF3JP1 50999
## 18 X 82446673 82446687 4579 X 82497669 82497924 EIF3JP1 50983
## 19 Y 12869910 12869975 184 Y 12537650 12860839 USP9Y 9072
##
## $pool14
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611324 268 1 18595414 18595636 AL031737.1 15620
## 2 10 6307518 6307583 263 10 6271169 6353827 LINC02649 0
## 3 11 1181147 1181217 222 11 1157953 1201138 MUC5AC 0
## 4 16 14989690 14989868 107 16 14974591 15139339 PDXDC1 0
## 5 16 14989690 14989868 107 16 14988259 14990160 AC138932.2 0
## 6 16 48441125 48441181 130 16 48356364 48448402 SIAH1 0
## 7 17 43755387 43755414 154 17 43753738 43758791 SOST 0
## 8 17 43755415 43755424 154 17 43753738 43758791 SOST 0
## 9 2 234950963 234951013 112 2 234952017 235055714 SH3BP4 1005
## 10 20 36986623 36986655 824 20 36996349 37095997 RBL1 9695
## 11 22 46679451 46679485 776 22 46576012 46679790 GRAMD4 0
## 12 4 8288864 8288959 1995 4 8269754 8307098 HTRA3 0
## 13 5 865245 865502 793 5 850291 892801 BRD9 0
## 14 5 10649438 10649513 10509 5 10564070 10657816 ANKRD33B 0
## 15 5 131945721 131945799 1567 5 131807143 132011637 AC034228.3 0
## 16 5 131945721 131945799 1567 5 131944408 131968220 AC034228.2 0
## 17 8 22055623 22055743 4470 8 22048995 22082527 DMTN 0
## 18 Y 12869910 12869975 278 Y 12537650 12860839 USP9Y 9072
##
## $pool15
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611336 621 1 18595414 18595636 AL031737.1 15620
## 2 10 6307508 6307583 570 10 6271169 6353827 LINC02649 0
## 3 10 70183632 70183662 106 10 70147289 70170523 SAR1A 13110
## 4 10 100122122 100122149 144 10 100105754 100140151 CYP2C23P 0
## 5 10 100122170 100122193 140 10 100105754 100140151 CYP2C23P 0
## 6 22 46679451 46679485 815 22 46576012 46679790 GRAMD4 0
## 7 4 8288864 8288951 309 4 8269754 8307098 HTRA3 0
## 8 5 865245 865502 938 5 850291 892801 BRD9 0
## 9 5 10649438 10649513 11662 5 10564070 10657816 ANKRD33B 0
## 10 5 131945721 131945786 1053 5 131807143 132011637 AC034228.3 0
## 11 5 131945721 131945786 1053 5 131944408 131968220 AC034228.2 0
## 12 5 131945789 131945799 1043 5 131807143 132011637 AC034228.3 0
## 13 5 131945789 131945799 1043 5 131944408 131968220 AC034228.2 0
## 14 6 62467363 62467402 155 6 62460940 62461503 DHFRP5 5861
## 15 6 62467511 62467538 155 6 62460940 62461503 DHFRP5 6009
## 16 8 22055623 22055743 4016 8 22048995 22082527 DMTN 0
## 17 X 153867168 153867235 102 X 153861514 153886173 L1CAM 0
## 18 Y 12869910 12869975 411 Y 12537650 12860839 USP9Y 9072
##
## $pool16
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 11748568 11748616 556 1 11736084 11754802 AGTRAP
## 2 1 18611255 18611336 726 1 18595414 18595636 AL031737.1
## 3 10 6307508 6307583 421 10 6271169 6353827 LINC02649
## 4 11 1289723 1289777 189 11 1274371 1309654 TOLLIP
## 5 16 14989690 14989869 180 16 14974591 15139339 PDXDC1
## 6 16 14989690 14989869 180 16 14988259 14990160 AC138932.2
## 7 17 4550782 4550844 300 17 4538897 4555386 MYBBP1A
## 8 22 46679451 46679485 576 22 46576012 46679790 GRAMD4
## 9 4 8288864 8288951 3404 4 8269754 8307098 HTRA3
## 10 5 865245 865502 2419 5 850291 892801 BRD9
## 11 5 10649438 10649513 9805 5 10564070 10657816 ANKRD33B
## 12 5 131945721 131945799 1392 5 131807143 132011637 AC034228.3
## 13 5 131945721 131945799 1392 5 131944408 131968220 AC034228.2
## 14 8 1974504 1974546 708 8 1971153 1974637 AC019257.1
## 15 8 1974504 1974546 708 8 1971397 1976478 KBTBD11-OT1
## 16 8 1974504 1974546 708 8 1973677 2006936 KBTBD11
## 17 8 22055623 22055743 3942 8 22048995 22082527 DMTN
## 18 8 41063496 41063528 217 8 41032892 41032998 RNU6-356P
## 19 X 2213846 2213880 141 X 2219506 2502805 DHRSX
## 20 X 2214118 2214156 144 X 2219506 2502805 DHRSX
## 21 X 3983551 3983596 328 X 3953056 3953561 RPL24P9
## 22 Y 12869918 12869975 319 Y 12537650 12860839 USP9Y
## dist_bp
## 1 0
## 2 15620
## 3 0
## 4 0
## 5 0
## 6 0
## 7 0
## 8 0
## 9 0
## 10 0
## 11 0
## 12 0
## 13 0
## 14 0
## 15 0
## 16 0
## 17 0
## 18 30499
## 19 5627
## 20 5351
## 21 29991
## 22 9080
##
## $pool17
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 4 8288864 8288951 3435 4 8269754 8307098 HTRA3 0
## 2 5 865252 865490 133 5 850291 892801 BRD9 0
## 3 5 10649438 10649513 12054 5 10564070 10657816 ANKRD33B 0
## 4 5 131945721 131945786 510 5 131807143 132011637 AC034228.3 0
## 5 5 131945721 131945786 510 5 131944408 131968220 AC034228.2 0
## 6 5 131945789 131945799 504 5 131807143 132011637 AC034228.3 0
## 7 5 131945789 131945799 504 5 131944408 131968220 AC034228.2 0
## 8 8 22055623 22055743 1924 8 22048995 22082527 DMTN 0
##
## $pool18
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611336 335 1 18595414 18595636 AL031737.1 15620
## 2 10 6307522 6307583 121 10 6271169 6353827 LINC02649 0
## 3 10 131347243 131347276 103 10 131092391 131311721 TCERG1L 35523
## 4 16 14989617 14989628 150 16 14974591 15139339 PDXDC1 0
## 5 16 14989617 14989628 150 16 14988259 14990160 AC138932.2 0
## 6 16 14989629 14989930 302 16 14974591 15139339 PDXDC1 0
## 7 16 14989629 14989930 302 16 14988259 14990160 AC138932.2 0
## 8 22 29788944 29789092 197 22 29788609 29838304 ASCC2 0
## 9 22 29789093 29789115 197 22 29788609 29838304 ASCC2 0
## 10 22 29789117 29789132 196 22 29788609 29838304 ASCC2 0
## 11 22 46679451 46679485 185 22 46576012 46679790 GRAMD4 0
## 12 4 8288864 8288951 1958 4 8269754 8307098 HTRA3 0
## 13 4 31367013 31367064 316 4 31350284 31351725 AC104071.1 15289
## 14 5 865245 865502 2675 5 850291 892801 BRD9 0
## 15 5 10649438 10649513 6016 5 10564070 10657816 ANKRD33B 0
## 16 5 131945721 131945786 536 5 131807143 132011637 AC034228.3 0
## 17 5 131945721 131945786 536 5 131944408 131968220 AC034228.2 0
## 18 5 131945789 131945799 526 5 131807143 132011637 AC034228.3 0
## 19 5 131945789 131945799 526 5 131944408 131968220 AC034228.2 0
## 20 8 22055623 22055743 2302 8 22048995 22082527 DMTN 0
## 21 Y 12869910 12869975 127 Y 12537650 12860839 USP9Y 9072
##
## $pool19
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 11 115173455 115173532 313 11 115169218 115504957 CADM1
## 2 12 132583203 132583212 344 12 132489551 132585188 FBRSL1
## 3 12 132583214 132583258 345 12 132489551 132585188 FBRSL1
## 4 13 69077731 69077797 210 13 69101832 69102056 SNRPFP3
## 5 16 14989689 14989870 197 16 14974591 15139339 PDXDC1
## 6 16 14989689 14989870 197 16 14988259 14990160 AC138932.2
## 7 16 66767740 66767838 201 16 66754640 66801620 TERB1
## 8 17 4550782 4550844 138 17 4538897 4555386 MYBBP1A
## 9 2 95526518 95526601 111 2 95525109 95526702 AC009237.14
## 10 2 95526518 95526601 111 2 95525345 95532405 AC009237.3
## 11 22 46679451 46679485 443 22 46576012 46679790 GRAMD4
## 12 4 8288864 8288955 4024 4 8269754 8307098 HTRA3
## 13 5 865245 865502 3139 5 850291 892801 BRD9
## 14 5 10649438 10649513 11258 5 10564070 10657816 ANKRD33B
## 15 5 131945721 131945786 1376 5 131807143 132011637 AC034228.3
## 16 5 131945721 131945786 1376 5 131944408 131968220 AC034228.2
## 17 5 131945789 131945799 1358 5 131807143 132011637 AC034228.3
## 18 5 131945789 131945799 1358 5 131944408 131968220 AC034228.2
## 19 8 22055623 22055743 4129 8 22048995 22082527 DMTN
## dist_bp
## 1 0
## 2 0
## 3 0
## 4 24036
## 5 0
## 6 0
## 7 0
## 8 0
## 9 0
## 10 0
## 11 0
## 12 0
## 13 0
## 14 0
## 15 0
## 16 0
## 17 0
## 18 0
## 19 0
##
## $pool2
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611336 555 1 18595414 18595636 AL031737.1 15620
## 2 10 6307518 6307583 399 10 6271169 6353827 LINC02649 0
## 3 10 100122122 100122193 203 10 100105754 100140151 CYP2C23P 0
## 4 12 7913634 7913754 229 12 7919230 7936187 SLC2A3 5477
## 5 17 81103010 81103061 310 17 81035122 81117432 BAIAP2 0
## 6 17 81103064 81103080 298 17 81035122 81117432 BAIAP2 0
## 7 22 46679451 46679485 818 22 46576012 46679790 GRAMD4 0
## 8 3 14555195 14555262 136 3 14489107 14556075 GRIP2 0
## 9 4 8288864 8288951 418 4 8269754 8307098 HTRA3 0
## 10 5 865245 865502 1057 5 850291 892801 BRD9 0
## 11 5 10649438 10649513 12873 5 10564070 10657816 ANKRD33B 0
## 12 5 131945721 131945799 2815 5 131807143 132011637 AC034228.3 0
## 13 5 131945721 131945799 2815 5 131944408 131968220 AC034228.2 0
## 14 6 96925095 96925147 121 6 96924620 97140754 KLHL32 0
## 15 8 22055623 22055743 4618 8 22048995 22082527 DMTN 0
## 16 9 129284217 129284230 523 9 129282458 129312665 AL161785.1 0
## 17 9 129284232 129284318 533 9 129282458 129312665 AL161785.1 0
## 18 X 32216848 32216897 595 X 31097677 33339609 DMD 0
## 19 Y 12869905 12869975 508 Y 12537650 12860839 USP9Y 9067
##
## $pool20
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 10 10027960 10028013 1258 10 10058722 10063502 LINC02670 30710
## 2 16 14989617 14989628 110 16 14974591 15139339 PDXDC1 0
## 3 16 14989617 14989628 110 16 14988259 14990160 AC138932.2 0
## 4 16 14989629 14989930 224 16 14974591 15139339 PDXDC1 0
## 5 16 14989629 14989930 224 16 14988259 14990160 AC138932.2 0
## 6 21 39108618 39108702 123 21 39127568 39128040 RPL23AP12 18867
## 7 22 46679451 46679485 229 22 46576012 46679790 GRAMD4 0
## 8 4 8288864 8288967 1632 4 8269754 8307098 HTRA3 0
## 9 5 865245 865502 1593 5 850291 892801 BRD9 0
## 10 5 10649438 10649513 4777 5 10564070 10657816 ANKRD33B 0
## 11 5 131945721 131945786 143 5 131807143 132011637 AC034228.3 0
## 12 5 131945721 131945786 143 5 131944408 131968220 AC034228.2 0
## 13 5 131945789 131945799 141 5 131807143 132011637 AC034228.3 0
## 14 5 131945789 131945799 141 5 131944408 131968220 AC034228.2 0
## 15 8 22055623 22055743 2318 8 22048995 22082527 DMTN 0
##
## $pool21
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611324 356 1 18595414 18595636 AL031737.1 15620
## 2 10 6307518 6307583 400 10 6271169 6353827 LINC02649 0
## 3 10 80473306 80473343 487 10 80454166 80533124 TSPAN14 0
## 4 10 132135162 132135199 164 10 132036336 132184858 JAKMIP3 0
## 5 12 105330765 105330791 229 12 105235290 105396097 C12orf75 0
## 6 16 14989690 14989869 171 16 14974591 15139339 PDXDC1 0
## 7 16 14989690 14989869 171 16 14988259 14990160 AC138932.2 0
## 8 20 37944304 37944312 125 20 37903111 37945350 VSTM2L 0
## 9 20 37944313 37944351 128 20 37903111 37945350 VSTM2L 0
## 10 22 43974366 43974508 202 22 43955442 44010531 SAMM50 0
## 11 22 46679451 46679485 130 22 46576012 46679790 GRAMD4 0
## 12 4 8288864 8288951 3145 4 8269754 8307098 HTRA3 0
## 13 5 865245 865502 2678 5 850291 892801 BRD9 0
## 14 5 10649438 10649513 10108 5 10564070 10657816 ANKRD33B 0
## 15 5 131945721 131945800 4480 5 131807143 132011637 AC034228.3 0
## 16 5 131945721 131945800 4480 5 131944408 131968220 AC034228.2 0
## 17 5 132200546 132200578 120 5 132190147 132295315 P4HA2 0
## 18 5 132200546 132200578 120 5 132199456 132203487 AC063976.2 0
## 19 7 63398175 63398190 101 7 63393745 63422053 AC073188.2 0
## 20 7 63398175 63398190 101 7 63396341 63399250 AC073188.6 0
## 21 7 63398175 63398190 101 7 63398046 63398957 SLC25A1P2 0
## 22 7 63398191 63398273 101 7 63393745 63422053 AC073188.2 0
## 23 7 63398191 63398273 101 7 63396341 63399250 AC073188.6 0
## 24 7 63398191 63398273 101 7 63398046 63398957 SLC25A1P2 0
## 25 8 22055623 22055743 4281 8 22048995 22082527 DMTN 0
## 26 X 153420796 153420848 102 X 153418322 153426481 ZFP92 0
## 27 X 153420849 153420964 102 X 153418322 153426481 ZFP92 0
## 28 Y 12869910 12869975 354 Y 12537650 12860839 USP9Y 9072
##
## $pool22
## chr start end n_reads chr.1 start.1 end.1
## 1 1 18611255 18611340 317 1 18595414 18595636
## 2 1 112387835 112387898 292 1 112396214 112463456
## 3 1 112387982 112388053 292 1 112396214 112463456
## 4 10 6307518 6307583 179 10 6271169 6353827
## 5 10 131346939 131346970 375 10 131092391 131311721
## 6 10 131346990 131347017 272 10 131092391 131311721
## 7 10 131347240 131347276 648 10 131092391 131311721
## 8 11 113627262 113627297 146 11 113687547 113706373
## 9 11 113627447 113627478 145 11 113687547 113706373
## 10 13 27351867 27351917 127 13 27343687 27343746
## 11 21 8205418 8205474 107 21 8197620 8227646
## 12 21 8205475 8205485 104 21 8197620 8227646
## 13 21 8249608 8249664 111 21 8249505 8249596
## 14 21 8249665 8249675 111 21 8249505 8249596
## 15 21 8388465 8388521 110 21 8380643 8454792
## 16 21 8388522 8388532 109 21 8380643 8454792
## 17 21 8432633 8432687 102 21 8380643 8454792
## 18 22 46679451 46679485 380 22 46576012 46679790
## 19 5 865245 865502 1692 5 850291 892801
## 20 5 10649438 10649513 13348 5 10564070 10657816
## 21 5 131945721 131945799 1965 5 131807143 132011637
## 22 5 131945721 131945799 1965 5 131944408 131968220
## 23 7 37256513 37256561 126 7 36852906 37449223
## 24 7 37256753 37256804 123 7 36852906 37449223
## 25 8 22055623 22055743 4642 8 22048995 22082527
## 26 GL000220.1 104835 104891 107 GL000220.1 105287 105376
## 27 GL000220.1 104892 104902 106 GL000220.1 105287 105376
## 28 KI270733.1 121684 121740 113 KI270733.1 122136 122225
## 29 KI270733.1 121741 121751 112 KI270733.1 122136 122225
## 30 KI270733.1 166771 166804 100 KI270733.1 167218 167307
## 31 Y 12869925 12869974 102 Y 12537650 12860839
## gene dist_bp
## 1 AL031737.1 15620
## 2 CTTNBP2NL 8317
## 3 CTTNBP2NL 8162
## 4 LINC02649 0
## 5 TCERG1L 35219
## 6 TCERG1L 35270
## 7 TCERG1L 35520
## 8 TMPRSS5 60251
## 9 TMPRSS5 60070
## 10 RNU6-70P 8122
## 11 FP671120.4 0
## 12 FP671120.4 0
## 13 MIR6724-2 13
## 14 MIR6724-2 70
## 15 FP236383.3 0
## 16 FP236383.3 0
## 17 FP236383.3 0
## 18 GRAMD4 0
## 19 BRD9 0
## 20 ANKRD33B 0
## 21 AC034228.3 0
## 22 AC034228.2 0
## 23 ELMO1 0
## 24 ELMO1 0
## 25 DMTN 0
## 26 AL592188.2 397
## 27 AL592188.2 386
## 28 AL353644.1 397
## 29 AL353644.1 386
## 30 AL353644.2 415
## 31 USP9Y 9087
##
## $pool23
## chr start end n_reads chr.1 start.1 end.1
## 1 1 18611255 18611344 564 1 18595414 18595636
## 2 10 6307512 6307583 246 10 6271169 6353827
## 3 10 70005108 70005147 117 10 69994276 70019496
## 4 10 70005357 70005404 117 10 69994276 70019496
## 5 10 131346939 131346970 238 10 131092391 131311721
## 6 10 131346990 131347017 318 10 131092391 131311721
## 7 10 131347240 131347276 554 10 131092391 131311721
## 8 11 80568673 80568788 280 11 80527960 80528066
## 9 11 80568796 80568810 275 11 80527960 80528066
## 10 16 14989694 14989865 108 16 14974591 15139339
## 11 16 14989694 14989865 108 16 14988259 14990160
## 12 22 46679451 46679485 400 22 46576012 46679790
## 13 4 8288864 8288929 125 4 8269754 8307098
## 14 5 865245 865502 1566 5 850291 892801
## 15 5 10649438 10649513 8843 5 10564070 10657816
## 16 5 131945721 131945786 1012 5 131807143 132011637
## 17 5 131945721 131945786 1012 5 131944408 131968220
## 18 5 131945789 131945799 1003 5 131807143 132011637
## 19 5 131945789 131945799 1003 5 131944408 131968220
## 20 7 37256513 37256549 206 7 36852906 37449223
## 21 7 37256753 37256803 202 7 36852906 37449223
## 22 8 22055623 22055743 1943 8 22048995 22082527
## 23 KI270733.1 133694 133777 106 KI270733.1 128877 129029
## 24 KI270733.1 178774 178856 105 KI270733.1 173956 174108
## 25 Y 12869910 12869975 183 Y 12537650 12860839
## gene dist_bp
## 1 AL031737.1 15620
## 2 LINC02649 0
## 3 LINC02636 0
## 4 LINC02636 0
## 5 TCERG1L 35219
## 6 TCERG1L 35270
## 7 TCERG1L 35520
## 8 RNU6-544P 40608
## 9 RNU6-544P 40731
## 10 PDXDC1 0
## 11 AC138932.2 0
## 12 GRAMD4 0
## 13 HTRA3 0
## 14 BRD9 0
## 15 ANKRD33B 0
## 16 AC034228.3 0
## 17 AC034228.2 0
## 18 AC034228.3 0
## 19 AC034228.2 0
## 20 ELMO1 0
## 21 ELMO1 0
## 22 DMTN 0
## 23 RNA5-8SN4 4666
## 24 5_8S_rRNA 4667
## 25 USP9Y 9072
##
## $pool24
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 43926216 43926323 356 1 43650149 43931014 AL451062.2
## 2 1 43926216 43926323 356 1 43705824 43931165 ST3GAL3
## 3 11 78417513 78417543 330 11 78215293 78418348 GAB2
## 4 11 78417513 78417543 330 11 78324758 78444049 AP003086.1
## 5 12 105330765 105330791 503 12 105235290 105396097 C12orf75
## 6 16 14989617 14989628 109 16 14974591 15139339 PDXDC1
## 7 16 14989617 14989628 109 16 14988259 14990160 AC138932.2
## 8 16 14989629 14989930 219 16 14974591 15139339 PDXDC1
## 9 16 14989629 14989930 219 16 14988259 14990160 AC138932.2
## 10 17 4550782 4550844 390 17 4538897 4555386 MYBBP1A
## 11 19 11551551 11551692 224 19 11551147 11559236 ELOF1
## 12 19 38326060 38326071 119 19 38319845 38332076 KCNK6
## 13 19 38326072 38326126 119 19 38319845 38332076 KCNK6
## 14 22 46679451 46679485 259 22 46576012 46679790 GRAMD4
## 15 4 8288864 8288951 1128 4 8269754 8307098 HTRA3
## 16 5 865245 865502 2330 5 850291 892801 BRD9
## 17 5 10649438 10649513 7273 5 10564070 10657816 ANKRD33B
## 18 5 131945721 131945786 1272 5 131807143 132011637 AC034228.3
## 19 5 131945721 131945786 1272 5 131944408 131968220 AC034228.2
## 20 5 131945789 131945799 1251 5 131807143 132011637 AC034228.3
## 21 5 131945789 131945799 1251 5 131944408 131968220 AC034228.2
## 22 8 1974504 1974546 185 8 1971153 1974637 AC019257.1
## 23 8 1974504 1974546 185 8 1971397 1976478 KBTBD11-OT1
## 24 8 1974504 1974546 185 8 1973677 2006936 KBTBD11
## 25 8 22055623 22055726 870 8 22048995 22082527 DMTN
## 26 8 22055727 22055743 862 8 22048995 22082527 DMTN
## dist_bp
## 1 0
## 2 0
## 3 0
## 4 0
## 5 0
## 6 0
## 7 0
## 8 0
## 9 0
## 10 0
## 11 0
## 12 0
## 13 0
## 14 0
## 15 0
## 16 0
## 17 0
## 18 0
## 19 0
## 20 0
## 21 0
## 22 0
## 23 0
## 24 0
## 25 0
## 26 0
##
## $pool3
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611336 529 1 18595414 18595636 AL031737.1 15620
## 2 10 6307526 6307583 419 10 6271169 6353827 LINC02649 0
## 3 16 15177391 15177437 110 16 15154903 15157020 AC126763.1 20372
## 4 17 4550782 4550844 150 17 4538897 4555386 MYBBP1A 0
## 5 17 62060954 62061019 288 17 61942605 62065278 MED13 0
## 6 17 65561479 65561525 948 17 65528563 65561648 AXIN2 0
## 7 17 65561479 65561525 948 17 65538102 65641033 AC004805.1 0
## 8 22 46679451 46679485 482 22 46576012 46679790 GRAMD4 0
## 9 4 8288865 8288898 112 4 8269754 8307098 HTRA3 0
## 10 5 865245 865502 834 5 850291 892801 BRD9 0
## 11 5 10649438 10649513 16465 5 10564070 10657816 ANKRD33B 0
## 12 5 131945721 131945786 1525 5 131807143 132011637 AC034228.3 0
## 13 5 131945721 131945786 1525 5 131944408 131968220 AC034228.2 0
## 14 5 131945789 131945799 1495 5 131807143 132011637 AC034228.3 0
## 15 5 131945789 131945799 1495 5 131944408 131968220 AC034228.2 0
## 16 8 22055623 22055743 2893 8 22048995 22082527 DMTN 0
## 17 8 144560678 144560685 111 8 144529179 144605816 ARHGAP39 0
## 18 8 144560686 144560738 111 8 144529179 144605816 ARHGAP39 0
## 19 X 119552588 119552625 136 X 119538149 119565409 CXorf56 0
## 20 X 119552627 119552635 136 X 119538149 119565409 CXorf56 0
## 21 Y 12869918 12869975 288 Y 12537650 12860839 USP9Y 9080
##
## $pool4
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611336 315 1 18595414 18595636 AL031737.1 15620
## 2 10 6307508 6307583 230 10 6271169 6353827 LINC02649 0
## 3 10 103584482 103584577 117 10 103493979 103592552 NEURL1 0
## 4 16 14989617 14989628 107 16 14974591 15139339 PDXDC1 0
## 5 16 14989617 14989628 107 16 14988259 14990160 AC138932.2 0
## 6 16 14989629 14989930 213 16 14974591 15139339 PDXDC1 0
## 7 16 14989629 14989930 213 16 14988259 14990160 AC138932.2 0
## 8 22 46679451 46679485 238 22 46576012 46679790 GRAMD4 0
## 9 4 3611860 3611931 106 4 3633029 3633975 AL121796.1 21099
## 10 4 8288864 8288951 2350 4 8269754 8307098 HTRA3 0
## 11 5 865245 865502 1249 5 850291 892801 BRD9 0
## 12 5 10649438 10649513 11784 5 10564070 10657816 ANKRD33B 0
## 13 5 66573511 66573558 130 5 66572057 66572546 PPIAP78 966
## 14 5 131945721 131945800 2391 5 131807143 132011637 AC034228.3 0
## 15 5 131945721 131945800 2391 5 131944408 131968220 AC034228.2 0
## 16 6 104424412 104424455 127 6 104487095 104528158 AL357522.1 62641
## 17 8 22055623 22055743 3973 8 22048995 22082527 DMTN 0
##
## $pool5
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611340 239 1 18595414 18595636 AL031737.1 15620
## 2 1 112387835 112387898 195 1 112396214 112463456 CTTNBP2NL 8317
## 3 1 112387982 112388053 195 1 112396214 112463456 CTTNBP2NL 8162
## 4 10 131346939 131346970 195 10 131092391 131311721 TCERG1L 35219
## 5 10 131346990 131347017 236 10 131092391 131311721 TCERG1L 35270
## 6 10 131347240 131347276 424 10 131092391 131311721 TCERG1L 35520
## 7 11 113627262 113627297 190 11 113687547 113706373 TMPRSS5 60251
## 8 11 113627447 113627478 187 11 113687547 113706373 TMPRSS5 60070
## 9 15 76814085 76814137 174 15 76347904 76905444 SCAPER 0
## 10 18 3412110 3412182 212 18 3411608 3459978 TGIF1 0
## 11 18 80001920 80001951 100 18 79970813 80033949 TXNL4A 0
## 12 21 28059665 28059710 108 21 28048404 28137611 LINC01697 0
## 13 22 46679451 46679485 241 22 46576012 46679790 GRAMD4 0
## 14 5 865245 865502 901 5 850291 892801 BRD9 0
## 15 5 10649438 10649513 13490 5 10564070 10657816 ANKRD33B 0
## 16 5 21485325 21485356 102 5 21341833 21589372 GUSBP1 0
## 17 5 34188811 34188842 105 5 34164698 34244796 AC138409.2 0
## 18 5 69652010 69652055 104 5 69639459 69679259 GUSBP3 0
## 19 5 69904397 69904442 101 5 69875271 69920867 GUSBP13 0
## 20 5 70213701 70213746 106 5 70197255 70207745 AC138866.1 5957
## 21 5 70528127 70528172 109 5 70516387 70555266 GUSBP15 0
## 22 5 71232086 71232131 111 5 71220356 71259238 GUSBP17 0
## 23 5 131945721 131945799 2036 5 131807143 132011637 AC034228.3 0
## 24 5 131945721 131945799 2036 5 131944408 131968220 AC034228.2 0
## 25 6 124862224 124862255 100 6 124644434 124963165 RNF217-AS1 0
## 26 8 22055623 22055743 2879 8 22048995 22082527 DMTN 0
## 27 X 13044583 13044596 458 X 13035617 13044682 FAM9C 0
## 28 X 13044599 13044672 465 X 13035617 13044682 FAM9C 0
## 29 Y 12869916 12869975 108 Y 12537650 12860839 USP9Y 9078
##
## $pool6
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 18611255 18611340 612 1 18595414 18595636 AL031737.1
## 2 10 6307518 6307583 297 10 6271169 6353827 LINC02649
## 3 10 132135162 132135199 150 10 132036336 132184858 JAKMIP3
## 4 12 12058886 12058925 267 12 12049844 12211084 BCL2L14
## 5 17 4550782 4550844 147 17 4538897 4555386 MYBBP1A
## 6 18 58646198 58646240 342 18 58659858 58660524 AC104971.3
## 7 19 28435207 28435249 283 19 28435388 28727680 AC005394.2
## 8 20 897327 897368 345 20 869900 916334 ANGPT4
## 9 20 29876340 29876455 143 20 29874059 29874177 RNA5SP532
## 10 22 29788944 29789092 139 22 29788609 29838304 ASCC2
## 11 22 29789093 29789115 136 22 29788609 29838304 ASCC2
## 12 22 29789117 29789131 133 22 29788609 29838304 ASCC2
## 13 22 46679451 46679485 1507 22 46576012 46679790 GRAMD4
## 14 3 72680749 72680784 100 3 72691705 72691811 RNA5SP136
## 15 3 179525820 179525862 385 3 179562886 179588407 ACTL6A
## 16 4 8288864 8288951 5299 4 8269754 8307098 HTRA3
## 17 5 865245 865502 1982 5 850291 892801 BRD9
## 18 5 10649438 10649513 18147 5 10564070 10657816 ANKRD33B
## 19 5 131945721 131945799 2085 5 131807143 132011637 AC034228.3
## 20 5 131945721 131945799 2085 5 131944408 131968220 AC034228.2
## 21 7 30480049 30480091 261 7 30424527 30478784 NOD1
## 22 7 143105600 143105642 330 7 143132077 143139739 PIP
## 23 8 1974504 1974546 215 8 1971153 1974637 AC019257.1
## 24 8 1974504 1974546 215 8 1971397 1976478 KBTBD11-OT1
## 25 8 1974504 1974546 215 8 1973677 2006936 KBTBD11
## 26 8 22055623 22055743 5609 8 22048995 22082527 DMTN
## 27 8 41063496 41063528 184 8 41032892 41032998 RNU6-356P
## 28 8 81903427 81903469 321 8 81841952 81924348 LINC02235
## 29 9 136857998 136858033 398 9 136850943 136860799 MAMDC4
## 30 9 136858034 136858050 396 9 136850943 136860799 MAMDC4
## 31 X 3983551 3983596 614 X 3953056 3953561 RPL24P9
## 32 Y 12869914 12869975 309 Y 12537650 12860839 USP9Y
## dist_bp
## 1 15620
## 2 0
## 3 0
## 4 0
## 5 0
## 6 13619
## 7 140
## 8 0
## 9 2164
## 10 0
## 11 0
## 12 0
## 13 0
## 14 10922
## 15 37025
## 16 0
## 17 0
## 18 0
## 19 0
## 20 0
## 21 1266
## 22 26436
## 23 0
## 24 0
## 25 0
## 26 0
## 27 30499
## 28 0
## 29 0
## 30 0
## 31 29991
## 32 9076
##
## $pool7
## chr start end n_reads chr.1 start.1 end.1
## 1 1 18611255 18611308 156 1 18595414 18595636
## 2 1 53276939 53276983 309 1 53242364 53328469
## 3 10 6307534 6307583 201 10 6271169 6353827
## 4 10 10027960 10028013 2108 10 10058722 10063502
## 5 22 46679451 46679485 1565 22 46576012 46679790
## 6 4 8288864 8288951 2466 4 8269754 8307098
## 7 5 865245 865502 777 5 850291 892801
## 8 5 4384227 4384295 139 5 4436850 4440259
## 9 5 10649438 10649513 9655 5 10564070 10657816
## 10 5 66573511 66573558 116 5 66572057 66572546
## 11 5 131945721 131945786 682 5 131807143 132011637
## 12 5 131945721 131945786 682 5 131944408 131968220
## 13 5 131945789 131945799 669 5 131807143 132011637
## 14 5 131945789 131945799 669 5 131944408 131968220
## 15 6 104424412 104424455 132 6 104487095 104528158
## 16 8 22055623 22055743 2547 8 22048995 22082527
## 17 GL000225.1 53207 53255 514 GL000225.1 183252 183364
## 18 X 13044583 13044596 388 X 13035617 13044682
## 19 X 13044599 13044672 420 X 13035617 13044682
## 20 Y 12869918 12869975 223 Y 12537650 12860839
## gene dist_bp
## 1 AL031737.1 15620
## 2 LRP8 0
## 3 LINC02649 0
## 4 LINC02670 30710
## 5 GRAMD4 0
## 6 HTRA3 0
## 7 BRD9 0
## 8 AC106799.3 52556
## 9 ANKRD33B 0
## 10 PPIAP78 966
## 11 AC034228.3 0
## 12 AC034228.2 0
## 13 AC034228.3 0
## 14 AC034228.2 0
## 15 AL357522.1 62641
## 16 DMTN 0
## 17 U2 129998
## 18 FAM9C 0
## 19 FAM9C 0
## 20 USP9Y 9080
##
## $pool8
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611316 367 1 18595414 18595636 AL031737.1 15620
## 2 1 228610466 228610478 114 1 228610268 228610386 RNA5S1 81
## 3 1 228610482 228610537 114 1 228610268 228610386 RNA5S1 97
## 4 1 228612707 228612719 119 1 228612509 228612627 RNA5S2 81
## 5 1 228612723 228612778 120 1 228612509 228612627 RNA5S2 97
## 6 1 228614948 228614959 115 1 228614750 228614868 RNA5S3 81
## 7 1 228614964 228615019 116 1 228614750 228614868 RNA5S3 97
## 8 1 228619430 228619442 122 1 228619232 228619350 RNA5S5 81
## 9 1 228619446 228619501 122 1 228619232 228619350 RNA5S5 97
## 10 1 228626107 228626118 110 1 228625909 228626027 RNA5S8 81
## 11 1 228626123 228626178 111 1 228625909 228626027 RNA5S8 97
## 12 1 228628346 228628358 153 1 228628148 228628266 RNA5S9 81
## 13 1 228628362 228628417 153 1 228628148 228628266 RNA5S9 97
## 14 1 228630589 228630599 102 1 228630390 228630508 RNA5S10 82
## 15 1 228630604 228630657 102 1 228630390 228630508 RNA5S10 97
## 16 1 228632829 228632841 117 1 228632631 228632749 RNA5S11 81
## 17 1 228632845 228632900 117 1 228632631 228632749 RNA5S11 97
## 18 1 228635069 228635081 119 1 228634871 228634989 RNA5S12 81
## 19 1 228635085 228635140 120 1 228634871 228634989 RNA5S12 97
## 20 1 228637294 228637306 125 1 228637096 228637214 RNA5S13 81
## 21 1 228637310 228637365 128 1 228637096 228637214 RNA5S13 97
## 22 1 228639535 228639547 111 1 228639337 228639455 RNA5S14 81
## 23 1 228639551 228639606 111 1 228639337 228639455 RNA5S14 97
## 24 1 228641766 228641777 108 1 228641568 228641686 RNA5S15 81
## 25 1 228641782 228641837 108 1 228641568 228641686 RNA5S15 97
## 26 1 228644008 228644018 105 1 228643809 228643927 RNA5S16 82
## 27 1 228644023 228644078 106 1 228643809 228643927 RNA5S16 97
## 28 1 228646238 228646250 129 1 228646040 228646158 RNA5S17 81
## 29 1 228646254 228646309 129 1 228646040 228646158 RNA5S17 97
## 30 10 6307526 6307583 391 10 6271169 6353827 LINC02649 0
## 31 10 125774165 125774287 162 10 125753580 125775821 MMP21 0
## 32 10 125774290 125774307 162 10 125753580 125775821 MMP21 0
## 33 10 131346990 131347017 132 10 131092391 131311721 TCERG1L 35270
## 34 10 131347243 131347276 182 10 131092391 131311721 TCERG1L 35523
## 35 11 2457620 2457656 2155 11 2444684 2849105 KCNQ1 0
## 36 11 65786127 65786205 136 11 65787063 65797214 OVOL1 859
## 37 11 113627262 113627297 164 11 113687547 113706373 TMPRSS5 60251
## 38 11 113627447 113627478 164 11 113687547 113706373 TMPRSS5 60070
## 39 20 29411394 29411458 392 20 29410348 29411600 DUX4L34 0
## 40 22 46679451 46679485 1273 22 46576012 46679790 GRAMD4 0
## 41 4 8288864 8288951 3994 4 8269754 8307098 HTRA3 0
## 42 5 865245 865502 541 5 850291 892801 BRD9 0
## 43 5 10649438 10649513 17948 5 10564070 10657816 ANKRD33B 0
## 44 5 131945721 131945786 1027 5 131807143 132011637 AC034228.3 0
## 45 5 131945721 131945786 1027 5 131944408 131968220 AC034228.2 0
## 46 5 131945789 131945799 1010 5 131807143 132011637 AC034228.3 0
## 47 5 131945789 131945799 1010 5 131944408 131968220 AC034228.2 0
## 48 5 167774205 167774259 544 5 167284799 168264157 TENM2 0
## 49 7 37256513 37256549 121 7 36852906 37449223 ELMO1 0
## 50 7 37256669 37256708 118 7 36852906 37449223 ELMO1 0
## 51 8 22055623 22055743 3993 8 22048995 22082527 DMTN 0
## 52 Y 12869918 12869975 368 Y 12537650 12860839 USP9Y 9080
##
## $pool9
## chr start end n_reads chr.1 start.1 end.1 gene dist_bp
## 1 1 18611255 18611324 366 1 18595414 18595636 AL031737.1 15620
## 2 10 6307518 6307583 387 10 6271169 6353827 LINC02649 0
## 3 10 131346990 131347017 125 10 131092391 131311721 TCERG1L 35270
## 4 10 131347241 131347276 213 10 131092391 131311721 TCERG1L 35521
## 5 17 43665375 43665443 115 17 43640389 43661922 MEOX1 3454
## 6 22 46679451 46679485 136 22 46576012 46679790 GRAMD4 0
## 7 5 865245 865502 2334 5 850291 892801 BRD9 0
## 8 5 10649438 10649513 8206 5 10564070 10657816 ANKRD33B 0
## 9 5 131945721 131945786 780 5 131807143 132011637 AC034228.3 0
## 10 5 131945721 131945786 780 5 131944408 131968220 AC034228.2 0
## 11 5 131945789 131945799 774 5 131807143 132011637 AC034228.3 0
## 12 5 131945789 131945799 774 5 131944408 131968220 AC034228.2 0
## 13 7 37256513 37256549 257 7 36852906 37449223 ELMO1 0
## 14 7 37256753 37256803 256 7 36852906 37449223 ELMO1 0
## 15 8 22055623 22055743 3376 8 22048995 22082527 DMTN 0
## 16 9 31321373 31321440 119 9 31371611 31381490 LINC01243 50172
## 17 Y 12869910 12869975 374 Y 12537650 12860839 USP9Y 9072
##
## $PoolM
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 5991850 5991895 119 1 5862811 5992473 NPHP4
## 2 1 5991850 5991895 119 1 5990927 6101193 KCNAB2
## 3 1 164321420 164321491 119 1 164343005 164343864 NMNAT1P2
## 4 1 168940009 168940047 384 1 168695874 169103276 AL135926.1
## 5 1 168940009 168940047 384 1 168903905 169087005 LINC00970
## 6 1 234742415 234742439 1097 1 234724042 234736720 LINC01132
## 7 1 240093617 240093698 148 1 240014348 240475187 FMN2
## 8 10 5813834 5813885 151 10 5765223 5842132 GDI2
## 9 10 5813887 5813902 150 10 5765223 5842132 GDI2
## 10 10 32347230 32347346 160 10 32267751 32378798 EPC1
## 11 10 93342741 93342782 187 10 93306429 93482334 MYOF
## 12 10 108862573 108862623 1565 10 108848186 108849561 MAPKAPK5P1
## 13 10 108862625 108862636 1551 10 108848186 108849561 MAPKAPK5P1
## 14 11 93330754 93330800 123 11 93329971 93438487 DEUP1
## 15 11 130916242 130916335 212 11 130866250 130916479 SNX19
## 16 12 47773188 47773214 382 12 47753916 47782751 SLC48A1
## 17 12 47773215 47773231 382 12 47753916 47782751 SLC48A1
## 18 12 64404619 64404626 174 12 64404392 64451125 XPOT
## 19 12 64404627 64404666 177 12 64404392 64451125 XPOT
## 20 12 64404670 64404681 175 12 64404392 64451125 XPOT
## 21 12 100372360 100372458 518 12 100357074 100422055 SLC17A8
## 22 12 105330759 105330791 831 12 105235290 105396097 C12orf75
## 23 12 118163439 118163472 262 12 118149801 118372907 TAOK3
## 24 15 80403871 80403944 491 15 80344853 80404214 AC016705.2
## 25 15 95066953 95067013 7909 15 94841059 95169864 AC087633.2
## 26 16 14989693 14989865 116 16 14974591 15139339 PDXDC1
## 27 16 14989693 14989865 116 16 14988259 14990160 AC138932.2
## 28 16 35639205 35639236 122 16 35636687 35645180 KIF18BP1
## 29 16 50708892 50708931 198 16 50693588 50734041 NOD2
## 30 16 62108333 62108393 242 16 61647242 62037035 CDH8
## 31 16 70251562 70251701 243 16 70246778 70251940 EXOSC6
## 32 16 78347038 78347078 2797 16 78099430 79212667 WWOX
## 33 17 13254784 13254854 276 17 13299184 13306771 LINC02093
## 34 17 15786192 15786281 179 17 15786618 15787575 MEIS3P1
## 35 18 9996768 9996808 935 18 9914016 9960021 VAPA
## 36 18 10590130 10590154 1098 18 10594590 10604798 AP001099.1
## 37 19 1600354 1600378 1123 19 1578339 1605445 AC005943.1
## 38 19 1600354 1600378 1123 19 1597169 1605473 UQCR11
## 39 19 48855456 48855480 1222 19 48837097 48868617 PLEKHA4
## 40 2 70477225 70477246 114 2 70447284 70554193 TGFA
## 41 2 111349875 111349923 120 2 111006015 111523376 MIR4435-2HG
## 42 2 119593691 119593715 1087 2 119544432 119662251 CFAP221
## 43 3 54205770 54205813 266 3 54122547 55074557 CACNA2D3
## 44 3 60181850 60181884 136 3 59747277 61251459 FHIT
## 45 3 138508460 138508543 879 3 138494344 138594538 CEP70
## 46 4 8288864 8288951 810 4 8269754 8307098 HTRA3
## 47 4 18051824 18051868 315 4 17841199 18021876 LCORL
## 48 4 122261613 122261700 844 4 122152331 122362758 KIAA1109
## 49 5 10649439 10649513 1822 5 10564070 10657816 ANKRD33B
## 50 5 96294197 96294227 2278 5 95962001 96631085 AC104123.1
## 51 5 115668895 115668939 139 5 115691462 115692167 AC008549.2
## 52 5 131945721 131945786 511 5 131807143 132011637 AC034228.3
## 53 5 131945721 131945786 511 5 131944408 131968220 AC034228.2
## 54 5 131945789 131945799 502 5 131807143 132011637 AC034228.3
## 55 5 131945789 131945799 502 5 131944408 131968220 AC034228.2
## 56 6 36461862 36461889 318 6 36442767 36491143 KCTD20
## 57 6 39792402 39792463 228 6 39792298 39904877 DAAM2
## 58 6 99568568 99568581 304 6 99520976 99589899 TSTD3
## 59 6 99568568 99568581 304 6 99542387 99568825 CCNC
## 60 6 99568582 99568627 309 6 99520976 99589899 TSTD3
## 61 6 99568582 99568627 309 6 99542387 99568825 CCNC
## 62 7 148667487 148667528 114 7 148649547 148650240 AC005229.2
## 63 8 1974504 1974546 414 8 1971153 1974637 AC019257.1
## 64 8 1974504 1974546 414 8 1971397 1976478 KBTBD11-OT1
## 65 8 1974504 1974546 414 8 1973677 2006936 KBTBD11
## 66 8 4909665 4909688 148 8 2935353 4994972 CSMD1
## 67 8 22055623 22055726 220 8 22048995 22082527 DMTN
## 68 8 22055727 22055743 219 8 22048995 22082527 DMTN
## 69 8 30812217 30812293 326 8 30774457 30814314 PPP2CB
## 70 8 66712550 66712702 3980 8 66667596 66860472 C8orf44-SGK3
## 71 8 109465537 109465573 284 8 109362461 109537207 PKHD1L1
## 72 9 76145 76236 360 9 72670 89850 PGM5P3-AS1
## 73 9 36136741 36136851 380 9 36136536 36163913 GLIPR2
## 74 9 68354257 68354348 360 9 68328308 68531061 PGM5
## 75 9 68354257 68354348 360 9 68353614 68357893 PGM5-AS1
## 76 X 5359719 5359783 196 X 5410122 5410251 AC095353.1
## 77 X 44874005 44874064 202 X 44873188 45112779 KDM6A
## dist_bp
## 1 0
## 2 0
## 3 21515
## 4 0
## 5 0
## 6 5696
## 7 0
## 8 0
## 9 0
## 10 0
## 11 0
## 12 13013
## 13 13065
## 14 0
## 15 0
## 16 0
## 17 0
## 18 0
## 19 0
## 20 0
## 21 0
## 22 0
## 23 0
## 24 0
## 25 0
## 26 0
## 27 0
## 28 0
## 29 0
## 30 71299
## 31 0
## 32 0
## 33 44331
## 34 338
## 35 36748
## 36 4437
## 37 0
## 38 0
## 39 0
## 40 0
## 41 0
## 42 0
## 43 0
## 44 0
## 45 0
## 46 0
## 47 29949
## 48 0
## 49 0
## 50 0
## 51 22524
## 52 0
## 53 0
## 54 0
## 55 0
## 56 0
## 57 0
## 58 0
## 59 0
## 60 0
## 61 0
## 62 17248
## 63 0
## 64 0
## 65 0
## 66 0
## 67 0
## 68 0
## 69 0
## 70 0
## 71 0
## 72 0
## 73 0
## 74 0
## 75 0
## 76 50340
## 77 0
##
## $PoolMM
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 234690965 234690994 120 1 234669523 234696153 AL160408.3
## 2 1 234742415 234742439 3703 1 234724042 234736720 LINC01132
## 3 10 54011707 54011774 169 10 53802771 55627942 PCDH15
## 4 10 70378639 70378682 120 10 70298970 70382650 LRRC20
## 5 10 112050459 112050465 713 10 111787233 111989909 AL136119.1
## 6 10 112050466 112050494 717 10 111787233 111989909 AL136119.1
## 7 11 35003588 35003634 232 11 34915829 35020591 PDHX
## 8 11 65067931 65067986 185 11 65066300 65084164 CDCA5
## 9 11 69974845 69974899 134 11 69985876 70015815 AP003555.2
## 10 12 55273510 55273577 140 12 55262539 55263431 OR6C69P
## 11 12 105330759 105330791 2542 12 105235290 105396097 C12orf75
## 12 13 41924412 41924449 168 13 41566835 41961120 VWA8
## 13 14 36580240 36580293 1203 14 36320753 36656163 AL132857.1
## 14 14 36580240 36580293 1203 14 36580004 36582614 NKX2-8
## 15 14 36580295 36580310 1181 14 36320753 36656163 AL132857.1
## 16 14 36580295 36580310 1181 14 36580004 36582614 NKX2-8
## 17 15 26275973 26276063 226 15 26261669 26265918 AC012060.1
## 18 18 10590130 10590154 3981 18 10594590 10604798 AP001099.1
## 19 19 1600354 1600378 3820 19 1578339 1605445 AC005943.1
## 20 19 1600354 1600378 3820 19 1597169 1605473 UQCR11
## 21 19 48855456 48855480 4032 19 48837097 48868617 PLEKHA4
## 22 2 10399589 10399610 118 2 10302889 10427617 HPCAL1
## 23 2 30334177 30334230 999 2 30343222 30348298 AC109642.1
## 24 2 70477216 70477246 868 2 70447284 70554193 TGFA
## 25 2 88069490 88069519 2336 2 88067825 88113384 SMYD1
## 26 2 119593691 119593715 3805 2 119544432 119662251 CFAP221
## 27 2 149038924 149038977 633 2 149038107 149215262 LYPD6B
## 28 4 13436379 13436398 116 4 13361354 13484365 RAB28
## 29 4 13436399 13436471 116 4 13361354 13484365 RAB28
## 30 4 18671384 18671419 132 4 18418662 18888662 AC093898.1
## 31 4 78125849 78125923 122 4 78057323 78544269 FRAS1
## 32 5 84522157 84522201 582 5 84382424 84490765 EDIL3-DT
## 33 5 125362225 125362268 134 5 124808981 125602227 LINC02240
## 34 5 125362225 125362268 134 5 125333369 126368755 AC116362.1
## 35 5 143586716 143586775 2773 5 143531331 143598434 AC016598.2
## 36 6 54751950 54752026 468 6 54770583 54771134 KRASP1
## 37 6 125050045 125050092 272 6 124962545 125092633 RNF217
## 38 6 162134756 162134804 329 6 161347417 162727775 PRKN
## 39 7 45596896 45596960 127 7 45574140 45723116 ADCY1
## 40 7 147628581 147628618 122 7 146116002 148420998 CNTNAP2
## 41 8 1974504 1974546 1773 8 1971153 1974637 AC019257.1
## 42 8 1974504 1974546 1773 8 1971397 1976478 KBTBD11-OT1
## 43 8 1974504 1974546 1773 8 1973677 2006936 KBTBD11
## 44 X 78458592 78458645 382 X 78519593 78520186 HMGN1P34
## dist_bp
## 1 0
## 2 5696
## 3 0
## 4 0
## 5 60551
## 6 60558
## 7 0
## 8 0
## 9 10978
## 10 10080
## 11 0
## 12 0
## 13 0
## 14 0
## 15 0
## 16 0
## 17 10056
## 18 4437
## 19 0
## 20 0
## 21 0
## 22 0
## 23 8993
## 24 0
## 25 0
## 26 0
## 27 0
## 28 0
## 29 0
## 30 0
## 31 0
## 32 31393
## 33 0
## 34 0
## 35 0
## 36 18558
## 37 0
## 38 0
## 39 0
## 40 0
## 41 0
## 42 0
## 43 0
## 44 60949
##
## $Undetermined
## chr start end n_reads chr.1 start.1 end.1 gene
## 1 1 18611255 18611326 275 1 18595414 18595636 AL031737.1
## 2 10 6307518 6307583 307 10 6271169 6353827 LINC02649
## 3 10 10027960 10028013 152 10 10058722 10063502 LINC02670
## 4 10 100122122 100122149 142 10 100105754 100140151 CYP2C23P
## 5 10 100122170 100122185 120 10 100105754 100140151 CYP2C23P
## 6 15 95066953 95067013 227 15 94841059 95169864 AC087633.2
## 7 16 14989690 14989868 156 16 14974591 15139339 PDXDC1
## 8 16 14989690 14989868 156 16 14988259 14990160 AC138932.2
## 9 19 35358874 35359135 3973 19 35358460 35360489 FFAR3
## 10 19 35371343 35371604 3969 19 35370929 35372962 GPR42
## 11 2 32916232 32916632 1964 2 32825359 32926693 LINC00486
## 12 22 46679451 46679485 299 22 46576012 46679790 GRAMD4
## 13 3 60181850 60181902 178 3 59747277 61251459 FHIT
## 14 4 8288864 8288955 2094 4 8269754 8307098 HTRA3
## 15 5 865245 865502 2611 5 850291 892801 BRD9
## 16 5 10649430 10649514 16571 5 10564070 10657816 ANKRD33B
## 17 5 119023122 119023140 150 5 119006347 119070902 AC008629.1
## 18 5 119023143 119023175 150 5 119006347 119070902 AC008629.1
## 19 5 131945721 131945788 1194 5 131807143 132011637 AC034228.3
## 20 5 131945721 131945788 1194 5 131944408 131968220 AC034228.2
## 21 5 131945789 131945799 1078 5 131807143 132011637 AC034228.3
## 22 5 131945789 131945799 1078 5 131944408 131968220 AC034228.2
## 23 5 143586716 143586735 105 5 143531331 143598434 AC016598.2
## 24 5 143586736 143586766 105 5 143531331 143598434 AC016598.2
## 25 6 54725892 54725921 239 6 54770583 54771134 KRASP1
## 26 6 54725998 54726020 239 6 54770583 54771134 KRASP1
## 27 8 22055623 22055743 3883 8 22048995 22082527 DMTN
## 28 8 66712550 66712695 188 8 66667596 66860472 C8orf44-SGK3
## 29 8 66712696 66712702 181 8 66667596 66860472 C8orf44-SGK3
## 30 X 82446629 82446671 185 X 82497669 82497924 EIF3JP1
## 31 X 82446673 82446687 183 X 82497669 82497924 EIF3JP1
## 32 Y 12869918 12869975 178 Y 12537650 12860839 USP9Y
## dist_bp
## 1 15620
## 2 0
## 3 30710
## 4 0
## 5 0
## 6 0
## 7 0
## 8 0
## 9 0
## 10 0
## 11 0
## 12 0
## 13 0
## 14 0
## 15 0
## 16 0
## 17 0
## 18 0
## 19 0
## 20 0
## 21 0
## 22 0
## 23 0
## 24 0
## 25 44663
## 26 44564
## 27 0
## 28 0
## 29 0
## 30 50999
## 31 50983
## 32 9080Now we can look at the sequence of these off-target regions. Lower case indicates that the sequence was repeat-masked.
myfiles <- list.files("fastq/",pattern=".bedgraph.offtarget.fa$",full.names=TRUE)
oft2 <- lapply(myfiles, function(x) {
y <- readLines(x)
n=length(y)
if(n>0){
seq <- y[(1:(n/2))*2]
names(seq) <- y[((1:(n/2))*2)-1]
seq
}
})
names(oft2) <- gsub(".bam.bedgraph.offtarget.fa","",gsub("fastq//","",myfiles))
oft2## $`101-1023`
## >19:35358874-35358981 27777_107bp
## "ACCAGTGGCCACCACCATGGATACAGGCCCCGACCAGTCCTACTTCTCCGGCAATCACTGGTTCGTCTTCTCGGTGTACCTTCTCACTTTCCTGGTGGGGCTCCCCC"
## >19:35371343-35371444 27968_101bp
## "ACCAGTGGCCACCACCATGGATACAGGCCCCGACCAGTCCTACTTCTCCGGCAATCACTGGTTCGTCTTCTCGGTGTACCTTCTCACTTTCCTGGTGGGGC"
##
## $`185-1135`
## >19:35358949-35359135 24019_186bp
## "GTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCAGCGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCC"
## >19:35371418-35371604 24643_186bp
## "GTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCGGTGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCC"
## >6:158378467-158378509 113_42bp
## "ttttttttttttttttttggtgggggtgggggtgggagatgg"
##
## $`7185`
## >19:35358949-35359142 20615_193bp
## "GTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCAGCGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCCCCTGCCC"
## >19:35371418-35371611 19032_193bp
## "GTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCGGTGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCCCCTGCCC"
## >2:152619971-152620002 102_31bp
## "CACTGGCCCCACCGAGAGAATGGAAGAGAGA"
## >7:39369845-39369878 156_33bp
## "gcatttttttttttttttggtgggggtggttag"
## >X:112340564-112340598 109_34bp
## "TTATCTTTTCATCTTTTCGGCGGGGGTGGGGAGG"
##
## $Neg
## NULL
##
## $NTC
## NULL
##
## $pool1
## >1:18611255-18611316 259_61bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:162034657-162034667 417_10bp
## "ttagctcgta"
## >1:162034670-162034712 418_42bp
## "aaggaaatggaggcagacagctggactaacttgctcaaggac"
## >10:6307526-6307583 195_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >11:65786127-65786205 111_78bp
## "GGTGGCCGCAGCAGGGCAAAGGCGGCTGAGCCTTTCCCGGTCTGAGGTCCCCAGCCCTCCGCGCTCCACCAGCCTGGC"
## >17:4550782-4550844 593_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >19:13908861-13908908 118_47bp
## "gcttccttctttttttccttccttccctccttcctccctccctctct"
## >2:35765764-35765776 145_12bp
## "CTCAGTAAACAC"
## >2:35765778-35765802 146_24bp
## "AACTAGAGAGGCCGACTGTGCCTC"
## >2:35765803-35765822 146_19bp
## "AACTTCTGTTTGAGATTTG"
## >22:46679451-46679485 216_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >3:60181850-60181902 4490_52bp
## "TCTGACTCCAAAAGAAATGGAGGTACACCCTCCTATATATATCTCTACCTGT"
## >3:186110029-186110063 153_34bp
## "CCTCCGAAACGGGCATGCAGACTCAGACTTTTTG"
## >3:186110064-186110092 153_28bp
## "CTCCCTCCCCGGGCTGCTTGTTTTCCAT"
## >4:8288864-8288951 2355_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 767_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 15302_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:119023122-119023140 4411_18bp
## "ttaactttgaaaacaatc"
## >5:119023143-119023175 4421_32bp
## "tgaggtacagttggccctccttatctataagt"
## >5:131945721-131945786 896_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 887_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 4150_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:39240838-39240870 693_32bp
## "CAGcccaaatctcatgtcctcacatttcaaaa"
## >X:13044583-13044596 167_13bp
## "TGGCACCGCGAAG"
## >X:13044599-13044672 174_73bp
## "CTCCGAGGGCCTGGGTCCTCTGTTCTCACGAGAGCAGCAGCCGCCCCGGCTGCCCGCGCTCCTCGCTGATTGG"
## >Y:12869918-12869975 222_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool10
## >1:234742415-234742439 763_24bp
## "agccaggcgtagtgacgggcgcct"
## >10:10027960-10028013 239_53bp
## "cagaaatagaggggcccaagcaagggattgcaactcaatttcaaaaacttctg"
## >12:105330759-105330791 224_32bp
## "CCCCACTCGGTTCCTGGCCCCTCGCGGCCCCG"
## >16:14989690-14989869 168_179bp
## "AGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAG"
## >18:10590130-10590154 759_24bp
## "agccaggcgtagtgacgggcgcct"
## >18:37891155-37891201 3213_46bp
## "CTCCTGAAATCCTAAATCTCATTATCTTGCCTGTAGGTCTGGGTTG"
## >19:1600354-1600378 708_24bp
## "aggcgcccgtcactgcgcctggct"
## >19:38326060-38326071 139_11bp
## "tcactgacaga"
## >19:38326072-38326126 140_54bp
## "ggagtgcggcatgagtgacgagggcgtcagggatgaaggcaaggctcttggcct"
## >19:46791472-46791496 228_24bp
## "agttgggcgtggtggcgggcggct"
## >19:48855456-48855480 706_24bp
## "agccaggcgtagtgacgggcgcct"
## >2:119593691-119593715 682_24bp
## "agccaggcgtagtgacgggcgcct"
## >22:46679451-46679485 211_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 3647_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >4:78422580-78422696 168_116bp
## "gagaatgtgtccttgtgtctgaaatgtgaagggtcaggcagagcagggatgcatctggtgggagagacagaggccatacctgacagaccctcgaagcctgtaaggatttgggttgt"
## >4:78422698-78422709 163_11bp
## "tcccaacatca"
## >5:865245-865502 1648_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 6749_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1352_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945788-131945799 1328_11bp
## "GCGCAGGTTCC"
## >7:86652471-86652495 233_24bp
## "agccgcccgccaccacgcccaact"
## >8:1974504-1974546 2771_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >8:22055623-22055743 3445_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
##
## $pool11
## >4:8288864-8288951 403_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865490 213_245bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCC"
## >5:865491-865502 113_11bp
## "CCTGTGCTTCG"
## >5:10649439-10649513 955_74bp
## "GGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >8:22055623-22055726 402_103bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCT"
## >8:22055727-22055743 401_16bp
## "CCTTCTCTCTGGAGCC"
##
## $pool12
## >1:18611255-18611340 1032_85bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:58306257-58306325 156_68bp
## "AGTTCAGTGGGGAAGGAGGAAGGAGGAAAAGGAGAACTGGAAGGGGCAAGGTGAAATTTGGGGGAGGA"
## >1:241065370-241065403 653_33bp
## "CCAAAATTTACCCCCACCCCTTCCAAATTCTGC"
## >10:6307518-6307583 670_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:70183632-70183662 141_30bp
## "gagaaggaggaaggaaggaaggaaggaaAA"
## >10:83229789-83229800 316_11bp
## "agcaagaggct"
## >10:83229801-83229848 363_47bp
## "aaactaggaaaggcacccactcccccgactctgcctccatttcattt"
## >10:100122122-100122149 289_27bp
## "agggagggaggaaggaaggaaggaagg"
## >10:100122170-100122193 284_23bp
## "aggaaggaaggaaggaaaatttg"
## >11:25874404-25874455 106_51bp
## "ACCGCTACAAAACAGACCTGAGGCAGATCCTGATGGTTGCTGGCTTTCTTT"
## >11:65726854-65726937 348_83bp
## "aaacaagggctgACCTAGAGGAAGCTTCTCCATCCTTGAATCTACATCTGGTTCGGCCTGCCTACCTCCACTCCTGCCTCCAT"
## >15:20074892-20074922 223_30bp
## "ttcatggcctttgggttgcttctatctctt"
## >15:21082005-21082035 183_30bp
## "ttcatggcctttgggttgcttctatctctt"
## >16:14989693-14989868 116_175bp
## "TGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCA"
## >16:17690789-17690800 208_11bp
## "tggagctggga"
## >16:17690802-17690847 210_45bp
## "taaacccagatcttccaaacaacaaattctctgctcatttcaAGA"
## >16:18089070-18089116 109_46bp
## "agagagggagggaggaaggaaggaaggaaggaaggaaggaaaacct"
## >17:4550782-4550844 206_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >2:95526518-95526601 268_83bp
## "AGAGGCCGCAAAAGCCCGAGGGCTCCAAGAACTGCCTGCAGAGGCTCAGGGACTGCGAGCTGTCCGCGCTGACGCCGCGCTCC"
## >22:46679451-46679485 252_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >3:196196004-196196051 123_47bp
## "CTGGGGGTGGCTCATCTGAACCCTTGGGTGACATCCTTCTGCCCCCA"
## >4:8288864-8288951 608_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 1154_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 11895_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 875_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 862_10bp
## "CGCAGGTTCC"
## >5:181195621-181195635 113_14bp
## "ATCCAGAGAGAGGA"
## >5:181195639-181195726 116_87bp
## "GCGCGGGTTGGCCGTGTCGGGATCCAAGGTGAGCTCCACTGCAGACAGAGACAGGGAGAAATGTCCCCACGCAGCCAGGCCCCTGGC"
## >5:181195730-181195744 103_14bp
## "TCTTTGCAGGGCCG"
## >6:30466891-30466928 554_37bp
## "gtggcgcgatctcggctctcggctcactgcggcctcc"
## >6:62467363-62467402 481_39bp
## "Tggaaggaaggaaggaaggaaggaaggaaggaaggaagg"
## >6:62467511-62467538 481_27bp
## "agaaggaggaaggaaggaaggaaggaa"
## >8:22055623-22055743 4658_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:37701095-37701196 243_101bp
## "GGGCCGGGGGCGCTTGCTCCCTGCGCAAGGGCCTGGGCGCGCGGGGCCAATGGGACGCTCTGCAAAACCGCCTCCTGCGCCGCTTCCTGGCCGCGCTCCTC"
## >X:54367258-54367275 718_17bp
## "gagaatcgcttgaaccc"
## >X:54367276-54367320 740_44bp
## "ggaggcggaggttgcagtgagctgagatggcaccgccgcgctcc"
## >Y:12869910-12869975 675_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool13
## >1:18611255-18611324 187_69bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 183_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:132135162-132135199 121_37bp
## "GAGCGCGGGCGGGGGCTTCTGGCTCCTGGGGGTTTGT"
## >2:221871203-221871265 1343_62bp
## "caaatacaggagcacccagattcaaaaagcaagttcttacagacattcgaagagacttagac"
## >22:46679451-46679485 181_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 2343_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 1563_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 9952_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 637_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 624_10bp
## "CGCAGGTTCC"
## >7:37256513-37256545 105_32bp
## "gagaaggaggaaggaaggaaggaaggaaagaa"
## >7:37256766-37256788 105_22bp
## "gggaggaggaagggaagggaga"
## >8:22055623-22055743 2591_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >9:93435058-93435107 109_49bp
## "gtagaagctcctgaaattttcttttctttccacgctccttttctctctt"
## >X:82446629-82446671 4642_42bp
## "atgaggaaaaaacagagcaaaagcgcagaaaatttcaaaaac"
## >X:82446673-82446687 4579_14bp
## "gaatacctcttctc"
## >Y:12869910-12869975 184_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool14
## >1:18611255-18611324 268_69bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 263_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >11:1181147-1181217 222_70bp
## "GGAGCGCGGCGTGGAGTGCACCTACAAAGCTGAGGGTGAGCGGCCGGCAGCCCCTGGGGCTGGGGTCCGG"
## >16:14989690-14989868 107_178bp
## "AGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCA"
## >16:48441125-48441181 130_56bp
## "TGGTAGAGGGAAGAGCCCAAGTGGGAAGAATATTTCAGAGGGAGGTGCCAAGCCTC"
## >17:43755387-43755414 154_27bp
## "GCGCGGGGCCGCGGCTTCCGGCCCTTC"
## >17:43755415-43755424 154_9bp
## "GCGGCCGAG"
## >2:234950963-234951013 112_50bp
## "AGGACCAGGAGCAACAAATGTTGGCTTCTTCCCCGGCAAAGACCCGCGCT"
## >20:36986623-36986655 824_32bp
## "gaaatggttctcctgggttgtcttcttttagg"
## >22:46679451-46679485 776_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288959 1995_95bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtctctctctct"
## >5:865245-865502 793_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 10509_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945799 1567_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >8:22055623-22055743 4470_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >Y:12869910-12869975 278_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool15
## >1:18611255-18611336 621_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307508-6307583 570_75bp
## "ttttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:70183632-70183662 106_30bp
## "gagaaggaggaaggaaggaaggaaggaaAA"
## >10:100122122-100122149 144_27bp
## "agggagggaggaaggaaggaaggaagg"
## >10:100122170-100122193 140_23bp
## "aggaaggaaggaaggaaaatttg"
## >22:46679451-46679485 815_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 309_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 938_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 11662_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1053_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1043_10bp
## "CGCAGGTTCC"
## >6:62467363-62467402 155_39bp
## "Tggaaggaaggaaggaaggaaggaaggaaggaaggaagg"
## >6:62467511-62467538 155_27bp
## "agaaggaggaaggaaggaaggaaggaa"
## >8:22055623-22055743 4016_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >X:153867168-153867235 102_67bp
## "GAGAGCCACGAGGACCGAGGGCCAAGGAACAAATGGCTCATTCTGGCACCAAGGGAGTCCAGCCCCC"
## >Y:12869910-12869975 411_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool16
## >1:11748568-11748616 556_48bp
## "ACATGTACCGGGAGCGCGGGGGTGAGCTCCTGGTCCACACTGGTGAGG"
## >1:18611255-18611336 726_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307508-6307583 421_75bp
## "ttttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >11:1289723-1289777 189_54bp
## "gcggcaagaccctgtgcgcccagcggggcggacacatgcatgctctgtccctgg"
## >16:14989690-14989869 180_179bp
## "AGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAG"
## >17:4550782-4550844 300_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >22:46679451-46679485 576_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 3404_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 2419_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 9805_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945799 1392_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >8:1974504-1974546 708_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >8:22055623-22055743 3942_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:41063496-41063528 217_32bp
## "agggaaggagggaaggaggaaggaaggaaAAT"
## >X:2213846-2213880 141_34bp
## "agggaaggaggaaggaaggaggaaggaagggaag"
## >X:2214118-2214156 144_38bp
## "aggaaggaagggaaggaggaaggaaggaggaaggaagg"
## >X:3983551-3983596 328_45bp
## "aggaaagagggagggagggaggaaggaaggaaggaaggaaaATTT"
## >Y:12869918-12869975 319_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool17
## >4:8288864-8288951 3435_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865252-865490 133_238bp
## "GCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCC"
## >5:10649438-10649513 12054_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 510_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 504_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 1924_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
##
## $pool18
## >1:18611255-18611336 335_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307522-6307583 121_61bp
## "ttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:131347243-131347276 103_33bp
## "ttccttccttccttcctccttctctcattcttt"
## >16:14989617-14989628 150_11bp
## "GGACCCCGCGG"
## >16:14989629-14989930 302_301bp
## "AAGGCCAGAGACGGAggcgggcccggggccggcggccacggggccAGGACCTGGGGACCCCAGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAGGAAGCCGTTGGCCACCAGGGCCGGCACTCCAGGGCCCAGCGGTACCGCCTCGCCGCGCTCC"
## >22:29788944-29789092 197_148bp
## "CCCAGGCGATGGGAGCACGGCCTGGTGAGTCTGGTGCCGCTGCCTCCCCACTGGCCCTGCACCAGGTCTCAGGATGGGATCATGCCTTTGCTCCTCTTGCGGTCGGCCATGGTTCTCCGGTTGTGGTTGGCTCTTGTCGCCTTGTTGG"
## >22:29789093-29789115 197_22bp
## "TTCCTTCTTCCTGCGTTCCTGG"
## >22:29789117-29789132 196_15bp
## "TGTCTCGCGGCTCTG"
## >22:46679451-46679485 185_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 1958_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >4:31367013-31367064 316_51bp
## "AGATGAAGGAGGAAGGATTTTGAAGTCCCCTGTGGAAAATCTgggaataag"
## >5:865245-865502 2675_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 6016_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 536_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 526_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 2302_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >Y:12869910-12869975 127_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool19
## >11:115173455-115173532 313_77bp
## "AGAAGGAGAGAGAGCGCGGCCCCCAGCAACCCAGCCGGCAGCATGTCCTAGCATCTACTGCCAGCGTTCCTGGCCCC"
## >12:132583203-132583212 344_9bp
## "TGAAGGTCA"
## >12:132583214-132583258 345_44bp
## "GAGGAGCGCGGGGAGGACGAGGCCTCCGAGCCCCCGGCGGGCGG"
## >13:69077731-69077797 210_66bp
## "AACCCAAGAAACAACATTGTTTTTTACAAAAATAACAATCAACTAATATACATAAAATTTCAAGAA"
## >16:14989689-14989870 197_181bp
## "CAGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAGG"
## >16:66767740-66767838 201_98bp
## "tttttgagatggagtctcactctgtcgtccaggctggagtgcagtggcatgatctcggctcactgcaacctccgcctcctgggttgaagcagttctcc"
## >17:4550782-4550844 138_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >2:95526518-95526601 111_83bp
## "AGAGGCCGCAAAAGCCCGAGGGCTCCAAGAACTGCCTGCAGAGGCTCAGGGACTGCGAGCTGTCCGCGCTGACGCCGCGCTCC"
## >22:46679451-46679485 443_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288955 4024_91bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtctctct"
## >5:865245-865502 3139_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 11258_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1376_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1358_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 4129_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
##
## $pool2
## >1:18611255-18611336 555_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 399_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:100122122-100122193 203_71bp
## "agggagggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaaatttg"
## >12:7913634-7913754 229_120bp
## "CACGGCAAAATGtttattttatttttgatacagagtttcgctcttgttgcccaggctggagtgtaatggcactatcttggctcaccgtaacctctgcctcctgggttcaagcgattctcc"
## >17:81103010-81103061 310_51bp
## "GGAGCGCGGGCTCTTGGGCCCAAGGGCAGTGGTTGGAGCAGTGAGCCTCAG"
## >17:81103064-81103080 298_16bp
## "GTCTGACGGGGCTGCC"
## >22:46679451-46679485 818_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >3:14555195-14555262 136_67bp
## "GCCCAGAGCCAGGCAGCCTTCACCTATGTccccctgtcccaactccccacgtacagcccctcgctcc"
## >4:8288864-8288951 418_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 1057_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 12873_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945799 2815_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >6:96925095-96925147 121_52bp
## "CCAAGTGGGGGCAGACCCGGAGTTGACATTTCAGGGGCTTGCAGCCCATGCA"
## >8:22055623-22055743 4618_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >9:129284217-129284230 523_13bp
## "gggaacgggtggc"
## >9:129284232-129284318 533_86bp
## "aacccagacctgcccagtttcaTGTTCGCGCCGTGAGGGGTCCAGCGGCTGTGGTGTCACTTCTGGTTACCCCGTCATTTAGAGGG"
## >X:32216848-32216897 595_49bp
## "AAGAAGTTAAAGAGTCCAGATGTGCTGAAGATAAATACAATTTCGAAAA"
## >Y:12869905-12869975 508_70bp
## "Tttccttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool20
## >10:10027960-10028013 1258_53bp
## "cagaaatagaggggcccaagcaagggattgcaactcaatttcaaaaacttctg"
## >16:14989617-14989628 110_11bp
## "GGACCCCGCGG"
## >16:14989629-14989930 224_301bp
## "AAGGCCAGAGACGGAggcgggcccggggccggcggccacggggccAGGACCTGGGGACCCCAGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAGGAAGCCGTTGGCCACCAGGGCCGGCACTCCAGGGCCCAGCGGTACCGCCTCGCCGCGCTCC"
## >21:39108618-39108702 123_84bp
## "CAAGGCCCGGGCTCCAGGGGCCCTAACCAGGTGTGGGCTGAGAACGGGAGCTCCCCAAGGGCGGGCCGCGCTCCTCATCCTCTC"
## >22:46679451-46679485 229_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288967 1632_103bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtctctctctcttttttttt"
## >5:865245-865502 1593_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 4777_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 143_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 141_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 2318_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
##
## $pool21
## >1:18611255-18611324 356_69bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 400_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:80473306-80473343 487_37bp
## "TCCTGAAACTTGGCAGGTTTTGGGTTGTGAGTTTTTG"
## >10:132135162-132135199 164_37bp
## "GAGCGCGGGCGGGGGCTTCTGGCTCCTGGGGGTTTGT"
## >12:105330765-105330791 229_26bp
## "TCGGTTCCTGGCCCCTCGCGGCCCCG"
## >16:14989690-14989869 171_179bp
## "AGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAG"
## >20:37944304-37944312 125_8bp
## "AGGAGCCG"
## >20:37944313-37944351 128_38bp
## "CGGACCACCGGGGACCGACTGCCTGCGTCCAGCCGCGC"
## >22:43974366-43974508 202_142bp
## "tgaaggacaggagcgcggggtctcccagggccgttgtgagggttggatgagaggcgtggtaaagctcctgatgcggcgcgtggcgcagtttaggtgcttgaGGTGCGTTAGTGCCCCAGGCCTCTGGTCCTTGCAGACCAAG"
## >22:46679451-46679485 130_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 3145_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 2678_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 10108_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945800 4480_79bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCCT"
## >5:132200546-132200578 120_32bp
## "cttttttttGGGGGGAGTGGGGGtagagacag"
## >7:63398175-63398190 101_15bp
## "GGAGCGCGGGAGGTC"
## >7:63398191-63398273 101_82bp
## "TAGCTGCAGCCGGACGAGCGCTGGCACCAGCCGGGCACCGCGCATGGATCCCGCGTGCGCACTGTCGCGGTCATGGCGTCCC"
## >8:22055623-22055743 4281_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >X:153420796-153420848 102_52bp
## "GGGGCCGCAGGGCCCCAAAGGCGCGGAGAAGCGGTACCTGTGCCAGCagtgt"
## >X:153420849-153420964 102_115bp
## "ggaaggccttcagccgcagctccaacctcatcaagcaccgcatcatccacagtggcgagaagccttacgcgtgccccgagtgcggcaagctgtttcgccgcagcttcgcgctcct"
## >Y:12869910-12869975 354_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool22
## >1:18611255-18611340 317_85bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:112387835-112387898 292_63bp
## "agagagagaggaaggaaggaaggaaggaaggaaggaaggaaggaagggagggaaggaaggaga"
## >1:112387982-112388053 292_71bp
## "aggaagggagggagggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaaa"
## >10:6307518-6307583 179_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:131346939-131346970 375_31bp
## "ccttccctccttccttccttcctccctccct"
## >10:131346990-131347017 272_27bp
## "ctctccttccttcctccctccctccct"
## >10:131347240-131347276 648_36bp
## "tccttccttccttccttcctccttctctcattcttt"
## >11:113627262-113627297 146_35bp
## "agggagggaggaaggaaggaagggagggagggagg"
## >11:113627447-113627478 145_31bp
## "aaggaggaaggaaggaaggaaggaaggaaaa"
## >13:27351867-27351917 127_50bp
## "cccaggctagagtgcagtggcataaccacaactcattgaactcatttcag"
## >21:8205418-8205474 107_56bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCAT"
## >21:8205475-8205485 104_10bp
## "CTGGCCGTCT"
## >21:8249608-8249664 111_56bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCAT"
## >21:8249665-8249675 111_10bp
## "CTGGCCGTCT"
## >21:8388465-8388521 110_56bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCAT"
## >21:8388522-8388532 109_10bp
## "CTGGCCGTCT"
## >21:8432633-8432687 102_54bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTC"
## >22:46679451-46679485 380_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >5:865245-865502 1692_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 13348_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945799 1965_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >7:37256513-37256561 126_48bp
## "gagaaggaggaaggaaggaaggaaggaaagaaggaagaaaggaaggaa"
## >7:37256753-37256804 123_51bp
## "agggaagggagaagggaggaggaagggaagggagaagggagggagggaaag"
## >8:22055623-22055743 4642_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >GL000220.1:104835-104891 107_56bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCAT"
## >GL000220.1:104892-104902 106_10bp
## "CTGGCCGTCT"
## >KI270733.1:121684-121740 113_56bp
## "CGTGGCGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGGTCGCGGGTCCGCGCTCAT"
## >KI270733.1:121741-121751 112_10bp
## "CTGGCCGTCT"
## >KI270733.1:166771-166804 100_33bp
## "CGCGGGAGGCTGGGGACGCCCTTCCCGGCCCGG"
## >Y:12869925-12869974 102_49bp
## "cttccttccttccttccttccttccttccttccttcctccttctctccc"
##
## $pool23
## >1:18611255-18611344 564_89bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307512-6307583 246_71bp
## "ccttccttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:70005108-70005147 117_39bp
## "agggaaggggaggggaggggaggaagggaaaagggaaaa"
## >10:70005357-70005404 117_47bp
## "agggagggagggagggaggaaggaaggaaggaaggaaggaaggaaaa"
## >10:131346939-131346970 238_31bp
## "ccttccctccttccttccttcctccctccct"
## >10:131346990-131347017 318_27bp
## "ctctccttccttcctccctccctccct"
## >10:131347240-131347276 554_36bp
## "tccttccttccttccttcctccttctctcattcttt"
## >11:80568673-80568788 280_115bp
## "GCTCCTGAAACAATGAGGTAGCCCAGTGTGTGTTTGTGTGTATGCGTGTGGCTCAGTACTTCACACCTGAGAGGTATGAGTGTTCACTACAAAGAGGAACTggaaagctttgggc"
## >11:80568796-80568810 275_14bp
## "catgttcactctct"
## >16:14989694-14989865 108_171bp
## "GCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGG"
## >22:46679451-46679485 400_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288929 125_65bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttc"
## >5:865245-865502 1566_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 8843_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1012_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1003_10bp
## "CGCAGGTTCC"
## >7:37256513-37256549 206_36bp
## "gagaaggaggaaggaaggaaggaaggaaagaaggaa"
## >7:37256753-37256803 202_50bp
## "agggaagggagaagggaggaggaagggaagggagaagggagggagggaaa"
## >8:22055623-22055743 1943_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >KI270733.1:133694-133777 106_83bp
## "cgcggcggcggcggcggcggcgggcggcggaggggccgcgggccggtcccccccgccgggtccgcccccggggccgcggttcc"
## >KI270733.1:178774-178856 105_82bp
## "gcggcggcggcggcggcggcgggcggcggaggggccgcgggccggtcccccccgccgggtccgcccccggggccgcggttcc"
## >Y:12869910-12869975 183_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool24
## >1:43926216-43926323 356_107bp
## "acagagagtgagaagCGCGGCTCATCCTGGCAGGACCCTTGAACGTGGATACTTAACGGTTGGGCGAGGAGCCAAAGAAAAAGAGCTTCTggccgggcgcggtccct"
## >11:78417513-78417543 330_30bp
## "gctcctcgcccccggccccccgcggctccg"
## >12:105330765-105330791 503_26bp
## "TCGGTTCCTGGCCCCTCGCGGCCCCG"
## >16:14989617-14989628 109_11bp
## "GGACCCCGCGG"
## >16:14989629-14989930 219_301bp
## "AAGGCCAGAGACGGAggcgggcccggggccggcggccacggggccAGGACCTGGGGACCCCAGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAGGAAGCCGTTGGCCACCAGGGCCGGCACTCCAGGGCCCAGCGGTACCGCCTCGCCGCGCTCC"
## >17:4550782-4550844 390_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >19:11551551-11551692 224_141bp
## "CAGAGAAGCGAGGAGCGCGGCACGGAGCTGTCTTCTCCCCAGGGAGGGCAGGAGTTGAGGCTGGAACGTGGAGACCTGCGGAGGCAGACACCAGAAGACCCGCGCACAGACGCACGCAGCCCCTGGGGCCTCGTAAACCGG"
## >19:38326060-38326071 119_11bp
## "tcactgacaga"
## >19:38326072-38326126 119_54bp
## "ggagtgcggcatgagtgacgagggcgtcagggatgaaggcaaggctcttggcct"
## >22:46679451-46679485 259_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 1128_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 2330_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 7273_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1272_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1251_10bp
## "CGCAGGTTCC"
## >8:1974504-1974546 185_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >8:22055623-22055726 870_103bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCT"
## >8:22055727-22055743 862_16bp
## "CCTTCTCTCTGGAGCC"
##
## $pool3
## >1:18611255-18611336 529_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307526-6307583 419_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >16:15177391-15177437 110_46bp
## "agagagggagggaggaaggaaggaaggaaggaaggaaggaaaacct"
## >17:4550782-4550844 150_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >17:62060954-62061019 288_65bp
## "cccaaaagtgctgggattacaggcgtgagtgagccatggcacccagcTGATCACTATTTTAAAGG"
## >17:65561479-65561525 948_46bp
## "cggccgccgggcggccccgAAATCCATCGCTCTGAGGGGTTATTTT"
## >22:46679451-46679485 482_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288865-8288898 112_33bp
## "cCACCCCCAAATTttccttccttccttccgtcc"
## >5:865245-865502 834_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 16465_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1525_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1495_10bp
## "CGCAGGTTCC"
## >8:22055623-22055743 2893_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:144560678-144560685 111_7bp
## "tcgagga"
## >8:144560686-144560738 111_52bp
## "cagcggtgcgcgggttactctgttactgagttagatgaatatcatgttcctg"
## >X:119552588-119552625 136_37bp
## "cagaagcctcccaaaccctgtcctcctgggttgttat"
## >X:119552627-119552635 136_8bp
## "aagctttg"
## >Y:12869918-12869975 288_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool4
## >1:18611255-18611336 315_81bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307508-6307583 230_75bp
## "ttttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:103584482-103584577 117_95bp
## "cggggccgccTCCCGAGAGCCCTGCGTGACACTGCCCCGTGTCTCCCGCGCAGATAGCGAGCTGGTGCTCCCGGACTGTCTGCGGCCGCGCTCCT"
## >16:14989617-14989628 107_11bp
## "GGACCCCGCGG"
## >16:14989629-14989930 213_301bp
## "AAGGCCAGAGACGGAggcgggcccggggccggcggccacggggccAGGACCTGGGGACCCCAGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCAGGAAGCCGTTGGCCACCAGGGCCGGCACTCCAGGGCCCAGCGGTACCGCCTCGCCGCGCTCC"
## >22:46679451-46679485 238_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:3611860-3611931 106_71bp
## "GGAGCGCGGAGAGCAAGGCTGGGCAGAGAGGCATCTTCTCAGGGTGCCTCGCCCTGGGGGCCCAGCGGCAG"
## >4:8288864-8288951 2350_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 1249_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 11784_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:66573511-66573558 130_47bp
## "agggagggagggagggaggaaggaaggaaggaaAAtttaggaacaag"
## >5:131945721-131945800 2391_79bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCCT"
## >6:104424412-104424455 127_43bp
## "aggaagggagggaggaaggaaggaaggaaAATTTTTTCCCAGT"
## >8:22055623-22055743 3973_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
##
## $pool5
## >1:18611255-18611340 239_85bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:112387835-112387898 195_63bp
## "agagagagaggaaggaaggaaggaaggaaggaaggaaggaaggaagggagggaaggaaggaga"
## >1:112387982-112388053 195_71bp
## "aggaagggagggagggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaaa"
## >10:131346939-131346970 195_31bp
## "ccttccctccttccttccttcctccctccct"
## >10:131346990-131347017 236_27bp
## "ctctccttccttcctccctccctccct"
## >10:131347240-131347276 424_36bp
## "tccttccttccttccttcctccttctctcattcttt"
## >11:113627262-113627297 190_35bp
## "agggagggaggaaggaaggaagggagggagggagg"
## >11:113627447-113627478 187_31bp
## "aaggaggaaggaaggaaggaaggaaggaaaa"
## >15:76814085-76814137 174_52bp
## "tgaacccgggaggcagaggctgctgtgagccgagattacgccaccgcgctcc"
## >18:3412110-3412182 212_72bp
## "GAGGGCCGCAGGGAGCCAGAGACTCGAGCCTgcggttccagccccgccgcggttccggccccgccgcgATCC"
## >18:80001920-80001951 100_31bp
## "gcttttgaaatatgaggacatgagatttggg"
## >21:28059665-28059710 108_45bp
## "gggaaggcatgattgtttttgaaatgtgaggatatgagatttggg"
## >22:46679451-46679485 241_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >5:865245-865502 901_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 13490_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:21485325-21485356 102_31bp
## "cccaaatctcatgtcctcatatttcaaaagc"
## >5:34188811-34188842 105_31bp
## "gcttttgaaatatgaggacatgagatttggg"
## >5:69652010-69652055 104_45bp
## "gggaaggcacgattgcttttgaaatatgaggacatgagatttggg"
## >5:69904397-69904442 101_45bp
## "cccaaatctcatgtcctcatatttcaaaagcaatcatgccttccc"
## >5:70213701-70213746 106_45bp
## "gggaaggcacgattgcttttgaaatatgaggacatgagatttggg"
## >5:70528127-70528172 109_45bp
## "gggaaggcatgattgcttttgaaatatgaggacatgagatttggg"
## >5:71232086-71232131 111_45bp
## "gggaaggcatgattgcttttgaaatatgaggacatgagatttggg"
## >5:131945721-131945799 2036_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >6:124862224-124862255 100_31bp
## "cccaaatctcatgtcctcatatttcaaaaac"
## >8:22055623-22055743 2879_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >X:13044583-13044596 458_13bp
## "TGGCACCGCGAAG"
## >X:13044599-13044672 465_73bp
## "CTCCGAGGGCCTGGGTCCTCTGTTCTCACGAGAGCAGCAGCCGCCCCGGCTGCCCGCGCTCCTCGCTGATTGG"
## >Y:12869916-12869975 108_59bp
## "ccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool6
## >1:18611255-18611340 612_85bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 297_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:132135162-132135199 150_37bp
## "GAGCGCGGGCGGGGGCTTCTGGCTCCTGGGGGTTTGT"
## >12:12058886-12058925 267_39bp
## "cagaccaagcagcccaagaaacatctcaccaatttcaaa"
## >17:4550782-4550844 147_62bp
## "gggaccaaaaacaaccacctctcacgcgcttactcagtgccagcacccgcgctccgcctttt"
## >18:58646198-58646240 342_42bp
## "tttgaaattggtgagatgttctttgggctgtttggtctgagg"
## >19:28435207-28435249 283_42bp
## "tttgaaattggtgagatgtttcttgggctgcttggtctgagg"
## >20:897327-897368 345_41bp
## "ctcagatcaaacagcccaaggaacatctcaccaatttcaaa"
## >20:29876340-29876455 143_115bp
## "cagcggaaagagcagcgcggcgactggtggtgcttgggcgtagagggggagagcagtccggccaggggaaagtggctctagggtgcctgatcccagccttgtggccccgggtttt"
## >22:29788944-29789092 139_148bp
## "CCCAGGCGATGGGAGCACGGCCTGGTGAGTCTGGTGCCGCTGCCTCCCCACTGGCCCTGCACCAGGTCTCAGGATGGGATCATGCCTTTGCTCCTCTTGCGGTCGGCCATGGTTCTCCGGTTGTGGTTGGCTCTTGTCGCCTTGTTGG"
## >22:29789093-29789115 136_22bp
## "TTCCTTCTTCCTGCGTTCCTGG"
## >22:29789117-29789131 133_14bp
## "TGTCTCGCGGCTCT"
## >22:46679451-46679485 1507_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >3:72680749-72680784 100_35bp
## "gaaccagagactgaggacagacaggcccagccccc"
## >3:179525820-179525862 385_42bp
## "tttgaaattggtgagatgttccttgggttgtttggtctgacg"
## >4:8288864-8288951 5299_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 1982_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 18147_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945799 2085_78bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTGGCGCAGGTTCC"
## >7:30480049-30480091 261_42bp
## "cctcagaccaaacagcccaaggaacatctcaccaatttcaaa"
## >7:143105600-143105642 330_42bp
## "cctcagaccaagcagcccaaggaacatctcaccaatttcaaa"
## >8:1974504-1974546 215_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >8:22055623-22055743 5609_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:41063496-41063528 184_32bp
## "agggaaggagggaaggaggaaggaaggaaAAT"
## >8:81903427-81903469 321_42bp
## "tttgaaattggtgagatgttccttgggctgtttggtctgagg"
## >9:136857998-136858033 398_35bp
## "GAGGAGCGCGGGAGGCACCAGGTGCTCAGCCTCAG"
## >9:136858034-136858050 396_16bp
## "GCCCACGGCGGGCTTG"
## >X:3983551-3983596 614_45bp
## "aggaaagagggagggagggaggaaggaaggaaggaaggaaaATTT"
## >Y:12869914-12869975 309_61bp
## "ttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool7
## >1:18611255-18611308 156_53bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:53276939-53276983 309_44bp
## "CGGAACTCGCGGGGCCCGCAGGCCGGGTCTGCACAGCCGCGCTC"
## >10:6307534-6307583 201_49bp
## "ttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:10027960-10028013 2108_53bp
## "cagaaatagaggggcccaagcaagggattgcaactcaatttcaaaaacttctg"
## >22:46679451-46679485 1565_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 2466_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 777_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:4384227-4384295 139_68bp
## "CAGAAGCTTTTAAAACCCCACATCAAACATTTAAAGGGTATTATGGTCACCTCAGGCTTTGGGTAGTC"
## >5:10649438-10649513 9655_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:66573511-66573558 116_47bp
## "agggagggagggagggaggaaggaaggaaggaaAAtttaggaacaag"
## >5:131945721-131945786 682_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 669_10bp
## "CGCAGGTTCC"
## >6:104424412-104424455 132_43bp
## "aggaagggagggaggaaggaaggaaggaaAATTTTTTCCCAGT"
## >8:22055623-22055743 2547_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >GL000225.1:53207-53255 514_48bp
## "CAGAGAGACGGGCCACCCGGAGTCCAGAATTCAGATCTGGTTTCAGAA"
## >X:13044583-13044596 388_13bp
## "TGGCACCGCGAAG"
## >X:13044599-13044672 420_73bp
## "CTCCGAGGGCCTGGGTCCTCTGTTCTCACGAGAGCAGCAGCCGCCCCGGCTGCCCGCGCTCCTCGCTGATTGG"
## >Y:12869918-12869975 223_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool8
## >1:18611255-18611316 367_61bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >1:228610466-228610478 114_12bp
## "CGGGGCCGCGGG"
## >1:228610482-228610537 114_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228612707-228612719 119_12bp
## "CGGGGCCGCGGG"
## >1:228612723-228612778 120_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228614948-228614959 115_11bp
## "CGGGGCCGCGG"
## >1:228614964-228615019 116_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228619430-228619442 122_12bp
## "CGGGGCCGCGGG"
## >1:228619446-228619501 122_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228626107-228626118 110_11bp
## "CGGGGCCGCGG"
## >1:228626123-228626178 111_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228628346-228628358 153_12bp
## "CGGGGCCGCGGG"
## >1:228628362-228628417 153_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228630589-228630599 102_10bp
## "GGGGCCGCGG"
## >1:228630604-228630657 102_53bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCT"
## >1:228632829-228632841 117_12bp
## "CGGGGCCGCGGG"
## >1:228632845-228632900 117_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228635069-228635081 119_12bp
## "CGGGGCCGCGGG"
## >1:228635085-228635140 120_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228637294-228637306 125_12bp
## "CGGGGCCGCGGG"
## >1:228637310-228637365 128_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228639535-228639547 111_12bp
## "CGGGGCCGCGGG"
## >1:228639551-228639606 111_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228641766-228641777 108_11bp
## "CGGGGCCGCGG"
## >1:228641782-228641837 108_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228644008-228644018 105_10bp
## "GGGGCCGCGG"
## >1:228644023-228644078 106_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >1:228646238-228646250 129_12bp
## "CGGGGCCGCGGG"
## >1:228646254-228646309 129_55bp
## "GGATCGGGGACCCCCGAGCCGCTGGCCCGCGGCCTTCCCCCGGCTCCCGCGCTCC"
## >10:6307526-6307583 391_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:125774165-125774287 162_122bp
## "TCCGGGACCCCGCAGCGCGGCCGGTTCATGGCCGCTAGGGTGGCCGCGTCCAGCTCCCCGCTGGCCGGCAGCGCGTTCGCCCGCTGGAACCTGCGCACCGCCTCGGCCAGGGCGGCGCCCTT"
## >10:125774290-125774307 162_17bp
## "GGTCTCCGGCGGCCCCT"
## >10:131346990-131347017 132_27bp
## "ctctccttccttcctccctccctccct"
## >10:131347243-131347276 182_33bp
## "ttccttccttccttcctccttctctcattcttt"
## >11:2457620-2457656 2155_36bp
## "acaagagtggggaggggggaaggggagcaaggtttg"
## >11:65786127-65786205 136_78bp
## "GGTGGCCGCAGCAGGGCAAAGGCGGCTGAGCCTTTCCCGGTCTGAGGTCCCCAGCCCTCCGCGCTCCACCAGCCTGGC"
## >11:113627262-113627297 164_35bp
## "agggagggaggaaggaaggaagggagggagggagg"
## >11:113627447-113627478 164_31bp
## "aaggaggaaggaaggaaggaaggaaggaaaa"
## >20:29411394-29411458 392_64bp
## "ttctgaaaccaaatctggaccctgggctccggaatgccgatggcctgggccagcctttctctgg"
## >22:46679451-46679485 1273_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >4:8288864-8288951 3994_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >5:865245-865502 541_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 17948_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 1027_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 1010_10bp
## "CGCAGGTTCC"
## >5:167774205-167774259 544_54bp
## "gagggagggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaAATT"
## >7:37256513-37256549 121_36bp
## "gagaaggaggaaggaaggaaggaaggaaagaaggaa"
## >7:37256669-37256708 118_39bp
## "agagaagggagaaggagggaaggaagaaaggaaggaaga"
## >8:22055623-22055743 3993_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >Y:12869918-12869975 368_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $pool9
## >1:18611255-18611324 366_69bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa"
## >10:6307518-6307583 387_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:131346990-131347017 125_27bp
## "ctctccttccttcctccctccctccct"
## >10:131347241-131347276 213_35bp
## "ccttccttccttccttcctccttctctcattcttt"
## >17:43665375-43665443 115_68bp
## "ccatggggagggggcgcggtggggtgCTTTGCCCTGAGAACACAGGCCTCTGGCACCCCGGAGCCCCC"
## >22:46679451-46679485 136_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >5:865245-865502 2334_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649438-10649513 8206_75bp
## "CGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:131945721-131945786 780_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 774_10bp
## "CGCAGGTTCC"
## >7:37256513-37256549 257_36bp
## "gagaaggaggaaggaaggaaggaaggaaagaaggaa"
## >7:37256753-37256803 256_50bp
## "agggaagggagaagggaggaggaagggaagggagaagggagggagggaaa"
## >8:22055623-22055743 3376_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >9:31321373-31321440 119_67bp
## "ccagcccccaggctttaggctctcccaggcttgaaggtggggcttcaacagggacccacctccttcc"
## >Y:12869910-12869975 374_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
##
## $PoolM
## >1:5991850-5991895 119_45bp
## "CTAGGGCGCGGGGAGCCAAGGCCCAGAACATCGGTACCGCGCTCC"
## >1:164321420-164321491 119_71bp
## "ACGGGAATCGCGGAGCGCGGCAGCTCCCCTGCGCGCCGCCGCCGCCCTGCTCCTGGCCTCTGCAGGCGCCT"
## >1:168940009-168940047 384_38bp
## "AGGAAGGAAATTTTCCCAATTTACTAACTAAAATCTGG"
## >1:234742415-234742439 1097_24bp
## "agccaggcgtagtgacgggcgcct"
## >1:240093617-240093698 148_81bp
## "GGAGCGCGGGGTGGCGAGTGACAGCGGCGGTGGGGTGTCCCCAGCACTGGCCGCCAAGGCGTCTGGGGCCCCCGCGGCTGC"
## >10:5813834-5813885 151_51bp
## "ACGTGGGCGAGGAGCGCGGGCCGGGCTGCCTCTCGGGGGTGGCGGCCTTGG"
## >10:5813887-5813902 150_15bp
## "CCTCCCGCGGGGCTG"
## >10:32347230-32347346 160_116bp
## "GGAGCGCGGGCTCGAGGCCGGCGCCGGCACGAAGCGCGCGTCCCGCCAACCCCCGGCACCCGCCGGCCTCGCTTCCCGCGCCTCGCTGCTCCGGGCCCCCGCCCTTCGCGGGTCCG"
## >10:93342741-93342782 187_41bp
## "tggaggcagattatacagcgagatcttaaactgtctttttc"
## >10:108862573-108862623 1565_50bp
## "attaatcatcgcaGACTTTGAAGGGGGAAAAAATGCCTCATGTTGAAAAC"
## >10:108862625-108862636 1551_11bp
## "TTGGgggtgga"
## >11:93330754-93330800 123_46bp
## "GAGCGCGGCGCAGCGCAGGTAATGGCTCCTGGCCTTCCCGGCCCCG"
## >11:130916242-130916335 212_93bp
## "CGGGCGCTGCAAGGCCCTGGGGCCCACGGACACTTACACACGCAGCGGGCAGCGGCCGGCGAAGACTGGGTCACACGCCGCCGGGAACCGCGC"
## >12:47773188-47773214 382_26bp
## "ggagcgcggggcgccggctgctctgg"
## >12:47773215-47773231 382_16bp
## "ggcTCCCGCGGCTCCG"
## >12:64404619-64404626 174_7bp
## "AGAGCGA"
## >12:64404627-64404666 177_39bp
## "TAGAGGCGCGCGGTCCCGGCCAGCACCGTCTCTGGCGTT"
## >12:64404670-64404681 175_11bp
## "CTGCGGCCGTG"
## >12:100372360-100372458 518_98bp
## "tttttgaaacagggtctcactctgtcacccagcctggagtgcagtggcgagatcatagttcactgcagtgtccaactcctgggcttaagtgatcctct"
## >12:105330759-105330791 831_32bp
## "CCCCACTCGGTTCCTGGCCCCTCGCGGCCCCG"
## >12:118163439-118163472 262_33bp
## "TTTTTTTTTggggggggtgggggtagagatggg"
## >15:80403871-80403944 491_73bp
## "CTGGGAGCCGAGCAGCGCGGCTCTGGCATGCTAAGTGGGCAGCACTGGGGCGCCTTTGTTCCTCGCGGCCGTC"
## >15:95066953-95067013 7909_60bp
## "ccctgaaacacgtagagacacacagctagtaaactgctaaccaggattggaacttgggtc"
## >16:14989693-14989865 116_172bp
## "TGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGG"
## >16:35639205-35639236 122_31bp
## "GAGGAAGGAGTATTTGTAAAACTTGGAGAGC"
## >16:50708892-50708931 198_39bp
## "GCGCGGCACGGAGTGCAGGCCCTGGTTTGGCCCTTGGTT"
## >16:62108333-62108393 242_60bp
## "CAGATTTTTCCCCTCTTCCCACAATACTTCCCACACTGAAATGTTTCTTTTTCCTTACTC"
## >16:70251562-70251701 243_139bp
## "ggagcgcggcgccggcggcccgcgAAGGGTGCGCGGCGGAAGTCGCAGAGCAggcgaccgcgcagcgcggccggggcctcgccgcctgctccggccgggccgccgccgcgctcgccgccctcggcctgtcgcgggccCG"
## >16:78347038-78347078 2797_40bp
## "TTGCGTTTTTGTGGGGGTTGGGGtaataggtttattgaga"
## >17:13254784-13254854 276_70bp
## "TTTTCTTGTTGGAGTGAGGGAGGCAGCAGGGGCTTGTGTCTGTAGAGTCCTCTTGGATGACTCTCAGTGG"
## >17:15786192-15786281 179_89bp
## "ACCGGGAAGGCGGAgcgcggccgccagcacccccgagccgccgccggacccccgccgccccgggccgccccccgccccccgcggTCCCA"
## >18:9996768-9996808 935_40bp
## "AGAAAAAACTCAGCATGGGTATAACCTACCCCAGTACCTC"
## >18:10590130-10590154 1098_24bp
## "agccaggcgtagtgacgggcgcct"
## >19:1600354-1600378 1123_24bp
## "aggcgcccgtcactgcgcctggct"
## >19:48855456-48855480 1222_24bp
## "agccaggcgtagtgacgggcgcct"
## >2:70477225-70477246 114_21bp
## "GAAGGAGGAAGGAGACAAAAT"
## >2:111349875-111349923 120_48bp
## "aaaaaaaaaggaggcagagccaagtaatttcaacttcacgtctctctc"
## >2:119593691-119593715 1087_24bp
## "agccaggcgtagtgacgggcgcct"
## >3:54205770-54205813 266_43bp
## "AGAAAGGGAGGTAAGAAAGGGTTGCGGTGGAGGATGTCCTCTT"
## >3:60181850-60181884 136_34bp
## "TCTGACTCCAAAAGAAATGGAGGTACACCCTCCT"
## >3:138508460-138508543 879_83bp
## "AGGGCCTGTTGCTGATTATATTTGCTGGGCTCATCTTTCTTCTCTGTGTCCTCAGCCTTCTTATGATTAATAAGCTCCTGTAA"
## >4:8288864-8288951 810_87bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtct"
## >4:18051824-18051868 315_44bp
## "tggagaaaactgacaaataTTCCTACCTCCACCATGGGAGCCAG"
## >4:122261613-122261700 844_87bp
## "TGATTATTAGAGTAGTAGGAAGGATAATTTAGTGTTAAGAATTTGAAGGTAGAAGTTAGGTAGATGGGTTAAAAATCTGGCTTTTTC"
## >5:10649439-10649513 1822_74bp
## "GGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCC"
## >5:96294197-96294227 2278_30bp
## "ATGCATTGACTTGGGCTGTCTTTTCCTCTG"
## >5:115668895-115668939 139_44bp
## "ctaaaaagaactttatagctataagtgccttcatcaaaaagcaa"
## >5:131945721-131945786 511_65bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTC"
## >5:131945789-131945799 502_10bp
## "CGCAGGTTCC"
## >6:36461862-36461889 318_27bp
## "TGATTTGTAGAGAAGGAGGAAGGAAAA"
## >6:39792402-39792463 228_61bp
## "GGAGCGCGGGCGGCGGCGCCGTACCTCGGGCTGCGGGAGCGCGGGCGCCCTGGGGTCCTCG"
## >6:99568568-99568581 304_13bp
## "GCGGCCCGCGGAG"
## >6:99568582-99568627 309_45bp
## "GACCATAGACCCAGCCCGTCCGGTAACCGCGCTCCTCGATCAAAT"
## >7:148667487-148667528 114_41bp
## "agaaagatcagctagtgtttggactgagaagtctcctctag"
## >8:1974504-1974546 414_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >8:4909665-4909688 148_23bp
## "cacacccccggattttctccttc"
## >8:22055623-22055726 220_103bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCT"
## >8:22055727-22055743 219_16bp
## "CCTTCTCTCTGGAGCC"
## >8:30812217-30812293 326_76bp
## "gtgggccgcgccgggccaggggcggacgggaccggggcgggcAGGAAAGCGGCGGCCCGTCCCAGCCCCGCGCTCC"
## >8:66712550-66712702 3980_152bp
## "GGGAAGAGAGAGGAGCGCGGGTTTCCTCGGAGGCCTGAGCGGGACGCAGCCTGCAGCCCCTCCCCGCACGGGCTGCCCCCGGCCCGCCGCTCGCGCCGCTCTGCTGGGATCCGGCGCCTTCCCCGGCTGTCCTCGGCCTCCCGCGCGCTCCG"
## >8:109465537-109465573 284_36bp
## "aaaggaaaccatttcagttttagaatgcctccattt"
## >9:76145-76236 360_91bp
## "GACCCAGGGATTAGGCACCAGCACCTCAGACTAGATTTTAGAGAATTACCATTCAAGAGGCAATCCTCTTCCCTTGGTTCCAATTTCAAGG"
## >9:36136741-36136851 380_110bp
## "CGCAGCCGCGGGGAGCGAGGAGCGCGCGGAGCCGGCCATGGGCAAGTCAGGTGAGCCCGCGGGCTCGCCCGCTGCGGAATGGTTCGGAACCCCGCGCTCCCGGACCTCGC"
## >9:68354257-68354348 360_91bp
## "CCTTGAAATTGGAACCAAGGGAAGAGGATTGCCTCTTGAATGGTAATTCTCTAAAATCTAGTCTGAGGTGCTGGTGCCTAATCCCTGGGTC"
## >X:5359719-5359783 196_64bp
## "TCCGCTTTTAGAGGTAAGAGAATTATTAGAAAAAGGTTTTGCTCCCTTCATGCGGGCTATGACT"
## >X:44874005-44874064 202_59bp
## "GGAGCGCGGACACCGTCTCCCTggccggcgccgcgctcgccccgggccccgcggccggg"
##
## $PoolMM
## >1:234690965-234690994 120_29bp
## "aaagagacaaccacacatgatgtgcctcc"
## >1:234742415-234742439 3703_24bp
## "agccaggcgtagtgacgggcgcct"
## >10:54011707-54011774 169_67bp
## "gaaaccaaggacaagagctcagttacaaataaaggtcatgcacaaaacctcactcctctgaaaacat"
## >10:70378639-70378682 120_43bp
## "agctgggcgtggtggcgggcgcctcgggaagctgaggcaggag"
## >10:112050459-112050465 713_6bp
## "tctgcc"
## >10:112050466-112050494 717_28bp
## "cccgggttttacgccattctccttcctc"
## >11:35003588-35003634 232_46bp
## "GGAGGTAGAAGTACCTCCTTGGTTTTCCCCAGATTATTTTGCAAGT"
## >11:65067931-65067986 185_55bp
## "GGGAGAAACACCATCCACCTCCCCCAGTTTTGTGCGTGCCTGCATGTGCCTGCAT"
## >11:69974845-69974899 134_54bp
## "GTCCGGTTCTTATCTGAAAAAGACTAGGATGCCTCCGTCTCTaaaaaaaaaaaa"
## >12:55273510-55273577 140_67bp
## "TAAAGAAAGCAGTTAACCTACCTATTAAGGAGTTAGTCTTTTTACCTCCTTTTACATTTTTAACCTG"
## >12:105330759-105330791 2542_32bp
## "CCCCACTCGGTTCCTGGCCCCTCGCGGCCCCG"
## >13:41924412-41924449 168_37bp
## "aggagaggagatgaaggaaggaaaagcggggggaagg"
## >14:36580240-36580293 1203_53bp
## "TTCGAAACGCCAGCAGCTCTGGGAGCCCAGCGGAGAGTCGGAGTCACTCTGGG"
## >14:36580295-36580310 1181_15bp
## "CAGTGACGCCTCCCG"
## >15:26275973-26276063 226_90bp
## "ggaggcaacaagaaatgtacttgaagctgggaaatcagtcttgacggattcaaatttcacttctggccctttctagctgaaacaatttcc"
## >18:10590130-10590154 3981_24bp
## "agccaggcgtagtgacgggcgcct"
## >19:1600354-1600378 3820_24bp
## "aggcgcccgtcactgcgcctggct"
## >19:48855456-48855480 4032_24bp
## "agccaggcgtagtgacgggcgcct"
## >2:10399589-10399610 118_21bp
## "cgccaccaccaccaccacGAG"
## >2:30334177-30334230 999_53bp
## "AGGCAGAGGATCTAAAAAGAACTTACCTTACCGCAGATTCTTCTGAAGGAGAG"
## >2:70477216-70477246 868_30bp
## "AAAAAGGAAGAAGGAGGAAGGAGACAAAAT"
## >2:88069490-88069519 2336_29bp
## "TCAGAGTGAAAACAACCCAGAAACACAGG"
## >2:119593691-119593715 3805_24bp
## "agccaggcgtagtgacgggcgcct"
## >2:149038924-149038977 633_53bp
## "tggggcagccaggagctcgcggggccgcggggccgcggggccgcggggccgcg"
## >4:13436379-13436398 116_19bp
## "aaagggcatccaaatcagt"
## >4:13436399-13436471 116_72bp
## "aagaggaagtcaaactgtcactgttcaccaacgtcataatcctatacctagaaaaccctaaagatgcctcca"
## >4:18671384-18671419 132_35bp
## "atattttttgggggggatgggggtgttgttttttt"
## >4:78125849-78125923 122_74bp
## "ggaggcaatctgcccgttattggagcttgaatgccatgctgggagaaccactgccgtcttcagagctgtcaggc"
## >5:84522157-84522201 582_44bp
## "ATCTTAAAAATTAGTAAAACTGATAGCTAAAATCTGGGGATGGG"
## >5:125362225-125362268 134_43bp
## "aaagaacatctttatttctgcctccatttcgttatgtagccag"
## >5:143586716-143586775 2773_59bp
## "GTCTTAGAAACAAAATATGTTCCTCTTTGGTTCCAGATGCTTGGGTTTCTAGAGTCTGG"
## >6:54751950-54752026 468_76bp
## "ACCCAAATCTGAAGTTCCCATCAAATAATTTTGAATACCAATCAACTGCTGATTTATATTTGATTTCAGGAACTTC"
## >6:125050045-125050092 272_47bp
## "GGAGGTAGAGGAGGTGATAGCAGTTCTTTATGGAAGAGAGGAGAGAT"
## >6:162134756-162134804 329_48bp
## "ATGGAGGCAGAGAGTGCCAAAAAGAAAGAGTGGATGTCAGCTCATTCT"
## >7:45596896-45596960 127_64bp
## "TGGAGGCAGGGGAGCAGACACACTGGGGAGTTTGGCGGTGGTTTTCTTTTTGTTTCTTCCTGGG"
## >7:147628581-147628618 122_37bp
## "aaggcaacaactagcatgatgaagaaaacagtacctc"
## >8:1974504-1974546 1773_42bp
## "CCCTGGGGAGGGGAGCGCGGCCCTTGGTCCTCCGCCGCTGCG"
## >X:78458592-78458645 382_53bp
## "acaaatagaatttaaagaaaaccaaacatcatcttatacttgataatgcctcc"
##
## $Undetermined
## >1:18611255-18611326 275_71bp
## "agaaagggagagaaggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaagg"
## >10:6307518-6307583 307_65bp
## "ttccttccttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"
## >10:10027960-10028013 152_53bp
## "cagaaatagaggggcccaagcaagggattgcaactcaatttcaaaaacttctg"
## >10:100122122-100122149 142_27bp
## "agggagggaggaaggaaggaaggaagg"
## >10:100122170-100122185 120_15bp
## "aggaaggaaggaagg"
## >15:95066953-95067013 227_60bp
## "ccctgaaacacgtagagacacacagctagtaaactgctaaccaggattggaacttgggtc"
## >16:14989690-14989868 156_178bp
## "AGCTGCAGGCAACGCACGCGGCGCAGCAGCCCCTCCCGCAGCAGCAGCACCGCCTCTCCAGCTTCAGCCAGCGCGCTCAGCGGGCGCAGCTGCACGAAGGGCACAAAGTCCGGCGCCACGGCGGGCTCCCGCTCCCCGGGAGTCACCCACAGCCGATTGGCAGCCACGTCCAGGGCCA"
## >19:35358874-35359135 3973_261bp
## "ACCAGTGGCCACCACCATGGATACAGGCCCCGACCAGTCCTACTTCTCCGGCAATCACTGGTTCGTCTTCTCGGTGTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCAGCGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCC"
## >19:35371343-35371604 3969_261bp
## "ACCAGTGGCCACCACCATGGATACAGGCCCCGACCAGTCCTACTTCTCCGGCAATCACTGGTTCGTCTTCTCGGTGTACCTTCTCACTTTCCTGGTGGGGCTCCCCCTCAACCTGCTGGCCCTGGTGGTCTTCGTGGGCAAGCTGCGGTGCCGCCCGGTGGCCGTGGACGTGCTCCTGCTCAACCTGACCGCCTCGGACCTGCTCCTGCTGCTGTTCCTGCCTTTCCGCATGGTGGAGGCAGCCAATGGCATGCACTGGCC"
## >2:32916232-32916632 1964_400bp
## "ggggggggtggggggggggcgggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggagggaggggggggtgagagggggggggggggggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggggggggggaggggggggggggaggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggcgggggcggggggggggagggggggggggggggggggggggggggnnnnnnn"
## >22:46679451-46679485 299_34bp
## "GGAGCGCGGATCGGCACGGGCTCTGGGCTCCCCG"
## >3:60181850-60181902 178_52bp
## "TCTGACTCCAAAAGAAATGGAGGTACACCCTCCTATATATATCTCTACCTGT"
## >4:8288864-8288955 2094_91bp
## "ccCACCCCCAAATTttccttccttccttccgtccgtccttccttccttccttccttccttccttccttcctcccttcctcccCCtctctct"
## >5:865245-865502 2611_257bp
## "CGAGGCCGCGACCCAAGGACATCTGTGGAAACCGACCTCCACAACAGCACCGCTGCCCATGCAGCCTCCAGCCTTCCCACAACTACAATGCTGCCCACTACCTCGTCTAGACGTCACACTGACTGTGCTGGGGTCTCTGGGGATGCGGCGTGGGTGGGGGCATCTCACCCAGGTGGTGCTGGTCCCTCTCGGAGGCGTTGGACAGGGAGCTGAGGTTGGACGACGGCCGAGAGCCGCCGCGCTCCGCCTGTGCTTCG"
## >5:10649430-10649514 16571_84bp
## "AAGCGGCGCGGAAGCCCGCGGGCTCCAAGAACTGCCTGCAGAGGCTCACAGACTGCGTGCTGTCCGTGCTGACGCCGCGCTCCG"
## >5:119023122-119023140 150_18bp
## "ttaactttgaaaacaatc"
## >5:119023143-119023175 150_32bp
## "tgaggtacagttggccctccttatctataagt"
## >5:131945721-131945788 1194_67bp
## "GGGAAAACGGAGGAGCGCGGCAGCCGCCCAGCCTTCCTATAGGGGCCCAGTGGTTTCTGGCCTTCTG"
## >5:131945789-131945799 1078_10bp
## "CGCAGGTTCC"
## >5:143586716-143586735 105_19bp
## "GTCTTAGAAACAAAATATG"
## >5:143586736-143586766 105_30bp
## "TCCTCTTTGGTTCCAGATGCTTGGGTTTCT"
## >6:54725892-54725921 239_29bp
## "gttttctgagtatctataacaactatttc"
## >6:54725998-54726020 239_22bp
## "tgggtatctataacaactattt"
## >8:22055623-22055743 3883_120bp
## "CCCACCCCCAGGTTTTCTCTACCTTCACAGCCACCCCCGCCTGGCTGCAGCAGCTCAGCCTGTGTTCTGTCTCCCTTCTCAGCCACCTGCCTCCTTCCTTCCTCCCTTCTCTCTGGAGCC"
## >8:66712550-66712695 188_145bp
## "GGGAAGAGAGAGGAGCGCGGGTTTCCTCGGAGGCCTGAGCGGGACGCAGCCTGCAGCCCCTCCCCGCACGGGCTGCCCCCGGCCCGCCGCTCGCGCCGCTCTGCTGGGATCCGGCGCCTTCCCCGGCTGTCCTCGGCCTCCCGCG"
## >8:66712696-66712702 181_6bp
## "GCTCCG"
## >X:82446629-82446671 185_42bp
## "atgaggaaaaaacagagcaaaagcgcagaaaatttcaaaaac"
## >X:82446673-82446687 183_14bp
## "gaatacctcttctc"
## >Y:12869918-12869975 178_57bp
## "ttccttccttccttccttccttccttccttccttccttccttcctccttctctccct"Look at the origin of the off-target reads
If we look at the similarity of the genomic locations with the amplicons we should be able to track down which primer was responsible for which off-target region. The primers are 16-26 bp in length so I will use the 20bp at the termini to do this classification.
In these heatmaps, the seq names along the bottom are the target amplicons and the ones along the right are the off-target regions.
The deeper the red, the smaller the sequence edit distance.
# amplicon termini
x <- readLines("amplicons_hg38.bed.starts.fa")
n=length(x)
amp_st <- x[(1:(n/2))*2]
names(amp_st) <- x[((1:(n/2))*2)-1]
x <- readLines("amplicons_hg38.bed.ends.fa")
n=length(x)
amp_en <- x[(1:(n/2))*2]
names(amp_en) <- x[((1:(n/2))*2)-1]
amp <-c(amp_st,amp_en)
# seq termini
mystarts <- list.files("fastq/",pattern=".bedgraph.offtarget.starts.fa$",full.names=TRUE)
myends <- list.files("fastq/",pattern=".bedgraph.offtarget.ends.fa$",full.names=TRUE)
idxs <- grep("ool",mystarts)
lapply(idxs, function(z) {
mystart <- mystarts[z]
x <- readLines(mystart)
n=length(x)
st <- x[(1:(n/2))*2]
names(st) <- x[((1:(n/2))*2)-1]
myend <- myends[z]
x <- readLines(myend)
n=length(x)
en <- x[(1:(n/2))*2]
names(en) <- x[((1:(n/2))*2)-1]
seq <-c(st,en)
adist(seq,amp)
colfunc <- colorRampPalette(c("red", "white"))
heatmap.2(adist(seq,amp),col=colfunc(50),trace="none",scale="none",margin=c(15,20),main=names(oft2)[z])
})
## [[1]]
## [[1]]$rowInd
## [1] 13 4 8 1 17 7 15 14 2 16 11 18 9 12 3 6 5 10
##
## [[1]]$colInd
## [1] 8 3 11 12 14 7 9 5 2 6 4 10 13 1
##
## [[1]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[1]]$carpet
## >18611255-18611316 259_61BP >4:8288864-8288951 2355_87BP
## >128241036-128241347 17 15
## >2:25168373-25168611 17 15
## >25161598-25161833 14 13
## >25168373-25168611 16 14
## >78358469-78358619 8 7
## >7:128241036-1282413 7 5
## >24283548-24283843 14 12
## >7:24283548-24283843 14 11
## >2:25161598-25161833 10 12
## >7:24283796-24283936 12 13
## >6:31575210-31575467 13 11
## >24283796-24283936 12 8
## >31575210-31575467 10 11
## >17:78358469-7835861 10 12
## >8:22055623-22055743 4150_120BP
## >128241036-128241347 14
## >2:25168373-25168611 15
## >25161598-25161833 12
## >25168373-25168611 15
## >78358469-78358619 7
## >7:128241036-1282413 7
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >1:18611255-18611316 259_61BP >8288864-8288951 2355_87BP
## >128241036-128241347 4 6
## >2:25168373-25168611 10 11
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >2:25161598-25161833 15 13
## >7:24283796-24283936 12 11
## >6:31575210-31575467 12 12
## >24283796-24283936 13 14
## >31575210-31575467 12 14
## >17:78358469-7835861 14 13
## >5:131945721-131945786 896_65BP >4550782-4550844 593_62BP
## >128241036-128241347 11 12
## >2:25168373-25168611 8 11
## >25161598-25161833 10 9
## >25168373-25168611 10 11
## >78358469-78358619 16 15
## >7:128241036-1282413 16 17
## >24283548-24283843 10 12
## >7:24283548-24283843 12 10
## >2:25161598-25161833 13 15
## >7:24283796-24283936 13 14
## >6:31575210-31575467 14 17
## >24283796-24283936 13 14
## >31575210-31575467 16 14
## >17:78358469-7835861 14 17
## >22055623-22055743 4150_120BP
## >128241036-128241347 6
## >2:25168373-25168611 10
## >25161598-25161833 9
## >25168373-25168611 9
## >78358469-78358619 10
## >7:128241036-1282413 13
## >24283548-24283843 11
## >7:24283548-24283843 13
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >24283796-24283936 12
## >31575210-31575467 11
## >17:78358469-7835861 13
## >11:65786127-65786205 111_78BP >65786127-65786205 111_78BP
## >128241036-128241347 11 10
## >2:25168373-25168611 9 11
## >25161598-25161833 9 8
## >25168373-25168611 13 10
## >78358469-78358619 12 13
## >7:128241036-1282413 15 13
## >24283548-24283843 10 11
## >7:24283548-24283843 11 12
## >2:25161598-25161833 11 8
## >7:24283796-24283936 9 8
## >6:31575210-31575467 12 13
## >24283796-24283936 11 14
## >31575210-31575467 14 12
## >17:78358469-7835861 12 13
## >13044599-13044672 174_73BP >865245-865502 767_257BP
## >128241036-128241347 9 9
## >2:25168373-25168611 11 12
## >25161598-25161833 9 11
## >25168373-25168611 9 10
## >78358469-78358619 12 15
## >7:128241036-1282413 14 15
## >24283548-24283843 10 10
## >7:24283548-24283843 13 12
## >2:25161598-25161833 12 10
## >7:24283796-24283936 12 12
## >6:31575210-31575467 12 13
## >24283796-24283936 13 13
## >31575210-31575467 12 14
## >17:78358469-7835861 15 14
## >X:13044599-13044672 174_73BP
## >128241036-128241347 15
## >2:25168373-25168611 14
## >25161598-25161833 12
## >25168373-25168611 12
## >78358469-78358619 10
## >7:128241036-1282413 11
## >24283548-24283843 11
## >7:24283548-24283843 10
## >2:25161598-25161833 13
## >7:24283796-24283936 11
## >6:31575210-31575467 16
## >24283796-24283936 13
## >31575210-31575467 12
## >17:78358469-7835861 14
## >131945721-131945786 896_65BP >17:4550782-4550844 593_62BP
## >128241036-128241347 11 11
## >2:25168373-25168611 12 10
## >25161598-25161833 12 13
## >25168373-25168611 13 12
## >78358469-78358619 11 10
## >7:128241036-1282413 11 10
## >24283548-24283843 10 11
## >7:24283548-24283843 7 11
## >2:25161598-25161833 10 15
## >7:24283796-24283936 14 14
## >6:31575210-31575467 10 10
## >24283796-24283936 10 10
## >31575210-31575467 9 13
## >17:78358469-7835861 11 13
## >5:10649438-10649513 15302_75BP >5:865245-865502 767_257BP
## >128241036-128241347 14 11
## >2:25168373-25168611 9 10
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >2:25161598-25161833 12 11
## >7:24283796-24283936 11 14
## >6:31575210-31575467 13 13
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >10649438-10649513 15302_75BP
## >128241036-128241347 12
## >2:25168373-25168611 8
## >25161598-25161833 10
## >25168373-25168611 14
## >78358469-78358619 16
## >7:128241036-1282413 15
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25161598-25161833 11
## >7:24283796-24283936 14
## >6:31575210-31575467 15
## >24283796-24283936 14
## >31575210-31575467 13
## >17:78358469-7835861 12
##
## [[1]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[1]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 26.28688
##
## [[1]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[1]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[1]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[1]]$layout
## [[1]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[1]]$layout$lhei
## [1] 1.5 4.0
##
## [[1]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[2]]
## [[2]]$rowInd
## [1] 9 12 10 2 7 11 1 3 6 13 14 5 4 8
##
## [[2]]$colInd
## [1] 3 8 11 12 7 14 4 6 5 9 2 1 10 13
##
## [[2]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[2]]$carpet
## >131945721-131945786 1352_65BP
## >2:25168373-25168611 12
## >128241036-128241347 11
## >25161598-25161833 12
## >25168373-25168611 13
## >7:128241036-1282413 11
## >78358469-78358619 11
## >6:31575210-31575467 10
## >7:24283796-24283936 14
## >7:24283548-24283843 7
## >24283548-24283843 10
## >2:25161598-25161833 10
## >17:78358469-7835861 11
## >24283796-24283936 10
## >31575210-31575467 9
## >78422580-78422696 168_116BP >14989690-14989869 168_179BP
## >2:25168373-25168611 13 12
## >128241036-128241347 13 12
## >25161598-25161833 14 11
## >25168373-25168611 11 13
## >7:128241036-1282413 9 10
## >78358469-78358619 10 8
## >6:31575210-31575467 12 10
## >7:24283796-24283936 14 11
## >7:24283548-24283843 10 12
## >24283548-24283843 11 10
## >2:25161598-25161833 12 11
## >17:78358469-7835861 8 12
## >24283796-24283936 6 12
## >31575210-31575467 9 13
## >4:8288864-8288951 3647_87BP
## >2:25168373-25168611 15
## >128241036-128241347 15
## >25161598-25161833 13
## >25168373-25168611 14
## >7:128241036-1282413 5
## >78358469-78358619 7
## >6:31575210-31575467 11
## >7:24283796-24283936 13
## >7:24283548-24283843 11
## >24283548-24283843 12
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >24283796-24283936 8
## >31575210-31575467 11
## >8:22055623-22055743 3445_120BP
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25161598-25161833 12
## >25168373-25168611 15
## >7:128241036-1282413 7
## >78358469-78358619 7
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >7:24283548-24283843 11
## >24283548-24283843 12
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 10
## >31575210-31575467 11
## >22055623-22055743 3445_120BP
## >2:25168373-25168611 10
## >128241036-128241347 6
## >25161598-25161833 9
## >25168373-25168611 9
## >7:128241036-1282413 13
## >78358469-78358619 10
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >7:24283548-24283843 13
## >24283548-24283843 11
## >2:25161598-25161833 11
## >17:78358469-7835861 13
## >24283796-24283936 12
## >31575210-31575467 11
## >16:14989690-14989869 168_179BP
## >2:25168373-25168611 12
## >128241036-128241347 9
## >25161598-25161833 9
## >25168373-25168611 10
## >7:128241036-1282413 11
## >78358469-78358619 13
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >7:24283548-24283843 10
## >24283548-24283843 12
## >2:25161598-25161833 9
## >17:78358469-7835861 14
## >24283796-24283936 12
## >31575210-31575467 10
## >4:78422580-78422696 168_116BP
## >2:25168373-25168611 14
## >128241036-128241347 13
## >25161598-25161833 12
## >25168373-25168611 14
## >7:128241036-1282413 10
## >78358469-78358619 14
## >6:31575210-31575467 16
## >7:24283796-24283936 13
## >7:24283548-24283843 9
## >24283548-24283843 11
## >2:25161598-25161833 10
## >17:78358469-7835861 11
## >24283796-24283936 11
## >31575210-31575467 10
## >5:131945721-131945786 1352_65BP
## >2:25168373-25168611 8
## >128241036-128241347 11
## >25161598-25161833 10
## >25168373-25168611 10
## >7:128241036-1282413 16
## >78358469-78358619 16
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >7:24283548-24283843 12
## >24283548-24283843 10
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >24283796-24283936 13
## >31575210-31575467 16
## >8288864-8288951 3647_87BP >865245-865502 1648_257BP
## >2:25168373-25168611 11 12
## >128241036-128241347 6 9
## >25161598-25161833 12 11
## >25168373-25168611 11 10
## >7:128241036-1282413 16 15
## >78358469-78358619 15 15
## >6:31575210-31575467 12 13
## >7:24283796-24283936 11 12
## >7:24283548-24283843 9 12
## >24283548-24283843 11 10
## >2:25161598-25161833 13 10
## >17:78358469-7835861 13 14
## >24283796-24283936 14 13
## >31575210-31575467 14 14
## >5:10649438-10649513 6749_75BP >5:865245-865502 1648_257BP
## >2:25168373-25168611 9 10
## >128241036-128241347 14 11
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >7:128241036-1282413 13 14
## >78358469-78358619 13 14
## >6:31575210-31575467 13 13
## >7:24283796-24283936 11 14
## >7:24283548-24283843 11 13
## >24283548-24283843 10 12
## >2:25161598-25161833 12 11
## >17:78358469-7835861 13 10
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >10649438-10649513 6749_75BP
## >2:25168373-25168611 8
## >128241036-128241347 12
## >25161598-25161833 10
## >25168373-25168611 14
## >7:128241036-1282413 15
## >78358469-78358619 16
## >6:31575210-31575467 15
## >7:24283796-24283936 14
## >7:24283548-24283843 12
## >24283548-24283843 10
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 14
## >31575210-31575467 13
##
## [[2]]$rowDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 19
##
## [[2]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 20.27313
##
## [[2]]$breaks
## [1] 5.00 5.22 5.44 5.66 5.88 6.10 6.32 6.54 6.76 6.98 7.20 7.42
## [13] 7.64 7.86 8.08 8.30 8.52 8.74 8.96 9.18 9.40 9.62 9.84 10.06
## [25] 10.28 10.50 10.72 10.94 11.16 11.38 11.60 11.82 12.04 12.26 12.48 12.70
## [37] 12.92 13.14 13.36 13.58 13.80 14.02 14.24 14.46 14.68 14.90 15.12 15.34
## [49] 15.56 15.78 16.00
##
## [[2]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[2]]$colorTable
## low high color
## 1 5.00 5.22 #FF0000
## 2 5.22 5.44 #FF0505
## 3 5.44 5.66 #FF0A0A
## 4 5.66 5.88 #FF0F0F
## 5 5.88 6.10 #FF1414
## 6 6.10 6.32 #FF1A1A
## 7 6.32 6.54 #FF1F1F
## 8 6.54 6.76 #FF2424
## 9 6.76 6.98 #FF2929
## 10 6.98 7.20 #FF2E2E
## 11 7.20 7.42 #FF3434
## 12 7.42 7.64 #FF3939
## 13 7.64 7.86 #FF3E3E
## 14 7.86 8.08 #FF4343
## 15 8.08 8.30 #FF4848
## 16 8.30 8.52 #FF4E4E
## 17 8.52 8.74 #FF5353
## 18 8.74 8.96 #FF5858
## 19 8.96 9.18 #FF5D5D
## 20 9.18 9.40 #FF6262
## 21 9.40 9.62 #FF6868
## 22 9.62 9.84 #FF6D6D
## 23 9.84 10.06 #FF7272
## 24 10.06 10.28 #FF7777
## 25 10.28 10.50 #FF7C7C
## 26 10.50 10.72 #FF8282
## 27 10.72 10.94 #FF8787
## 28 10.94 11.16 #FF8C8C
## 29 11.16 11.38 #FF9191
## 30 11.38 11.60 #FF9696
## 31 11.60 11.82 #FF9C9C
## 32 11.82 12.04 #FFA1A1
## 33 12.04 12.26 #FFA6A6
## 34 12.26 12.48 #FFABAB
## 35 12.48 12.70 #FFB0B0
## 36 12.70 12.92 #FFB6B6
## 37 12.92 13.14 #FFBBBB
## 38 13.14 13.36 #FFC0C0
## 39 13.36 13.58 #FFC5C5
## 40 13.58 13.80 #FFCACA
## 41 13.80 14.02 #FFD0D0
## 42 14.02 14.24 #FFD5D5
## 43 14.24 14.46 #FFDADA
## 44 14.46 14.68 #FFDFDF
## 45 14.68 14.90 #FFE4E4
## 46 14.90 15.12 #FFEAEA
## 47 15.12 15.34 #FFEFEF
## 48 15.34 15.56 #FFF4F4
## 49 15.56 15.78 #FFF9F9
## 50 15.78 16.00 #FFFFFF
##
## [[2]]$layout
## [[2]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[2]]$layout$lhei
## [1] 1.5 4.0
##
## [[2]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[3]]
## [[3]]$rowInd
## [1] 1 4 6 7 3 2 5 8
##
## [[3]]$colInd
## [1] 7 14 3 8 12 10 13 6 4 5 9 11 2 1
##
## [[3]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[3]]$carpet
## >4:8288864-8288951 403_87BP >8:22055623-22055726 402_103BP
## >7:128241036-1282413 5 7
## >78358469-78358619 7 7
## >2:25168373-25168611 15 15
## >128241036-128241347 15 14
## >25168373-25168611 14 15
## >24283796-24283936 8 10
## >31575210-31575467 11 11
## >7:24283796-24283936 13 12
## >6:31575210-31575467 11 13
## >7:24283548-24283843 11 11
## >24283548-24283843 12 12
## >25161598-25161833 13 12
## >2:25161598-25161833 12 11
## >17:78358469-7835861 12 12
## >22055623-22055726 402_103BP >8288864-8288951 403_87BP
## >7:128241036-1282413 14 16
## >78358469-78358619 14 15
## >2:25168373-25168611 9 11
## >128241036-128241347 9 6
## >25168373-25168611 9 11
## >24283796-24283936 12 14
## >31575210-31575467 12 14
## >7:24283796-24283936 12 11
## >6:31575210-31575467 13 12
## >7:24283548-24283843 9 9
## >24283548-24283843 9 11
## >25161598-25161833 12 12
## >2:25161598-25161833 14 13
## >17:78358469-7835861 14 13
## >5:10649439-10649513 955_74BP >5:865245-865490 213_245BP
## >7:128241036-1282413 13 14
## >78358469-78358619 12 14
## >2:25168373-25168611 7 10
## >128241036-128241347 13 11
## >25168373-25168611 16 13
## >24283796-24283936 11 12
## >31575210-31575467 12 12
## >7:24283796-24283936 11 14
## >6:31575210-31575467 14 13
## >7:24283548-24283843 10 13
## >24283548-24283843 10 12
## >25161598-25161833 14 11
## >2:25161598-25161833 11 11
## >17:78358469-7835861 12 10
## >10649439-10649513 955_74BP >865245-865490 213_245BP
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >2:25168373-25168611 8 9
## >128241036-128241347 12 14
## >25168373-25168611 14 16
## >24283796-24283936 14 13
## >31575210-31575467 13 13
## >7:24283796-24283936 14 15
## >6:31575210-31575467 15 15
## >7:24283548-24283843 12 11
## >24283548-24283843 10 12
## >25161598-25161833 10 11
## >2:25161598-25161833 11 11
## >17:78358469-7835861 12 12
##
## [[3]]$rowDendrogram
## 'dendrogram' with 2 branches and 8 members total, at height 18.68154
##
## [[3]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 19.07878
##
## [[3]]$breaks
## [1] 5.00 5.22 5.44 5.66 5.88 6.10 6.32 6.54 6.76 6.98 7.20 7.42
## [13] 7.64 7.86 8.08 8.30 8.52 8.74 8.96 9.18 9.40 9.62 9.84 10.06
## [25] 10.28 10.50 10.72 10.94 11.16 11.38 11.60 11.82 12.04 12.26 12.48 12.70
## [37] 12.92 13.14 13.36 13.58 13.80 14.02 14.24 14.46 14.68 14.90 15.12 15.34
## [49] 15.56 15.78 16.00
##
## [[3]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[3]]$colorTable
## low high color
## 1 5.00 5.22 #FF0000
## 2 5.22 5.44 #FF0505
## 3 5.44 5.66 #FF0A0A
## 4 5.66 5.88 #FF0F0F
## 5 5.88 6.10 #FF1414
## 6 6.10 6.32 #FF1A1A
## 7 6.32 6.54 #FF1F1F
## 8 6.54 6.76 #FF2424
## 9 6.76 6.98 #FF2929
## 10 6.98 7.20 #FF2E2E
## 11 7.20 7.42 #FF3434
## 12 7.42 7.64 #FF3939
## 13 7.64 7.86 #FF3E3E
## 14 7.86 8.08 #FF4343
## 15 8.08 8.30 #FF4848
## 16 8.30 8.52 #FF4E4E
## 17 8.52 8.74 #FF5353
## 18 8.74 8.96 #FF5858
## 19 8.96 9.18 #FF5D5D
## 20 9.18 9.40 #FF6262
## 21 9.40 9.62 #FF6868
## 22 9.62 9.84 #FF6D6D
## 23 9.84 10.06 #FF7272
## 24 10.06 10.28 #FF7777
## 25 10.28 10.50 #FF7C7C
## 26 10.50 10.72 #FF8282
## 27 10.72 10.94 #FF8787
## 28 10.94 11.16 #FF8C8C
## 29 11.16 11.38 #FF9191
## 30 11.38 11.60 #FF9696
## 31 11.60 11.82 #FF9C9C
## 32 11.82 12.04 #FFA1A1
## 33 12.04 12.26 #FFA6A6
## 34 12.26 12.48 #FFABAB
## 35 12.48 12.70 #FFB0B0
## 36 12.70 12.92 #FFB6B6
## 37 12.92 13.14 #FFBBBB
## 38 13.14 13.36 #FFC0C0
## 39 13.36 13.58 #FFC5C5
## 40 13.58 13.80 #FFCACA
## 41 13.80 14.02 #FFD0D0
## 42 14.02 14.24 #FFD5D5
## 43 14.24 14.46 #FFDADA
## 44 14.46 14.68 #FFDFDF
## 45 14.68 14.90 #FFE4E4
## 46 14.90 15.12 #FFEAEA
## 47 15.12 15.34 #FFEFEF
## 48 15.34 15.56 #FFF4F4
## 49 15.56 15.78 #FFF9F9
## 50 15.78 16.00 #FFFFFF
##
## [[3]]$layout
## [[3]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[3]]$layout$lhei
## [1] 1.5 4.0
##
## [[3]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[4]]
## [[4]]$rowInd
## [1] 25 8 13 21 3 15 9 12 10 14 24 23 11 16 30 19 6 7 18 4 20 22 2 27 5
## [26] 29 1 28 17 26
##
## [[4]]$colInd
## [1] 8 11 12 3 9 5 14 7 4 13 10 2 6 1
##
## [[4]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[4]]$carpet
## >58306257-58306325 156_68BP >4:8288864-8288951 608_87BP
## >128241036-128241347 15 15
## >25161598-25161833 14 13
## >25168373-25168611 14 14
## >2:25168373-25168611 15 15
## >24283548-24283843 14 12
## >7:24283548-24283843 12 11
## >78358469-78358619 5 7
## >7:128241036-1282413 6 5
## >6:31575210-31575467 10 11
## >31575210-31575467 12 11
## >24283796-24283936 8 8
## >2:25161598-25161833 12 12
## >7:24283796-24283936 11 13
## >17:78358469-7835861 12 12
## >8:22055623-22055743 4658_120BP
## >128241036-128241347 14
## >25161598-25161833 12
## >25168373-25168611 15
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 7
## >7:128241036-1282413 7
## >6:31575210-31575467 13
## >31575210-31575467 11
## >24283796-24283936 10
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >17:78358469-7835861 12
## >18611255-18611340 1032_85BP >10:6307518-6307583 670_65BP
## >128241036-128241347 17 17
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >2:25168373-25168611 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >6:31575210-31575467 13 13
## >31575210-31575467 10 10
## >24283796-24283936 12 12
## >2:25161598-25161833 10 10
## >7:24283796-24283936 12 12
## >17:78358469-7835861 10 10
## >Y:12869910-12869975 675_65BP >5:865245-865502 1154_257BP
## >128241036-128241347 17 11
## >25161598-25161833 14 11
## >25168373-25168611 16 13
## >2:25168373-25168611 17 10
## >24283548-24283843 14 12
## >7:24283548-24283843 14 13
## >78358469-78358619 8 14
## >7:128241036-1282413 7 14
## >6:31575210-31575467 13 13
## >31575210-31575467 10 12
## >24283796-24283936 12 12
## >2:25161598-25161833 10 11
## >7:24283796-24283936 12 14
## >17:78358469-7835861 10 10
## >5:181195639-181195726 116_87BP
## >128241036-128241347 14
## >25161598-25161833 11
## >25168373-25168611 14
## >2:25168373-25168611 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 16
## >7:128241036-1282413 14
## >6:31575210-31575467 15
## >31575210-31575467 14
## >24283796-24283936 14
## >2:25161598-25161833 9
## >7:24283796-24283936 12
## >17:78358469-7835861 12
## >5:10649438-10649513 11895_75BP
## >128241036-128241347 14
## >25161598-25161833 15
## >25168373-25168611 16
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >78358469-78358619 13
## >7:128241036-1282413 13
## >6:31575210-31575467 13
## >31575210-31575467 14
## >24283796-24283936 13
## >2:25161598-25161833 12
## >7:24283796-24283936 11
## >17:78358469-7835861 13
## >8:37701095-37701196 243_101BP >4550782-4550844 206_62BP
## >128241036-128241347 14 12
## >25161598-25161833 12 9
## >25168373-25168611 16 11
## >2:25168373-25168611 9 11
## >24283548-24283843 12 12
## >7:24283548-24283843 11 10
## >78358469-78358619 13 15
## >7:128241036-1282413 14 17
## >6:31575210-31575467 16 17
## >31575210-31575467 14 14
## >24283796-24283936 15 14
## >2:25161598-25161833 12 15
## >7:24283796-24283936 13 14
## >17:78358469-7835861 13 17
## >37701095-37701196 243_101BP
## >128241036-128241347 11
## >25161598-25161833 10
## >25168373-25168611 12
## >2:25168373-25168611 8
## >24283548-24283843 11
## >7:24283548-24283843 11
## >78358469-78358619 16
## >7:128241036-1282413 16
## >6:31575210-31575467 15
## >31575210-31575467 13
## >24283796-24283936 12
## >2:25161598-25161833 14
## >7:24283796-24283936 12
## >17:78358469-7835861 13
## >5:131945721-131945786 875_65BP
## >128241036-128241347 11
## >25161598-25161833 10
## >25168373-25168611 10
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >78358469-78358619 16
## >7:128241036-1282413 16
## >6:31575210-31575467 14
## >31575210-31575467 16
## >24283796-24283936 13
## >2:25161598-25161833 13
## >7:24283796-24283936 13
## >17:78358469-7835861 14
## >10649438-10649513 11895_75BP >95526518-95526601 268_83BP
## >128241036-128241347 12 12
## >25161598-25161833 10 10
## >25168373-25168611 14 13
## >2:25168373-25168611 8 9
## >24283548-24283843 10 11
## >7:24283548-24283843 12 13
## >78358469-78358619 16 18
## >7:128241036-1282413 15 16
## >6:31575210-31575467 15 16
## >31575210-31575467 13 14
## >24283796-24283936 14 16
## >2:25161598-25161833 11 11
## >7:24283796-24283936 14 14
## >17:78358469-7835861 12 13
## >14989693-14989868 116_175BP >17:4550782-4550844 206_62BP
## >128241036-128241347 12 11
## >25161598-25161833 10 13
## >25168373-25168611 12 12
## >2:25168373-25168611 11 10
## >24283548-24283843 10 11
## >7:24283548-24283843 12 11
## >78358469-78358619 7 10
## >7:128241036-1282413 11 10
## >6:31575210-31575467 10 10
## >31575210-31575467 13 13
## >24283796-24283936 13 10
## >2:25161598-25161833 10 15
## >7:24283796-24283936 11 14
## >17:78358469-7835861 13 13
## >2:95526518-95526601 268_83BP
## >128241036-128241347 9
## >25161598-25161833 12
## >25168373-25168611 13
## >2:25168373-25168611 8
## >24283548-24283843 8
## >7:24283548-24283843 7
## >78358469-78358619 13
## >7:128241036-1282413 11
## >6:31575210-31575467 10
## >31575210-31575467 11
## >24283796-24283936 10
## >2:25161598-25161833 10
## >7:24283796-24283936 13
## >17:78358469-7835861 13
## >131945721-131945786 875_65BP
## >128241036-128241347 11
## >25161598-25161833 12
## >25168373-25168611 13
## >2:25168373-25168611 12
## >24283548-24283843 10
## >7:24283548-24283843 7
## >78358469-78358619 11
## >7:128241036-1282413 11
## >6:31575210-31575467 10
## >31575210-31575467 9
## >24283796-24283936 10
## >2:25161598-25161833 10
## >7:24283796-24283936 14
## >17:78358469-7835861 11
## >11:65726854-65726937 348_83BP
## >128241036-128241347 11
## >25161598-25161833 12
## >25168373-25168611 8
## >2:25168373-25168611 9
## >24283548-24283843 9
## >7:24283548-24283843 9
## >78358469-78358619 13
## >7:128241036-1282413 11
## >6:31575210-31575467 15
## >31575210-31575467 6
## >24283796-24283936 10
## >2:25161598-25161833 12
## >7:24283796-24283936 13
## >17:78358469-7835861 12
## >181195639-181195726 116_87BP
## >128241036-128241347 13
## >25161598-25161833 9
## >25168373-25168611 12
## >2:25168373-25168611 12
## >24283548-24283843 11
## >7:24283548-24283843 10
## >78358469-78358619 14
## >7:128241036-1282413 12
## >6:31575210-31575467 14
## >31575210-31575467 8
## >24283796-24283936 12
## >2:25161598-25161833 7
## >7:24283796-24283936 11
## >17:78358469-7835861 12
## >22055623-22055743 4658_120BP
## >128241036-128241347 6
## >25161598-25161833 9
## >25168373-25168611 9
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >78358469-78358619 10
## >7:128241036-1282413 13
## >6:31575210-31575467 8
## >31575210-31575467 11
## >24283796-24283936 12
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >17:78358469-7835861 13
## >1:58306257-58306325 156_68BP >65726854-65726937 348_83BP
## >128241036-128241347 3 9
## >25161598-25161833 9 9
## >25168373-25168611 10 10
## >2:25168373-25168611 11 11
## >24283548-24283843 13 9
## >7:24283548-24283843 12 10
## >78358469-78358619 13 12
## >7:128241036-1282413 13 15
## >6:31575210-31575467 11 12
## >31575210-31575467 10 11
## >24283796-24283936 13 11
## >2:25161598-25161833 11 11
## >7:24283796-24283936 8 12
## >17:78358469-7835861 12 12
## >16:14989693-14989868 116_175BP >865245-865502 1154_257BP
## >128241036-128241347 11 9
## >25161598-25161833 10 11
## >25168373-25168611 9 10
## >2:25168373-25168611 13 12
## >24283548-24283843 11 10
## >7:24283548-24283843 13 12
## >78358469-78358619 14 15
## >7:128241036-1282413 14 15
## >6:31575210-31575467 12 13
## >31575210-31575467 11 14
## >24283796-24283936 14 13
## >2:25161598-25161833 11 10
## >7:24283796-24283936 13 12
## >17:78358469-7835861 14 14
## >1:18611255-18611340 1032_85BP >8288864-8288951 608_87BP
## >128241036-128241347 4 6
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >2:25168373-25168611 10 11
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >6:31575210-31575467 12 12
## >31575210-31575467 12 14
## >24283796-24283936 13 14
## >2:25161598-25161833 15 13
## >7:24283796-24283936 12 11
## >17:78358469-7835861 14 13
## >12869910-12869975 675_65BP >6307518-6307583 670_65BP
## >128241036-128241347 7 7
## >25161598-25161833 12 12
## >25168373-25168611 11 11
## >2:25168373-25168611 10 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >78358469-78358619 14 14
## >7:128241036-1282413 16 16
## >6:31575210-31575467 10 10
## >31575210-31575467 13 13
## >24283796-24283936 13 13
## >2:25161598-25161833 15 15
## >7:24283796-24283936 12 12
## >17:78358469-7835861 11 11
##
## [[4]]$rowDendrogram
## 'dendrogram' with 2 branches and 30 members total, at height 22.36068
##
## [[4]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 35.49648
##
## [[4]]$breaks
## [1] 3.0 3.3 3.6 3.9 4.2 4.5 4.8 5.1 5.4 5.7 6.0 6.3 6.6 6.9 7.2
## [16] 7.5 7.8 8.1 8.4 8.7 9.0 9.3 9.6 9.9 10.2 10.5 10.8 11.1 11.4 11.7
## [31] 12.0 12.3 12.6 12.9 13.2 13.5 13.8 14.1 14.4 14.7 15.0 15.3 15.6 15.9 16.2
## [46] 16.5 16.8 17.1 17.4 17.7 18.0
##
## [[4]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[4]]$colorTable
## low high color
## 1 3.0 3.3 #FF0000
## 2 3.3 3.6 #FF0505
## 3 3.6 3.9 #FF0A0A
## 4 3.9 4.2 #FF0F0F
## 5 4.2 4.5 #FF1414
## 6 4.5 4.8 #FF1A1A
## 7 4.8 5.1 #FF1F1F
## 8 5.1 5.4 #FF2424
## 9 5.4 5.7 #FF2929
## 10 5.7 6.0 #FF2E2E
## 11 6.0 6.3 #FF3434
## 12 6.3 6.6 #FF3939
## 13 6.6 6.9 #FF3E3E
## 14 6.9 7.2 #FF4343
## 15 7.2 7.5 #FF4848
## 16 7.5 7.8 #FF4E4E
## 17 7.8 8.1 #FF5353
## 18 8.1 8.4 #FF5858
## 19 8.4 8.7 #FF5D5D
## 20 8.7 9.0 #FF6262
## 21 9.0 9.3 #FF6868
## 22 9.3 9.6 #FF6D6D
## 23 9.6 9.9 #FF7272
## 24 9.9 10.2 #FF7777
## 25 10.2 10.5 #FF7C7C
## 26 10.5 10.8 #FF8282
## 27 10.8 11.1 #FF8787
## 28 11.1 11.4 #FF8C8C
## 29 11.4 11.7 #FF9191
## 30 11.7 12.0 #FF9696
## 31 12.0 12.3 #FF9C9C
## 32 12.3 12.6 #FFA1A1
## 33 12.6 12.9 #FFA6A6
## 34 12.9 13.2 #FFABAB
## 35 13.2 13.5 #FFB0B0
## 36 13.5 13.8 #FFB6B6
## 37 13.8 14.1 #FFBBBB
## 38 14.1 14.4 #FFC0C0
## 39 14.4 14.7 #FFC5C5
## 40 14.7 15.0 #FFCACA
## 41 15.0 15.3 #FFD0D0
## 42 15.3 15.6 #FFD5D5
## 43 15.6 15.9 #FFDADA
## 44 15.9 16.2 #FFDFDF
## 45 16.2 16.5 #FFE4E4
## 46 16.5 16.8 #FFEAEA
## 47 16.8 17.1 #FFEFEF
## 48 17.1 17.4 #FFF4F4
## 49 17.4 17.7 #FFF9F9
## 50 17.7 18.0 #FFFFFF
##
## [[4]]$layout
## [[4]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[4]]$layout$lhei
## [1] 1.5 4.0
##
## [[4]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[5]]
## [[5]]$rowInd
## [1] 15 4 8 13 2 9 6 5 10 18 7 3 12 14 1 17 11 16
##
## [[5]]$colInd
## [1] 14 7 2 10 13 1 8 3 9 5 4 6 11 12
##
## [[5]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[5]]$carpet
## >221871203-221871265 1343_62BP
## >78358469-78358619 13
## >7:128241036-1282413 11
## >2:25161598-25161833 11
## >24283796-24283936 11
## >31575210-31575467 8
## >17:78358469-7835861 10
## >128241036-128241347 12
## >2:25168373-25168611 15
## >24283548-24283843 14
## >7:24283548-24283843 15
## >6:31575210-31575467 12
## >7:24283796-24283936 9
## >25161598-25161833 9
## >25168373-25168611 12
## >4:8288864-8288951 2343_87BP
## >78358469-78358619 7
## >7:128241036-1282413 5
## >2:25161598-25161833 12
## >24283796-24283936 8
## >31575210-31575467 11
## >17:78358469-7835861 12
## >128241036-128241347 15
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 11
## >7:24283796-24283936 13
## >25161598-25161833 13
## >25168373-25168611 14
## >8:22055623-22055743 2591_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >128241036-128241347 14
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >25161598-25161833 12
## >25168373-25168611 15
## >18611255-18611324 187_69BP >10:6307518-6307583 183_65BP
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >6:31575210-31575467 13 13
## >7:24283796-24283936 12 12
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >Y:12869910-12869975 184_65BP
## >78358469-78358619 8
## >7:128241036-1282413 7
## >2:25161598-25161833 10
## >24283796-24283936 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >128241036-128241347 17
## >2:25168373-25168611 17
## >24283548-24283843 14
## >7:24283548-24283843 14
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >25161598-25161833 14
## >25168373-25168611 16
## >5:10649438-10649513 9952_75BP >5:865245-865502 1563_257BP
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >2:25161598-25161833 12 11
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >128241036-128241347 14 11
## >2:25168373-25168611 9 10
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >6:31575210-31575467 13 13
## >7:24283796-24283936 11 14
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >10649438-10649513 9952_75BP >865245-865502 1563_257BP
## >78358469-78358619 16 15
## >7:128241036-1282413 15 15
## >2:25161598-25161833 11 10
## >24283796-24283936 14 13
## >31575210-31575467 13 14
## >17:78358469-7835861 12 14
## >128241036-128241347 12 9
## >2:25168373-25168611 8 12
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 15 13
## >7:24283796-24283936 14 12
## >25161598-25161833 10 11
## >25168373-25168611 14 10
## >5:131945721-131945786 637_65BP
## >78358469-78358619 16
## >7:128241036-1282413 16
## >2:25161598-25161833 13
## >24283796-24283936 13
## >31575210-31575467 16
## >17:78358469-7835861 14
## >128241036-128241347 11
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >25161598-25161833 10
## >25168373-25168611 10
## >2:221871203-221871265 1343_62BP
## >78358469-78358619 9
## >7:128241036-1282413 11
## >2:25161598-25161833 13
## >24283796-24283936 8
## >31575210-31575467 9
## >17:78358469-7835861 12
## >128241036-128241347 10
## >2:25168373-25168611 9
## >24283548-24283843 4
## >7:24283548-24283843 10
## >6:31575210-31575467 11
## >7:24283796-24283936 11
## >25161598-25161833 12
## >25168373-25168611 9
## >131945721-131945786 637_65BP
## >78358469-78358619 11
## >7:128241036-1282413 11
## >2:25161598-25161833 10
## >24283796-24283936 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >128241036-128241347 11
## >2:25168373-25168611 12
## >24283548-24283843 10
## >7:24283548-24283843 7
## >6:31575210-31575467 10
## >7:24283796-24283936 14
## >25161598-25161833 12
## >25168373-25168611 13
## >22055623-22055743 2591_120BP
## >78358469-78358619 10
## >7:128241036-1282413 13
## >2:25161598-25161833 11
## >24283796-24283936 12
## >31575210-31575467 11
## >17:78358469-7835861 13
## >128241036-128241347 6
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >25161598-25161833 9
## >25168373-25168611 9
## >1:18611255-18611324 187_69BP >8288864-8288951 2343_87BP
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >2:25161598-25161833 15 13
## >24283796-24283936 13 14
## >31575210-31575467 12 14
## >17:78358469-7835861 14 13
## >128241036-128241347 4 6
## >2:25168373-25168611 10 11
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >6:31575210-31575467 12 12
## >7:24283796-24283936 12 11
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >12869910-12869975 184_65BP >6307518-6307583 183_65BP
## >78358469-78358619 14 14
## >7:128241036-1282413 16 16
## >2:25161598-25161833 15 15
## >24283796-24283936 13 13
## >31575210-31575467 13 13
## >17:78358469-7835861 11 11
## >128241036-128241347 7 7
## >2:25168373-25168611 10 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 10 10
## >7:24283796-24283936 12 12
## >25161598-25161833 12 12
## >25168373-25168611 11 11
##
## [[5]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[5]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 31.03224
##
## [[5]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[5]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[5]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[5]]$layout
## [[5]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[5]]$layout$lhei
## [1] 1.5 4.0
##
## [[5]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[6]]
## [[6]]$rowInd
## [1] 5 9 16 2 10 1 19 13 18 12 15 17 14 4 7 6 20 8 3 11
##
## [[6]]$colInd
## [1] 8 12 3 11 9 5 7 14 2 6 4 1 13 10
##
## [[6]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[6]]$carpet
## >4:8288864-8288959 1995_95BP
## >128241036-128241347 15
## >25168373-25168611 14
## >2:25168373-25168611 15
## >25161598-25161833 13
## >24283548-24283843 12
## >7:24283548-24283843 11
## >7:128241036-1282413 5
## >78358469-78358619 7
## >2:25161598-25161833 12
## >7:24283796-24283936 13
## >6:31575210-31575467 11
## >17:78358469-7835861 12
## >31575210-31575467 11
## >24283796-24283936 8
## >8:22055623-22055743 4470_120BP
## >128241036-128241347 14
## >25168373-25168611 15
## >2:25168373-25168611 15
## >25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >7:128241036-1282413 7
## >78358469-78358619 7
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >17:78358469-7835861 12
## >31575210-31575467 11
## >24283796-24283936 10
## >18611255-18611324 268_69BP >10:6307518-6307583 263_65BP
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >2:25168373-25168611 17 17
## >25161598-25161833 14 14
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >7:128241036-1282413 7 7
## >78358469-78358619 8 8
## >2:25161598-25161833 10 10
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >17:78358469-7835861 10 10
## >31575210-31575467 10 10
## >24283796-24283936 12 12
## >Y:12869910-12869975 278_65BP
## >128241036-128241347 17
## >25168373-25168611 16
## >2:25168373-25168611 17
## >25161598-25161833 14
## >24283548-24283843 14
## >7:24283548-24283843 14
## >7:128241036-1282413 7
## >78358469-78358619 8
## >2:25161598-25161833 10
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >17:78358469-7835861 10
## >31575210-31575467 10
## >24283796-24283936 12
## >1:18611255-18611324 268_69BP >8288864-8288959 1995_95BP
## >128241036-128241347 4 6
## >25168373-25168611 8 10
## >2:25168373-25168611 10 11
## >25161598-25161833 11 12
## >24283548-24283843 11 10
## >7:24283548-24283843 9 11
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >2:25161598-25161833 15 14
## >7:24283796-24283936 12 13
## >6:31575210-31575467 12 13
## >17:78358469-7835861 14 12
## >31575210-31575467 12 12
## >24283796-24283936 13 13
## >12869910-12869975 278_65BP >6307518-6307583 263_65BP
## >128241036-128241347 7 7
## >25168373-25168611 11 11
## >2:25168373-25168611 10 10
## >25161598-25161833 12 12
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >7:128241036-1282413 16 16
## >78358469-78358619 14 14
## >2:25161598-25161833 15 15
## >7:24283796-24283936 12 12
## >6:31575210-31575467 10 10
## >17:78358469-7835861 11 11
## >31575210-31575467 13 13
## >24283796-24283936 13 13
## >1181147-1181217 222_70BP >14989690-14989868 107_178BP
## >128241036-128241347 11 12
## >25168373-25168611 11 12
## >2:25168373-25168611 11 11
## >25161598-25161833 13 10
## >24283548-24283843 10 10
## >7:24283548-24283843 13 12
## >7:128241036-1282413 10 11
## >78358469-78358619 13 7
## >2:25161598-25161833 9 10
## >7:24283796-24283936 12 11
## >6:31575210-31575467 10 10
## >17:78358469-7835861 8 13
## >31575210-31575467 10 13
## >24283796-24283936 11 13
## >22055623-22055743 4470_120BP
## >128241036-128241347 6
## >25168373-25168611 9
## >2:25168373-25168611 10
## >25161598-25161833 9
## >24283548-24283843 11
## >7:24283548-24283843 13
## >7:128241036-1282413 13
## >78358469-78358619 10
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >17:78358469-7835861 13
## >31575210-31575467 11
## >24283796-24283936 12
## >131945721-131945799 1567_78BP
## >128241036-128241347 11
## >25168373-25168611 11
## >2:25168373-25168611 11
## >25161598-25161833 10
## >24283548-24283843 12
## >7:24283548-24283843 10
## >7:128241036-1282413 12
## >78358469-78358619 12
## >2:25161598-25161833 12
## >7:24283796-24283936 10
## >6:31575210-31575467 12
## >17:78358469-7835861 11
## >31575210-31575467 11
## >24283796-24283936 10
## >16:14989690-14989868 107_178BP
## >128241036-128241347 9
## >25168373-25168611 10
## >2:25168373-25168611 12
## >25161598-25161833 9
## >24283548-24283843 12
## >7:24283548-24283843 10
## >7:128241036-1282413 11
## >78358469-78358619 13
## >2:25161598-25161833 9
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >17:78358469-7835861 14
## >31575210-31575467 10
## >24283796-24283936 12
## >5:10649438-10649513 10509_75BP >5:865245-865502 793_257BP
## >128241036-128241347 14 11
## >25168373-25168611 16 13
## >2:25168373-25168611 9 10
## >25161598-25161833 15 11
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >7:128241036-1282413 13 14
## >78358469-78358619 13 14
## >2:25161598-25161833 12 11
## >7:24283796-24283936 11 14
## >6:31575210-31575467 13 13
## >17:78358469-7835861 13 10
## >31575210-31575467 14 12
## >24283796-24283936 13 12
## >865245-865502 793_257BP >5:131945721-131945799 1567_78BP
## >128241036-128241347 9 11
## >25168373-25168611 10 10
## >2:25168373-25168611 12 8
## >25161598-25161833 11 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >7:128241036-1282413 15 16
## >78358469-78358619 15 16
## >2:25161598-25161833 10 13
## >7:24283796-24283936 12 13
## >6:31575210-31575467 13 14
## >17:78358469-7835861 14 14
## >31575210-31575467 14 16
## >24283796-24283936 13 13
## >11:1181147-1181217 222_70BP >10649438-10649513 10509_75BP
## >128241036-128241347 11 12
## >25168373-25168611 14 14
## >2:25168373-25168611 9 8
## >25161598-25161833 10 10
## >24283548-24283843 10 10
## >7:24283548-24283843 11 12
## >7:128241036-1282413 15 15
## >78358469-78358619 15 16
## >2:25161598-25161833 14 11
## >7:24283796-24283936 11 14
## >6:31575210-31575467 14 15
## >17:78358469-7835861 13 12
## >31575210-31575467 14 13
## >24283796-24283936 15 14
##
## [[6]]$rowDendrogram
## 'dendrogram' with 2 branches and 20 members total, at height 22.36068
##
## [[6]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 31.36877
##
## [[6]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[6]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[6]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[6]]$layout
## [[6]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[6]]$layout$lhei
## [1] 1.5 4.0
##
## [[6]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[7]]
## [[7]]$rowInd
## [1] 12 13 3 7 14 2 9 5 4 10 18 6 15 1 17 8 11 16
##
## [[7]]$colInd
## [1] 8 3 11 12 14 7 9 5 4 6 2 1 13 10
##
## [[7]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[7]]$carpet
## >131945721-131945786 1053_65BP
## >128241036-128241347 11
## >2:25168373-25168611 12
## >25161598-25161833 12
## >25168373-25168611 13
## >78358469-78358619 11
## >7:128241036-1282413 11
## >24283548-24283843 10
## >7:24283548-24283843 7
## >6:31575210-31575467 10
## >7:24283796-24283936 14
## >2:25161598-25161833 10
## >17:78358469-7835861 11
## >31575210-31575467 9
## >24283796-24283936 10
## >153867168-153867235 102_67BP >4:8288864-8288951 309_87BP
## >128241036-128241347 15 15
## >2:25168373-25168611 12 15
## >25161598-25161833 13 13
## >25168373-25168611 15 14
## >78358469-78358619 12 7
## >7:128241036-1282413 12 5
## >24283548-24283843 10 12
## >7:24283548-24283843 9 11
## >6:31575210-31575467 12 11
## >7:24283796-24283936 14 13
## >2:25161598-25161833 9 12
## >17:78358469-7835861 8 12
## >31575210-31575467 11 11
## >24283796-24283936 12 8
## >8:22055623-22055743 4016_120BP
## >128241036-128241347 14
## >2:25168373-25168611 15
## >25161598-25161833 12
## >25168373-25168611 15
## >78358469-78358619 7
## >7:128241036-1282413 7
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >31575210-31575467 11
## >24283796-24283936 10
## >18611255-18611336 621_81BP >10:6307508-6307583 570_75BP
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >6:31575210-31575467 13 13
## >7:24283796-24283936 12 12
## >2:25161598-25161833 10 10
## >17:78358469-7835861 10 10
## >31575210-31575467 10 10
## >24283796-24283936 12 12
## >Y:12869910-12869975 411_65BP
## >128241036-128241347 17
## >2:25168373-25168611 17
## >25161598-25161833 14
## >25168373-25168611 16
## >78358469-78358619 8
## >7:128241036-1282413 7
## >24283548-24283843 14
## >7:24283548-24283843 14
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >2:25161598-25161833 10
## >17:78358469-7835861 10
## >31575210-31575467 10
## >24283796-24283936 12
## >5:10649438-10649513 11662_75BP >5:865245-865502 938_257BP
## >128241036-128241347 14 11
## >2:25168373-25168611 9 10
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >6:31575210-31575467 13 13
## >7:24283796-24283936 11 14
## >2:25161598-25161833 12 11
## >17:78358469-7835861 13 10
## >31575210-31575467 14 12
## >24283796-24283936 13 12
## >10649438-10649513 11662_75BP >865245-865502 938_257BP
## >128241036-128241347 12 9
## >2:25168373-25168611 8 12
## >25161598-25161833 10 11
## >25168373-25168611 14 10
## >78358469-78358619 16 15
## >7:128241036-1282413 15 15
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 15 13
## >7:24283796-24283936 14 12
## >2:25161598-25161833 11 10
## >17:78358469-7835861 12 14
## >31575210-31575467 13 14
## >24283796-24283936 14 13
## >5:131945721-131945786 1053_65BP
## >128241036-128241347 11
## >2:25168373-25168611 8
## >25161598-25161833 10
## >25168373-25168611 10
## >78358469-78358619 16
## >7:128241036-1282413 16
## >24283548-24283843 10
## >7:24283548-24283843 12
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >31575210-31575467 16
## >24283796-24283936 13
## >22055623-22055743 4016_120BP
## >128241036-128241347 6
## >2:25168373-25168611 10
## >25161598-25161833 9
## >25168373-25168611 9
## >78358469-78358619 10
## >7:128241036-1282413 13
## >24283548-24283843 11
## >7:24283548-24283843 13
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >2:25161598-25161833 11
## >17:78358469-7835861 13
## >31575210-31575467 11
## >24283796-24283936 12
## >1:18611255-18611336 621_81BP >8288864-8288951 309_87BP
## >128241036-128241347 4 6
## >2:25168373-25168611 10 11
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >6:31575210-31575467 12 12
## >7:24283796-24283936 12 11
## >2:25161598-25161833 15 13
## >17:78358469-7835861 14 13
## >31575210-31575467 12 14
## >24283796-24283936 13 14
## >X:153867168-153867235 102_67BP
## >128241036-128241347 8
## >2:25168373-25168611 9
## >25161598-25161833 11
## >25168373-25168611 10
## >78358469-78358619 12
## >7:128241036-1282413 13
## >24283548-24283843 8
## >7:24283548-24283843 11
## >6:31575210-31575467 12
## >7:24283796-24283936 12
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >31575210-31575467 12
## >24283796-24283936 11
## >12869910-12869975 411_65BP >6307508-6307583 570_75BP
## >128241036-128241347 7 7
## >2:25168373-25168611 10 10
## >25161598-25161833 12 12
## >25168373-25168611 11 11
## >78358469-78358619 14 14
## >7:128241036-1282413 16 16
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 10 10
## >7:24283796-24283936 12 12
## >2:25161598-25161833 15 15
## >17:78358469-7835861 11 11
## >31575210-31575467 13 13
## >24283796-24283936 13 13
##
## [[7]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[7]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 31.54362
##
## [[7]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[7]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[7]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[7]]$layout
## [[7]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[7]]$layout$lhei
## [1] 1.5 4.0
##
## [[7]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[8]]
## [[8]]$rowInd
## [1] 7 12 4 5 9 2 13 15 6 10 18 8 14 11 3 16 1 17
##
## [[8]]$colInd
## [1] 8 3 9 5 11 12 14 7 2 6 4 1 10 13
##
## [[8]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[8]]$carpet
## >5:10649438-10649513 9805_75BP
## >128241036-128241347 14
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 15
## >25168373-25168611 16
## >78358469-78358619 13
## >7:128241036-1282413 13
## >2:25161598-25161833 12
## >7:24283796-24283936 11
## >6:31575210-31575467 13
## >17:78358469-7835861 13
## >24283796-24283936 13
## >31575210-31575467 14
## >14989690-14989869 180_179BP >17:4550782-4550844 300_62BP
## >128241036-128241347 12 11
## >2:25168373-25168611 12 10
## >24283548-24283843 10 11
## >7:24283548-24283843 12 11
## >25161598-25161833 11 13
## >25168373-25168611 13 12
## >78358469-78358619 8 10
## >7:128241036-1282413 10 10
## >2:25161598-25161833 11 15
## >7:24283796-24283936 11 14
## >6:31575210-31575467 10 10
## >17:78358469-7835861 12 13
## >24283796-24283936 12 10
## >31575210-31575467 13 13
## >4:8288864-8288951 3404_87BP
## >128241036-128241347 15
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 13
## >25168373-25168611 14
## >78358469-78358619 7
## >7:128241036-1282413 5
## >2:25161598-25161833 12
## >7:24283796-24283936 13
## >6:31575210-31575467 11
## >17:78358469-7835861 12
## >24283796-24283936 8
## >31575210-31575467 11
## >8:22055623-22055743 3942_120BP
## >128241036-128241347 14
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 12
## >25168373-25168611 15
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >17:78358469-7835861 12
## >24283796-24283936 10
## >31575210-31575467 11
## >10:6307508-6307583 421_75BP >18611255-18611336 726_81BP
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >17:78358469-7835861 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >4550782-4550844 300_62BP >5:865245-865502 2419_257BP
## >128241036-128241347 12 11
## >2:25168373-25168611 11 10
## >24283548-24283843 12 12
## >7:24283548-24283843 10 13
## >25161598-25161833 9 11
## >25168373-25168611 11 13
## >78358469-78358619 15 14
## >7:128241036-1282413 17 14
## >2:25161598-25161833 15 11
## >7:24283796-24283936 14 14
## >6:31575210-31575467 17 13
## >17:78358469-7835861 17 10
## >24283796-24283936 14 12
## >31575210-31575467 14 12
## >10649438-10649513 9805_75BP >865245-865502 2419_257BP
## >128241036-128241347 12 9
## >2:25168373-25168611 8 12
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >25161598-25161833 10 11
## >25168373-25168611 14 10
## >78358469-78358619 16 15
## >7:128241036-1282413 15 15
## >2:25161598-25161833 11 10
## >7:24283796-24283936 14 12
## >6:31575210-31575467 15 13
## >17:78358469-7835861 12 14
## >24283796-24283936 14 13
## >31575210-31575467 13 14
## >5:131945721-131945799 1392_78BP
## >128241036-128241347 11
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >25161598-25161833 10
## >25168373-25168611 10
## >78358469-78358619 16
## >7:128241036-1282413 16
## >2:25161598-25161833 13
## >7:24283796-24283936 13
## >6:31575210-31575467 14
## >17:78358469-7835861 14
## >24283796-24283936 13
## >31575210-31575467 16
## >22055623-22055743 3942_120BP
## >128241036-128241347 6
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >25161598-25161833 9
## >25168373-25168611 9
## >78358469-78358619 10
## >7:128241036-1282413 13
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >17:78358469-7835861 13
## >24283796-24283936 12
## >31575210-31575467 11
## >131945721-131945799 1392_78BP
## >128241036-128241347 11
## >2:25168373-25168611 11
## >24283548-24283843 12
## >7:24283548-24283843 10
## >25161598-25161833 10
## >25168373-25168611 11
## >78358469-78358619 12
## >7:128241036-1282413 12
## >2:25161598-25161833 12
## >7:24283796-24283936 10
## >6:31575210-31575467 12
## >17:78358469-7835861 11
## >24283796-24283936 10
## >31575210-31575467 11
## >16:14989690-14989869 180_179BP >6307508-6307583 421_75BP
## >128241036-128241347 9 7
## >2:25168373-25168611 12 10
## >24283548-24283843 12 10
## >7:24283548-24283843 10 12
## >25161598-25161833 9 12
## >25168373-25168611 10 11
## >78358469-78358619 13 14
## >7:128241036-1282413 11 16
## >2:25161598-25161833 9 15
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 10
## >17:78358469-7835861 14 11
## >24283796-24283936 12 13
## >31575210-31575467 10 13
## >1:18611255-18611336 726_81BP >8288864-8288951 3404_87BP
## >128241036-128241347 4 6
## >2:25168373-25168611 10 11
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >2:25161598-25161833 15 13
## >7:24283796-24283936 12 11
## >6:31575210-31575467 12 12
## >17:78358469-7835861 14 13
## >24283796-24283936 13 14
## >31575210-31575467 12 14
##
## [[8]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[8]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 28.5482
##
## [[8]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[8]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[8]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[8]]$layout
## [[8]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[8]]$layout$lhei
## [1] 1.5 4.0
##
## [[8]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[9]]
## [[9]]$rowInd
## [1] 2 7 1 5 8 9 4 3 6 10
##
## [[9]]$colInd
## [1] 14 7 9 5 10 13 2 1 3 8 11 12 4 6
##
## [[9]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[9]]$carpet
## >5:865252-865490 133_238BP >131945721-131945786 510_65BP
## >78358469-78358619 10 11
## >7:128241036-1282413 10 11
## >24283548-24283843 9 10
## >7:24283548-24283843 11 7
## >24283796-24283936 10 10
## >31575210-31575467 9 9
## >2:25161598-25161833 11 10
## >17:78358469-7835861 13 11
## >2:25168373-25168611 9 12
## >128241036-128241347 12 11
## >25161598-25161833 12 12
## >25168373-25168611 10 13
## >6:31575210-31575467 11 10
## >7:24283796-24283936 13 14
## >4:8288864-8288951 3435_87BP
## >78358469-78358619 7
## >7:128241036-1282413 5
## >24283548-24283843 12
## >7:24283548-24283843 11
## >24283796-24283936 8
## >31575210-31575467 11
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >2:25168373-25168611 15
## >128241036-128241347 15
## >25161598-25161833 13
## >25168373-25168611 14
## >6:31575210-31575467 11
## >7:24283796-24283936 13
## >8:22055623-22055743 1924_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >24283548-24283843 12
## >7:24283548-24283843 11
## >24283796-24283936 10
## >31575210-31575467 11
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25161598-25161833 12
## >25168373-25168611 15
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >22055623-22055743 1924_120BP >8288864-8288951 3435_87BP
## >78358469-78358619 10 15
## >7:128241036-1282413 13 16
## >24283548-24283843 11 11
## >7:24283548-24283843 13 9
## >24283796-24283936 12 14
## >31575210-31575467 11 14
## >2:25161598-25161833 11 13
## >17:78358469-7835861 13 13
## >2:25168373-25168611 10 11
## >128241036-128241347 6 6
## >25161598-25161833 9 12
## >25168373-25168611 9 11
## >6:31575210-31575467 8 12
## >7:24283796-24283936 10 11
## >5:131945721-131945786 510_65BP
## >78358469-78358619 16
## >7:128241036-1282413 16
## >24283548-24283843 10
## >7:24283548-24283843 12
## >24283796-24283936 13
## >31575210-31575467 16
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >2:25168373-25168611 8
## >128241036-128241347 11
## >25161598-25161833 10
## >25168373-25168611 10
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >5:10649438-10649513 12054_75BP
## >78358469-78358619 13
## >7:128241036-1282413 13
## >24283548-24283843 10
## >7:24283548-24283843 11
## >24283796-24283936 13
## >31575210-31575467 14
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >2:25168373-25168611 9
## >128241036-128241347 14
## >25161598-25161833 15
## >25168373-25168611 16
## >6:31575210-31575467 13
## >7:24283796-24283936 11
## >10649438-10649513 12054_75BP >865252-865490 133_238BP
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >24283548-24283843 10 12
## >7:24283548-24283843 12 11
## >24283796-24283936 14 13
## >31575210-31575467 13 13
## >2:25161598-25161833 11 11
## >17:78358469-7835861 12 12
## >2:25168373-25168611 8 9
## >128241036-128241347 12 14
## >25161598-25161833 10 11
## >25168373-25168611 14 16
## >6:31575210-31575467 15 15
## >7:24283796-24283936 14 15
##
## [[9]]$rowDendrogram
## 'dendrogram' with 2 branches and 10 members total, at height 19
##
## [[9]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 19.44222
##
## [[9]]$breaks
## [1] 5.00 5.22 5.44 5.66 5.88 6.10 6.32 6.54 6.76 6.98 7.20 7.42
## [13] 7.64 7.86 8.08 8.30 8.52 8.74 8.96 9.18 9.40 9.62 9.84 10.06
## [25] 10.28 10.50 10.72 10.94 11.16 11.38 11.60 11.82 12.04 12.26 12.48 12.70
## [37] 12.92 13.14 13.36 13.58 13.80 14.02 14.24 14.46 14.68 14.90 15.12 15.34
## [49] 15.56 15.78 16.00
##
## [[9]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[9]]$colorTable
## low high color
## 1 5.00 5.22 #FF0000
## 2 5.22 5.44 #FF0505
## 3 5.44 5.66 #FF0A0A
## 4 5.66 5.88 #FF0F0F
## 5 5.88 6.10 #FF1414
## 6 6.10 6.32 #FF1A1A
## 7 6.32 6.54 #FF1F1F
## 8 6.54 6.76 #FF2424
## 9 6.76 6.98 #FF2929
## 10 6.98 7.20 #FF2E2E
## 11 7.20 7.42 #FF3434
## 12 7.42 7.64 #FF3939
## 13 7.64 7.86 #FF3E3E
## 14 7.86 8.08 #FF4343
## 15 8.08 8.30 #FF4848
## 16 8.30 8.52 #FF4E4E
## 17 8.52 8.74 #FF5353
## 18 8.74 8.96 #FF5858
## 19 8.96 9.18 #FF5D5D
## 20 9.18 9.40 #FF6262
## 21 9.40 9.62 #FF6868
## 22 9.62 9.84 #FF6D6D
## 23 9.84 10.06 #FF7272
## 24 10.06 10.28 #FF7777
## 25 10.28 10.50 #FF7C7C
## 26 10.50 10.72 #FF8282
## 27 10.72 10.94 #FF8787
## 28 10.94 11.16 #FF8C8C
## 29 11.16 11.38 #FF9191
## 30 11.38 11.60 #FF9696
## 31 11.60 11.82 #FF9C9C
## 32 11.82 12.04 #FFA1A1
## 33 12.04 12.26 #FFA6A6
## 34 12.26 12.48 #FFABAB
## 35 12.48 12.70 #FFB0B0
## 36 12.70 12.92 #FFB6B6
## 37 12.92 13.14 #FFBBBB
## 38 13.14 13.36 #FFC0C0
## 39 13.36 13.58 #FFC5C5
## 40 13.58 13.80 #FFCACA
## 41 13.80 14.02 #FFD0D0
## 42 14.02 14.24 #FFD5D5
## 43 14.24 14.46 #FFDADA
## 44 14.46 14.68 #FFDFDF
## 45 14.68 14.90 #FFE4E4
## 46 14.90 15.12 #FFEAEA
## 47 15.12 15.34 #FFEFEF
## 48 15.34 15.56 #FFF4F4
## 49 15.56 15.78 #FFF9F9
## 50 15.78 16.00 #FFFFFF
##
## [[9]]$layout
## [[9]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[9]]$layout$lhei
## [1] 1.5 4.0
##
## [[9]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[10]]
## [[10]]$rowInd
## [1] 13 5 9 15 2 10 8 14 7 6 11 1 19 12 18 16 4 17 3 20
##
## [[10]]$colInd
## [1] 14 7 2 10 13 1 8 3 11 12 9 5 6 4
##
## [[10]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[10]]$carpet
## >131945721-131945786 536_65BP >4:8288864-8288951 1958_87BP
## >78358469-78358619 11 7
## >7:128241036-1282413 11 5
## >2:25161598-25161833 10 12
## >24283796-24283936 10 8
## >31575210-31575467 9 11
## >17:78358469-7835861 11 12
## >128241036-128241347 11 15
## >2:25168373-25168611 12 15
## >25161598-25161833 12 13
## >25168373-25168611 13 14
## >24283548-24283843 10 12
## >7:24283548-24283843 7 11
## >7:24283796-24283936 14 13
## >6:31575210-31575467 10 11
## >8:22055623-22055743 2302_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >128241036-128241347 14
## >2:25168373-25168611 15
## >25161598-25161833 12
## >25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >18611255-18611336 335_81BP >10:6307522-6307583 121_61BP
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >Y:12869910-12869975 127_65BP
## >78358469-78358619 8
## >7:128241036-1282413 7
## >2:25161598-25161833 10
## >24283796-24283936 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >128241036-128241347 17
## >2:25168373-25168611 17
## >25161598-25161833 14
## >25168373-25168611 16
## >24283548-24283843 14
## >7:24283548-24283843 14
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >5:131945721-131945786 536_65BP
## >78358469-78358619 16
## >7:128241036-1282413 16
## >2:25161598-25161833 13
## >24283796-24283936 13
## >31575210-31575467 16
## >17:78358469-7835861 14
## >128241036-128241347 11
## >2:25168373-25168611 8
## >25161598-25161833 10
## >25168373-25168611 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >7:24283796-24283936 13
## >6:31575210-31575467 14
## >14989629-14989930 302_301BP
## >78358469-78358619 15
## >7:128241036-1282413 17
## >2:25161598-25161833 14
## >24283796-24283936 15
## >31575210-31575467 15
## >17:78358469-7835861 16
## >128241036-128241347 11
## >2:25168373-25168611 8
## >25161598-25161833 10
## >25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 12
## >7:24283796-24283936 11
## >6:31575210-31575467 15
## >5:10649438-10649513 6016_75BP >5:865245-865502 2675_257BP
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >2:25161598-25161833 12 11
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >128241036-128241347 14 11
## >2:25168373-25168611 9 10
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >7:24283796-24283936 11 14
## >6:31575210-31575467 13 13
## >10649438-10649513 6016_75BP >1:18611255-18611336 335_81BP
## >78358469-78358619 16 16
## >7:128241036-1282413 15 15
## >2:25161598-25161833 11 15
## >24283796-24283936 14 13
## >31575210-31575467 13 12
## >17:78358469-7835861 12 14
## >128241036-128241347 12 4
## >2:25168373-25168611 8 10
## >25161598-25161833 10 11
## >25168373-25168611 14 8
## >24283548-24283843 10 11
## >7:24283548-24283843 12 9
## >7:24283796-24283936 14 12
## >6:31575210-31575467 15 12
## >8288864-8288951 1958_87BP >12869910-12869975 127_65BP
## >78358469-78358619 15 14
## >7:128241036-1282413 16 16
## >2:25161598-25161833 13 15
## >24283796-24283936 14 13
## >31575210-31575467 14 13
## >17:78358469-7835861 13 11
## >128241036-128241347 6 7
## >2:25168373-25168611 11 10
## >25161598-25161833 12 12
## >25168373-25168611 11 11
## >24283548-24283843 11 10
## >7:24283548-24283843 9 12
## >7:24283796-24283936 11 12
## >6:31575210-31575467 12 10
## >6307522-6307583 121_61BP >22055623-22055743 2302_120BP
## >78358469-78358619 14 10
## >7:128241036-1282413 16 13
## >2:25161598-25161833 15 11
## >24283796-24283936 13 12
## >31575210-31575467 13 11
## >17:78358469-7835861 11 13
## >128241036-128241347 7 6
## >2:25168373-25168611 10 10
## >25161598-25161833 12 9
## >25168373-25168611 11 9
## >24283548-24283843 10 11
## >7:24283548-24283843 12 13
## >7:24283796-24283936 12 10
## >6:31575210-31575467 10 8
## >22:29788944-29789092 197_148BP
## >78358469-78358619 12
## >7:128241036-1282413 14
## >2:25161598-25161833 11
## >24283796-24283936 13
## >31575210-31575467 11
## >17:78358469-7835861 12
## >128241036-128241347 11
## >2:25168373-25168611 11
## >25161598-25161833 8
## >25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >7:24283796-24283936 10
## >6:31575210-31575467 14
## >29788944-29789092 197_148BP
## >78358469-78358619 11
## >7:128241036-1282413 13
## >2:25161598-25161833 15
## >24283796-24283936 11
## >31575210-31575467 11
## >17:78358469-7835861 13
## >128241036-128241347 10
## >2:25168373-25168611 11
## >25161598-25161833 10
## >25168373-25168611 8
## >24283548-24283843 11
## >7:24283548-24283843 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >16:14989629-14989930 302_301BP >865245-865502 2675_257BP
## >78358469-78358619 14 15
## >7:128241036-1282413 14 15
## >2:25161598-25161833 12 10
## >24283796-24283936 14 13
## >31575210-31575467 13 14
## >17:78358469-7835861 14 14
## >128241036-128241347 7 9
## >2:25168373-25168611 12 12
## >25161598-25161833 10 11
## >25168373-25168611 9 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >7:24283796-24283936 13 12
## >6:31575210-31575467 12 13
##
## [[10]]$rowDendrogram
## 'dendrogram' with 2 branches and 20 members total, at height 22.36068
##
## [[10]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 32.61901
##
## [[10]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[10]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[10]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[10]]$layout
## [[10]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[10]]$layout$lhei
## [1] 1.5 4.0
##
## [[10]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[11]]
## [[11]]$rowInd
## [1] 9 8 12 22 17 1 21 20 10 16 2 5 4 3 15 19 7 11 18 14 6 13
##
## [[11]]$colInd
## [1] 3 9 5 11 8 12 14 7 10 13 4 6 2 1
##
## [[11]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[11]]$carpet
## >5:10649438-10649513 11258_75BP
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 15
## >128241036-128241347 14
## >25168373-25168611 16
## >78358469-78358619 13
## >7:128241036-1282413 13
## >24283796-24283936 13
## >31575210-31575467 14
## >6:31575210-31575467 13
## >7:24283796-24283936 11
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >5:865245-865502 3139_257BP >10649438-10649513 11258_75BP
## >2:25168373-25168611 10 8
## >24283548-24283843 12 10
## >7:24283548-24283843 13 12
## >25161598-25161833 11 10
## >128241036-128241347 11 12
## >25168373-25168611 13 14
## >78358469-78358619 14 16
## >7:128241036-1282413 14 15
## >24283796-24283936 12 14
## >31575210-31575467 12 13
## >6:31575210-31575467 13 15
## >7:24283796-24283936 14 14
## >2:25161598-25161833 11 11
## >17:78358469-7835861 10 12
## >95526518-95526601 111_83BP >4550782-4550844 138_62BP
## >2:25168373-25168611 9 11
## >24283548-24283843 11 12
## >7:24283548-24283843 13 10
## >25161598-25161833 10 9
## >128241036-128241347 12 12
## >25168373-25168611 13 11
## >78358469-78358619 18 15
## >7:128241036-1282413 16 17
## >24283796-24283936 16 14
## >31575210-31575467 14 14
## >6:31575210-31575467 16 17
## >7:24283796-24283936 14 14
## >2:25161598-25161833 11 15
## >17:78358469-7835861 13 17
## >11:115173455-115173532 313_77BP >865245-865502 3139_257BP
## >2:25168373-25168611 11 12
## >24283548-24283843 11 10
## >7:24283548-24283843 9 12
## >25161598-25161833 9 11
## >128241036-128241347 7 9
## >25168373-25168611 9 10
## >78358469-78358619 13 15
## >7:128241036-1282413 16 15
## >24283796-24283936 13 13
## >31575210-31575467 14 14
## >6:31575210-31575467 14 13
## >7:24283796-24283936 15 12
## >2:25161598-25161833 13 10
## >17:78358469-7835861 15 14
## >8288864-8288955 4024_91BP
## >2:25168373-25168611 9
## >24283548-24283843 9
## >7:24283548-24283843 10
## >25161598-25161833 10
## >128241036-128241347 8
## >25168373-25168611 9
## >78358469-78358619 16
## >7:128241036-1282413 16
## >24283796-24283936 14
## >31575210-31575467 13
## >6:31575210-31575467 13
## >7:24283796-24283936 13
## >2:25161598-25161833 13
## >17:78358469-7835861 13
## >5:131945721-131945786 1376_65BP
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >25161598-25161833 10
## >128241036-128241347 11
## >25168373-25168611 10
## >78358469-78358619 16
## >7:128241036-1282413 16
## >24283796-24283936 13
## >31575210-31575467 16
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >22055623-22055743 4129_120BP
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >25161598-25161833 9
## >128241036-128241347 6
## >25168373-25168611 9
## >78358469-78358619 10
## >7:128241036-1282413 13
## >24283796-24283936 12
## >31575210-31575467 11
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >2:25161598-25161833 11
## >17:78358469-7835861 13
## >13:69077731-69077797 210_66BP
## >2:25168373-25168611 14
## >24283548-24283843 11
## >7:24283548-24283843 12
## >25161598-25161833 11
## >128241036-128241347 11
## >25168373-25168611 10
## >78358469-78358619 10
## >7:128241036-1282413 11
## >24283796-24283936 10
## >31575210-31575467 9
## >6:31575210-31575467 10
## >7:24283796-24283936 13
## >2:25161598-25161833 14
## >17:78358469-7835861 14
## >17:4550782-4550844 138_62BP
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 11
## >25161598-25161833 13
## >128241036-128241347 11
## >25168373-25168611 12
## >78358469-78358619 10
## >7:128241036-1282413 10
## >24283796-24283936 10
## >31575210-31575467 13
## >6:31575210-31575467 10
## >7:24283796-24283936 14
## >2:25161598-25161833 15
## >17:78358469-7835861 13
## >16:66767740-66767838 201_98BP
## >2:25168373-25168611 12
## >24283548-24283843 8
## >7:24283548-24283843 11
## >25161598-25161833 12
## >128241036-128241347 12
## >25168373-25168611 11
## >78358469-78358619 6
## >7:128241036-1282413 11
## >24283796-24283936 11
## >31575210-31575467 9
## >6:31575210-31575467 11
## >7:24283796-24283936 9
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >16:14989689-14989870 197_181BP
## >2:25168373-25168611 13
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 10
## >128241036-128241347 9
## >25168373-25168611 10
## >78358469-78358619 11
## >7:128241036-1282413 10
## >24283796-24283936 10
## >31575210-31575467 12
## >6:31575210-31575467 12
## >7:24283796-24283936 11
## >2:25161598-25161833 10
## >17:78358469-7835861 12
## >14989689-14989870 197_181BP >69077731-69077797 210_66BP
## >2:25168373-25168611 13 15
## >24283548-24283843 10 12
## >7:24283548-24283843 11 15
## >25161598-25161833 9 12
## >128241036-128241347 13 14
## >25168373-25168611 12 13
## >78358469-78358619 9 9
## >7:128241036-1282413 10 10
## >24283796-24283936 13 11
## >31575210-31575467 11 9
## >6:31575210-31575467 11 10
## >7:24283796-24283936 10 10
## >2:25161598-25161833 10 12
## >17:78358469-7835861 13 9
## >4:8288864-8288955 4024_91BP
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 13
## >128241036-128241347 15
## >25168373-25168611 14
## >78358469-78358619 7
## >7:128241036-1282413 5
## >24283796-24283936 8
## >31575210-31575467 11
## >6:31575210-31575467 11
## >7:24283796-24283936 13
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >8:22055623-22055743 4129_120BP
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 12
## >128241036-128241347 14
## >25168373-25168611 15
## >78358469-78358619 7
## >7:128241036-1282413 7
## >24283796-24283936 10
## >31575210-31575467 11
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >66767740-66767838 201_98BP >131945721-131945786 1376_65BP
## >2:25168373-25168611 11 12
## >24283548-24283843 8 10
## >7:24283548-24283843 10 7
## >25161598-25161833 14 12
## >128241036-128241347 13 11
## >25168373-25168611 14 13
## >78358469-78358619 14 11
## >7:128241036-1282413 8 11
## >24283796-24283936 9 10
## >31575210-31575467 11 9
## >6:31575210-31575467 13 10
## >7:24283796-24283936 12 14
## >2:25161598-25161833 11 10
## >17:78358469-7835861 10 11
## >2:95526518-95526601 111_83BP
## >2:25168373-25168611 8
## >24283548-24283843 8
## >7:24283548-24283843 7
## >25161598-25161833 12
## >128241036-128241347 9
## >25168373-25168611 13
## >78358469-78358619 13
## >7:128241036-1282413 11
## >24283796-24283936 10
## >31575210-31575467 11
## >6:31575210-31575467 10
## >7:24283796-24283936 13
## >2:25161598-25161833 10
## >17:78358469-7835861 13
## >115173455-115173532 313_77BP
## >2:25168373-25168611 8
## >24283548-24283843 9
## >7:24283548-24283843 9
## >25161598-25161833 12
## >128241036-128241347 11
## >25168373-25168611 12
## >78358469-78358619 12
## >7:128241036-1282413 13
## >24283796-24283936 11
## >31575210-31575467 12
## >6:31575210-31575467 11
## >7:24283796-24283936 11
## >2:25161598-25161833 12
## >17:78358469-7835861 12
##
## [[11]]$rowDendrogram
## 'dendrogram' with 2 branches and 22 members total, at height 20.07486
##
## [[11]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 24.61707
##
## [[11]]$breaks
## [1] 5.00 5.26 5.52 5.78 6.04 6.30 6.56 6.82 7.08 7.34 7.60 7.86
## [13] 8.12 8.38 8.64 8.90 9.16 9.42 9.68 9.94 10.20 10.46 10.72 10.98
## [25] 11.24 11.50 11.76 12.02 12.28 12.54 12.80 13.06 13.32 13.58 13.84 14.10
## [37] 14.36 14.62 14.88 15.14 15.40 15.66 15.92 16.18 16.44 16.70 16.96 17.22
## [49] 17.48 17.74 18.00
##
## [[11]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[11]]$colorTable
## low high color
## 1 5.00 5.26 #FF0000
## 2 5.26 5.52 #FF0505
## 3 5.52 5.78 #FF0A0A
## 4 5.78 6.04 #FF0F0F
## 5 6.04 6.30 #FF1414
## 6 6.30 6.56 #FF1A1A
## 7 6.56 6.82 #FF1F1F
## 8 6.82 7.08 #FF2424
## 9 7.08 7.34 #FF2929
## 10 7.34 7.60 #FF2E2E
## 11 7.60 7.86 #FF3434
## 12 7.86 8.12 #FF3939
## 13 8.12 8.38 #FF3E3E
## 14 8.38 8.64 #FF4343
## 15 8.64 8.90 #FF4848
## 16 8.90 9.16 #FF4E4E
## 17 9.16 9.42 #FF5353
## 18 9.42 9.68 #FF5858
## 19 9.68 9.94 #FF5D5D
## 20 9.94 10.20 #FF6262
## 21 10.20 10.46 #FF6868
## 22 10.46 10.72 #FF6D6D
## 23 10.72 10.98 #FF7272
## 24 10.98 11.24 #FF7777
## 25 11.24 11.50 #FF7C7C
## 26 11.50 11.76 #FF8282
## 27 11.76 12.02 #FF8787
## 28 12.02 12.28 #FF8C8C
## 29 12.28 12.54 #FF9191
## 30 12.54 12.80 #FF9696
## 31 12.80 13.06 #FF9C9C
## 32 13.06 13.32 #FFA1A1
## 33 13.32 13.58 #FFA6A6
## 34 13.58 13.84 #FFABAB
## 35 13.84 14.10 #FFB0B0
## 36 14.10 14.36 #FFB6B6
## 37 14.36 14.62 #FFBBBB
## 38 14.62 14.88 #FFC0C0
## 39 14.88 15.14 #FFC5C5
## 40 15.14 15.40 #FFCACA
## 41 15.40 15.66 #FFD0D0
## 42 15.66 15.92 #FFD5D5
## 43 15.92 16.18 #FFDADA
## 44 16.18 16.44 #FFDFDF
## 45 16.44 16.70 #FFE4E4
## 46 16.70 16.96 #FFEAEA
## 47 16.96 17.22 #FFEFEF
## 48 17.22 17.48 #FFF4F4
## 49 17.48 17.74 #FFF9F9
## 50 17.74 18.00 #FFFFFF
##
## [[11]]$layout
## [[11]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[11]]$layout$lhei
## [1] 1.5 4.0
##
## [[11]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[12]]
## [[12]]$rowInd
## [1] 4 13 6 10 19 2 12 20 16 11 5 17 1 23 3 15 21 22 8 24 9 7 18 14
##
## [[12]]$colInd
## [1] 8 9 5 3 11 12 7 14 6 4 2 1 10 13
##
## [[12]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[12]]$carpet
## >12:7913634-7913754 229_120BP
## >128241036-128241347 15
## >24283548-24283843 11
## >7:24283548-24283843 10
## >2:25168373-25168611 14
## >25161598-25161833 15
## >25168373-25168611 13
## >7:128241036-1282413 10
## >78358469-78358619 10
## >7:24283796-24283936 15
## >6:31575210-31575467 13
## >2:25161598-25161833 14
## >17:78358469-7835861 10
## >24283796-24283936 10
## >31575210-31575467 11
## >100122122-100122193 203_71BP >4:8288864-8288951 418_87BP
## >128241036-128241347 16 15
## >24283548-24283843 12 12
## >7:24283548-24283843 12 11
## >2:25168373-25168611 16 15
## >25161598-25161833 16 13
## >25168373-25168611 15 14
## >7:128241036-1282413 7 5
## >78358469-78358619 11 7
## >7:24283796-24283936 15 13
## >6:31575210-31575467 14 11
## >2:25161598-25161833 12 12
## >17:78358469-7835861 10 12
## >24283796-24283936 11 8
## >31575210-31575467 12 11
## >8:22055623-22055743 4618_120BP
## >128241036-128241347 14
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25168373-25168611 15
## >25161598-25161833 12
## >25168373-25168611 15
## >7:128241036-1282413 7
## >78358469-78358619 7
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 10
## >31575210-31575467 11
## >18611255-18611336 555_81BP >10:6307518-6307583 399_65BP
## >128241036-128241347 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >2:25168373-25168611 17 17
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >7:128241036-1282413 7 7
## >78358469-78358619 8 8
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >2:25161598-25161833 10 10
## >17:78358469-7835861 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >Y:12869905-12869975 508_70BP
## >128241036-128241347 17
## >24283548-24283843 14
## >7:24283548-24283843 14
## >2:25168373-25168611 17
## >25161598-25161833 14
## >25168373-25168611 16
## >7:128241036-1282413 7
## >78358469-78358619 8
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >2:25161598-25161833 10
## >17:78358469-7835861 10
## >24283796-24283936 12
## >31575210-31575467 10
## >22055623-22055743 4618_120BP
## >128241036-128241347 6
## >24283548-24283843 11
## >7:24283548-24283843 13
## >2:25168373-25168611 10
## >25161598-25161833 9
## >25168373-25168611 9
## >7:128241036-1282413 13
## >78358469-78358619 10
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >2:25161598-25161833 11
## >17:78358469-7835861 13
## >24283796-24283936 12
## >31575210-31575467 11
## >129284232-129284318 533_86BP
## >128241036-128241347 11
## >24283548-24283843 13
## >7:24283548-24283843 16
## >2:25168373-25168611 14
## >25161598-25161833 11
## >25168373-25168611 11
## >7:128241036-1282413 14
## >78358469-78358619 9
## >7:24283796-24283936 9
## >6:31575210-31575467 8
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >24283796-24283936 13
## >31575210-31575467 11
## >9:129284232-129284318 533_86BP
## >128241036-128241347 12
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25168373-25168611 14
## >25161598-25161833 11
## >25168373-25168611 12
## >7:128241036-1282413 10
## >78358469-78358619 9
## >7:24283796-24283936 11
## >6:31575210-31575467 15
## >2:25161598-25161833 11
## >17:78358469-7835861 11
## >24283796-24283936 10
## >31575210-31575467 8
## >3:14555195-14555262 136_67BP
## >128241036-128241347 11
## >24283548-24283843 8
## >7:24283548-24283843 10
## >2:25168373-25168611 13
## >25161598-25161833 9
## >25168373-25168611 12
## >7:128241036-1282413 11
## >78358469-78358619 10
## >7:24283796-24283936 8
## >6:31575210-31575467 13
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >24283796-24283936 10
## >31575210-31575467 10
## >131945721-131945799 2815_78BP
## >128241036-128241347 11
## >24283548-24283843 12
## >7:24283548-24283843 10
## >2:25168373-25168611 11
## >25161598-25161833 10
## >25168373-25168611 11
## >7:128241036-1282413 12
## >78358469-78358619 12
## >7:24283796-24283936 10
## >6:31575210-31575467 12
## >2:25161598-25161833 12
## >17:78358469-7835861 11
## >24283796-24283936 10
## >31575210-31575467 11
## >1:18611255-18611336 555_81BP >8288864-8288951 418_87BP
## >128241036-128241347 4 6
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >2:25168373-25168611 10 11
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >7:24283796-24283936 12 11
## >6:31575210-31575467 12 12
## >2:25161598-25161833 15 13
## >17:78358469-7835861 14 13
## >24283796-24283936 13 14
## >31575210-31575467 12 14
## >10:100122122-100122193 203_71BP
## >128241036-128241347 7
## >24283548-24283843 11
## >7:24283548-24283843 11
## >2:25168373-25168611 9
## >25161598-25161833 12
## >25168373-25168611 11
## >7:128241036-1282413 15
## >78358469-78358619 16
## >7:24283796-24283936 11
## >6:31575210-31575467 10
## >2:25161598-25161833 15
## >17:78358469-7835861 12
## >24283796-24283936 14
## >31575210-31575467 13
## >12869905-12869975 508_70BP >6307518-6307583 399_65BP
## >128241036-128241347 7 7
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >2:25168373-25168611 10 10
## >25161598-25161833 12 12
## >25168373-25168611 11 11
## >7:128241036-1282413 16 16
## >78358469-78358619 14 14
## >7:24283796-24283936 12 12
## >6:31575210-31575467 10 10
## >2:25161598-25161833 15 15
## >17:78358469-7835861 11 11
## >24283796-24283936 13 13
## >31575210-31575467 13 13
## >7913634-7913754 229_120BP >5:10649438-10649513 12873_75BP
## >128241036-128241347 12 14
## >24283548-24283843 9 10
## >7:24283548-24283843 9 11
## >2:25168373-25168611 9 9
## >25161598-25161833 13 15
## >25168373-25168611 13 16
## >7:128241036-1282413 9 13
## >78358469-78358619 13 13
## >7:24283796-24283936 12 11
## >6:31575210-31575467 14 13
## >2:25161598-25161833 13 12
## >17:78358469-7835861 12 13
## >24283796-24283936 9 13
## >31575210-31575467 11 14
## >865245-865502 1057_257BP >5:131945721-131945799 2815_78BP
## >128241036-128241347 9 11
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >2:25168373-25168611 12 8
## >25161598-25161833 11 10
## >25168373-25168611 10 10
## >7:128241036-1282413 15 16
## >78358469-78358619 15 16
## >7:24283796-24283936 12 13
## >6:31575210-31575467 13 14
## >2:25161598-25161833 10 13
## >17:78358469-7835861 14 14
## >24283796-24283936 13 13
## >31575210-31575467 14 16
## >5:865245-865502 1057_257BP >14555195-14555262 136_67BP
## >128241036-128241347 11 13
## >24283548-24283843 12 10
## >7:24283548-24283843 13 11
## >2:25168373-25168611 10 9
## >25161598-25161833 11 10
## >25168373-25168611 13 13
## >7:128241036-1282413 14 14
## >78358469-78358619 14 14
## >7:24283796-24283936 14 13
## >6:31575210-31575467 13 16
## >2:25161598-25161833 11 11
## >17:78358469-7835861 10 12
## >24283796-24283936 12 13
## >31575210-31575467 12 13
## >10649438-10649513 12873_75BP
## >128241036-128241347 12
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25168373-25168611 8
## >25161598-25161833 10
## >25168373-25168611 14
## >7:128241036-1282413 15
## >78358469-78358619 16
## >7:24283796-24283936 14
## >6:31575210-31575467 15
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 14
## >31575210-31575467 13
##
## [[12]]$rowDendrogram
## 'dendrogram' with 2 branches and 24 members total, at height 22.36068
##
## [[12]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 33.98529
##
## [[12]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[12]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[12]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[12]]$layout
## [[12]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[12]]$layout$lhei
## [1] 1.5 4.0
##
## [[12]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[13]]
## [[13]]$rowInd
## [1] 9 3 7 13 5 10 6 8 11 2 4 1 12 14
##
## [[13]]$colInd
## [1] 8 12 3 11 9 5 14 7 6 4 10 2 13 1
##
## [[13]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[13]]$carpet
## >131945721-131945786 143_65BP
## >128241036-128241347 11
## >25168373-25168611 13
## >2:25168373-25168611 12
## >25161598-25161833 12
## >24283548-24283843 10
## >7:24283548-24283843 7
## >78358469-78358619 11
## >7:128241036-1282413 11
## >7:24283796-24283936 14
## >6:31575210-31575467 10
## >24283796-24283936 10
## >2:25161598-25161833 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >4:8288864-8288967 1632_103BP
## >128241036-128241347 15
## >25168373-25168611 14
## >2:25168373-25168611 15
## >25161598-25161833 13
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 7
## >7:128241036-1282413 5
## >7:24283796-24283936 13
## >6:31575210-31575467 11
## >24283796-24283936 8
## >2:25161598-25161833 12
## >31575210-31575467 11
## >17:78358469-7835861 12
## >8:22055623-22055743 2318_120BP
## >128241036-128241347 14
## >25168373-25168611 15
## >2:25168373-25168611 15
## >25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 7
## >7:128241036-1282413 7
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >24283796-24283936 10
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 12
## >8288864-8288967 1632_103BP >5:10649438-10649513 4777_75BP
## >128241036-128241347 9 14
## >25168373-25168611 8 16
## >2:25168373-25168611 10 9
## >25161598-25161833 14 15
## >24283548-24283843 10 10
## >7:24283548-24283843 12 11
## >78358469-78358619 14 13
## >7:128241036-1282413 16 13
## >7:24283796-24283936 13 11
## >6:31575210-31575467 13 13
## >24283796-24283936 12 13
## >2:25161598-25161833 17 12
## >31575210-31575467 13 14
## >17:78358469-7835861 16 13
## >14989629-14989930 224_301BP
## >128241036-128241347 11
## >25168373-25168611 15
## >2:25168373-25168611 8
## >25161598-25161833 10
## >24283548-24283843 12
## >7:24283548-24283843 12
## >78358469-78358619 15
## >7:128241036-1282413 17
## >7:24283796-24283936 11
## >6:31575210-31575467 15
## >24283796-24283936 15
## >2:25161598-25161833 14
## >31575210-31575467 15
## >17:78358469-7835861 16
## >5:131945721-131945786 143_65BP
## >128241036-128241347 11
## >25168373-25168611 10
## >2:25168373-25168611 8
## >25161598-25161833 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >78358469-78358619 16
## >7:128241036-1282413 16
## >7:24283796-24283936 13
## >6:31575210-31575467 14
## >24283796-24283936 13
## >2:25161598-25161833 13
## >31575210-31575467 16
## >17:78358469-7835861 14
## >10649438-10649513 4777_75BP >22055623-22055743 2318_120BP
## >128241036-128241347 12 6
## >25168373-25168611 14 9
## >2:25168373-25168611 8 10
## >25161598-25161833 10 9
## >24283548-24283843 10 11
## >7:24283548-24283843 12 13
## >78358469-78358619 16 10
## >7:128241036-1282413 15 13
## >7:24283796-24283936 14 10
## >6:31575210-31575467 15 8
## >24283796-24283936 14 12
## >2:25161598-25161833 11 11
## >31575210-31575467 13 11
## >17:78358469-7835861 12 13
## >21:39108618-39108702 123_84BP >5:865245-865502 1593_257BP
## >128241036-128241347 12 11
## >25168373-25168611 11 13
## >2:25168373-25168611 11 10
## >25161598-25161833 11 11
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >7:24283796-24283936 13 14
## >6:31575210-31575467 14 13
## >24283796-24283936 11 12
## >2:25161598-25161833 10 11
## >31575210-31575467 11 12
## >17:78358469-7835861 10 10
## >16:14989629-14989930 224_301BP
## >128241036-128241347 7
## >25168373-25168611 9
## >2:25168373-25168611 12
## >25161598-25161833 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >78358469-78358619 14
## >7:128241036-1282413 14
## >7:24283796-24283936 13
## >6:31575210-31575467 12
## >24283796-24283936 14
## >2:25161598-25161833 12
## >31575210-31575467 13
## >17:78358469-7835861 14
## >39108618-39108702 123_84BP >865245-865502 1593_257BP
## >128241036-128241347 9 9
## >25168373-25168611 10 10
## >2:25168373-25168611 11 12
## >25161598-25161833 9 11
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >78358469-78358619 14 15
## >7:128241036-1282413 15 15
## >7:24283796-24283936 12 12
## >6:31575210-31575467 14 13
## >24283796-24283936 11 13
## >2:25161598-25161833 12 10
## >31575210-31575467 14 14
## >17:78358469-7835861 14 14
##
## [[13]]$rowDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 19.72308
##
## [[13]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 21.65641
##
## [[13]]$breaks
## [1] 5.00 5.24 5.48 5.72 5.96 6.20 6.44 6.68 6.92 7.16 7.40 7.64
## [13] 7.88 8.12 8.36 8.60 8.84 9.08 9.32 9.56 9.80 10.04 10.28 10.52
## [25] 10.76 11.00 11.24 11.48 11.72 11.96 12.20 12.44 12.68 12.92 13.16 13.40
## [37] 13.64 13.88 14.12 14.36 14.60 14.84 15.08 15.32 15.56 15.80 16.04 16.28
## [49] 16.52 16.76 17.00
##
## [[13]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[13]]$colorTable
## low high color
## 1 5.00 5.24 #FF0000
## 2 5.24 5.48 #FF0505
## 3 5.48 5.72 #FF0A0A
## 4 5.72 5.96 #FF0F0F
## 5 5.96 6.20 #FF1414
## 6 6.20 6.44 #FF1A1A
## 7 6.44 6.68 #FF1F1F
## 8 6.68 6.92 #FF2424
## 9 6.92 7.16 #FF2929
## 10 7.16 7.40 #FF2E2E
## 11 7.40 7.64 #FF3434
## 12 7.64 7.88 #FF3939
## 13 7.88 8.12 #FF3E3E
## 14 8.12 8.36 #FF4343
## 15 8.36 8.60 #FF4848
## 16 8.60 8.84 #FF4E4E
## 17 8.84 9.08 #FF5353
## 18 9.08 9.32 #FF5858
## 19 9.32 9.56 #FF5D5D
## 20 9.56 9.80 #FF6262
## 21 9.80 10.04 #FF6868
## 22 10.04 10.28 #FF6D6D
## 23 10.28 10.52 #FF7272
## 24 10.52 10.76 #FF7777
## 25 10.76 11.00 #FF7C7C
## 26 11.00 11.24 #FF8282
## 27 11.24 11.48 #FF8787
## 28 11.48 11.72 #FF8C8C
## 29 11.72 11.96 #FF9191
## 30 11.96 12.20 #FF9696
## 31 12.20 12.44 #FF9C9C
## 32 12.44 12.68 #FFA1A1
## 33 12.68 12.92 #FFA6A6
## 34 12.92 13.16 #FFABAB
## 35 13.16 13.40 #FFB0B0
## 36 13.40 13.64 #FFB6B6
## 37 13.64 13.88 #FFBBBB
## 38 13.88 14.12 #FFC0C0
## 39 14.12 14.36 #FFC5C5
## 40 14.36 14.60 #FFCACA
## 41 14.60 14.84 #FFD0D0
## 42 14.84 15.08 #FFD5D5
## 43 15.08 15.32 #FFDADA
## 44 15.32 15.56 #FFDFDF
## 45 15.56 15.80 #FFE4E4
## 46 15.80 16.04 #FFEAEA
## 47 16.04 16.28 #FFEFEF
## 48 16.28 16.52 #FFF4F4
## 49 16.52 16.76 #FFF9F9
## 50 16.76 17.00 #FFFFFF
##
## [[13]]$layout
## [[13]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[13]]$layout$lhei
## [1] 1.5 4.0
##
## [[13]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[14]]
## [[14]]$rowInd
## [1] 5 10 18 2 12 20 16 19 3 9 1 23 14 21 7 15 11 6 22 17 13 8 4 24
##
## [[14]]$colInd
## [1] 3 8 12 7 14 2 1 10 13 6 4 5 9 11
##
## [[14]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[14]]$carpet
## >4:8288864-8288951 3145_87BP
## >2:25168373-25168611 15
## >128241036-128241347 15
## >25168373-25168611 14
## >7:128241036-1282413 5
## >78358469-78358619 7
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >24283796-24283936 8
## >31575210-31575467 11
## >7:24283796-24283936 13
## >6:31575210-31575467 11
## >7:24283548-24283843 11
## >24283548-24283843 12
## >25161598-25161833 13
## >8:22055623-22055743 4281_120BP
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25168373-25168611 15
## >7:128241036-1282413 7
## >78358469-78358619 7
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 10
## >31575210-31575467 11
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >7:24283548-24283843 11
## >24283548-24283843 12
## >25161598-25161833 12
## >18611255-18611324 356_69BP >10:6307518-6307583 400_65BP
## >2:25168373-25168611 17 17
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >7:128241036-1282413 7 7
## >78358469-78358619 8 8
## >2:25161598-25161833 10 10
## >17:78358469-7835861 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >7:24283548-24283843 14 14
## >24283548-24283843 14 14
## >25161598-25161833 14 14
## >Y:12869910-12869975 354_65BP >43974366-43974508 202_142BP
## >2:25168373-25168611 17 11
## >128241036-128241347 17 10
## >25168373-25168611 16 12
## >7:128241036-1282413 7 10
## >78358469-78358619 8 8
## >2:25161598-25161833 10 11
## >17:78358469-7835861 10 11
## >24283796-24283936 12 10
## >31575210-31575467 10 11
## >7:24283796-24283936 12 7
## >6:31575210-31575467 13 8
## >7:24283548-24283843 14 12
## >24283548-24283843 14 11
## >25161598-25161833 14 11
## >14989690-14989869 171_179BP >22055623-22055743 4281_120BP
## >2:25168373-25168611 12 10
## >128241036-128241347 12 6
## >25168373-25168611 13 9
## >7:128241036-1282413 10 13
## >78358469-78358619 8 10
## >2:25161598-25161833 11 11
## >17:78358469-7835861 12 13
## >24283796-24283936 12 12
## >31575210-31575467 13 11
## >7:24283796-24283936 11 10
## >6:31575210-31575467 10 8
## >7:24283548-24283843 12 13
## >24283548-24283843 10 11
## >25161598-25161833 11 9
## >16:14989690-14989869 171_179BP
## >2:25168373-25168611 12
## >128241036-128241347 9
## >25168373-25168611 10
## >7:128241036-1282413 11
## >78358469-78358619 13
## >2:25161598-25161833 9
## >17:78358469-7835861 14
## >24283796-24283936 12
## >31575210-31575467 10
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >7:24283548-24283843 10
## >24283548-24283843 12
## >25161598-25161833 9
## >7:63398191-63398273 101_82BP
## >2:25168373-25168611 12
## >128241036-128241347 9
## >25168373-25168611 9
## >7:128241036-1282413 11
## >78358469-78358619 12
## >2:25161598-25161833 10
## >17:78358469-7835861 12
## >24283796-24283936 14
## >31575210-31575467 12
## >7:24283796-24283936 10
## >6:31575210-31575467 12
## >7:24283548-24283843 13
## >24283548-24283843 11
## >25161598-25161833 10
## >1:18611255-18611324 356_69BP >8288864-8288951 3145_87BP
## >2:25168373-25168611 10 11
## >128241036-128241347 4 6
## >25168373-25168611 8 11
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >2:25161598-25161833 15 13
## >17:78358469-7835861 14 13
## >24283796-24283936 13 14
## >31575210-31575467 12 14
## >7:24283796-24283936 12 11
## >6:31575210-31575467 12 12
## >7:24283548-24283843 9 9
## >24283548-24283843 11 11
## >25161598-25161833 11 12
## >12869910-12869975 354_65BP >6307518-6307583 400_65BP
## >2:25168373-25168611 10 10
## >128241036-128241347 7 7
## >25168373-25168611 11 11
## >7:128241036-1282413 16 16
## >78358469-78358619 14 14
## >2:25161598-25161833 15 15
## >17:78358469-7835861 11 11
## >24283796-24283936 13 13
## >31575210-31575467 13 13
## >7:24283796-24283936 12 12
## >6:31575210-31575467 10 10
## >7:24283548-24283843 12 12
## >24283548-24283843 10 10
## >25161598-25161833 12 12
## >5:10649438-10649513 10108_75BP
## >2:25168373-25168611 9
## >128241036-128241347 14
## >25168373-25168611 16
## >7:128241036-1282413 13
## >78358469-78358619 13
## >2:25161598-25161833 12
## >17:78358469-7835861 13
## >24283796-24283936 13
## >31575210-31575467 14
## >7:24283796-24283936 11
## >6:31575210-31575467 13
## >7:24283548-24283843 11
## >24283548-24283843 10
## >25161598-25161833 15
## >131945721-131945800 4480_79BP
## >2:25168373-25168611 11
## >128241036-128241347 10
## >25168373-25168611 12
## >7:128241036-1282413 12
## >78358469-78358619 14
## >2:25161598-25161833 12
## >17:78358469-7835861 10
## >24283796-24283936 10
## >31575210-31575467 12
## >7:24283796-24283936 11
## >6:31575210-31575467 11
## >7:24283548-24283843 11
## >24283548-24283843 12
## >25161598-25161833 11
## >X:153420849-153420964 102_115BP
## >2:25168373-25168611 12
## >128241036-128241347 13
## >25168373-25168611 14
## >7:128241036-1282413 12
## >78358469-78358619 13
## >2:25161598-25161833 11
## >17:78358469-7835861 10
## >24283796-24283936 10
## >31575210-31575467 11
## >7:24283796-24283936 11
## >6:31575210-31575467 12
## >7:24283548-24283843 10
## >24283548-24283843 11
## >25161598-25161833 11
## >5:865245-865502 2678_257BP >63398191-63398273 101_82BP
## >2:25168373-25168611 10 11
## >128241036-128241347 11 12
## >25168373-25168611 13 13
## >7:128241036-1282413 14 14
## >78358469-78358619 14 14
## >2:25161598-25161833 11 12
## >17:78358469-7835861 10 11
## >24283796-24283936 12 13
## >31575210-31575467 12 14
## >7:24283796-24283936 14 11
## >6:31575210-31575467 13 12
## >7:24283548-24283843 13 13
## >24283548-24283843 12 11
## >25161598-25161833 11 11
## >153420849-153420964 102_115BP
## >2:25168373-25168611 8
## >128241036-128241347 11
## >25168373-25168611 12
## >7:128241036-1282413 14
## >78358469-78358619 16
## >2:25161598-25161833 11
## >17:78358469-7835861 14
## >24283796-24283936 13
## >31575210-31575467 12
## >7:24283796-24283936 16
## >6:31575210-31575467 14
## >7:24283548-24283843 10
## >24283548-24283843 11
## >25161598-25161833 10
## >10649438-10649513 10108_75BP
## >2:25168373-25168611 8
## >128241036-128241347 12
## >25168373-25168611 14
## >7:128241036-1282413 15
## >78358469-78358619 16
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >24283796-24283936 14
## >31575210-31575467 13
## >7:24283796-24283936 14
## >6:31575210-31575467 15
## >7:24283548-24283843 12
## >24283548-24283843 10
## >25161598-25161833 10
## >5:131945721-131945800 4480_79BP
## >2:25168373-25168611 8
## >128241036-128241347 11
## >25168373-25168611 10
## >7:128241036-1282413 16
## >78358469-78358619 16
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >24283796-24283936 13
## >31575210-31575467 16
## >7:24283796-24283936 13
## >6:31575210-31575467 14
## >7:24283548-24283843 12
## >24283548-24283843 10
## >25161598-25161833 10
## >22:43974366-43974508 202_142BP >865245-865502 2678_257BP
## >2:25168373-25168611 11 12
## >128241036-128241347 10 9
## >25168373-25168611 9 10
## >7:128241036-1282413 15 15
## >78358469-78358619 14 15
## >2:25161598-25161833 13 10
## >17:78358469-7835861 13 14
## >24283796-24283936 13 13
## >31575210-31575467 13 14
## >7:24283796-24283936 14 12
## >6:31575210-31575467 12 13
## >7:24283548-24283843 10 12
## >24283548-24283843 9 10
## >25161598-25161833 10 11
##
## [[14]]$rowDendrogram
## 'dendrogram' with 2 branches and 24 members total, at height 22.36068
##
## [[14]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 31.87475
##
## [[14]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[14]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[14]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[14]]$layout
## [[14]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[14]]$layout$lhei
## [1] 1.5 4.0
##
## [[14]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[15]]
## [[15]]$rowInd
## [1] 8 13 11 4 10 6 5 9 16 7 14 12 1 3 2 15
##
## [[15]]$colInd
## [1] 7 14 2 10 1 13 3 8 12 6 4 11 9 5
##
## [[15]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[15]]$carpet
## >8:22055623-22055743 4642_120BP
## >7:128241036-1282413 7
## >78358469-78358619 7
## >2:25161598-25161833 11
## >24283796-24283936 10
## >17:78358469-7835861 12
## >31575210-31575467 11
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25168373-25168611 15
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >18611255-18611340 317_85BP >112387982-112388053 292_71BP
## >7:128241036-1282413 7 7
## >78358469-78358619 8 8
## >2:25161598-25161833 10 10
## >24283796-24283936 12 12
## >17:78358469-7835861 10 10
## >31575210-31575467 10 10
## >2:25168373-25168611 17 17
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >25161598-25161833 14 14
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >10:6307518-6307583 179_65BP >112387835-112387898 292_63BP
## >7:128241036-1282413 7 7
## >78358469-78358619 8 8
## >2:25161598-25161833 10 10
## >24283796-24283936 12 12
## >17:78358469-7835861 10 10
## >31575210-31575467 10 10
## >2:25168373-25168611 17 17
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >25161598-25161833 14 14
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >5:10649438-10649513 13348_75BP
## >7:128241036-1282413 13
## >78358469-78358619 13
## >2:25161598-25161833 12
## >24283796-24283936 13
## >17:78358469-7835861 13
## >31575210-31575467 14
## >2:25168373-25168611 9
## >128241036-128241347 14
## >25168373-25168611 16
## >7:24283796-24283936 11
## >6:31575210-31575467 13
## >25161598-25161833 15
## >24283548-24283843 10
## >7:24283548-24283843 11
## >5:865245-865502 1692_257BP >10649438-10649513 13348_75BP
## >7:128241036-1282413 14 15
## >78358469-78358619 14 16
## >2:25161598-25161833 11 11
## >24283796-24283936 12 14
## >17:78358469-7835861 10 12
## >31575210-31575467 12 13
## >2:25168373-25168611 10 8
## >128241036-128241347 11 12
## >25168373-25168611 13 14
## >7:24283796-24283936 14 14
## >6:31575210-31575467 13 15
## >25161598-25161833 11 10
## >24283548-24283843 12 10
## >7:24283548-24283843 13 12
## >865245-865502 1692_257BP >5:131945721-131945799 1965_78BP
## >7:128241036-1282413 15 16
## >78358469-78358619 15 16
## >2:25161598-25161833 10 13
## >24283796-24283936 13 13
## >17:78358469-7835861 14 14
## >31575210-31575467 14 16
## >2:25168373-25168611 12 8
## >128241036-128241347 9 11
## >25168373-25168611 10 10
## >7:24283796-24283936 12 13
## >6:31575210-31575467 13 14
## >25161598-25161833 11 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >22055623-22055743 4642_120BP
## >7:128241036-1282413 13
## >78358469-78358619 10
## >2:25161598-25161833 11
## >24283796-24283936 12
## >17:78358469-7835861 13
## >31575210-31575467 11
## >2:25168373-25168611 10
## >128241036-128241347 6
## >25168373-25168611 9
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >25161598-25161833 9
## >24283548-24283843 11
## >7:24283548-24283843 13
## >131945721-131945799 1965_78BP
## >7:128241036-1282413 12
## >78358469-78358619 12
## >2:25161598-25161833 12
## >24283796-24283936 10
## >17:78358469-7835861 11
## >31575210-31575467 11
## >2:25168373-25168611 11
## >128241036-128241347 11
## >25168373-25168611 11
## >7:24283796-24283936 10
## >6:31575210-31575467 12
## >25161598-25161833 10
## >24283548-24283843 12
## >7:24283548-24283843 10
## >1:18611255-18611340 317_85BP
## >7:128241036-1282413 15
## >78358469-78358619 16
## >2:25161598-25161833 15
## >24283796-24283936 13
## >17:78358469-7835861 14
## >31575210-31575467 12
## >2:25168373-25168611 10
## >128241036-128241347 4
## >25168373-25168611 8
## >7:24283796-24283936 12
## >6:31575210-31575467 12
## >25161598-25161833 11
## >24283548-24283843 11
## >7:24283548-24283843 9
## >1:112387982-112388053 292_71BP
## >7:128241036-1282413 16
## >78358469-78358619 16
## >2:25161598-25161833 14
## >24283796-24283936 15
## >17:78358469-7835861 13
## >31575210-31575467 13
## >2:25168373-25168611 10
## >128241036-128241347 7
## >25168373-25168611 10
## >7:24283796-24283936 11
## >6:31575210-31575467 12
## >25161598-25161833 11
## >24283548-24283843 11
## >7:24283548-24283843 11
## >1:112387835-112387898 292_63BP >6307518-6307583 179_65BP
## >7:128241036-1282413 15 16
## >78358469-78358619 15 14
## >2:25161598-25161833 15 15
## >24283796-24283936 12 13
## >17:78358469-7835861 12 11
## >31575210-31575467 13 13
## >2:25168373-25168611 10 10
## >128241036-128241347 5 7
## >25168373-25168611 10 11
## >7:24283796-24283936 12 12
## >6:31575210-31575467 11 10
## >25161598-25161833 12 12
## >24283548-24283843 10 10
## >7:24283548-24283843 11 12
##
## [[15]]$rowDendrogram
## 'dendrogram' with 2 branches and 16 members total, at height 22.36068
##
## [[15]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 31.01612
##
## [[15]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[15]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[15]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[15]]$layout
## [[15]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[15]]$layout$lhei
## [1] 1.5 4.0
##
## [[15]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[16]]
## [[16]]$rowInd
## [1] 15 17 22 5 9 19 2 12 20 3 1 23 14 21 10 11 7 8 24 4 6 13 16 18
##
## [[16]]$colInd
## [1] 14 7 3 8 12 11 2 9 5 4 6 10 13 1
##
## [[16]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[16]]$carpet
## >131945721-131945786 1012_65BP
## >78358469-78358619 11
## >7:128241036-1282413 11
## >2:25168373-25168611 12
## >128241036-128241347 11
## >25168373-25168611 13
## >25161598-25161833 12
## >2:25161598-25161833 10
## >24283548-24283843 10
## >7:24283548-24283843 7
## >6:31575210-31575467 10
## >7:24283796-24283936 14
## >24283796-24283936 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >14989694-14989865 108_171BP >80568673-80568788 280_115BP
## >78358469-78358619 10 11
## >7:128241036-1282413 14 10
## >2:25168373-25168611 11 15
## >128241036-128241347 14 14
## >25168373-25168611 14 13
## >25161598-25161833 10 11
## >2:25161598-25161833 10 12
## >24283548-24283843 11 12
## >7:24283548-24283843 12 12
## >6:31575210-31575467 14 15
## >7:24283796-24283936 9 11
## >24283796-24283936 13 10
## >31575210-31575467 11 9
## >17:78358469-7835861 13 11
## >4:8288864-8288929 125_65BP
## >78358469-78358619 7
## >7:128241036-1282413 5
## >2:25168373-25168611 15
## >128241036-128241347 15
## >25168373-25168611 14
## >25161598-25161833 13
## >2:25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 11
## >7:24283796-24283936 13
## >24283796-24283936 8
## >31575210-31575467 11
## >17:78358469-7835861 12
## >8:22055623-22055743 1943_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25168373-25168611 15
## >25161598-25161833 12
## >2:25161598-25161833 11
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >18611255-18611344 564_89BP >10:6307512-6307583 246_71BP
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25168373-25168611 17 17
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >25161598-25161833 14 14
## >2:25161598-25161833 10 10
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >6:31575210-31575467 13 13
## >7:24283796-24283936 12 12
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >Y:12869910-12869975 183_65BP
## >78358469-78358619 8
## >7:128241036-1282413 7
## >2:25168373-25168611 17
## >128241036-128241347 17
## >25168373-25168611 16
## >25161598-25161833 14
## >2:25161598-25161833 10
## >24283548-24283843 14
## >7:24283548-24283843 14
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >24283796-24283936 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >22055623-22055743 1943_120BP
## >78358469-78358619 10
## >7:128241036-1282413 13
## >2:25168373-25168611 10
## >128241036-128241347 6
## >25168373-25168611 9
## >25161598-25161833 9
## >2:25161598-25161833 11
## >24283548-24283843 11
## >7:24283548-24283843 13
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >24283796-24283936 12
## >31575210-31575467 11
## >17:78358469-7835861 13
## >11:80568673-80568788 280_115BP
## >78358469-78358619 10
## >7:128241036-1282413 12
## >2:25168373-25168611 13
## >128241036-128241347 9
## >25168373-25168611 11
## >25161598-25161833 9
## >2:25161598-25161833 11
## >24283548-24283843 13
## >7:24283548-24283843 15
## >6:31575210-31575467 8
## >7:24283796-24283936 9
## >24283796-24283936 11
## >31575210-31575467 9
## >17:78358469-7835861 12
## >1:18611255-18611344 564_89BP >8288864-8288929 125_65BP
## >78358469-78358619 16 15
## >7:128241036-1282413 15 15
## >2:25168373-25168611 10 10
## >128241036-128241347 4 9
## >25168373-25168611 8 9
## >25161598-25161833 11 12
## >2:25161598-25161833 15 16
## >24283548-24283843 11 10
## >7:24283548-24283843 9 10
## >6:31575210-31575467 12 13
## >7:24283796-24283936 12 11
## >24283796-24283936 13 12
## >31575210-31575467 12 14
## >17:78358469-7835861 14 14
## >12869910-12869975 183_65BP >6307512-6307583 246_71BP
## >78358469-78358619 14 14
## >7:128241036-1282413 16 16
## >2:25168373-25168611 10 10
## >128241036-128241347 7 7
## >25168373-25168611 11 11
## >25161598-25161833 12 12
## >2:25161598-25161833 15 15
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 10 10
## >7:24283796-24283936 12 12
## >24283796-24283936 13 13
## >31575210-31575467 13 13
## >17:78358469-7835861 11 11
## >KI270733.1:133694-133777 106_83BP
## >78358469-78358619 18
## >7:128241036-1282413 19
## >2:25168373-25168611 12
## >128241036-128241347 13
## >25168373-25168611 14
## >25161598-25161833 11
## >2:25161598-25161833 10
## >24283548-24283843 15
## >7:24283548-24283843 13
## >6:31575210-31575467 16
## >7:24283796-24283936 14
## >24283796-24283936 18
## >31575210-31575467 16
## >17:78358469-7835861 15
## >KI270733.1:178774-178856 105_82BP
## >78358469-78358619 17
## >7:128241036-1282413 19
## >2:25168373-25168611 12
## >128241036-128241347 13
## >25168373-25168611 15
## >25161598-25161833 10
## >2:25161598-25161833 12
## >24283548-24283843 15
## >7:24283548-24283843 14
## >6:31575210-31575467 16
## >7:24283796-24283936 14
## >24283796-24283936 16
## >31575210-31575467 17
## >17:78358469-7835861 15
## >5:10649438-10649513 8843_75BP
## >78358469-78358619 13
## >7:128241036-1282413 13
## >2:25168373-25168611 9
## >128241036-128241347 14
## >25168373-25168611 16
## >25161598-25161833 15
## >2:25161598-25161833 12
## >24283548-24283843 10
## >7:24283548-24283843 11
## >6:31575210-31575467 13
## >7:24283796-24283936 11
## >24283796-24283936 13
## >31575210-31575467 14
## >17:78358469-7835861 13
## >5:131945721-131945786 1012_65BP >865245-865502 1566_257BP
## >78358469-78358619 16 15
## >7:128241036-1282413 16 15
## >2:25168373-25168611 8 12
## >128241036-128241347 11 9
## >25168373-25168611 10 10
## >25161598-25161833 10 11
## >2:25161598-25161833 13 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >6:31575210-31575467 14 13
## >7:24283796-24283936 13 12
## >24283796-24283936 13 13
## >31575210-31575467 16 14
## >17:78358469-7835861 14 14
## >16:14989694-14989865 108_171BP
## >78358469-78358619 14
## >7:128241036-1282413 14
## >2:25168373-25168611 13
## >128241036-128241347 12
## >25168373-25168611 10
## >25161598-25161833 9
## >2:25161598-25161833 11
## >24283548-24283843 12
## >7:24283548-24283843 14
## >6:31575210-31575467 14
## >7:24283796-24283936 12
## >24283796-24283936 13
## >31575210-31575467 13
## >17:78358469-7835861 14
## >5:865245-865502 1566_257BP >10649438-10649513 8843_75BP
## >78358469-78358619 14 16
## >7:128241036-1282413 14 15
## >2:25168373-25168611 10 8
## >128241036-128241347 11 12
## >25168373-25168611 13 14
## >25161598-25161833 11 10
## >2:25161598-25161833 11 11
## >24283548-24283843 12 10
## >7:24283548-24283843 13 12
## >6:31575210-31575467 13 15
## >7:24283796-24283936 14 14
## >24283796-24283936 12 14
## >31575210-31575467 12 13
## >17:78358469-7835861 10 12
## >133694-133777 106_83BP >178774-178856 105_82BP
## >78358469-78358619 16 16
## >7:128241036-1282413 16 16
## >2:25168373-25168611 10 10
## >128241036-128241347 11 11
## >25168373-25168611 13 13
## >25161598-25161833 11 11
## >2:25161598-25161833 12 12
## >24283548-24283843 14 14
## >7:24283548-24283843 13 13
## >6:31575210-31575467 16 16
## >7:24283796-24283936 13 13
## >24283796-24283936 13 13
## >31575210-31575467 12 12
## >17:78358469-7835861 13 13
##
## [[16]]$rowDendrogram
## 'dendrogram' with 2 branches and 24 members total, at height 22.60531
##
## [[16]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 32.37283
##
## [[16]]$breaks
## [1] 4.0 4.3 4.6 4.9 5.2 5.5 5.8 6.1 6.4 6.7 7.0 7.3 7.6 7.9 8.2
## [16] 8.5 8.8 9.1 9.4 9.7 10.0 10.3 10.6 10.9 11.2 11.5 11.8 12.1 12.4 12.7
## [31] 13.0 13.3 13.6 13.9 14.2 14.5 14.8 15.1 15.4 15.7 16.0 16.3 16.6 16.9 17.2
## [46] 17.5 17.8 18.1 18.4 18.7 19.0
##
## [[16]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[16]]$colorTable
## low high color
## 1 4.0 4.3 #FF0000
## 2 4.3 4.6 #FF0505
## 3 4.6 4.9 #FF0A0A
## 4 4.9 5.2 #FF0F0F
## 5 5.2 5.5 #FF1414
## 6 5.5 5.8 #FF1A1A
## 7 5.8 6.1 #FF1F1F
## 8 6.1 6.4 #FF2424
## 9 6.4 6.7 #FF2929
## 10 6.7 7.0 #FF2E2E
## 11 7.0 7.3 #FF3434
## 12 7.3 7.6 #FF3939
## 13 7.6 7.9 #FF3E3E
## 14 7.9 8.2 #FF4343
## 15 8.2 8.5 #FF4848
## 16 8.5 8.8 #FF4E4E
## 17 8.8 9.1 #FF5353
## 18 9.1 9.4 #FF5858
## 19 9.4 9.7 #FF5D5D
## 20 9.7 10.0 #FF6262
## 21 10.0 10.3 #FF6868
## 22 10.3 10.6 #FF6D6D
## 23 10.6 10.9 #FF7272
## 24 10.9 11.2 #FF7777
## 25 11.2 11.5 #FF7C7C
## 26 11.5 11.8 #FF8282
## 27 11.8 12.1 #FF8787
## 28 12.1 12.4 #FF8C8C
## 29 12.4 12.7 #FF9191
## 30 12.7 13.0 #FF9696
## 31 13.0 13.3 #FF9C9C
## 32 13.3 13.6 #FFA1A1
## 33 13.6 13.9 #FFA6A6
## 34 13.9 14.2 #FFABAB
## 35 14.2 14.5 #FFB0B0
## 36 14.5 14.8 #FFB6B6
## 37 14.8 15.1 #FFBBBB
## 38 15.1 15.4 #FFC0C0
## 39 15.4 15.7 #FFC5C5
## 40 15.7 16.0 #FFCACA
## 41 16.0 16.3 #FFD0D0
## 42 16.3 16.6 #FFD5D5
## 43 16.6 16.9 #FFDADA
## 44 16.9 17.2 #FFDFDF
## 45 17.2 17.5 #FFE4E4
## 46 17.5 17.8 #FFEAEA
## 47 17.8 18.1 #FFEFEF
## 48 18.1 18.4 #FFF4F4
## 49 18.4 18.7 #FFF9F9
## 50 18.7 19.0 #FFFFFF
##
## [[16]]$layout
## [[16]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[16]]$layout$lhei
## [1] 1.5 4.0
##
## [[16]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[17]]
## [[17]]$rowInd
## [1] 5 9 3 11 12 7 15 6 10 16 8 13 4 14 1 17 2 18
##
## [[17]]$colInd
## [1] 3 9 5 11 8 12 7 14 6 10 4 2 13 1
##
## [[17]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[17]]$carpet
## >4:8288864-8288951 1128_87BP
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 13
## >128241036-128241347 15
## >25168373-25168611 14
## >7:128241036-1282413 5
## >78358469-78358619 7
## >7:24283796-24283936 13
## >24283796-24283936 8
## >6:31575210-31575467 11
## >2:25161598-25161833 12
## >31575210-31575467 11
## >17:78358469-7835861 12
## >8:22055623-22055726 870_103BP
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 12
## >128241036-128241347 14
## >25168373-25168611 15
## >7:128241036-1282413 7
## >78358469-78358619 7
## >7:24283796-24283936 12
## >24283796-24283936 10
## >6:31575210-31575467 13
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 12
## >17:4550782-4550844 390_62BP >11551551-11551692 224_141BP
## >2:25168373-25168611 10 10
## >24283548-24283843 11 9
## >7:24283548-24283843 11 10
## >25161598-25161833 13 12
## >128241036-128241347 11 12
## >25168373-25168611 12 13
## >7:128241036-1282413 10 10
## >78358469-78358619 10 9
## >7:24283796-24283936 14 13
## >24283796-24283936 10 11
## >6:31575210-31575467 10 11
## >2:25161598-25161833 15 10
## >31575210-31575467 13 10
## >17:78358469-7835861 13 10
## >131945721-131945786 1272_65BP
## >2:25168373-25168611 12
## >24283548-24283843 10
## >7:24283548-24283843 7
## >25161598-25161833 12
## >128241036-128241347 11
## >25168373-25168611 13
## >7:128241036-1282413 11
## >78358469-78358619 11
## >7:24283796-24283936 14
## >24283796-24283936 10
## >6:31575210-31575467 10
## >2:25161598-25161833 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >5:10649438-10649513 7273_75BP
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 15
## >128241036-128241347 14
## >25168373-25168611 16
## >7:128241036-1282413 13
## >78358469-78358619 13
## >7:24283796-24283936 11
## >24283796-24283936 13
## >6:31575210-31575467 13
## >2:25161598-25161833 12
## >31575210-31575467 14
## >17:78358469-7835861 13
## >43926216-43926323 356_107BP >5:865245-865502 2330_257BP
## >2:25168373-25168611 6 10
## >24283548-24283843 9 12
## >7:24283548-24283843 12 13
## >25161598-25161833 14 11
## >128241036-128241347 12 11
## >25168373-25168611 14 13
## >7:128241036-1282413 14 14
## >78358469-78358619 15 14
## >7:24283796-24283936 13 14
## >24283796-24283936 13 12
## >6:31575210-31575467 14 13
## >2:25161598-25161833 12 11
## >31575210-31575467 10 12
## >17:78358469-7835861 10 10
## >10649438-10649513 7273_75BP >4550782-4550844 390_62BP
## >2:25168373-25168611 8 11
## >24283548-24283843 10 12
## >7:24283548-24283843 12 10
## >25161598-25161833 10 9
## >128241036-128241347 12 12
## >25168373-25168611 14 11
## >7:128241036-1282413 15 17
## >78358469-78358619 16 15
## >7:24283796-24283936 14 14
## >24283796-24283936 14 14
## >6:31575210-31575467 15 17
## >2:25161598-25161833 11 15
## >31575210-31575467 13 14
## >17:78358469-7835861 12 17
## >5:131945721-131945786 1272_65BP
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >25161598-25161833 10
## >128241036-128241347 11
## >25168373-25168611 10
## >7:128241036-1282413 16
## >78358469-78358619 16
## >7:24283796-24283936 13
## >24283796-24283936 13
## >6:31575210-31575467 14
## >2:25161598-25161833 13
## >31575210-31575467 16
## >17:78358469-7835861 14
## >14989629-14989930 219_301BP
## >2:25168373-25168611 8
## >24283548-24283843 12
## >7:24283548-24283843 12
## >25161598-25161833 10
## >128241036-128241347 11
## >25168373-25168611 15
## >7:128241036-1282413 17
## >78358469-78358619 15
## >7:24283796-24283936 11
## >24283796-24283936 15
## >6:31575210-31575467 15
## >2:25161598-25161833 14
## >31575210-31575467 15
## >17:78358469-7835861 16
## >19:11551551-11551692 224_141BP
## >2:25168373-25168611 11
## >24283548-24283843 7
## >7:24283548-24283843 11
## >25161598-25161833 10
## >128241036-128241347 9
## >25168373-25168611 8
## >7:128241036-1282413 14
## >78358469-78358619 15
## >7:24283796-24283936 13
## >24283796-24283936 14
## >6:31575210-31575467 14
## >2:25161598-25161833 13
## >31575210-31575467 14
## >17:78358469-7835861 14
## >22055623-22055726 870_103BP
## >2:25168373-25168611 9
## >24283548-24283843 9
## >7:24283548-24283843 9
## >25161598-25161833 12
## >128241036-128241347 9
## >25168373-25168611 9
## >7:128241036-1282413 14
## >78358469-78358619 14
## >7:24283796-24283936 12
## >24283796-24283936 12
## >6:31575210-31575467 13
## >2:25161598-25161833 14
## >31575210-31575467 12
## >17:78358469-7835861 14
## >1:43926216-43926323 356_107BP >8288864-8288951 1128_87BP
## >2:25168373-25168611 12 11
## >24283548-24283843 9 11
## >7:24283548-24283843 10 9
## >25161598-25161833 11 12
## >128241036-128241347 8 6
## >25168373-25168611 9 11
## >7:128241036-1282413 13 16
## >78358469-78358619 15 15
## >7:24283796-24283936 14 11
## >24283796-24283936 12 14
## >6:31575210-31575467 13 12
## >2:25161598-25161833 12 13
## >31575210-31575467 11 14
## >17:78358469-7835861 14 13
## >16:14989629-14989930 219_301BP >865245-865502 2330_257BP
## >2:25168373-25168611 12 12
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >25161598-25161833 10 11
## >128241036-128241347 7 9
## >25168373-25168611 9 10
## >7:128241036-1282413 14 15
## >78358469-78358619 14 15
## >7:24283796-24283936 13 12
## >24283796-24283936 14 13
## >6:31575210-31575467 12 13
## >2:25161598-25161833 12 10
## >31575210-31575467 13 14
## >17:78358469-7835861 14 14
##
## [[17]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 19.72308
##
## [[17]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 23.74868
##
## [[17]]$breaks
## [1] 5.00 5.24 5.48 5.72 5.96 6.20 6.44 6.68 6.92 7.16 7.40 7.64
## [13] 7.88 8.12 8.36 8.60 8.84 9.08 9.32 9.56 9.80 10.04 10.28 10.52
## [25] 10.76 11.00 11.24 11.48 11.72 11.96 12.20 12.44 12.68 12.92 13.16 13.40
## [37] 13.64 13.88 14.12 14.36 14.60 14.84 15.08 15.32 15.56 15.80 16.04 16.28
## [49] 16.52 16.76 17.00
##
## [[17]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[17]]$colorTable
## low high color
## 1 5.00 5.24 #FF0000
## 2 5.24 5.48 #FF0505
## 3 5.48 5.72 #FF0A0A
## 4 5.72 5.96 #FF0F0F
## 5 5.96 6.20 #FF1414
## 6 6.20 6.44 #FF1A1A
## 7 6.44 6.68 #FF1F1F
## 8 6.68 6.92 #FF2424
## 9 6.92 7.16 #FF2929
## 10 7.16 7.40 #FF2E2E
## 11 7.40 7.64 #FF3434
## 12 7.64 7.88 #FF3939
## 13 7.88 8.12 #FF3E3E
## 14 8.12 8.36 #FF4343
## 15 8.36 8.60 #FF4848
## 16 8.60 8.84 #FF4E4E
## 17 8.84 9.08 #FF5353
## 18 9.08 9.32 #FF5858
## 19 9.32 9.56 #FF5D5D
## 20 9.56 9.80 #FF6262
## 21 9.80 10.04 #FF6868
## 22 10.04 10.28 #FF6D6D
## 23 10.28 10.52 #FF7272
## 24 10.52 10.76 #FF7777
## 25 10.76 11.00 #FF7C7C
## 26 11.00 11.24 #FF8282
## 27 11.24 11.48 #FF8787
## 28 11.48 11.72 #FF8C8C
## 29 11.72 11.96 #FF9191
## 30 11.96 12.20 #FF9696
## 31 12.20 12.44 #FF9C9C
## 32 12.44 12.68 #FFA1A1
## 33 12.68 12.92 #FFA6A6
## 34 12.92 13.16 #FFABAB
## 35 13.16 13.40 #FFB0B0
## 36 13.40 13.64 #FFB6B6
## 37 13.64 13.88 #FFBBBB
## 38 13.88 14.12 #FFC0C0
## 39 14.12 14.36 #FFC5C5
## 40 14.36 14.60 #FFCACA
## 41 14.60 14.84 #FFD0D0
## 42 14.84 15.08 #FFD5D5
## 43 15.08 15.32 #FFDADA
## 44 15.32 15.56 #FFDFDF
## 45 15.56 15.80 #FFE4E4
## 46 15.80 16.04 #FFEAEA
## 47 16.04 16.28 #FFEFEF
## 48 16.28 16.52 #FFF4F4
## 49 16.52 16.76 #FFF9F9
## 50 16.76 17.00 #FFFFFF
##
## [[17]]$layout
## [[17]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[17]]$layout$lhei
## [1] 1.5 4.0
##
## [[17]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[18]]
## [[18]]$rowInd
## [1] 7 10 1 12 9 2 11 13 3 5 4 8 14 6
##
## [[18]]$colInd
## [1] 8 12 5 3 9 11 14 7 2 1 4 6 10 13
##
## [[18]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[18]]$carpet
## >8:22055623-22055743 2893_120BP
## >128241036-128241347 14
## >25168373-25168611 15
## >7:24283548-24283843 11
## >2:25168373-25168611 15
## >24283548-24283843 12
## >25161598-25161833 12
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >24283796-24283936 10
## >31575210-31575467 11
## >18611255-18611336 529_81BP >1:18611255-18611336 529_81BP
## >128241036-128241347 17 4
## >25168373-25168611 16 8
## >7:24283548-24283843 14 9
## >2:25168373-25168611 17 10
## >24283548-24283843 14 11
## >25161598-25161833 14 11
## >78358469-78358619 8 16
## >7:128241036-1282413 7 15
## >2:25161598-25161833 10 15
## >17:78358469-7835861 10 14
## >6:31575210-31575467 13 12
## >7:24283796-24283936 12 12
## >24283796-24283936 12 13
## >31575210-31575467 10 12
## >4550782-4550844 150_62BP >131945721-131945786 1525_65BP
## >128241036-128241347 12 11
## >25168373-25168611 11 13
## >7:24283548-24283843 10 7
## >2:25168373-25168611 11 12
## >24283548-24283843 12 10
## >25161598-25161833 9 12
## >78358469-78358619 15 11
## >7:128241036-1282413 17 11
## >2:25161598-25161833 15 10
## >17:78358469-7835861 17 11
## >6:31575210-31575467 17 10
## >7:24283796-24283936 14 14
## >24283796-24283936 14 10
## >31575210-31575467 14 9
## >17:4550782-4550844 150_62BP >22055623-22055743 2893_120BP
## >128241036-128241347 11 6
## >25168373-25168611 12 9
## >7:24283548-24283843 11 13
## >2:25168373-25168611 10 10
## >24283548-24283843 11 11
## >25161598-25161833 13 9
## >78358469-78358619 10 10
## >7:128241036-1282413 10 13
## >2:25161598-25161833 15 11
## >17:78358469-7835861 13 13
## >6:31575210-31575467 10 8
## >7:24283796-24283936 14 10
## >24283796-24283936 10 12
## >31575210-31575467 13 11
## >62060954-62061019 288_65BP >17:62060954-62061019 288_65BP
## >128241036-128241347 12 12
## >25168373-25168611 10 10
## >7:24283548-24283843 15 12
## >2:25168373-25168611 13 14
## >24283548-24283843 10 11
## >25161598-25161833 9 11
## >78358469-78358619 7 11
## >7:128241036-1282413 12 13
## >2:25161598-25161833 13 14
## >17:78358469-7835861 12 14
## >6:31575210-31575467 9 13
## >7:24283796-24283936 11 10
## >24283796-24283936 10 11
## >31575210-31575467 12 11
## >5:10649438-10649513 16465_75BP >5:865245-865502 834_257BP
## >128241036-128241347 14 11
## >25168373-25168611 16 13
## >7:24283548-24283843 11 13
## >2:25168373-25168611 9 10
## >24283548-24283843 10 12
## >25161598-25161833 15 11
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >2:25161598-25161833 12 11
## >17:78358469-7835861 13 10
## >6:31575210-31575467 13 13
## >7:24283796-24283936 11 14
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >10649438-10649513 16465_75BP >865245-865502 834_257BP
## >128241036-128241347 12 9
## >25168373-25168611 14 10
## >7:24283548-24283843 12 12
## >2:25168373-25168611 8 12
## >24283548-24283843 10 10
## >25161598-25161833 10 11
## >78358469-78358619 16 15
## >7:128241036-1282413 15 15
## >2:25161598-25161833 11 10
## >17:78358469-7835861 12 14
## >6:31575210-31575467 15 13
## >7:24283796-24283936 14 12
## >24283796-24283936 14 13
## >31575210-31575467 13 14
## >5:131945721-131945786 1525_65BP
## >128241036-128241347 11
## >25168373-25168611 10
## >7:24283548-24283843 12
## >2:25168373-25168611 8
## >24283548-24283843 10
## >25161598-25161833 10
## >78358469-78358619 16
## >7:128241036-1282413 16
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >24283796-24283936 13
## >31575210-31575467 16
##
## [[18]]$rowDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 22.36068
##
## [[18]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 20.63977
##
## [[18]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[18]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[18]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[18]]$layout
## [[18]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[18]]$layout$lhei
## [1] 1.5 4.0
##
## [[18]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[19]]
## [[19]]$rowInd
## [1] 6 10 2 15 16 18 1 19 13 7 4 20 8 17 3 11 12 14 5 9
##
## [[19]]$colInd
## [1] 8 12 3 11 9 5 14 7 2 1 13 10 6 4
##
## [[19]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[19]]$carpet
## >4:8288864-8288951 2350_87BP
## >128241036-128241347 15
## >25168373-25168611 14
## >2:25168373-25168611 15
## >25161598-25161833 13
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 7
## >7:128241036-1282413 5
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >31575210-31575467 11
## >24283796-24283936 8
## >7:24283796-24283936 13
## >6:31575210-31575467 11
## >8:22055623-22055743 3973_120BP
## >128241036-128241347 14
## >25168373-25168611 15
## >2:25168373-25168611 15
## >25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >17:78358469-7835861 12
## >31575210-31575467 11
## >24283796-24283936 10
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >10:6307508-6307583 230_75BP >18611255-18611336 315_81BP
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >2:25168373-25168611 17 17
## >25161598-25161833 14 14
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >17:78358469-7835861 10 10
## >31575210-31575467 10 10
## >24283796-24283936 12 12
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >22055623-22055743 3973_120BP >6307508-6307583 230_75BP
## >128241036-128241347 6 7
## >25168373-25168611 9 11
## >2:25168373-25168611 10 10
## >25161598-25161833 9 12
## >24283548-24283843 11 10
## >7:24283548-24283843 13 12
## >78358469-78358619 10 14
## >7:128241036-1282413 13 16
## >2:25161598-25161833 11 15
## >17:78358469-7835861 13 11
## >31575210-31575467 11 13
## >24283796-24283936 12 13
## >7:24283796-24283936 10 12
## >6:31575210-31575467 8 10
## >1:18611255-18611336 315_81BP >8288864-8288951 2350_87BP
## >128241036-128241347 4 6
## >25168373-25168611 8 11
## >2:25168373-25168611 10 11
## >25161598-25161833 11 12
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >2:25161598-25161833 15 13
## >17:78358469-7835861 14 13
## >31575210-31575467 12 14
## >24283796-24283936 13 14
## >7:24283796-24283936 12 11
## >6:31575210-31575467 12 12
## >131945721-131945800 2391_79BP >5:865245-865502 1249_257BP
## >128241036-128241347 10 11
## >25168373-25168611 12 13
## >2:25168373-25168611 11 10
## >25161598-25161833 11 11
## >24283548-24283843 12 12
## >7:24283548-24283843 11 13
## >78358469-78358619 14 14
## >7:128241036-1282413 12 14
## >2:25161598-25161833 12 11
## >17:78358469-7835861 10 10
## >31575210-31575467 12 12
## >24283796-24283936 10 12
## >7:24283796-24283936 11 14
## >6:31575210-31575467 11 13
## >16:14989629-14989930 213_301BP >865245-865502 1249_257BP
## >128241036-128241347 7 9
## >25168373-25168611 9 10
## >2:25168373-25168611 12 12
## >25161598-25161833 10 11
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >78358469-78358619 14 15
## >7:128241036-1282413 14 15
## >2:25161598-25161833 12 10
## >17:78358469-7835861 14 14
## >31575210-31575467 13 14
## >24283796-24283936 14 13
## >7:24283796-24283936 13 12
## >6:31575210-31575467 12 13
## >5:10649438-10649513 11784_75BP >3611860-3611931 106_71BP
## >128241036-128241347 14 13
## >25168373-25168611 16 13
## >2:25168373-25168611 9 10
## >25161598-25161833 15 11
## >24283548-24283843 10 10
## >7:24283548-24283843 11 12
## >78358469-78358619 13 11
## >7:128241036-1282413 13 12
## >2:25161598-25161833 12 8
## >17:78358469-7835861 13 9
## >31575210-31575467 14 9
## >24283796-24283936 13 13
## >7:24283796-24283936 11 12
## >6:31575210-31575467 13 13
## >10:103584482-103584577 117_95BP
## >128241036-128241347 14
## >25168373-25168611 15
## >2:25168373-25168611 11
## >25161598-25161833 12
## >24283548-24283843 14
## >7:24283548-24283843 14
## >78358469-78358619 14
## >7:128241036-1282413 13
## >2:25161598-25161833 9
## >17:78358469-7835861 9
## >31575210-31575467 11
## >24283796-24283936 14
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >103584482-103584577 117_95BP
## >128241036-128241347 13
## >25168373-25168611 13
## >2:25168373-25168611 8
## >25161598-25161833 12
## >24283548-24283843 9
## >7:24283548-24283843 9
## >78358469-78358619 16
## >7:128241036-1282413 15
## >2:25161598-25161833 12
## >17:78358469-7835861 12
## >31575210-31575467 13
## >24283796-24283936 15
## >7:24283796-24283936 10
## >6:31575210-31575467 14
## >10649438-10649513 11784_75BP >14989629-14989930 213_301BP
## >128241036-128241347 12 11
## >25168373-25168611 14 15
## >2:25168373-25168611 8 8
## >25161598-25161833 10 10
## >24283548-24283843 10 12
## >7:24283548-24283843 12 12
## >78358469-78358619 16 15
## >7:128241036-1282413 15 17
## >2:25161598-25161833 11 14
## >17:78358469-7835861 12 16
## >31575210-31575467 13 15
## >24283796-24283936 14 15
## >7:24283796-24283936 14 11
## >6:31575210-31575467 15 15
## >4:3611860-3611931 106_71BP
## >128241036-128241347 11
## >25168373-25168611 13
## >2:25168373-25168611 6
## >25161598-25161833 9
## >24283548-24283843 11
## >7:24283548-24283843 11
## >78358469-78358619 13
## >7:128241036-1282413 16
## >2:25161598-25161833 15
## >17:78358469-7835861 13
## >31575210-31575467 14
## >24283796-24283936 13
## >7:24283796-24283936 13
## >6:31575210-31575467 13
## >5:131945721-131945800 2391_79BP
## >128241036-128241347 11
## >25168373-25168611 10
## >2:25168373-25168611 8
## >25161598-25161833 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >78358469-78358619 16
## >7:128241036-1282413 16
## >2:25161598-25161833 13
## >17:78358469-7835861 14
## >31575210-31575467 16
## >24283796-24283936 13
## >7:24283796-24283936 13
## >6:31575210-31575467 14
##
## [[19]]$rowDendrogram
## 'dendrogram' with 2 branches and 20 members total, at height 22.36068
##
## [[19]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 30
##
## [[19]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[19]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[19]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[19]]$layout
## [[19]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[19]]$layout$lhei
## [1] 1.5 4.0
##
## [[19]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[20]]
## [[20]]$rowInd
## [1] 9 8 15 11 12 7 17 6 5 10 16 4 14 13 18 3 1 2
##
## [[20]]$colInd
## [1] 14 7 2 10 13 1 3 8 12 6 4 11 9 5
##
## [[20]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[20]]$carpet
## >X:13044599-13044672 465_73BP
## >78358469-78358619 10
## >7:128241036-1282413 11
## >2:25161598-25161833 13
## >24283796-24283936 13
## >31575210-31575467 12
## >17:78358469-7835861 14
## >2:25168373-25168611 14
## >128241036-128241347 15
## >25168373-25168611 12
## >7:24283796-24283936 11
## >6:31575210-31575467 16
## >25161598-25161833 12
## >24283548-24283843 11
## >7:24283548-24283843 10
## >8:22055623-22055743 2879_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25168373-25168611 15
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >25161598-25161833 12
## >24283548-24283843 12
## >7:24283548-24283843 11
## >18611255-18611340 239_85BP >112387835-112387898 195_63BP
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >24283796-24283936 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >2:25168373-25168611 17 17
## >128241036-128241347 17 17
## >25168373-25168611 16 16
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >25161598-25161833 14 14
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >112387982-112388053 195_71BP
## >78358469-78358619 8
## >7:128241036-1282413 7
## >2:25161598-25161833 10
## >24283796-24283936 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >2:25168373-25168611 17
## >128241036-128241347 17
## >25168373-25168611 16
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >25161598-25161833 14
## >24283548-24283843 14
## >7:24283548-24283843 14
## >5:131945721-131945799 2036_78BP >3412110-3412182 212_72BP
## >78358469-78358619 16 15
## >7:128241036-1282413 16 18
## >2:25161598-25161833 13 13
## >24283796-24283936 13 15
## >31575210-31575467 16 14
## >17:78358469-7835861 14 14
## >2:25168373-25168611 8 7
## >128241036-128241347 11 11
## >25168373-25168611 10 15
## >7:24283796-24283936 13 12
## >6:31575210-31575467 14 14
## >25161598-25161833 10 11
## >24283548-24283843 10 13
## >7:24283548-24283843 12 13
## >5:10649438-10649513 13490_75BP >5:865245-865502 901_257BP
## >78358469-78358619 13 14
## >7:128241036-1282413 13 14
## >2:25161598-25161833 12 11
## >24283796-24283936 13 12
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >2:25168373-25168611 9 10
## >128241036-128241347 14 11
## >25168373-25168611 16 13
## >7:24283796-24283936 11 14
## >6:31575210-31575467 13 13
## >25161598-25161833 15 11
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >10649438-10649513 13490_75BP
## >78358469-78358619 16
## >7:128241036-1282413 15
## >2:25161598-25161833 11
## >24283796-24283936 14
## >31575210-31575467 13
## >17:78358469-7835861 12
## >2:25168373-25168611 8
## >128241036-128241347 12
## >25168373-25168611 14
## >7:24283796-24283936 14
## >6:31575210-31575467 15
## >25161598-25161833 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >22055623-22055743 2879_120BP >18:3412110-3412182 212_72BP
## >78358469-78358619 10 12
## >7:128241036-1282413 13 14
## >2:25161598-25161833 11 12
## >24283796-24283936 12 11
## >31575210-31575467 11 13
## >17:78358469-7835861 13 12
## >2:25168373-25168611 10 6
## >128241036-128241347 6 9
## >25168373-25168611 9 13
## >7:24283796-24283936 10 9
## >6:31575210-31575467 8 11
## >25161598-25161833 9 11
## >24283548-24283843 11 9
## >7:24283548-24283843 13 10
## >131945721-131945799 2036_78BP >13044599-13044672 465_73BP
## >78358469-78358619 12 12
## >7:128241036-1282413 12 14
## >2:25161598-25161833 12 12
## >24283796-24283936 10 13
## >31575210-31575467 11 12
## >17:78358469-7835861 11 15
## >2:25168373-25168611 11 11
## >128241036-128241347 11 9
## >25168373-25168611 11 9
## >7:24283796-24283936 10 12
## >6:31575210-31575467 12 12
## >25161598-25161833 10 9
## >24283548-24283843 12 10
## >7:24283548-24283843 10 13
## >865245-865502 901_257BP >1:112387982-112388053 195_71BP
## >78358469-78358619 15 16
## >7:128241036-1282413 15 16
## >2:25161598-25161833 10 14
## >24283796-24283936 13 15
## >31575210-31575467 14 13
## >17:78358469-7835861 14 13
## >2:25168373-25168611 12 10
## >128241036-128241347 9 7
## >25168373-25168611 10 10
## >7:24283796-24283936 12 11
## >6:31575210-31575467 13 12
## >25161598-25161833 11 11
## >24283548-24283843 10 11
## >7:24283548-24283843 12 11
## >1:18611255-18611340 239_85BP
## >78358469-78358619 16
## >7:128241036-1282413 15
## >2:25161598-25161833 15
## >24283796-24283936 13
## >31575210-31575467 12
## >17:78358469-7835861 14
## >2:25168373-25168611 10
## >128241036-128241347 4
## >25168373-25168611 8
## >7:24283796-24283936 12
## >6:31575210-31575467 12
## >25161598-25161833 11
## >24283548-24283843 11
## >7:24283548-24283843 9
## >1:112387835-112387898 195_63BP
## >78358469-78358619 15
## >7:128241036-1282413 15
## >2:25161598-25161833 15
## >24283796-24283936 12
## >31575210-31575467 13
## >17:78358469-7835861 12
## >2:25168373-25168611 10
## >128241036-128241347 5
## >25168373-25168611 10
## >7:24283796-24283936 12
## >6:31575210-31575467 11
## >25161598-25161833 12
## >24283548-24283843 10
## >7:24283548-24283843 11
##
## [[20]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[20]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 29.93326
##
## [[20]]$breaks
## [1] 4.00 4.28 4.56 4.84 5.12 5.40 5.68 5.96 6.24 6.52 6.80 7.08
## [13] 7.36 7.64 7.92 8.20 8.48 8.76 9.04 9.32 9.60 9.88 10.16 10.44
## [25] 10.72 11.00 11.28 11.56 11.84 12.12 12.40 12.68 12.96 13.24 13.52 13.80
## [37] 14.08 14.36 14.64 14.92 15.20 15.48 15.76 16.04 16.32 16.60 16.88 17.16
## [49] 17.44 17.72 18.00
##
## [[20]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[20]]$colorTable
## low high color
## 1 4.00 4.28 #FF0000
## 2 4.28 4.56 #FF0505
## 3 4.56 4.84 #FF0A0A
## 4 4.84 5.12 #FF0F0F
## 5 5.12 5.40 #FF1414
## 6 5.40 5.68 #FF1A1A
## 7 5.68 5.96 #FF1F1F
## 8 5.96 6.24 #FF2424
## 9 6.24 6.52 #FF2929
## 10 6.52 6.80 #FF2E2E
## 11 6.80 7.08 #FF3434
## 12 7.08 7.36 #FF3939
## 13 7.36 7.64 #FF3E3E
## 14 7.64 7.92 #FF4343
## 15 7.92 8.20 #FF4848
## 16 8.20 8.48 #FF4E4E
## 17 8.48 8.76 #FF5353
## 18 8.76 9.04 #FF5858
## 19 9.04 9.32 #FF5D5D
## 20 9.32 9.60 #FF6262
## 21 9.60 9.88 #FF6868
## 22 9.88 10.16 #FF6D6D
## 23 10.16 10.44 #FF7272
## 24 10.44 10.72 #FF7777
## 25 10.72 11.00 #FF7C7C
## 26 11.00 11.28 #FF8282
## 27 11.28 11.56 #FF8787
## 28 11.56 11.84 #FF8C8C
## 29 11.84 12.12 #FF9191
## 30 12.12 12.40 #FF9696
## 31 12.40 12.68 #FF9C9C
## 32 12.68 12.96 #FFA1A1
## 33 12.96 13.24 #FFA6A6
## 34 13.24 13.52 #FFABAB
## 35 13.52 13.80 #FFB0B0
## 36 13.80 14.08 #FFB6B6
## 37 14.08 14.36 #FFBBBB
## 38 14.36 14.64 #FFC0C0
## 39 14.64 14.92 #FFC5C5
## 40 14.92 15.20 #FFCACA
## 41 15.20 15.48 #FFD0D0
## 42 15.48 15.76 #FFD5D5
## 43 15.76 16.04 #FFDADA
## 44 16.04 16.32 #FFDFDF
## 45 16.32 16.60 #FFE4E4
## 46 16.60 16.88 #FFEAEA
## 47 16.88 17.16 #FFEFEF
## 48 17.16 17.44 #FFF4F4
## 49 17.44 17.72 #FFF9F9
## 50 17.72 18.00 #FFFFFF
##
## [[20]]$layout
## [[20]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[20]]$layout$lhei
## [1] 1.5 4.0
##
## [[20]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[21]]
## [[21]]$rowInd
## [1] 6 10 15 2 11 16 1 21 13 20 19 3 8 5 17 14 18 7 12 9 22 4
##
## [[21]]$colInd
## [1] 8 3 9 5 11 12 14 7 10 4 2 6 13 1
##
## [[21]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[21]]$carpet
## >4:8288864-8288951 5299_87BP
## >128241036-128241347 15
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 13
## >25168373-25168611 14
## >78358469-78358619 7
## >7:128241036-1282413 5
## >24283796-24283936 8
## >6:31575210-31575467 11
## >2:25161598-25161833 12
## >7:24283796-24283936 13
## >31575210-31575467 11
## >17:78358469-7835861 12
## >8:22055623-22055743 5609_120BP
## >128241036-128241347 14
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 12
## >25168373-25168611 15
## >78358469-78358619 7
## >7:128241036-1282413 7
## >24283796-24283936 10
## >6:31575210-31575467 13
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >31575210-31575467 11
## >17:78358469-7835861 12
## >18611255-18611340 612_85BP >10:6307518-6307583 297_65BP
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >2:25161598-25161833 10 10
## >7:24283796-24283936 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >Y:12869914-12869975 309_61BP
## >128241036-128241347 17
## >2:25168373-25168611 17
## >24283548-24283843 14
## >7:24283548-24283843 14
## >25161598-25161833 14
## >25168373-25168611 16
## >78358469-78358619 8
## >7:128241036-1282413 7
## >24283796-24283936 12
## >6:31575210-31575467 13
## >2:25161598-25161833 10
## >7:24283796-24283936 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >22055623-22055743 5609_120BP
## >128241036-128241347 6
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >25161598-25161833 9
## >25168373-25168611 9
## >78358469-78358619 10
## >7:128241036-1282413 13
## >24283796-24283936 12
## >6:31575210-31575467 8
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 13
## >1:18611255-18611340 612_85BP >8288864-8288951 5299_87BP
## >128241036-128241347 4 6
## >2:25168373-25168611 10 11
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >78358469-78358619 16 15
## >7:128241036-1282413 15 16
## >24283796-24283936 13 14
## >6:31575210-31575467 12 12
## >2:25161598-25161833 15 13
## >7:24283796-24283936 12 11
## >31575210-31575467 12 14
## >17:78358469-7835861 14 13
## >12869914-12869975 309_61BP >6307518-6307583 297_65BP
## >128241036-128241347 7 7
## >2:25168373-25168611 10 10
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >25161598-25161833 12 12
## >25168373-25168611 11 11
## >78358469-78358619 14 14
## >7:128241036-1282413 16 16
## >24283796-24283936 13 13
## >6:31575210-31575467 10 10
## >2:25161598-25161833 15 15
## >7:24283796-24283936 12 12
## >31575210-31575467 13 13
## >17:78358469-7835861 11 11
## >4550782-4550844 147_62BP >17:4550782-4550844 147_62BP
## >128241036-128241347 12 11
## >2:25168373-25168611 11 10
## >24283548-24283843 12 11
## >7:24283548-24283843 10 11
## >25161598-25161833 9 13
## >25168373-25168611 11 12
## >78358469-78358619 15 10
## >7:128241036-1282413 17 10
## >24283796-24283936 14 10
## >6:31575210-31575467 17 10
## >2:25161598-25161833 15 15
## >7:24283796-24283936 14 14
## >31575210-31575467 14 13
## >17:78358469-7835861 17 13
## >5:10649438-10649513 18147_75BP
## >128241036-128241347 14
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 15
## >25168373-25168611 16
## >78358469-78358619 13
## >7:128241036-1282413 13
## >24283796-24283936 13
## >6:31575210-31575467 13
## >2:25161598-25161833 12
## >7:24283796-24283936 11
## >31575210-31575467 14
## >17:78358469-7835861 13
## >22:29788944-29789092 139_148BP
## >128241036-128241347 11
## >2:25168373-25168611 11
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 8
## >25168373-25168611 9
## >78358469-78358619 12
## >7:128241036-1282413 14
## >24283796-24283936 13
## >6:31575210-31575467 14
## >2:25161598-25161833 11
## >7:24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 12
## >29788944-29789092 139_148BP
## >128241036-128241347 10
## >2:25168373-25168611 11
## >24283548-24283843 11
## >7:24283548-24283843 11
## >25161598-25161833 10
## >25168373-25168611 8
## >78358469-78358619 11
## >7:128241036-1282413 13
## >24283796-24283936 11
## >6:31575210-31575467 13
## >2:25161598-25161833 15
## >7:24283796-24283936 12
## >31575210-31575467 11
## >17:78358469-7835861 13
## >131945721-131945799 2085_78BP
## >128241036-128241347 11
## >2:25168373-25168611 11
## >24283548-24283843 12
## >7:24283548-24283843 10
## >25161598-25161833 10
## >25168373-25168611 11
## >78358469-78358619 12
## >7:128241036-1282413 12
## >24283796-24283936 10
## >6:31575210-31575467 12
## >2:25161598-25161833 12
## >7:24283796-24283936 10
## >31575210-31575467 11
## >17:78358469-7835861 11
## >29876340-29876455 143_115BP >5:865245-865502 1982_257BP
## >128241036-128241347 11 11
## >2:25168373-25168611 11 10
## >24283548-24283843 12 12
## >7:24283548-24283843 11 13
## >25161598-25161833 11 11
## >25168373-25168611 12 13
## >78358469-78358619 13 14
## >7:128241036-1282413 14 14
## >24283796-24283936 9 12
## >6:31575210-31575467 14 13
## >2:25161598-25161833 13 11
## >7:24283796-24283936 13 14
## >31575210-31575467 11 12
## >17:78358469-7835861 13 10
## >10649438-10649513 18147_75BP
## >128241036-128241347 12
## >2:25168373-25168611 8
## >24283548-24283843 10
## >7:24283548-24283843 12
## >25161598-25161833 10
## >25168373-25168611 14
## >78358469-78358619 16
## >7:128241036-1282413 15
## >24283796-24283936 14
## >6:31575210-31575467 15
## >2:25161598-25161833 11
## >7:24283796-24283936 14
## >31575210-31575467 13
## >17:78358469-7835861 12
## >5:131945721-131945799 2085_78BP >865245-865502 1982_257BP
## >128241036-128241347 11 9
## >2:25168373-25168611 8 12
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >25161598-25161833 10 11
## >25168373-25168611 10 10
## >78358469-78358619 16 15
## >7:128241036-1282413 16 15
## >24283796-24283936 13 13
## >6:31575210-31575467 14 13
## >2:25161598-25161833 13 10
## >7:24283796-24283936 13 12
## >31575210-31575467 16 14
## >17:78358469-7835861 14 14
## >20:29876340-29876455 143_115BP
## >128241036-128241347 10
## >2:25168373-25168611 12
## >24283548-24283843 8
## >7:24283548-24283843 13
## >25161598-25161833 12
## >25168373-25168611 10
## >78358469-78358619 14
## >7:128241036-1282413 15
## >24283796-24283936 14
## >6:31575210-31575467 12
## >2:25161598-25161833 12
## >7:24283796-24283936 15
## >31575210-31575467 14
## >17:78358469-7835861 13
##
## [[21]]$rowDendrogram
## 'dendrogram' with 2 branches and 22 members total, at height 22.36068
##
## [[21]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 32.24903
##
## [[21]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[21]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[21]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[21]]$layout
## [[21]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[21]]$layout$lhei
## [1] 1.5 4.0
##
## [[21]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[22]]
## [[22]]$rowInd
## [1] 12 10 3 1 6 11 7 4 2 8 13 5 9 14
##
## [[22]]$colInd
## [1] 10 7 14 3 8 11 12 9 5 4 6 2 13 1
##
## [[22]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[22]]$carpet
## >4384227-4384295 139_68BP >131945721-131945786 682_65BP
## >24283796-24283936 4 10
## >7:128241036-1282413 9 11
## >78358469-78358619 9 11
## >2:25168373-25168611 11 12
## >128241036-128241347 8 11
## >25161598-25161833 10 12
## >25168373-25168611 11 13
## >24283548-24283843 12 10
## >7:24283548-24283843 11 7
## >6:31575210-31575467 10 10
## >7:24283796-24283936 11 14
## >2:25161598-25161833 11 10
## >31575210-31575467 11 9
## >17:78358469-7835861 11 11
## >5:4384227-4384295 139_68BP >4:8288864-8288951 2466_87BP
## >24283796-24283936 9 8
## >7:128241036-1282413 5 5
## >78358469-78358619 10 7
## >2:25168373-25168611 14 15
## >128241036-128241347 12 15
## >25161598-25161833 15 13
## >25168373-25168611 14 14
## >24283548-24283843 9 12
## >7:24283548-24283843 9 11
## >6:31575210-31575467 9 11
## >7:24283796-24283936 12 13
## >2:25161598-25161833 13 12
## >31575210-31575467 12 11
## >17:78358469-7835861 10 12
## >8:22055623-22055743 2547_120BP
## >24283796-24283936 10
## >7:128241036-1282413 7
## >78358469-78358619 7
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25161598-25161833 12
## >25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >6:31575210-31575467 13
## >7:24283796-24283936 12
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 12
## >22055623-22055743 2547_120BP
## >24283796-24283936 12
## >7:128241036-1282413 13
## >78358469-78358619 10
## >2:25168373-25168611 10
## >128241036-128241347 6
## >25161598-25161833 9
## >25168373-25168611 9
## >24283548-24283843 11
## >7:24283548-24283843 13
## >6:31575210-31575467 8
## >7:24283796-24283936 10
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 13
## >X:13044599-13044672 420_73BP
## >24283796-24283936 13
## >7:128241036-1282413 11
## >78358469-78358619 10
## >2:25168373-25168611 14
## >128241036-128241347 15
## >25161598-25161833 12
## >25168373-25168611 12
## >24283548-24283843 11
## >7:24283548-24283843 10
## >6:31575210-31575467 16
## >7:24283796-24283936 11
## >2:25161598-25161833 13
## >31575210-31575467 12
## >17:78358469-7835861 14
## >5:10649438-10649513 9655_75BP >5:865245-865502 777_257BP
## >24283796-24283936 13 12
## >7:128241036-1282413 13 14
## >78358469-78358619 13 14
## >2:25168373-25168611 9 10
## >128241036-128241347 14 11
## >25161598-25161833 15 11
## >25168373-25168611 16 13
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >6:31575210-31575467 13 13
## >7:24283796-24283936 11 14
## >2:25161598-25161833 12 11
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >10649438-10649513 9655_75BP >8288864-8288951 2466_87BP
## >24283796-24283936 14 14
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >2:25168373-25168611 8 11
## >128241036-128241347 12 6
## >25161598-25161833 10 12
## >25168373-25168611 14 11
## >24283548-24283843 10 11
## >7:24283548-24283843 12 9
## >6:31575210-31575467 15 12
## >7:24283796-24283936 14 11
## >2:25161598-25161833 11 13
## >31575210-31575467 13 14
## >17:78358469-7835861 12 13
## >5:131945721-131945786 682_65BP
## >24283796-24283936 13
## >7:128241036-1282413 16
## >78358469-78358619 16
## >2:25168373-25168611 8
## >128241036-128241347 11
## >25161598-25161833 10
## >25168373-25168611 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >6:31575210-31575467 14
## >7:24283796-24283936 13
## >2:25161598-25161833 13
## >31575210-31575467 16
## >17:78358469-7835861 14
## >13044599-13044672 420_73BP >865245-865502 777_257BP
## >24283796-24283936 13 13
## >7:128241036-1282413 14 15
## >78358469-78358619 12 15
## >2:25168373-25168611 11 12
## >128241036-128241347 9 9
## >25161598-25161833 9 11
## >25168373-25168611 9 10
## >24283548-24283843 10 10
## >7:24283548-24283843 13 12
## >6:31575210-31575467 12 13
## >7:24283796-24283936 12 12
## >2:25161598-25161833 12 10
## >31575210-31575467 12 14
## >17:78358469-7835861 15 14
##
## [[22]]$rowDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 19
##
## [[22]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 21.65641
##
## [[22]]$breaks
## [1] 4.00 4.24 4.48 4.72 4.96 5.20 5.44 5.68 5.92 6.16 6.40 6.64
## [13] 6.88 7.12 7.36 7.60 7.84 8.08 8.32 8.56 8.80 9.04 9.28 9.52
## [25] 9.76 10.00 10.24 10.48 10.72 10.96 11.20 11.44 11.68 11.92 12.16 12.40
## [37] 12.64 12.88 13.12 13.36 13.60 13.84 14.08 14.32 14.56 14.80 15.04 15.28
## [49] 15.52 15.76 16.00
##
## [[22]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[22]]$colorTable
## low high color
## 1 4.00 4.24 #FF0000
## 2 4.24 4.48 #FF0505
## 3 4.48 4.72 #FF0A0A
## 4 4.72 4.96 #FF0F0F
## 5 4.96 5.20 #FF1414
## 6 5.20 5.44 #FF1A1A
## 7 5.44 5.68 #FF1F1F
## 8 5.68 5.92 #FF2424
## 9 5.92 6.16 #FF2929
## 10 6.16 6.40 #FF2E2E
## 11 6.40 6.64 #FF3434
## 12 6.64 6.88 #FF3939
## 13 6.88 7.12 #FF3E3E
## 14 7.12 7.36 #FF4343
## 15 7.36 7.60 #FF4848
## 16 7.60 7.84 #FF4E4E
## 17 7.84 8.08 #FF5353
## 18 8.08 8.32 #FF5858
## 19 8.32 8.56 #FF5D5D
## 20 8.56 8.80 #FF6262
## 21 8.80 9.04 #FF6868
## 22 9.04 9.28 #FF6D6D
## 23 9.28 9.52 #FF7272
## 24 9.52 9.76 #FF7777
## 25 9.76 10.00 #FF7C7C
## 26 10.00 10.24 #FF8282
## 27 10.24 10.48 #FF8787
## 28 10.48 10.72 #FF8C8C
## 29 10.72 10.96 #FF9191
## 30 10.96 11.20 #FF9696
## 31 11.20 11.44 #FF9C9C
## 32 11.44 11.68 #FFA1A1
## 33 11.68 11.92 #FFA6A6
## 34 11.92 12.16 #FFABAB
## 35 12.16 12.40 #FFB0B0
## 36 12.40 12.64 #FFB6B6
## 37 12.64 12.88 #FFBBBB
## 38 12.88 13.12 #FFC0C0
## 39 13.12 13.36 #FFC5C5
## 40 13.36 13.60 #FFCACA
## 41 13.60 13.84 #FFD0D0
## 42 13.84 14.08 #FFD5D5
## 43 14.08 14.32 #FFDADA
## 44 14.32 14.56 #FFDFDF
## 45 14.56 14.80 #FFE4E4
## 46 14.80 15.04 #FFEAEA
## 47 15.04 15.28 #FFEFEF
## 48 15.28 15.52 #FFF4F4
## 49 15.52 15.76 #FFF9F9
## 50 15.76 16.00 #FFFFFF
##
## [[22]]$layout
## [[22]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[22]]$layout$lhei
## [1] 1.5 4.0
##
## [[22]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[23]]
## [[23]]$rowInd
## [1] 12 4 13 5 9 15 7 6 2 10 11 14 16 3 1 17 18 8
##
## [[23]]$colInd
## [1] 7 14 3 8 12 13 1 10 4 9 5 2 11 6
##
## [[23]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[23]]$carpet
## >131945721-131945786 1027_65BP
## >7:128241036-1282413 11
## >78358469-78358619 11
## >2:25168373-25168611 12
## >128241036-128241347 11
## >25168373-25168611 13
## >31575210-31575467 9
## >17:78358469-7835861 11
## >24283796-24283936 10
## >6:31575210-31575467 10
## >24283548-24283843 10
## >7:24283548-24283843 7
## >2:25161598-25161833 10
## >25161598-25161833 12
## >7:24283796-24283936 14
## >20:29411394-29411458 392_64BP >18611255-18611316 367_61BP
## >7:128241036-1282413 10 7
## >78358469-78358619 10 8
## >2:25168373-25168611 14 17
## >128241036-128241347 13 17
## >25168373-25168611 13 16
## >31575210-31575467 7 10
## >17:78358469-7835861 11 10
## >24283796-24283936 9 12
## >6:31575210-31575467 9 13
## >24283548-24283843 12 14
## >7:24283548-24283843 14 14
## >2:25161598-25161833 12 10
## >25161598-25161833 12 14
## >7:24283796-24283936 12 12
## >4:8288864-8288951 3994_87BP
## >7:128241036-1282413 5
## >78358469-78358619 7
## >2:25168373-25168611 15
## >128241036-128241347 15
## >25168373-25168611 14
## >31575210-31575467 11
## >17:78358469-7835861 12
## >24283796-24283936 8
## >6:31575210-31575467 11
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 12
## >25161598-25161833 13
## >7:24283796-24283936 13
## >8:22055623-22055743 3993_120BP
## >7:128241036-1282413 7
## >78358469-78358619 7
## >2:25168373-25168611 15
## >128241036-128241347 14
## >25168373-25168611 15
## >31575210-31575467 11
## >17:78358469-7835861 12
## >24283796-24283936 10
## >6:31575210-31575467 13
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 11
## >25161598-25161833 12
## >7:24283796-24283936 12
## >29411394-29411458 392_64BP
## >7:128241036-1282413 12
## >78358469-78358619 12
## >2:25168373-25168611 12
## >128241036-128241347 11
## >25168373-25168611 11
## >31575210-31575467 11
## >17:78358469-7835861 12
## >24283796-24283936 12
## >6:31575210-31575467 14
## >24283548-24283843 5
## >7:24283548-24283843 10
## >2:25161598-25161833 13
## >25161598-25161833 13
## >7:24283796-24283936 12
## >5:10649438-10649513 17948_75BP >5:865245-865502 541_257BP
## >7:128241036-1282413 13 14
## >78358469-78358619 13 14
## >2:25168373-25168611 9 10
## >128241036-128241347 14 11
## >25168373-25168611 16 13
## >31575210-31575467 14 12
## >17:78358469-7835861 13 10
## >24283796-24283936 13 12
## >6:31575210-31575467 13 13
## >24283548-24283843 10 12
## >7:24283548-24283843 11 13
## >2:25161598-25161833 12 11
## >25161598-25161833 15 11
## >7:24283796-24283936 11 14
## >10:125774165-125774287 162_122BP
## >7:128241036-1282413 13
## >78358469-78358619 14
## >2:25168373-25168611 11
## >128241036-128241347 14
## >25168373-25168611 12
## >31575210-31575467 11
## >17:78358469-7835861 10
## >24283796-24283936 15
## >6:31575210-31575467 12
## >24283548-24283843 11
## >7:24283548-24283843 14
## >2:25161598-25161833 10
## >25161598-25161833 11
## >7:24283796-24283936 13
## >10649438-10649513 17948_75BP
## >7:128241036-1282413 15
## >78358469-78358619 16
## >2:25168373-25168611 8
## >128241036-128241347 12
## >25168373-25168611 14
## >31575210-31575467 13
## >17:78358469-7835861 12
## >24283796-24283936 14
## >6:31575210-31575467 15
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25161598-25161833 11
## >25161598-25161833 10
## >7:24283796-24283936 14
## >125774165-125774287 162_122BP
## >7:128241036-1282413 14
## >78358469-78358619 17
## >2:25168373-25168611 12
## >128241036-128241347 12
## >25168373-25168611 15
## >31575210-31575467 12
## >17:78358469-7835861 10
## >24283796-24283936 15
## >6:31575210-31575467 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 10
## >25161598-25161833 12
## >7:24283796-24283936 14
## >22055623-22055743 3993_120BP >65786127-65786205 136_78BP
## >7:128241036-1282413 13 13
## >78358469-78358619 10 13
## >2:25168373-25168611 10 11
## >128241036-128241347 6 10
## >25168373-25168611 9 10
## >31575210-31575467 11 12
## >17:78358469-7835861 13 13
## >24283796-24283936 12 14
## >6:31575210-31575467 8 13
## >24283548-24283843 11 11
## >7:24283548-24283843 13 12
## >2:25161598-25161833 11 8
## >25161598-25161833 9 8
## >7:24283796-24283936 10 8
## >11:65786127-65786205 136_78BP
## >7:128241036-1282413 15
## >78358469-78358619 12
## >2:25168373-25168611 9
## >128241036-128241347 11
## >25168373-25168611 13
## >31575210-31575467 14
## >17:78358469-7835861 12
## >24283796-24283936 11
## >6:31575210-31575467 12
## >24283548-24283843 10
## >7:24283548-24283843 11
## >2:25161598-25161833 11
## >25161598-25161833 9
## >7:24283796-24283936 9
## >1:18611255-18611316 367_61BP >8288864-8288951 3994_87BP
## >7:128241036-1282413 15 16
## >78358469-78358619 16 15
## >2:25168373-25168611 10 11
## >128241036-128241347 4 6
## >25168373-25168611 8 11
## >31575210-31575467 12 14
## >17:78358469-7835861 14 13
## >24283796-24283936 13 14
## >6:31575210-31575467 12 12
## >24283548-24283843 11 11
## >7:24283548-24283843 9 9
## >2:25161598-25161833 15 13
## >25161598-25161833 11 12
## >7:24283796-24283936 12 11
## >865245-865502 541_257BP >5:131945721-131945786 1027_65BP
## >7:128241036-1282413 15 16
## >78358469-78358619 15 16
## >2:25168373-25168611 12 8
## >128241036-128241347 9 11
## >25168373-25168611 10 10
## >31575210-31575467 14 16
## >17:78358469-7835861 14 14
## >24283796-24283936 13 13
## >6:31575210-31575467 13 14
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >2:25161598-25161833 10 13
## >25161598-25161833 11 10
## >7:24283796-24283936 12 13
##
## [[23]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[23]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 25.27845
##
## [[23]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[23]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[23]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[23]]$layout
## [[23]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[23]]$layout$lhei
## [1] 1.5 4.0
##
## [[23]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[24]]
## [[24]]$rowInd
## [1] 8 12 7 13 2 9 14 1 11 17 6 18 3 4 10 15 16 5
##
## [[24]]$colInd
## [1] 14 7 2 13 1 10 8 3 9 5 11 12 6 4
##
## [[24]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[24]]$carpet
## >9:31321373-31321440 119_67BP
## >78358469-78358619 8
## >7:128241036-1282413 9
## >2:25161598-25161833 10
## >31575210-31575467 10
## >17:78358469-7835861 9
## >24283796-24283936 8
## >128241036-128241347 11
## >2:25168373-25168611 13
## >24283548-24283843 11
## >7:24283548-24283843 12
## >25161598-25161833 11
## >25168373-25168611 12
## >7:24283796-24283936 11
## >6:31575210-31575467 10
## >131945721-131945786 780_65BP
## >78358469-78358619 11
## >7:128241036-1282413 11
## >2:25161598-25161833 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >24283796-24283936 10
## >128241036-128241347 11
## >2:25168373-25168611 12
## >24283548-24283843 10
## >7:24283548-24283843 7
## >25161598-25161833 12
## >25168373-25168611 13
## >7:24283796-24283936 14
## >6:31575210-31575467 10
## >8:22055623-22055743 3376_120BP
## >78358469-78358619 7
## >7:128241036-1282413 7
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 12
## >24283796-24283936 10
## >128241036-128241347 14
## >2:25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >25161598-25161833 12
## >25168373-25168611 15
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >18611255-18611324 366_69BP >10:6307518-6307583 387_65BP
## >78358469-78358619 8 8
## >7:128241036-1282413 7 7
## >2:25161598-25161833 10 10
## >31575210-31575467 10 10
## >17:78358469-7835861 10 10
## >24283796-24283936 12 12
## >128241036-128241347 17 17
## >2:25168373-25168611 17 17
## >24283548-24283843 14 14
## >7:24283548-24283843 14 14
## >25161598-25161833 14 14
## >25168373-25168611 16 16
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 13
## >Y:12869910-12869975 374_65BP
## >78358469-78358619 8
## >7:128241036-1282413 7
## >2:25161598-25161833 10
## >31575210-31575467 10
## >17:78358469-7835861 10
## >24283796-24283936 12
## >128241036-128241347 17
## >2:25168373-25168611 17
## >24283548-24283843 14
## >7:24283548-24283843 14
## >25161598-25161833 14
## >25168373-25168611 16
## >7:24283796-24283936 12
## >6:31575210-31575467 13
## >22055623-22055743 3376_120BP
## >78358469-78358619 10
## >7:128241036-1282413 13
## >2:25161598-25161833 11
## >31575210-31575467 11
## >17:78358469-7835861 13
## >24283796-24283936 12
## >128241036-128241347 6
## >2:25168373-25168611 10
## >24283548-24283843 11
## >7:24283548-24283843 13
## >25161598-25161833 9
## >25168373-25168611 9
## >7:24283796-24283936 10
## >6:31575210-31575467 8
## >1:18611255-18611324 366_69BP >12869910-12869975 374_65BP
## >78358469-78358619 16 14
## >7:128241036-1282413 15 16
## >2:25161598-25161833 15 15
## >31575210-31575467 12 13
## >17:78358469-7835861 14 11
## >24283796-24283936 13 13
## >128241036-128241347 4 7
## >2:25168373-25168611 10 10
## >24283548-24283843 11 10
## >7:24283548-24283843 9 12
## >25161598-25161833 11 12
## >25168373-25168611 8 11
## >7:24283796-24283936 12 12
## >6:31575210-31575467 12 10
## >6307518-6307583 387_65BP >5:131945721-131945786 780_65BP
## >78358469-78358619 14 16
## >7:128241036-1282413 16 16
## >2:25161598-25161833 15 13
## >31575210-31575467 13 16
## >17:78358469-7835861 11 14
## >24283796-24283936 13 13
## >128241036-128241347 7 11
## >2:25168373-25168611 10 8
## >24283548-24283843 10 10
## >7:24283548-24283843 12 12
## >25161598-25161833 12 10
## >25168373-25168611 11 10
## >7:24283796-24283936 12 13
## >6:31575210-31575467 10 14
## >865245-865502 2334_257BP >17:43665375-43665443 115_68BP
## >78358469-78358619 15 13
## >7:128241036-1282413 15 17
## >2:25161598-25161833 10 12
## >31575210-31575467 14 14
## >17:78358469-7835861 14 15
## >24283796-24283936 13 15
## >128241036-128241347 9 11
## >2:25168373-25168611 12 12
## >24283548-24283843 10 13
## >7:24283548-24283843 12 12
## >25161598-25161833 11 9
## >25168373-25168611 10 9
## >7:24283796-24283936 12 12
## >6:31575210-31575467 13 14
## >5:865245-865502 2334_257BP >10649438-10649513 8206_75BP
## >78358469-78358619 14 16
## >7:128241036-1282413 14 15
## >2:25161598-25161833 11 11
## >31575210-31575467 12 13
## >17:78358469-7835861 10 12
## >24283796-24283936 12 14
## >128241036-128241347 11 12
## >2:25168373-25168611 10 8
## >24283548-24283843 12 10
## >7:24283548-24283843 13 12
## >25161598-25161833 11 10
## >25168373-25168611 13 14
## >7:24283796-24283936 14 14
## >6:31575210-31575467 13 15
## >31321373-31321440 119_67BP >43665375-43665443 115_68BP
## >78358469-78358619 12 12
## >7:128241036-1282413 13 13
## >2:25161598-25161833 12 11
## >31575210-31575467 13 14
## >17:78358469-7835861 12 11
## >24283796-24283936 11 12
## >128241036-128241347 13 13
## >2:25168373-25168611 10 7
## >24283548-24283843 10 10
## >7:24283548-24283843 6 11
## >25161598-25161833 12 12
## >25168373-25168611 14 15
## >7:24283796-24283936 13 11
## >6:31575210-31575467 16 11
## >5:10649438-10649513 8206_75BP
## >78358469-78358619 13
## >7:128241036-1282413 13
## >2:25161598-25161833 12
## >31575210-31575467 14
## >17:78358469-7835861 13
## >24283796-24283936 13
## >128241036-128241347 14
## >2:25168373-25168611 9
## >24283548-24283843 10
## >7:24283548-24283843 11
## >25161598-25161833 15
## >25168373-25168611 16
## >7:24283796-24283936 11
## >6:31575210-31575467 13
##
## [[24]]$rowDendrogram
## 'dendrogram' with 2 branches and 18 members total, at height 22.36068
##
## [[24]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 28.30194
##
## [[24]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[24]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[24]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[24]]$layout
## [[24]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[24]]$layout$lhei
## [1] 1.5 4.0
##
## [[24]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[25]]
## [[25]]$rowInd
## [1] 27 8 16 21 37 19 15 25 1 32 41 3 38 10 2 36 12 17 26 24 28 13 9 23 5
## [26] 31 40 20 42 30 29 22 44 34 46 6 7 33 11 4 39 43 18 45 35 14
##
## [[25]]$colInd
## [1] 4 13 1 14 10 7 3 11 8 12 9 5 2 6
##
## [[25]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[25]]$carpet
## >130916242-130916335 212_93BP
## >6:31575210-31575467 13
## >31575210-31575467 15
## >17:78358469-7835861 13
## >78358469-78358619 15
## >24283796-24283936 15
## >7:128241036-1282413 13
## >2:25168373-25168611 12
## >25161598-25161833 12
## >128241036-128241347 14
## >25168373-25168611 15
## >24283548-24283843 14
## >7:24283548-24283843 14
## >2:25161598-25161833 10
## >7:24283796-24283936 13
## >16:70251562-70251701 243_139BP
## >6:31575210-31575467 17
## >31575210-31575467 16
## >17:78358469-7835861 15
## >78358469-78358619 16
## >24283796-24283936 16
## >7:128241036-1282413 16
## >2:25168373-25168611 10
## >25161598-25161833 9
## >128241036-128241347 12
## >25168373-25168611 15
## >24283548-24283843 13
## >7:24283548-24283843 12
## >2:25161598-25161833 13
## >7:24283796-24283936 12
## >6:39792402-39792463 228_61BP
## >6:31575210-31575467 17
## >31575210-31575467 17
## >17:78358469-7835861 16
## >78358469-78358619 16
## >24283796-24283936 16
## >7:128241036-1282413 17
## >2:25168373-25168611 10
## >25161598-25161833 10
## >128241036-128241347 13
## >25168373-25168611 14
## >24283548-24283843 14
## >7:24283548-24283843 12
## >2:25161598-25161833 14
## >7:24283796-24283936 14
## >9:36136741-36136851 380_110BP
## >6:31575210-31575467 14
## >31575210-31575467 14
## >17:78358469-7835861 15
## >78358469-78358619 14
## >24283796-24283936 14
## >7:128241036-1282413 16
## >2:25168373-25168611 7
## >25161598-25161833 10
## >128241036-128241347 10
## >25168373-25168611 11
## >24283548-24283843 12
## >7:24283548-24283843 13
## >2:25161598-25161833 10
## >7:24283796-24283936 12
## >32347230-32347346 160_116BP
## >6:31575210-31575467 11
## >31575210-31575467 14
## >17:78358469-7835861 15
## >78358469-78358619 14
## >24283796-24283936 14
## >7:128241036-1282413 15
## >2:25168373-25168611 8
## >25161598-25161833 9
## >128241036-128241347 10
## >25168373-25168611 11
## >24283548-24283843 13
## >7:24283548-24283843 13
## >2:25161598-25161833 12
## >7:24283796-24283936 14
## >8:66712550-66712702 3980_152BP
## >6:31575210-31575467 13
## >31575210-31575467 14
## >17:78358469-7835861 14
## >78358469-78358619 15
## >24283796-24283936 13
## >7:128241036-1282413 16
## >2:25168373-25168611 9
## >25161598-25161833 10
## >128241036-128241347 9
## >25168373-25168611 10
## >24283548-24283843 10
## >7:24283548-24283843 11
## >2:25161598-25161833 13
## >7:24283796-24283936 13
## >5:131945721-131945786 511_65BP
## >6:31575210-31575467 14
## >31575210-31575467 16
## >17:78358469-7835861 14
## >78358469-78358619 16
## >24283796-24283936 13
## >7:128241036-1282413 16
## >2:25168373-25168611 8
## >25161598-25161833 10
## >128241036-128241347 11
## >25168373-25168611 10
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25161598-25161833 13
## >7:24283796-24283936 13
## >10649439-10649513 1822_74BP
## >6:31575210-31575467 15
## >31575210-31575467 13
## >17:78358469-7835861 12
## >78358469-78358619 16
## >24283796-24283936 14
## >7:128241036-1282413 15
## >2:25168373-25168611 8
## >25161598-25161833 10
## >128241036-128241347 12
## >25168373-25168611 14
## >24283548-24283843 10
## >7:24283548-24283843 12
## >2:25161598-25161833 11
## >7:24283796-24283936 14
## >1:164321420-164321491 119_71BP
## >6:31575210-31575467 15
## >31575210-31575467 15
## >17:78358469-7835861 13
## >78358469-78358619 16
## >24283796-24283936 15
## >7:128241036-1282413 15
## >2:25168373-25168611 8
## >25161598-25161833 12
## >128241036-128241347 11
## >25168373-25168611 12
## >24283548-24283843 12
## >7:24283548-24283843 14
## >2:25161598-25161833 12
## >7:24283796-24283936 15
## >15786192-15786281 179_89BP >66712550-66712702 3980_152BP
## >6:31575210-31575467 13 13
## >31575210-31575467 14 15
## >17:78358469-7835861 14 14
## >78358469-78358619 16 16
## >24283796-24283936 16 16
## >7:128241036-1282413 16 17
## >2:25168373-25168611 7 7
## >25161598-25161833 11 12
## >128241036-128241347 13 12
## >25168373-25168611 12 13
## >24283548-24283843 11 12
## >7:24283548-24283843 15 12
## >2:25161598-25161833 12 12
## >7:24283796-24283936 14 13
## >10:32347230-32347346 160_116BP
## >6:31575210-31575467 15
## >31575210-31575467 15
## >17:78358469-7835861 14
## >78358469-78358619 17
## >24283796-24283936 15
## >7:128241036-1282413 14
## >2:25168373-25168611 10
## >25161598-25161833 11
## >128241036-128241347 13
## >25168373-25168611 11
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 13
## >7:24283796-24283936 11
## >36136741-36136851 380_110BP
## >6:31575210-31575467 14
## >31575210-31575467 15
## >17:78358469-7835861 14
## >78358469-78358619 15
## >24283796-24283936 15
## >7:128241036-1282413 15
## >2:25168373-25168611 10
## >25161598-25161833 10
## >128241036-128241347 12
## >25168373-25168611 13
## >24283548-24283843 12
## >7:24283548-24283843 13
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >17:15786192-15786281 179_89BP
## >6:31575210-31575467 15
## >31575210-31575467 14
## >17:78358469-7835861 14
## >78358469-78358619 15
## >24283796-24283936 16
## >7:128241036-1282413 16
## >2:25168373-25168611 10
## >25161598-25161833 11
## >128241036-128241347 12
## >25168373-25168611 11
## >24283548-24283843 10
## >7:24283548-24283843 13
## >2:25161598-25161833 12
## >7:24283796-24283936 13
## >1:240093617-240093698 148_81BP
## >6:31575210-31575467 16
## >31575210-31575467 15
## >17:78358469-7835861 14
## >78358469-78358619 16
## >24283796-24283936 15
## >7:128241036-1282413 16
## >2:25168373-25168611 8
## >25161598-25161833 9
## >128241036-128241347 12
## >25168373-25168611 12
## >24283548-24283843 12
## >7:24283548-24283843 12
## >2:25161598-25161833 13
## >7:24283796-24283936 12
## >30812217-30812293 326_76BP >4:8288864-8288951 810_87BP
## >6:31575210-31575467 15 11
## >31575210-31575467 14 11
## >17:78358469-7835861 13 12
## >78358469-78358619 17 7
## >24283796-24283936 15 8
## >7:128241036-1282413 17 5
## >2:25168373-25168611 8 15
## >25161598-25161833 11 13
## >128241036-128241347 12 15
## >25168373-25168611 12 14
## >24283548-24283843 12 12
## >7:24283548-24283843 13 11
## >2:25161598-25161833 11 12
## >7:24283796-24283936 12 13
## >8:22055623-22055726 220_103BP
## >6:31575210-31575467 13
## >31575210-31575467 11
## >17:78358469-7835861 12
## >78358469-78358619 7
## >24283796-24283936 10
## >7:128241036-1282413 7
## >2:25168373-25168611 15
## >25161598-25161833 12
## >128241036-128241347 14
## >25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 11
## >2:25161598-25161833 11
## >7:24283796-24283936 12
## >122261613-122261700 844_87BP
## >6:31575210-31575467 16
## >31575210-31575467 11
## >17:78358469-7835861 13
## >78358469-78358619 12
## >24283796-24283936 7
## >7:128241036-1282413 11
## >2:25168373-25168611 12
## >25161598-25161833 13
## >128241036-128241347 13
## >25168373-25168611 13
## >24283548-24283843 11
## >7:24283548-24283843 10
## >2:25161598-25161833 13
## >7:24283796-24283936 13
## >100372360-100372458 518_98BP
## >6:31575210-31575467 12
## >31575210-31575467 10
## >17:78358469-7835861 10
## >78358469-78358619 12
## >24283796-24283936 7
## >7:128241036-1282413 8
## >2:25168373-25168611 10
## >25161598-25161833 13
## >128241036-128241347 11
## >25168373-25168611 13
## >24283548-24283843 8
## >7:24283548-24283843 8
## >2:25161598-25161833 11
## >7:24283796-24283936 13
## >131945721-131945786 511_65BP
## >6:31575210-31575467 10
## >31575210-31575467 9
## >17:78358469-7835861 11
## >78358469-78358619 11
## >24283796-24283936 10
## >7:128241036-1282413 11
## >2:25168373-25168611 12
## >25161598-25161833 12
## >128241036-128241347 11
## >25168373-25168611 13
## >24283548-24283843 10
## >7:24283548-24283843 7
## >2:25161598-25161833 10
## >7:24283796-24283936 14
## >4:122261613-122261700 844_87BP
## >6:31575210-31575467 7
## >31575210-31575467 9
## >17:78358469-7835861 8
## >78358469-78358619 10
## >24283796-24283936 8
## >7:128241036-1282413 11
## >2:25168373-25168611 11
## >25161598-25161833 10
## >128241036-128241347 4
## >25168373-25168611 9
## >24283548-24283843 9
## >7:24283548-24283843 12
## >2:25161598-25161833 10
## >7:24283796-24283936 10
## >17:13254784-13254854 276_70BP >X:5359719-5359783 196_64BP
## >6:31575210-31575467 10 8
## >31575210-31575467 10 12
## >17:78358469-7835861 11 11
## >78358469-78358619 9 9
## >24283796-24283936 12 11
## >7:128241036-1282413 11 11
## >2:25168373-25168611 11 10
## >25161598-25161833 9 13
## >128241036-128241347 10 11
## >25168373-25168611 9 11
## >24283548-24283843 13 12
## >7:24283548-24283843 13 13
## >2:25161598-25161833 8 11
## >7:24283796-24283936 9 10
## >12:100372360-100372458 518_98BP
## >6:31575210-31575467 10
## >31575210-31575467 11
## >17:78358469-7835861 13
## >78358469-78358619 7
## >24283796-24283936 11
## >7:128241036-1282413 12
## >2:25168373-25168611 13
## >25161598-25161833 11
## >128241036-128241347 13
## >25168373-25168611 12
## >24283548-24283843 9
## >7:24283548-24283843 12
## >2:25161598-25161833 13
## >7:24283796-24283936 10
## >14989693-14989865 116_172BP >5359719-5359783 196_64BP
## >6:31575210-31575467 14 12
## >31575210-31575467 11 7
## >17:78358469-7835861 13 11
## >78358469-78358619 10 13
## >24283796-24283936 13 10
## >7:128241036-1282413 14 10
## >2:25168373-25168611 11 12
## >25161598-25161833 10 8
## >128241036-128241347 14 9
## >25168373-25168611 14 11
## >24283548-24283843 11 10
## >7:24283548-24283843 12 12
## >2:25161598-25161833 10 9
## >7:24283796-24283936 9 9
## >9:76145-76236 360_91BP >68354257-68354348 360_91BP
## >6:31575210-31575467 12 12
## >31575210-31575467 10 10
## >17:78358469-7835861 13 13
## >78358469-78358619 10 10
## >24283796-24283936 11 11
## >7:128241036-1282413 11 11
## >2:25168373-25168611 11 11
## >25161598-25161833 10 10
## >128241036-128241347 9 9
## >25168373-25168611 9 9
## >24283548-24283843 9 9
## >7:24283548-24283843 11 11
## >2:25161598-25161833 13 13
## >7:24283796-24283936 9 9
## >138508460-138508543 879_83BP >13254784-13254854 276_70BP
## >6:31575210-31575467 13 12
## >31575210-31575467 8 8
## >17:78358469-7835861 10 9
## >78358469-78358619 10 10
## >24283796-24283936 11 10
## >7:128241036-1282413 12 11
## >2:25168373-25168611 14 11
## >25161598-25161833 12 12
## >128241036-128241347 12 10
## >25168373-25168611 11 11
## >24283548-24283843 10 10
## >7:24283548-24283843 11 12
## >2:25161598-25161833 13 11
## >7:24283796-24283936 11 12
## >9:68354257-68354348 360_91BP >76145-76236 360_91BP
## >6:31575210-31575467 11 11
## >31575210-31575467 10 10
## >17:78358469-7835861 11 11
## >78358469-78358619 10 10
## >24283796-24283936 10 10
## >7:128241036-1282413 10 10
## >2:25168373-25168611 12 12
## >25161598-25161833 12 12
## >128241036-128241347 12 12
## >25168373-25168611 12 12
## >24283548-24283843 10 10
## >7:24283548-24283843 13 13
## >2:25161598-25161833 10 10
## >7:24283796-24283936 10 10
## >22055623-22055726 220_103BP >8288864-8288951 810_87BP
## >6:31575210-31575467 13 12
## >31575210-31575467 12 14
## >17:78358469-7835861 14 13
## >78358469-78358619 14 15
## >24283796-24283936 12 14
## >7:128241036-1282413 14 16
## >2:25168373-25168611 9 11
## >25161598-25161833 12 12
## >128241036-128241347 9 6
## >25168373-25168611 9 11
## >24283548-24283843 9 11
## >7:24283548-24283843 9 9
## >2:25161598-25161833 14 13
## >7:24283796-24283936 12 11
## >15:80403871-80403944 491_73BP
## >6:31575210-31575467 13
## >31575210-31575467 11
## >17:78358469-7835861 11
## >78358469-78358619 14
## >24283796-24283936 14
## >7:128241036-1282413 14
## >2:25168373-25168611 10
## >25161598-25161833 10
## >128241036-128241347 10
## >25168373-25168611 11
## >24283548-24283843 9
## >7:24283548-24283843 13
## >2:25161598-25161833 11
## >7:24283796-24283936 13
## >16:14989693-14989865 116_172BP
## >6:31575210-31575467 12
## >31575210-31575467 11
## >17:78358469-7835861 14
## >78358469-78358619 14
## >24283796-24283936 14
## >7:128241036-1282413 14
## >2:25168373-25168611 13
## >25161598-25161833 10
## >128241036-128241347 11
## >25168373-25168611 9
## >24283548-24283843 11
## >7:24283548-24283843 13
## >2:25161598-25161833 11
## >7:24283796-24283936 13
## >164321420-164321491 119_71BP
## >6:31575210-31575467 10
## >31575210-31575467 12
## >17:78358469-7835861 11
## >78358469-78358619 10
## >24283796-24283936 11
## >7:128241036-1282413 10
## >2:25168373-25168611 8
## >25161598-25161833 12
## >128241036-128241347 9
## >25168373-25168611 12
## >24283548-24283843 9
## >7:24283548-24283843 9
## >2:25161598-25161833 9
## >7:24283796-24283936 11
## >3:138508460-138508543 879_83BP
## >6:31575210-31575467 11
## >31575210-31575467 11
## >17:78358469-7835861 9
## >78358469-78358619 11
## >24283796-24283936 13
## >7:128241036-1282413 11
## >2:25168373-25168611 10
## >25161598-25161833 13
## >128241036-128241347 11
## >25168373-25168611 15
## >24283548-24283843 10
## >7:24283548-24283843 11
## >2:25161598-25161833 9
## >7:24283796-24283936 9
## >11:130916242-130916335 212_93BP
## >6:31575210-31575467 11
## >31575210-31575467 13
## >17:78358469-7835861 11
## >78358469-78358619 12
## >24283796-24283936 11
## >7:128241036-1282413 10
## >2:25168373-25168611 11
## >25161598-25161833 13
## >128241036-128241347 13
## >25168373-25168611 15
## >24283548-24283843 12
## >7:24283548-24283843 8
## >2:25161598-25161833 9
## >7:24283796-24283936 12
## >39792402-39792463 228_61BP >70251562-70251701 243_139BP
## >6:31575210-31575467 12 12
## >31575210-31575467 13 12
## >17:78358469-7835861 12 13
## >78358469-78358619 13 13
## >24283796-24283936 11 14
## >7:128241036-1282413 11 14
## >2:25168373-25168611 11 6
## >25161598-25161833 14 10
## >128241036-128241347 12 11
## >25168373-25168611 12 11
## >24283548-24283843 11 10
## >7:24283548-24283843 11 13
## >2:25161598-25161833 10 10
## >7:24283796-24283936 13 12
## >8:30812217-30812293 326_76BP >80403871-80403944 491_73BP
## >6:31575210-31575467 14 13
## >31575210-31575467 12 14
## >17:78358469-7835861 10 14
## >78358469-78358619 13 14
## >24283796-24283936 14 12
## >7:128241036-1282413 14 14
## >2:25168373-25168611 6 8
## >25161598-25161833 11 14
## >128241036-128241347 12 12
## >25168373-25168611 13 13
## >24283548-24283843 11 10
## >7:24283548-24283843 12 12
## >2:25161598-25161833 11 14
## >7:24283796-24283936 10 10
## >240093617-240093698 148_81BP
## >6:31575210-31575467 14
## >31575210-31575467 12
## >17:78358469-7835861 12
## >78358469-78358619 12
## >24283796-24283936 11
## >7:128241036-1282413 13
## >2:25168373-25168611 8
## >25161598-25161833 13
## >128241036-128241347 12
## >25168373-25168611 15
## >24283548-24283843 10
## >7:24283548-24283843 10
## >2:25161598-25161833 11
## >7:24283796-24283936 11
## >5:10649439-10649513 1822_74BP
## >6:31575210-31575467 14
## >31575210-31575467 12
## >17:78358469-7835861 12
## >78358469-78358619 12
## >24283796-24283936 11
## >7:128241036-1282413 13
## >2:25168373-25168611 7
## >25161598-25161833 14
## >128241036-128241347 13
## >25168373-25168611 16
## >24283548-24283843 10
## >7:24283548-24283843 10
## >2:25161598-25161833 11
## >7:24283796-24283936 11
##
## [[25]]$rowDendrogram
## 'dendrogram' with 2 branches and 46 members total, at height 22.97825
##
## [[25]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 36.40055
##
## [[25]]$breaks
## [1] 4.00 4.26 4.52 4.78 5.04 5.30 5.56 5.82 6.08 6.34 6.60 6.86
## [13] 7.12 7.38 7.64 7.90 8.16 8.42 8.68 8.94 9.20 9.46 9.72 9.98
## [25] 10.24 10.50 10.76 11.02 11.28 11.54 11.80 12.06 12.32 12.58 12.84 13.10
## [37] 13.36 13.62 13.88 14.14 14.40 14.66 14.92 15.18 15.44 15.70 15.96 16.22
## [49] 16.48 16.74 17.00
##
## [[25]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[25]]$colorTable
## low high color
## 1 4.00 4.26 #FF0000
## 2 4.26 4.52 #FF0505
## 3 4.52 4.78 #FF0A0A
## 4 4.78 5.04 #FF0F0F
## 5 5.04 5.30 #FF1414
## 6 5.30 5.56 #FF1A1A
## 7 5.56 5.82 #FF1F1F
## 8 5.82 6.08 #FF2424
## 9 6.08 6.34 #FF2929
## 10 6.34 6.60 #FF2E2E
## 11 6.60 6.86 #FF3434
## 12 6.86 7.12 #FF3939
## 13 7.12 7.38 #FF3E3E
## 14 7.38 7.64 #FF4343
## 15 7.64 7.90 #FF4848
## 16 7.90 8.16 #FF4E4E
## 17 8.16 8.42 #FF5353
## 18 8.42 8.68 #FF5858
## 19 8.68 8.94 #FF5D5D
## 20 8.94 9.20 #FF6262
## 21 9.20 9.46 #FF6868
## 22 9.46 9.72 #FF6D6D
## 23 9.72 9.98 #FF7272
## 24 9.98 10.24 #FF7777
## 25 10.24 10.50 #FF7C7C
## 26 10.50 10.76 #FF8282
## 27 10.76 11.02 #FF8787
## 28 11.02 11.28 #FF8C8C
## 29 11.28 11.54 #FF9191
## 30 11.54 11.80 #FF9696
## 31 11.80 12.06 #FF9C9C
## 32 12.06 12.32 #FFA1A1
## 33 12.32 12.58 #FFA6A6
## 34 12.58 12.84 #FFABAB
## 35 12.84 13.10 #FFB0B0
## 36 13.10 13.36 #FFB6B6
## 37 13.36 13.62 #FFBBBB
## 38 13.62 13.88 #FFC0C0
## 39 13.88 14.14 #FFC5C5
## 40 14.14 14.40 #FFCACA
## 41 14.40 14.66 #FFD0D0
## 42 14.66 14.92 #FFD5D5
## 43 14.92 15.18 #FFDADA
## 44 15.18 15.44 #FFDFDF
## 45 15.44 15.70 #FFE4E4
## 46 15.70 15.96 #FFEAEA
## 47 15.96 16.22 #FFEFEF
## 48 16.22 16.48 #FFF4F4
## 49 16.48 16.74 #FFF9F9
## 50 16.74 17.00 #FFFFFF
##
## [[25]]$layout
## [[25]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[25]]$layout$lhei
## [1] 1.5 4.0
##
## [[25]]$layout$lwid
## [1] 1.5 4.0
##
##
##
## [[26]]
## [[26]]$rowInd
## [1] 11 7 3 13 1 10 12 14 9 6 2 4 8 5
##
## [[26]]$colInd
## [1] 9 10 7 5 12 11 4 8 14 6 3 13 1 2
##
## [[26]]$call
## heatmap.2(x = adist(seq, amp), scale = "none", col = colfunc(50),
## trace = "none", margins = c(15, 20), main = names(oft2)[z])
##
## [[26]]$carpet
## >54011707-54011774 169_67BP >7:45596896-45596960 127_64BP
## >24283548-24283843 11 7
## >24283796-24283936 10 14
## >7:128241036-1282413 11 14
## >7:24283548-24283843 13 11
## >25168373-25168611 10 12
## >25161598-25161833 10 12
## >6:31575210-31575467 8 12
## >128241036-128241347 7 10
## >78358469-78358619 7 10
## >7:24283796-24283936 9 10
## >2:25168373-25168611 10 9
## >31575210-31575467 10 13
## >17:78358469-7835861 12 12
## >2:25161598-25161833 10 13
## >15:26275973-26276063 226_90BP >55273510-55273577 140_67BP
## >24283548-24283843 10 10
## >24283796-24283936 9 10
## >7:128241036-1282413 10 11
## >7:24283548-24283843 10 13
## >25168373-25168611 13 10
## >25161598-25161833 12 12
## >6:31575210-31575467 8 8
## >128241036-128241347 10 10
## >78358469-78358619 11 12
## >7:24283796-24283936 12 14
## >2:25168373-25168611 12 13
## >31575210-31575467 13 12
## >17:78358469-7835861 12 10
## >2:25161598-25161833 14 13
## >10:54011707-54011774 169_67BP >45596896-45596960 127_64BP
## >24283548-24283843 11 11
## >24283796-24283936 9 11
## >7:128241036-1282413 11 13
## >7:24283548-24283843 11 13
## >25168373-25168611 8 10
## >25161598-25161833 11 10
## >6:31575210-31575467 13 10
## >128241036-128241347 10 10
## >78358469-78358619 11 12
## >7:24283796-24283936 11 11
## >2:25168373-25168611 12 13
## >31575210-31575467 13 11
## >17:78358469-7835861 15 12
## >2:25161598-25161833 15 16
## >54751950-54752026 468_76BP >78125849-78125923 122_74BP
## >24283548-24283843 13 12
## >24283796-24283936 9 11
## >7:128241036-1282413 9 11
## >7:24283548-24283843 10 14
## >25168373-25168611 15 9
## >25161598-25161833 15 10
## >6:31575210-31575467 8 13
## >128241036-128241347 12 11
## >78358469-78358619 10 12
## >7:24283796-24283936 10 10
## >2:25168373-25168611 12 12
## >31575210-31575467 11 8
## >17:78358469-7835861 12 10
## >2:25161598-25161833 12 9
## >26275973-26276063 226_90BP >6:54751950-54752026 468_76BP
## >24283548-24283843 10 10
## >24283796-24283936 10 10
## >7:128241036-1282413 11 7
## >7:24283548-24283843 11 9
## >25168373-25168611 13 13
## >25161598-25161833 13 13
## >6:31575210-31575467 12 13
## >128241036-128241347 12 12
## >78358469-78358619 14 9
## >7:24283796-24283936 10 11
## >2:25168373-25168611 9 14
## >31575210-31575467 10 9
## >17:78358469-7835861 8 14
## >2:25161598-25161833 10 12
## >12:55273510-55273577 140_67BP
## >24283548-24283843 6
## >24283796-24283936 10
## >7:128241036-1282413 11
## >7:24283548-24283843 10
## >25168373-25168611 11
## >25161598-25161833 12
## >6:31575210-31575467 13
## >128241036-128241347 12
## >78358469-78358619 11
## >7:24283796-24283936 12
## >2:25168373-25168611 14
## >31575210-31575467 11
## >17:78358469-7835861 12
## >2:25161598-25161833 14
## >4:13436399-13436471 116_72BP >13436399-13436471 116_72BP
## >24283548-24283843 10 10
## >24283796-24283936 11 12
## >7:128241036-1282413 9 8
## >7:24283548-24283843 9 11
## >25168373-25168611 13 13
## >25161598-25161833 14 11
## >6:31575210-31575467 13 13
## >128241036-128241347 12 14
## >78358469-78358619 14 12
## >7:24283796-24283936 14 12
## >2:25168373-25168611 13 12
## >31575210-31575467 10 12
## >17:78358469-7835861 12 9
## >2:25161598-25161833 13 12
## >4:78125849-78125923 122_74BP
## >24283548-24283843 11
## >24283796-24283936 11
## >7:128241036-1282413 11
## >7:24283548-24283843 12
## >25168373-25168611 15
## >25161598-25161833 13
## >6:31575210-31575467 14
## >128241036-128241347 14
## >78358469-78358619 14
## >7:24283796-24283936 13
## >2:25168373-25168611 13
## >31575210-31575467 12
## >17:78358469-7835861 10
## >2:25161598-25161833 11
##
## [[26]]$rowDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 14.28286
##
## [[26]]$colDendrogram
## 'dendrogram' with 2 branches and 14 members total, at height 13.92839
##
## [[26]]$breaks
## [1] 6.0 6.2 6.4 6.6 6.8 7.0 7.2 7.4 7.6 7.8 8.0 8.2 8.4 8.6 8.8
## [16] 9.0 9.2 9.4 9.6 9.8 10.0 10.2 10.4 10.6 10.8 11.0 11.2 11.4 11.6 11.8
## [31] 12.0 12.2 12.4 12.6 12.8 13.0 13.2 13.4 13.6 13.8 14.0 14.2 14.4 14.6 14.8
## [46] 15.0 15.2 15.4 15.6 15.8 16.0
##
## [[26]]$col
## [1] "#FF0000" "#FF0505" "#FF0A0A" "#FF0F0F" "#FF1414" "#FF1A1A" "#FF1F1F"
## [8] "#FF2424" "#FF2929" "#FF2E2E" "#FF3434" "#FF3939" "#FF3E3E" "#FF4343"
## [15] "#FF4848" "#FF4E4E" "#FF5353" "#FF5858" "#FF5D5D" "#FF6262" "#FF6868"
## [22] "#FF6D6D" "#FF7272" "#FF7777" "#FF7C7C" "#FF8282" "#FF8787" "#FF8C8C"
## [29] "#FF9191" "#FF9696" "#FF9C9C" "#FFA1A1" "#FFA6A6" "#FFABAB" "#FFB0B0"
## [36] "#FFB6B6" "#FFBBBB" "#FFC0C0" "#FFC5C5" "#FFCACA" "#FFD0D0" "#FFD5D5"
## [43] "#FFDADA" "#FFDFDF" "#FFE4E4" "#FFEAEA" "#FFEFEF" "#FFF4F4" "#FFF9F9"
## [50] "#FFFFFF"
##
## [[26]]$colorTable
## low high color
## 1 6.0 6.2 #FF0000
## 2 6.2 6.4 #FF0505
## 3 6.4 6.6 #FF0A0A
## 4 6.6 6.8 #FF0F0F
## 5 6.8 7.0 #FF1414
## 6 7.0 7.2 #FF1A1A
## 7 7.2 7.4 #FF1F1F
## 8 7.4 7.6 #FF2424
## 9 7.6 7.8 #FF2929
## 10 7.8 8.0 #FF2E2E
## 11 8.0 8.2 #FF3434
## 12 8.2 8.4 #FF3939
## 13 8.4 8.6 #FF3E3E
## 14 8.6 8.8 #FF4343
## 15 8.8 9.0 #FF4848
## 16 9.0 9.2 #FF4E4E
## 17 9.2 9.4 #FF5353
## 18 9.4 9.6 #FF5858
## 19 9.6 9.8 #FF5D5D
## 20 9.8 10.0 #FF6262
## 21 10.0 10.2 #FF6868
## 22 10.2 10.4 #FF6D6D
## 23 10.4 10.6 #FF7272
## 24 10.6 10.8 #FF7777
## 25 10.8 11.0 #FF7C7C
## 26 11.0 11.2 #FF8282
## 27 11.2 11.4 #FF8787
## 28 11.4 11.6 #FF8C8C
## 29 11.6 11.8 #FF9191
## 30 11.8 12.0 #FF9696
## 31 12.0 12.2 #FF9C9C
## 32 12.2 12.4 #FFA1A1
## 33 12.4 12.6 #FFA6A6
## 34 12.6 12.8 #FFABAB
## 35 12.8 13.0 #FFB0B0
## 36 13.0 13.2 #FFB6B6
## 37 13.2 13.4 #FFBBBB
## 38 13.4 13.6 #FFC0C0
## 39 13.6 13.8 #FFC5C5
## 40 13.8 14.0 #FFCACA
## 41 14.0 14.2 #FFD0D0
## 42 14.2 14.4 #FFD5D5
## 43 14.4 14.6 #FFDADA
## 44 14.6 14.8 #FFDFDF
## 45 14.8 15.0 #FFE4E4
## 46 15.0 15.2 #FFEAEA
## 47 15.2 15.4 #FFEFEF
## 48 15.4 15.6 #FFF4F4
## 49 15.6 15.8 #FFF9F9
## 50 15.8 16.0 #FFFFFF
##
## [[26]]$layout
## [[26]]$layout$lmat
## [,1] [,2]
## [1,] 4 3
## [2,] 2 1
##
## [[26]]$layout$lhei
## [1] 1.5 4.0
##
## [[26]]$layout$lwid
## [1] 1.5 4.0Look at methylation levels
Looking at the average CpG methylation levels across the whole genome. It shows that total methylation levels are very high across the whole sample set. Pool MM is the unmethylated control with ~20% methylation. Pool M is the methylated control with ~91% methylation.
myfilelist <- list.files("fastq",pattern="vcf_meth_average.tsv", full.names = TRUE)
samplelist <- gsub(".bam.vcf_meth_average.tsv","",myfilelist)
myread2 <- function(myfile){
read.table(myfile,header=TRUE)
}
z <- lapply(myfilelist, myread2)
zz <- lapply(z,function(x) {tail(x,1)[4] } )
zz <- unlist(zz)
zz <- gsub("%","",zz)
zz <- as.numeric(zz)
nz <- lapply(z,function(x) {tail(x,1)[1] } )
nz <- unname(gsub(".bam","",gsub("fastq/","",unlist(nz))))
names(zz) <- nz
par(mar=c(5, 10, 5, 2))
barplot(zz,horiz=TRUE,las=1,cex.names=0.6,xlab="percent CpG methylation")
grid()
Now I will look at average CpH methylation levels across the whole genome
z <- lapply(myfilelist, myread2)
zz <- lapply(z,function(x) {tail(x,1)[10] } )
zz <- unlist(zz)
zz <- gsub("%","",zz)
zz <- as.numeric(zz)
nz <- lapply(z,function(x) {tail(x,1)[1] } )
nz <- unname(gsub(".bam","",gsub("fastq/","",unlist(nz))))
names(zz) <- nz
par(mar=c(5, 10, 5, 2))
barplot(zz,horiz=TRUE,las=1,cex.names=0.6,xlab="percent CpH methylation")
grid()
cph <- zzRead in data
myobjf looks strange because if the coverage is high, it gets capped to approx 2623.
file.list <- list.files(DATADIR,pattern="methylkit.tsv",full.names=TRUE)
lines <- lapply(file.list,readLines)
file.list <- file.list[which(lapply(lines,length) > 0)]
samplesheet <- read.table("sample_info/samplesheet_2020-10-15.tsv",sep="\t",header=TRUE)
samplesheet$poolID <- paste("pool",samplesheet$Internal_ID,sep="")
# filter files for those in the sample sheet
file.list <- sapply(strsplit(file.list,"\\."),"[[",1)
file.list <- sapply(strsplit(file.list,"/"),"[[",2)
file.list <- file.list[grep("ool",file.list)]
file.list## [1] "pool1" "pool10" "pool11" "pool12" "pool13" "pool14" "pool15" "pool16"
## [9] "pool17" "pool18" "pool19" "pool2" "pool20" "pool21" "pool22" "pool23"
## [17] "pool24" "pool3" "pool4" "pool5" "pool6" "pool7" "pool8" "pool9"
## [25] "PoolM" "PoolMM"myobj <- methRead( location=as.list(paste("fastq/",file.list,".methylkit.tsv",sep="")),
sample.id=as.list(file.list),
header=FALSE,
assembly="hg38",
treatment=sample(1:length(file.list)),
context="CpG",
mincov = 0 )## Received list of locations.## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.myobjf <- filterByCoverage(myobj,lo.count=3,lo.perc=NULL,
hi.count=NULL,hi.perc=NULL)
meth <- unite(myobjf, destrand=FALSE)## uniting...percMethylation(meth) %>% kbl() %>% kable_styling()| pool1 | pool10 | pool11 | pool12 | pool13 | pool14 | pool15 | pool16 | pool17 | pool18 | pool19 | pool2 | pool20 | pool21 | pool22 | pool23 | pool24 | pool3 | pool4 | pool5 | pool6 | pool7 | pool8 | pool9 | PoolM | PoolMM |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44.2105263 | 51.1055486 | 51.3513514 | 35.8905035 | 58.2954545 | 60.6260297 | 62.1198569 | 49.1853674 | 44.2940039 | 60.5173876 | 68.3053360 | 57.6923077 | 58.1673307 | 52.5090909 | 66.3100058 | 53.5913529 | 61.4853763 | 66.2091239 | 64.0079478 | 60.6912267 | 52.7004117 | 52.7762507 | 64.3000000 | 42.2116091 | 95.8333333 | 2.1739130 |
| 70.4086912 | 70.6868357 | 61.5835777 | 72.5033289 | 68.8107704 | 68.1793914 | 67.0198675 | 60.0120992 | 54.3859649 | 68.9970870 | 72.7094561 | 69.8062792 | 70.4879938 | 64.9988030 | 71.2933754 | 67.5954592 | 69.5133742 | 72.0015886 | 74.7972028 | 73.7020316 | 61.2987631 | 62.3767798 | 72.2986248 | 50.2881844 | 95.9016393 | 1.4492754 |
| 80.3860198 | 71.2183156 | 74.7093023 | 80.4045093 | 78.3996995 | 78.6133333 | 81.2914640 | 68.1928441 | 70.8938121 | 80.2083333 | 79.5104039 | 75.1087320 | 80.3937008 | 77.6044167 | 78.9863326 | 78.9872546 | 79.5110968 | 85.2824185 | 88.5913529 | 90.0037439 | 79.4908399 | 75.1776927 | 79.1133005 | 56.3898917 | 99.1869919 | 2.8169014 |
| 34.6013549 | 29.7107438 | 31.9526627 | 29.5949113 | 35.8848049 | 28.3776451 | 32.1828776 | 27.0064083 | 29.2083013 | 35.6991973 | 35.6045590 | 35.3872054 | 24.2687747 | 34.4067797 | 40.7087295 | 35.2039038 | 34.4995141 | 32.0064335 | 40.1075573 | 39.1089109 | 30.6004340 | 30.5908338 | 34.6898263 | 30.9044306 | 100.0000000 | 1.4285714 |
| 71.3006846 | 69.7809012 | 65.9763314 | 49.4952894 | 71.6082317 | 71.1938664 | 71.9116321 | 61.6000000 | 63.3966654 | 75.3202391 | 76.5931069 | 63.7159206 | 71.3375796 | 67.1068721 | 73.1104651 | 68.2121531 | 75.1973684 | 71.9902716 | 79.5953263 | 71.8904526 | 60.9000726 | 56.2015504 | 73.0150754 | 53.4926471 | 99.1525424 | 3.5971223 |
| 66.1949686 | 61.5833333 | 65.6716418 | 50.7075472 | 72.2919042 | 69.3144723 | 75.9209344 | 60.0983707 | 57.0987654 | 70.0000000 | 76.4078392 | 69.4989844 | 61.5873016 | 64.6915386 | 71.1967546 | 70.5159705 | 73.0111769 | 75.7009346 | 79.7968397 | 72.5928734 | 65.3036535 | 64.8783186 | 76.2024048 | 52.3178808 | 96.6942149 | 3.7037037 |
| 52.0207254 | 45.7084189 | 45.8579882 | 52.1056150 | 59.1960561 | 58.5831063 | 59.8839804 | 44.4920441 | 35.0115296 | 55.9966216 | 59.5907298 | 49.4963062 | 48.0252765 | 46.0962050 | 50.9962460 | 47.9064899 | 49.1039427 | 59.7008892 | 55.2957746 | 50.0944465 | 44.1056423 | 44.1176471 | 56.8159204 | 40.6102434 | 99.1452991 | 0.7352941 |
| 91.7808219 | 95.1515152 | 88.2352941 | 94.5454545 | 98.2608696 | 91.6666667 | 96.0526316 | 96.4285714 | 97.5903614 | 95.2941176 | 95.9595960 | 96.2962963 | 84.6153846 | 93.3333333 | 95.4248366 | 97.9591837 | 92.2705314 | 90.1408451 | 96.5517241 | 93.8271605 | 95.2380952 | 97.5000000 | 98.3333333 | 92.7710843 | 95.4773869 | 66.6666667 |
| 98.8925803 | 99.2296919 | 100.0000000 | 98.8313856 | 99.7117117 | 98.9552239 | 99.6784566 | 99.5786517 | 99.5953465 | 99.4958875 | 99.6054362 | 99.3464052 | 98.6168741 | 99.5045417 | 99.6022978 | 99.5934959 | 99.6946876 | 99.5092025 | 99.5783556 | 99.5927602 | 99.3131082 | 99.1243433 | 99.5711222 | 99.5898277 | 99.3984267 | 85.7142857 |
| 85.9266601 | 90.1098901 | 93.1034483 | 93.3232170 | 85.7844858 | 84.0852130 | 92.3591213 | 91.8953145 | 91.2904022 | 95.6923077 | 99.4152047 | 72.7649007 | 95.7158963 | 74.2062076 | 95.6972973 | 94.0958555 | 90.3996865 | 89.5991333 | 95.2114428 | 96.2914485 | 97.4884675 | 92.3437500 | 92.2701950 | 89.9062438 | 99.4871795 | 88.0000000 |
| 78.3143939 | 72.5853094 | 85.7142857 | 80.3183792 | 81.0986012 | 85.6796117 | 79.2088316 | 80.9072165 | 81.0999039 | 85.5014896 | 70.0934579 | 72.4778047 | 86.4097363 | 68.1959296 | 83.7009032 | 84.4049248 | 74.2009132 | 82.6844262 | 85.4277286 | 88.4183232 | 84.1841842 | 83.7349398 | 79.3758480 | 68.5073171 | 86.0016420 | 79.4117647 |
| 81.1224490 | 71.3304185 | 74.4360902 | 84.8159509 | 80.9138840 | 65.4911839 | 81.5429688 | 67.6008493 | 80.5091091 | 83.3121988 | 81.3953488 | 75.1694915 | 79.9140709 | 73.1924360 | 78.7988887 | 69.9094497 | 71.0019646 | 73.0684327 | 83.0855019 | 81.0199557 | 81.7847769 | 66.7189953 | 77.0020534 | 74.6000000 | 99.6097138 | 71.8750000 |
| 92.8909953 | 93.9271255 | 86.5771812 | 93.0576071 | 93.2830706 | 83.0952381 | 93.8924339 | 93.1864545 | 94.1938580 | 87.2960949 | 89.2896988 | 77.5020016 | 89.3137255 | 87.7060440 | 93.3976106 | 83.5112423 | 95.1937690 | 87.7530364 | 94.7183099 | 95.7993999 | 92.3115079 | 93.6201780 | 95.9754434 | 85.5925639 | 99.7954173 | 96.5517241 |
| 83.7535014 | 81.4899713 | 84.2105263 | 84.8484848 | 82.1969697 | 70.9069494 | 84.6708747 | 89.2089249 | 89.3103448 | 81.6051844 | 78.9915966 | 81.3897764 | 84.5857418 | 73.9026063 | 89.6081772 | 82.0984814 | 86.4088821 | 71.2841254 | 89.5869692 | 85.3849500 | 89.7969292 | 77.3060029 | 84.0220386 | 75.5987436 | 95.6026059 | 90.3225806 |
| 71.0550887 | 69.9079402 | 74.3243243 | 53.8020086 | 78.2090569 | 63.7767221 | 70.0723327 | 75.2147239 | 80.2924958 | 67.2070744 | 77.4097507 | 75.8785942 | 74.8768473 | 67.8105697 | 76.9086748 | 71.3997308 | 85.1950019 | 57.7235772 | 84.2756184 | 81.4163090 | 81.2874251 | 76.1413844 | 80.0677966 | 62.1916236 | 95.1129363 | 64.5161290 |
| 82.4594852 | 76.3720393 | 75.8169935 | 80.0000000 | 81.7035775 | 88.5505481 | 80.3127875 | 84.4941957 | 89.3917625 | 74.6895181 | 79.9177263 | 74.1646292 | 76.7258383 | 76.5875785 | 92.1982849 | 65.2931854 | 82.9017517 | 68.8659794 | 91.3069190 | 82.2970639 | 87.0755195 | 88.9894419 | 79.1836735 | 72.6051402 | 99.9168399 | 79.1666667 |
| 74.1131352 | 72.7758007 | 71.9178082 | 69.8085420 | 71.1893370 | 76.5906363 | 81.9029851 | 73.1980116 | 74.1097209 | 64.7985989 | 66.1016949 | 64.3211921 | 73.1584258 | 71.9958203 | 85.1984044 | 70.2947846 | 71.4994277 | 66.4926931 | 87.6704209 | 78.4017279 | 78.4880771 | 75.8982036 | 66.8711656 | 61.9094295 | 86.6171004 | 83.3333333 |
| 69.0522244 | 67.1216617 | 61.6438356 | 53.7537538 | 53.9959016 | 72.0000000 | 71.1627907 | 75.8850479 | 70.5995666 | 56.2067260 | 74.9147404 | 54.8810500 | 79.3034826 | 56.7174761 | 73.2030265 | 75.1930940 | 66.6031262 | 52.7253669 | 76.9276748 | 80.1997395 | 69.8017285 | 67.0694864 | 58.4763212 | 60.5929707 | 95.1891447 | 61.2903226 |
| 55.7964185 | 50.0859599 | 54.3624161 | 46.6666667 | 54.4871795 | 53.6266350 | 71.4154412 | 59.1076545 | 72.8960978 | 60.0048626 | 31.8132069 | 26.2618297 | 63.9613527 | 42.9008152 | 62.1916118 | 41.5060908 | 48.2086505 | 34.6076459 | 70.4159344 | 69.4092827 | 50.7843137 | 44.1002950 | 41.9867550 | 54.1077570 | 96.4019851 | 55.5555556 |
| 88.0626223 | 79.6219728 | 88.6666667 | 95.1807229 | 85.7142857 | 74.2405832 | 92.3862581 | 85.2819237 | 85.3983353 | 84.9963226 | 81.8903592 | 73.8211382 | 83.4843907 | 74.9127704 | 90.9904286 | 77.7033065 | 85.8056026 | 71.3250518 | 91.1203814 | 92.3010753 | 90.2834008 | 87.5945537 | 73.1674512 | 79.1972212 | 85.5893378 | 66.6666667 |
| 92.1549156 | 89.6901073 | 89.8648649 | 88.8217523 | 78.1101292 | 87.2500000 | 91.8309859 | 92.2948771 | 91.6967509 | 79.7020029 | 87.6987131 | 74.5306122 | 87.5373878 | 75.8885017 | 82.4043261 | 85.6916459 | 88.8972384 | 78.9862724 | 90.9198813 | 95.9122203 | 88.9171327 | 96.1656442 | 74.7297297 | 78.6995948 | 96.2870254 | 71.4285714 |
| 81.9704433 | 76.3839812 | 78.5234899 | 63.2683658 | 74.2022170 | 84.9689441 | 68.2191781 | 78.4968685 | 85.8018868 | 84.9975526 | 71.1069418 | 52.8652139 | 83.8484546 | 56.4973730 | 88.9026658 | 74.6109382 | 78.9040584 | 75.1817238 | 88.3263848 | 79.4970162 | 77.0843990 | 72.7138643 | 69.0666667 | 71.7938858 | 100.0000000 | 69.2307692 |
| 87.7929688 | 84.9290780 | 91.3907285 | 87.1870398 | 87.9165264 | 91.2938331 | 91.5662651 | 89.5084676 | 94.1991545 | 76.2113465 | 86.5987165 | 71.2653061 | 91.4085914 | 78.9035392 | 93.7022507 | 80.8918618 | 92.2024367 | 92.1079958 | 93.6867183 | 91.5182358 | 93.5091278 | 86.7269985 | 81.0884354 | 84.0007664 | 99.7918401 | 100.0000000 |
| 84.8137536 | 92.6857143 | 97.4358974 | 100.0000000 | 88.6896552 | 89.2018779 | 91.4414414 | 88.1975110 | 94.6070133 | 92.8893340 | 92.7970750 | 90.8661417 | 93.8446970 | 94.6138211 | 97.5073933 | 86.6956721 | 87.2925014 | 88.2113821 | 94.7215777 | 94.8796499 | 95.5056180 | 94.8755490 | 87.5338753 | 89.8942421 | 99.9197754 | 93.3333333 |
| 96.5941343 | 84.4974446 | 89.8734177 | 100.0000000 | 94.3078478 | 85.7808858 | 93.4163701 | 91.5037894 | 95.2041785 | 91.7976424 | 95.2830189 | 88.0031571 | 96.8926554 | 92.1964346 | 93.7901056 | 93.7991463 | 89.2970947 | 90.9638554 | 96.5895954 | 94.3969204 | 92.7007299 | 92.5764192 | 81.6722408 | 96.3948332 | 100.0000000 | 81.8181818 |
| 92.8571429 | 94.3909348 | 89.8089172 | 81.1239193 | 82.8021248 | 83.1381733 | 93.2862191 | 96.7160593 | 92.3988842 | 92.8055823 | 87.7898551 | 75.6116811 | 94.7867299 | 80.7070707 | 94.7980416 | 96.3981663 | 83.1053604 | 91.9919920 | 96.1959654 | 95.0922819 | 94.6808511 | 93.5578331 | 84.7682119 | 95.2947846 | 94.5967422 | 92.8571429 |
| 99.4157741 | 97.3130841 | 96.0784314 | 100.0000000 | 96.3967056 | 94.0191388 | 98.5428051 | 95.6840391 | 95.9913064 | 99.9011858 | 97.6882923 | 94.9234488 | 97.1098266 | 95.2002762 | 99.7907950 | 99.7964261 | 97.4072672 | 88.0368098 | 94.8174323 | 98.7074537 | 99.8013903 | 98.5096870 | 84.5784784 | 98.6954829 | 100.0000000 | 100.0000000 |
| 93.2338308 | 93.8162544 | 93.3774834 | 100.0000000 | 95.7000344 | 93.5523114 | 92.6443203 | 97.3923841 | 90.0048520 | 94.2950490 | 94.0090430 | 94.8387097 | 94.0476190 | 94.6856547 | 91.5056275 | 97.4885845 | 93.7091189 | 93.9682540 | 93.7873357 | 91.9790759 | 93.9073515 | 97.7544910 | 93.5055866 | 95.1913641 | 94.1836311 | 87.5000000 |
| 92.5143954 | 96.7109059 | 98.0263158 | 99.8538012 | 99.7977755 | 95.7091776 | 97.9128857 | 98.0971660 | 95.3882915 | 92.0099256 | 98.3119266 | 89.6931550 | 95.4589372 | 97.5940359 | 95.0939457 | 98.8052299 | 97.5937855 | 99.7969543 | 95.2242283 | 97.3819742 | 95.5039526 | 96.9298246 | 96.2238705 | 98.1985435 | 100.0000000 | 100.0000000 |
| 91.8307087 | 97.3004695 | 98.0519481 | 95.1183432 | 98.8111888 | 91.8951132 | 89.6330275 | 95.3852493 | 96.5897939 | 92.0113754 | 93.3927246 | 87.2888174 | 92.6971762 | 93.0000000 | 89.4962487 | 94.5001165 | 95.6930305 | 99.3865031 | 89.5796329 | 92.4174844 | 89.0201871 | 95.0672646 | 88.2926829 | 97.3959361 | 99.7938994 | 66.6666667 |
| 100.0000000 | 100.0000000 | 100.0000000 | 99.8552822 | 99.8901099 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8994301 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8852553 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 |
| 99.9068901 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.9075786 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8013903 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8575499 | 99.9331551 | 99.9045255 | 100.0000000 | 100.0000000 |
| 99.9049430 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8861480 | 100.0000000 | 100.0000000 | 99.9192897 | 99.8914813 | 100.0000000 | 100.0000000 | 100.0000000 | 99.9057493 | 99.8993289 | 99.9070416 | 99.8974885 | 99.8947590 | 100.0000000 | 99.8260870 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.9195818 | 100.0000000 |
| 2.2566996 | 0.0000000 | 0.9803922 | 0.9319664 | 0.8080808 | 0.8042895 | 0.8988764 | 0.3913043 | 1.6666667 | 1.1961722 | 0.5992011 | 0.7028112 | 0.9960159 | 0.5154639 | 0.6940063 | 0.6798097 | 0.7184553 | 0.6402049 | 0.5862647 | 1.1820331 | 0.6860158 | 0.5427408 | 0.3868472 | 0.4014273 | 0.0000000 | 0.0000000 |
| 86.9064748 | 83.0729167 | 85.8585859 | 81.9811321 | 92.1070693 | 89.8921833 | 91.5704388 | 84.1941229 | 74.3362832 | 90.4054597 | 90.6913073 | 83.0208333 | 88.3767535 | 82.5050505 | 89.2834496 | 77.5720165 | 89.3793103 | 86.0742706 | 81.2980359 | 87.0658683 | 82.3788546 | 82.8212291 | 86.1788618 | 86.3781321 | 97.2222222 | 100.0000000 |
| 97.5852273 | 94.8253558 | 98.0099502 | 99.7232472 | 96.6180371 | 96.5471448 | 98.6379115 | 97.7006508 | 96.8253968 | 98.7833595 | 98.1903485 | 95.7317073 | 95.4091816 | 96.7167722 | 97.3275326 | 96.9312875 | 92.7027027 | 98.7163030 | 98.7384357 | 98.8249119 | 97.5897161 | 96.5986395 | 97.0472441 | 98.1216458 | 100.0000000 | 100.0000000 |
| 94.4927536 | 93.5656836 | 98.0295567 | 95.8178439 | 95.6698241 | 98.9189189 | 98.9595376 | 99.1204925 | 100.0000000 | 96.2005484 | 97.1004720 | 94.4728762 | 95.6291391 | 93.1809065 | 91.3825170 | 95.1318458 | 94.0018315 | 98.9690722 | 96.6244726 | 96.9519343 | 97.7801841 | 96.8275862 | 94.6938776 | 95.5163043 | 100.0000000 | 100.0000000 |
| 96.5566714 | 92.5675676 | 94.9748744 | 95.3917051 | 95.0752394 | 99.0514905 | 98.0615735 | 97.1818582 | 100.0000000 | 96.5900079 | 94.8029891 | 96.9262295 | 97.1218206 | 98.3146067 | 95.9773727 | 96.6847091 | 97.5952813 | 98.5861183 | 95.3310696 | 94.6933962 | 98.3225108 | 97.3389356 | 97.8000000 | 97.2158832 | 100.0000000 | 100.0000000 |
| 93.4191702 | 90.3566711 | 88.0597015 | 98.8909427 | 91.7743032 | 96.5053763 | 88.9521640 | 96.2108014 | 91.6666667 | 92.2863924 | 92.4865229 | 89.6341463 | 89.8809524 | 90.7023144 | 88.0716934 | 90.0815217 | 88.8032638 | 91.5364583 | 89.3007582 | 86.5339578 | 89.5844576 | 93.0843707 | 92.9577465 | 95.0000000 | 100.0000000 | 100.0000000 |
| 96.2804006 | 98.5861183 | 98.4848485 | 99.0723562 | 99.1210277 | 97.7513228 | 94.7488584 | 95.1881015 | 100.0000000 | 95.2815226 | 97.9845482 | 93.4493347 | 96.6688874 | 95.2114924 | 99.0752158 | 92.7111717 | 97.4908759 | 97.2797927 | 98.7363100 | 98.8249119 | 98.0139560 | 96.1432507 | 95.1903808 | 97.7119785 | 96.8750000 | 100.0000000 |
| 96.6763006 | 99.3670886 | 98.5000000 | 97.7798335 | 98.9276139 | 97.5000000 | 95.1847704 | 97.3160173 | 100.0000000 | 98.6873508 | 97.2128946 | 96.6497462 | 97.9765013 | 97.9992154 | 97.1779141 | 92.6023778 | 98.3820225 | 98.5695709 | 98.7416107 | 98.8317757 | 99.0942994 | 98.9100817 | 98.8095238 | 99.4217082 | 100.0000000 | 100.0000000 |
| 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.9179319 | 99.8962656 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.7621879 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 |
| 0.6008813 | 0.6980273 | 0.6711409 | 0.6030324 | 0.6996830 | 0.7006617 | 0.8931699 | 0.6054280 | 0.6028433 | 0.6915098 | 0.6912862 | 0.8001306 | 1.0845987 | 0.8075914 | 0.7991432 | 0.8055521 | 1.1005578 | 0.7061447 | 0.6961364 | 0.7014998 | 0.6963163 | 0.6950295 | 0.6005285 | 0.8994496 | 0.6749156 | 0.0000000 |
| 98.3937893 | 98.8852064 | 95.4545455 | 93.7929849 | 98.3987883 | 97.2936137 | 95.1086957 | 97.3035117 | 99.0038246 | 94.7001132 | 98.8034808 | 94.9036263 | 92.7826087 | 98.0960097 | 96.5025907 | 94.0043870 | 99.1048784 | 98.0977247 | 96.2943633 | 96.4980545 | 98.0996289 | 98.6058302 | 98.2961363 | 99.3991989 | 99.7777778 | 100.0000000 |
| 97.3996227 | 97.2981178 | 97.3033708 | 99.6024888 | 99.0993924 | 97.4028510 | 97.7060173 | 94.6019744 | 100.0000000 | 99.2076967 | 97.3928897 | 98.7072492 | 98.2166159 | 98.2926829 | 98.6036694 | 95.4010302 | 91.8983917 | 95.2011997 | 98.9049192 | 98.1008618 | 95.3997068 | 97.3081814 | 98.0954677 | 98.0935875 | 95.8520179 | 100.0000000 |
| 100.0000000 | 100.0000000 | 100.0000000 | 99.8955795 | 99.9015640 | 100.0000000 | 99.8937865 | 100.0000000 | 99.9020568 | 99.9052312 | 99.9076468 | 100.0000000 | 99.9105145 | 99.8976249 | 99.9021686 | 99.9012955 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8977970 | 99.8932992 | 99.9026290 | 99.9058000 | 100.0000000 | 100.0000000 |
| 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 100.0000000 | 99.8939414 | 100.0000000 | 100.0000000 |
| 85.3333333 | 89.6860987 | 85.4838710 | 92.3774955 | 82.1727019 | 87.7777778 | 97.8813559 | 85.6643357 | 87.4125874 | 81.0606061 | 90.1477833 | 88.6120996 | 87.8151261 | 91.5200000 | 81.9718310 | 90.2027027 | 86.9801085 | 87.5000000 | 86.7768595 | 91.5730337 | 86.1111111 | 87.9194631 | 85.7142857 | 90.7986111 | 96.2732919 | 0.0000000 |
| 75.6756757 | 85.1351351 | 88.5245902 | 75.0455373 | 82.9201102 | 84.7457627 | 86.8085106 | 81.7241379 | 85.2803738 | 81.4249364 | 87.0915033 | 87.9858657 | 83.3333333 | 87.6623377 | 80.4469274 | 87.8378378 | 88.9087657 | 84.1025641 | 79.5833333 | 81.1111111 | 86.5753425 | 83.4437086 | 85.8585859 | 87.0085470 | 94.3037975 | 0.0000000 |
| 86.4516129 | 83.8565022 | 87.5000000 | 82.1942446 | 43.3701657 | 85.7142857 | 85.7142857 | 82.1678322 | 84.7775176 | 89.1959799 | 87.5202593 | 90.5594406 | 85.6540084 | 89.7600000 | 80.3370787 | 45.4545455 | 86.7620751 | 86.2944162 | 77.4590164 | 78.8888889 | 87.2576177 | 34.8684211 | 89.6907216 | 84.2195540 | 0.6250000 | 0.0000000 |
| 71.7948718 | 71.8750000 | 93.7500000 | 82.1362799 | 56.2326870 | 74.4444444 | 61.1111111 | 64.3109541 | 80.1909308 | 61.7948718 | 60.5911330 | 72.5978648 | 75.8620690 | 77.0731707 | 65.2542373 | 81.7241379 | 77.6556777 | 61.8090452 | 66.5254237 | 69.8863636 | 73.0769231 | 73.8255034 | 73.4042553 | 70.5985915 | 90.6250000 | 1.6393443 |
| 66.2500000 | 70.1298701 | 76.6666667 | 71.0037175 | 52.2222222 | 69.1011236 | 48.9361702 | 63.6042403 | 69.9052133 | 60.8247423 | 55.0335570 | 54.5454545 | 57.7586207 | 72.0853859 | 53.8028169 | 74.8275862 | 70.9386282 | 44.7236181 | 57.6131687 | 60.6936416 | 65.2777778 | 74.5098039 | 59.3750000 | 70.9059233 | 90.7975460 | 1.5873016 |
| 58.8957055 | 62.2807018 | 64.5161290 | 62.6151013 | 45.9610028 | 63.3333333 | 53.8135593 | 55.6338028 | 64.0287770 | 56.4102564 | 46.3054187 | 57.9505300 | 59.4936709 | 64.0194489 | 56.7796610 | 67.0068027 | 71.6337522 | 44.6700508 | 48.9539749 | 61.0169492 | 66.7582418 | 68.2432432 | 48.4210526 | 63.7931034 | 95.0920245 | 3.1746032 |
| 39.4904459 | 48.8262911 | 51.7241379 | 41.2962963 | 29.7058824 | 38.0116959 | 34.0909091 | 35.5633803 | 39.6508728 | 38.1962865 | 24.2784380 | 36.0000000 | 28.7610619 | 38.5665529 | 32.4637681 | 45.4545455 | 38.2899628 | 34.7368421 | 19.1304348 | 23.1213873 | 40.8571429 | 34.9315068 | 37.0786517 | 46.8468468 | 86.8750000 | 3.4482759 |
| 46.9879518 | 60.6060606 | 68.7500000 | 48.4460695 | 38.2920110 | 48.3516484 | 50.2092050 | 55.2083333 | 61.3583138 | 54.7073791 | 42.7406199 | 50.5263158 | 49.1525424 | 57.8175896 | 49.4413408 | 66.7808219 | 52.9729730 | 46.3917526 | 32.6446281 | 41.8994413 | 52.9247911 | 47.4025974 | 47.3684211 | 64.4714038 | 93.2515337 | 3.1250000 |
| 0.0000000 | 18.3333333 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.9708738 | 16.5048544 | 5.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 6.9767442 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 2.0833333 | 0.0000000 | 0.0000000 | 0.0000000 | 100.0000000 | 0.0000000 |
| 0.0000000 | 1.7543860 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 2.0408163 | 4.0404040 | 0.0000000 | 0.0000000 | 0.0000000 | 2.9411765 | 0.0000000 | 0.0000000 | 0.0000000 | 3.0303030 | 0.0000000 | 4.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 100.0000000 | 0.0000000 |
| 0.0000000 | 17.8571429 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 3.7037037 | 13.7254902 | 2.8169014 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 3.4090909 | 5.2631579 | 0.0000000 | 0.8000000 | 0.0000000 | 0.0000000 | 0.0000000 | 1.8518519 | 0.0000000 | 0.0000000 | 1.2195122 | 98.0392157 | 0.0000000 |
| 0.0000000 | 21.6666667 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 4.8780488 | 14.4385027 | 9.8360656 | 5.7142857 | 0.0000000 | 0.0000000 | 3.6363636 | 5.0847458 | 0.0000000 | 8.1081081 | 5.0000000 | 7.4074074 | 0.0000000 | 0.0000000 | 4.4943820 | 6.2500000 | 0.0000000 | 3.9215686 | 68.5185185 | 0.0000000 |
| 6.0606061 | 27.5862069 | 40.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 20.1117318 | 12.9411765 | 0.0000000 | 0.0000000 | 0.0000000 | 9.5238095 | 1.7094017 | 2.5316456 | 0.0000000 | 1.7241379 | 6.8965517 | 15.6862745 | 21.0526316 | 2.4390244 | 0.0000000 | 3.5714286 | 1.8518519 | 100.0000000 | 0.0000000 |
| 0.0000000 | 29.8245614 | 0.0000000 | 1.2195122 | 0.0000000 | 7.6923077 | 0.0000000 | 21.0784314 | 16.3366337 | 0.8474576 | 2.7972028 | 0.0000000 | 5.4054054 | 2.9411765 | 11.3636364 | 0.0000000 | 0.0000000 | 6.2500000 | 18.1818182 | 13.9534884 | 2.0833333 | 6.2500000 | 0.0000000 | 0.8130081 | 88.4615385 | 2.3809524 |
| 5.0000000 | 32.7586207 | 0.0000000 | 1.2578616 | 0.0000000 | 11.7647059 | 0.0000000 | 0.9900990 | 4.0404040 | 0.0000000 | 2.8368794 | 0.0000000 | 2.8169014 | 7.4626866 | 4.5454545 | 26.5060241 | 3.9603960 | 3.2258065 | 7.4074074 | 13.9534884 | 3.1578947 | 6.2500000 | 0.0000000 | 0.0000000 | 73.0769231 | 0.0000000 |
| 0.0000000 | 26.6666667 | 0.0000000 | 3.6809816 | 16.6666667 | 11.5384615 | 0.0000000 | 0.9803922 | 3.9603960 | 1.6949153 | 0.0000000 | 10.5263158 | 0.0000000 | 4.3795620 | 0.0000000 | 0.0000000 | 0.9708738 | 11.2903226 | 3.6363636 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 98.1818182 | 0.0000000 |
| 5.0000000 | 27.5862069 | 0.0000000 | 45.6790123 | 0.0000000 | 11.7647059 | 0.0000000 | 8.3743842 | 13.7254902 | 1.6666667 | 0.0000000 | 0.0000000 | 14.6666667 | 19.1176471 | 4.4444444 | 20.9876543 | 1.9801980 | 6.3492063 | 0.0000000 | 13.9534884 | 2.1276596 | 6.4516129 | 0.0000000 | 1.5873016 | 100.0000000 | 2.4390244 |
| 4.6511628 | 27.1186441 | 50.0000000 | 45.1807229 | 13.3333333 | 0.0000000 | 8.6956522 | 15.1219512 | 3.9603960 | 1.6949153 | 0.0000000 | 10.5263158 | 3.9473684 | 4.3478261 | 0.0000000 | 0.0000000 | 10.6796117 | 3.0769231 | 10.5263158 | 0.0000000 | 2.1052632 | 0.0000000 | 6.4516129 | 7.2580645 | 100.0000000 | 0.0000000 |
| 9.5238095 | 22.8070175 | 16.6666667 | 1.2500000 | 0.0000000 | 3.8461538 | 0.0000000 | 14.4278607 | 12.0603015 | 0.0000000 | 0.0000000 | 0.0000000 | 8.0000000 | 5.8394161 | 4.5454545 | 0.0000000 | 0.0000000 | 0.0000000 | 3.5714286 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 18.8524590 | 85.4545455 | 0.0000000 |
| 0.0000000 | 26.2295082 | 0.0000000 | 0.0000000 | 0.0000000 | 7.6923077 | 0.0000000 | 16.1764706 | 3.9800995 | 0.0000000 | 13.9860140 | 0.0000000 | 2.6315789 | 5.7971014 | 0.0000000 | 0.0000000 | 0.9661836 | 3.0769231 | 0.0000000 | 0.0000000 | 0.0000000 | 6.4516129 | 0.0000000 | 0.0000000 | 87.2727273 | 0.0000000 |
| 13.9534884 | 27.4193548 | 0.0000000 | 0.0000000 | 0.0000000 | 7.6923077 | 0.0000000 | 16.1764706 | 1.9704433 | 1.6806723 | 0.0000000 | 0.0000000 | 1.3333333 | 4.3478261 | 0.0000000 | 2.3255814 | 1.4563107 | 6.0606061 | 3.5714286 | 0.0000000 | 0.0000000 | 13.3333333 | 0.0000000 | 6.4516129 | 98.2142857 | 0.0000000 |
| 4.7619048 | 26.6666667 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 15.7635468 | 4.9751244 | 0.0000000 | 1.4084507 | 3.3898305 | 12.1621622 | 0.0000000 | 4.4943820 | 0.0000000 | 4.8543689 | 0.0000000 | 0.0000000 | 0.0000000 | 2.1505376 | 0.0000000 | 0.0000000 | 0.0000000 | 98.1481481 | 0.0000000 |
| 0.0000000 | 29.5081967 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 0.0000000 | 13.7254902 | 0.0000000 | 6.7226891 | 0.0000000 | 10.3448276 | 0.0000000 | 20.5882353 | 4.6511628 | 7.1428571 | 0.0000000 | 0.0000000 | 7.1428571 | 0.0000000 | 0.0000000 | 0.0000000 | 12.9032258 | 0.0000000 | 85.1851852 | 0.0000000 |
| 0.4100338 | 1.7055988 | 0.5076142 | 0.4092769 | 1.2895302 | 0.7871433 | 0.3918774 | 0.8110101 | 1.8102824 | 0.7014028 | 0.5968011 | 0.5972892 | 1.2134584 | 0.8949881 | 0.6083959 | 0.5074915 | 0.6033183 | 2.1857923 | 2.5996534 | 0.7956241 | 0.6943208 | 0.4101162 | 0.6014215 | 0.6962025 | 96.4943820 | 0.6990970 |
| 2.3035887 | 1.5140045 | 1.5789474 | 1.7015342 | 1.8862090 | 1.2948207 | 1.4028777 | 1.1116726 | 2.4069199 | 2.3964396 | 1.4925373 | 1.7113784 | 1.9830028 | 1.2944984 | 2.2102871 | 0.8104126 | 0.9042719 | 1.9088670 | 3.7991266 | 1.4066817 | 1.6010074 | 0.6920415 | 1.4933628 | 1.7903646 | 98.6107895 | 0.2063679 |
| 3.4883721 | 3.9068666 | 2.5000000 | 2.7947598 | 2.4123512 | 2.2911526 | 2.2958224 | 1.7875920 | 3.9968956 | 2.0885848 | 1.6034614 | 2.7033551 | 2.9773463 | 4.5014724 | 3.6059240 | 2.0918367 | 1.5086914 | 4.0064103 | 5.0894085 | 1.7890029 | 1.7937220 | 3.7103104 | 2.5093741 | 1.7160162 | 97.8998384 | 0.8890251 |
| 3.0985234 | 3.2879819 | 2.1052632 | 3.6094012 | 1.9153537 | 2.3944130 | 2.5955299 | 2.8044467 | 4.3168168 | 1.9080068 | 2.0960273 | 4.2995839 | 3.3917467 | 2.5060631 | 2.4953599 | 2.2091311 | 2.2111492 | 4.2102028 | 5.3953692 | 2.2099448 | 1.4008621 | 2.7911785 | 3.1024931 | 1.7851347 | 95.9054750 | 0.2059429 |
| 1.5969030 | 2.6873581 | 1.0498688 | 2.9050279 | 2.5000000 | 2.0909393 | 2.3096355 | 1.8939394 | 3.0120482 | 1.9138756 | 1.4885310 | 1.8933272 | 1.9241653 | 2.5065696 | 2.3902741 | 1.3991163 | 2.2139071 | 3.0079804 | 3.9091505 | 2.9116466 | 2.7080344 | 2.2046159 | 1.4127424 | 1.4939916 | 96.8955786 | 0.0884173 |
| 15.8536585 | 23.6024845 | 8.6956522 | 24.2574257 | 17.6100629 | 20.4545455 | 36.0360360 | 11.1627907 | 20.5741627 | 14.2361111 | 24.7093023 | 11.9658120 | 21.6374269 | 20.6060606 | 24.8756219 | 10.3896104 | 4.1666667 | 25.0000000 | 10.4895105 | 13.8888889 | 23.4939759 | 8.4337349 | 26.5822785 | 16.0427807 | 100.0000000 | 5.4545455 |
| 26.8292683 | 12.3456790 | 4.3478261 | 24.0000000 | 29.6296296 | 19.5652174 | 27.8260870 | 15.2073733 | 12.6760563 | 11.6838488 | 10.5882353 | 7.5630252 | 12.5000000 | 19.7604790 | 18.8775510 | 19.2307692 | 22.2222222 | 19.4805195 | 16.6666667 | 16.3636364 | 9.6969697 | 12.1951220 | 21.2500000 | 17.0329670 | 99.7126437 | 5.3892216 |
| 15.4761905 | 19.5121951 | 29.1666667 | 27.8606965 | 30.4878049 | 6.6666667 | 28.0701754 | 14.6118721 | 15.7407407 | 16.4383562 | 21.7008798 | 11.9658120 | 15.6976744 | 12.5748503 | 20.6030151 | 14.1025641 | 21.2765957 | 23.7500000 | 9.8591549 | 15.0943396 | 13.4146341 | 8.3333333 | 22.0779221 | 11.4130435 | 100.0000000 | 5.2941176 |
| 20.0000000 | 19.8795181 | 4.3478261 | 17.7339901 | 27.4390244 | 11.7021277 | 25.0000000 | 10.7623318 | 17.3708920 | 8.0808081 | 15.1428571 | 7.6923077 | 14.5251397 | 13.5294118 | 22.1674877 | 15.1898734 | 18.0000000 | 12.9870130 | 18.0555556 | 8.2568807 | 12.7906977 | 4.7058824 | 7.5000000 | 10.1063830 | 100.0000000 | 5.2941176 |
| 17.8571429 | 11.8012422 | 0.0000000 | 4.0000000 | 17.6100629 | 10.1123596 | 20.3539823 | 7.4766355 | 14.0776699 | 11.3013699 | 11.6279070 | 9.2436975 | 12.0000000 | 8.2840237 | 22.4489796 | 11.5384615 | 8.0000000 | 16.4556962 | 12.4087591 | 9.5238095 | 12.5748503 | 7.1428571 | 14.6666667 | 3.2258065 | 100.0000000 | 5.3254438 |
| 34.9397590 | 12.5786164 | 0.0000000 | 30.0492611 | 13.0434783 | 16.3043478 | 24.5614035 | 10.8490566 | 11.0047847 | 9.8245614 | 15.7270030 | 6.7796610 | 13.9534884 | 12.5748503 | 25.0000000 | 17.9487179 | 14.8936170 | 16.0000000 | 13.1944444 | 5.5045872 | 12.5748503 | 12.1951220 | 7.4074074 | 4.9723757 | 100.0000000 | 5.3254438 |
| 17.3469388 | 5.4545455 | 12.0000000 | 5.7268722 | 14.1304348 | 4.7169811 | 11.6788321 | 10.0775194 | 8.5365854 | 8.1005587 | 6.0532688 | 4.4776119 | 3.5532995 | 3.5714286 | 14.2857143 | 6.1111111 | 6.7796610 | 5.3763441 | 6.1797753 | 4.8000000 | 6.5000000 | 5.8823529 | 3.0303030 | 2.2935780 | 100.0000000 | 4.7337278 |
| 28.7128713 | 20.9580838 | 7.1428571 | 8.1784387 | 16.5919283 | 7.9365079 | 34.0277778 | 8.5324232 | 11.9133574 | 11.2531969 | 13.8828633 | 12.1951220 | 7.7868852 | 10.9649123 | 26.5625000 | 8.3333333 | 4.1095890 | 12.6213592 | 9.6256684 | 12.8378378 | 8.8235294 | 17.2413793 | 13.9130435 | 11.4173228 | 99.7150997 | 5.2631579 |
| 9.7402597 | 16.1676647 | 2.2727273 | 8.8471850 | 8.5245902 | 5.1724138 | 14.7058824 | 4.9763033 | 2.9197080 | 4.1218638 | 8.5803432 | 3.4334764 | 7.3619632 | 7.0063694 | 12.6760563 | 5.7627119 | 8.7912088 | 6.8027211 | 2.8070175 | 3.2710280 | 8.2018927 | 3.7267081 | 3.8216561 | 5.7471264 | 100.0000000 | 5.2631579 |
| 2.9761905 | 13.5802469 | 7.1428571 | 15.2112676 | 8.0906149 | 7.5144509 | 15.6565657 | 4.9411765 | 5.2896725 | 5.3406998 | 3.2448378 | 4.4052863 | 5.0147493 | 5.5384615 | 10.5555556 | 7.8231293 | 0.0000000 | 5.1948052 | 6.7137809 | 11.3861386 | 4.2424242 | 1.8072289 | 6.4102564 | 9.0909091 | 100.0000000 | 5.9171598 |
| 10.2564103 | 4.7619048 | 2.5641026 | 15.0417827 | 6.7340067 | 2.3668639 | 10.1941748 | 6.5000000 | 7.6315789 | 4.6554935 | 2.6813880 | 3.1390135 | 3.6923077 | 1.6129032 | 8.7570621 | 4.3478261 | 4.5454545 | 5.7142857 | 9.0225564 | 4.8780488 | 2.5889968 | 0.0000000 | 6.4102564 | 3.1976744 | 84.4311377 | 5.8139535 |
| 7.6433121 | 10.6508876 | 0.0000000 | 19.3732194 | 8.6092715 | 10.7784431 | 14.7058824 | 5.1851852 | 4.8387097 | 5.8270677 | 3.1152648 | 6.4516129 | 4.3478261 | 4.3189369 | 5.5096419 | 9.3525180 | 5.7471264 | 3.4722222 | 5.3435115 | 6.4676617 | 4.9079755 | 3.1847134 | 12.9032258 | 3.9436620 | 100.0000000 | 5.2325581 |
| 2.4096386 | 6.4705882 | 2.1739130 | 15.8038147 | 2.1406728 | 0.0000000 | 8.2949309 | 3.9080460 | 3.1707317 | 5.3191489 | 1.4684288 | 1.6528926 | 2.5936599 | 1.8292683 | 5.9740260 | 7.3825503 | 2.0833333 | 1.2578616 | 2.0979021 | 1.8518519 | 3.2258065 | 1.1976048 | 3.0864198 | 0.2638522 | 100.0000000 | 5.1724138 |
| 7.8125000 | 9.5808383 | 0.0000000 | 20.1438849 | 5.4166667 | 4.8611111 | 13.0434783 | 7.1823204 | 7.0063694 | 4.7227926 | 5.5956679 | 5.2910053 | 5.1181102 | 6.9230769 | 8.0267559 | 5.0209205 | 1.2048193 | 2.5000000 | 7.2033898 | 4.9689441 | 4.1237113 | 6.9767442 | 17.8294574 | 8.1560284 | 100.0000000 | 7.6023392 |
| 13.1736527 | 11.5151515 | 2.2222222 | 0.0000000 | 18.6119874 | 3.2608696 | 27.8761062 | 16.5532880 | 7.5829384 | 11.0356537 | 14.3063584 | 14.7540984 | 9.1954023 | 10.2719033 | 18.5000000 | 20.0636943 | 0.0000000 | 12.9870130 | 14.3835616 | 11.1111111 | 11.1764706 | 7.6470588 | 13.1736527 | 8.7671233 | 99.7289973 | 5.8479532 |
| 14.2011834 | 5.9880240 | 8.8888889 | 9.8522167 | 10.8433735 | 4.2780749 | 11.6883117 | 11.0859729 | 8.2547170 | 3.5593220 | 3.8406828 | 5.2845528 | 3.1428571 | 3.8690476 | 4.0000000 | 13.2492114 | 8.0000000 | 8.9171975 | 7.1186441 | 5.3811659 | 8.7976540 | 2.9069767 | 5.3254438 | 5.8981233 | 99.4520548 | 5.2023121 |
| 9.5238095 | 5.3892216 | 0.0000000 | 0.0000000 | 10.5919003 | 1.0928962 | 15.9817352 | 3.0023095 | 7.2639225 | 6.0658579 | 5.1020408 | 4.6413502 | 0.0000000 | 4.2682927 | 8.3969466 | 3.1645570 | 9.4736842 | 5.0955414 | 0.6779661 | 6.0747664 | 2.6548673 | 4.7619048 | 7.7844311 | 4.6575342 | 100.0000000 | 5.8479532 |
| 14.1975309 | 15.6626506 | 8.6956522 | 16.4102564 | 7.1651090 | 2.2222222 | 22.5225225 | 2.5761124 | 7.1065990 | 3.8869258 | 5.3097345 | 8.5106383 | 2.6162791 | 12.6934985 | 13.0319149 | 10.0649351 | 4.1237113 | 9.0322581 | 2.7972028 | 4.8076923 | 2.4242424 | 3.6585366 | 4.7058824 | 3.3149171 | 70.7520891 | 6.4327485 |
| 13.2947977 | 10.2409639 | 0.0000000 | 3.8929440 | 7.3846154 | 1.0928962 | 20.8888889 | 0.6741573 | 4.9528302 | 8.7030717 | 3.1700288 | 5.3497942 | 3.9548023 | 9.0634441 | 14.6529563 | 7.0063694 | 0.0000000 | 7.5000000 | 9.9315068 | 8.2191781 | 2.9325513 | 1.1764706 | 5.8479532 | 6.1662198 | 71.1911357 | 4.7619048 |
| 10.9090909 | 12.7272727 | 4.3478261 | 14.7959184 | 11.3496933 | 9.3922652 | 22.6244344 | 4.8387097 | 9.7087379 | 6.8493151 | 3.3773862 | 7.6595745 | 5.5072464 | 5.7228916 | 7.3232323 | 3.8585209 | 13.1313131 | 9.6153846 | 13.3561644 | 10.0456621 | 4.6783626 | 3.5502959 | 4.1666667 | 9.2643052 | 87.9888268 | 5.9171598 |
| 33.5443038 | 35.5828221 | 13.9534884 | 29.6587927 | 42.3076923 | 30.4597701 | 67.3076923 | 41.0138249 | 33.3333333 | 34.3580470 | 32.0726172 | 33.3333333 | 25.7763975 | 31.4465409 | 34.5108696 | 25.7425743 | 42.1052632 | 26.7973856 | 32.1299639 | 29.8507463 | 39.5705521 | 27.5000000 | 32.7044025 | 36.0563380 | 99.1825613 | 4.7058824 |
| 15.1515152 | 20.1298701 | 4.3478261 | 6.8354430 | 13.7931034 | 5.5555556 | 29.7777778 | 8.7155963 | 12.4688279 | 13.3099825 | 10.1321586 | 13.0252101 | 8.9552239 | 16.6144201 | 11.8421053 | 14.0065147 | 8.9887640 | 17.6470588 | 11.3793103 | 16.0377358 | 8.4592145 | 4.8780488 | 6.7484663 | 13.1868132 | 62.8834356 | 3.0303030 |
| 29.3750000 | 23.4177215 | 9.0909091 | 37.9032258 | 17.9738562 | 7.5144509 | 31.9634703 | 10.0719424 | 21.6931217 | 15.5303030 | 19.7530864 | 17.5438596 | 14.2857143 | 11.8210863 | 24.8677249 | 12.5412541 | 11.6279070 | 16.8831169 | 19.5488722 | 15.1960784 | 9.8726115 | 11.9205298 | 17.5324675 | 22.7528090 | 99.4475138 | 4.7904192 |
| 34.6666667 | 42.8571429 | 22.7272727 | 50.9536785 | 25.2595156 | 21.6867470 | 49.0384615 | 27.9301746 | 25.9259259 | 29.0944123 | 26.9789984 | 26.9406393 | 27.9069767 | 42.3487544 | 32.0113314 | 28.0701754 | 19.3181818 | 20.6896552 | 29.6296296 | 15.0753769 | 26.5175719 | 23.3333333 | 38.1944444 | 33.4337349 | 99.6774194 | 0.7692308 |
| 13.0952381 | 15.9763314 | 6.8181818 | 23.3082707 | 12.6934985 | 8.1081081 | 17.1806167 | 12.8146453 | 17.4876847 | 14.3589744 | 8.1991215 | 14.9377593 | 13.5211268 | 8.7087087 | 13.9650873 | 12.0634921 | 3.1578947 | 6.2893082 | 16.7808219 | 4.5662100 | 8.5798817 | 14.3712575 | 5.4878049 | 7.3170732 | 99.7267760 | 4.1916168 |
| 14.2857143 | 16.9230769 | 27.7777778 | 26.6666667 | 19.8630137 | 9.5890411 | 20.4301075 | 21.9251337 | 19.2982456 | 13.3064516 | 15.9169550 | 15.5339806 | 29.6052632 | 14.0625000 | 17.9012346 | 11.9402985 | 11.6279070 | 8.5714286 | 17.5000000 | 5.9523810 | 8.6666667 | 14.0845070 | 23.9436620 | 12.0253165 | 99.7067449 | 5.9259259 |
| 12.3456790 | 20.7792208 | 18.1818182 | 35.3846154 | 18.1250000 | 10.0000000 | 33.6363636 | 23.9234450 | 21.7391304 | 16.7259786 | 29.2035398 | 20.8333333 | 23.2558140 | 24.5398773 | 27.1794872 | 18.1818182 | 31.9148936 | 20.7792208 | 21.8309859 | 20.1923077 | 10.1190476 | 8.7500000 | 14.8148148 | 10.4972376 | 68.2719547 | 5.5214724 |
| 45.5696203 | 44.8051948 | 61.9047619 | 65.9459459 | 40.9090909 | 33.3333333 | 54.1284404 | 40.1913876 | 43.6170213 | 53.2374101 | 33.0330330 | 45.5357143 | 40.6976744 | 33.3333333 | 37.7659574 | 37.5838926 | 23.9130435 | 30.6666667 | 30.9352518 | 39.8058252 | 46.8750000 | 43.5897436 | 43.0379747 | 32.9608939 | 100.0000000 | 5.0000000 |
| 44.9275362 | 39.5683453 | 15.0000000 | 46.2857143 | 33.3333333 | 28.3950617 | 58.8785047 | 40.7216495 | 47.9289941 | 41.8326693 | 37.0129870 | 35.1851852 | 24.6666667 | 39.8550725 | 44.8863636 | 33.5820896 | 23.2558140 | 34.7826087 | 34.1269841 | 28.7234043 | 37.7622378 | 28.5714286 | 51.3157895 | 23.7804878 | 100.0000000 | 6.3380282 |
| 57.5342466 | 48.9795918 | 45.0000000 | 51.7045455 | 45.2702703 | 38.1578947 | 59.0476190 | 38.5000000 | 50.0000000 | 52.4904215 | 44.6308725 | 45.7142857 | 34.7826087 | 45.2054795 | 50.5681818 | 34.2857143 | 41.0256410 | 43.9393939 | 38.8059701 | 40.6250000 | 42.1052632 | 36.7647059 | 40.2777778 | 42.7710843 | 100.0000000 | 5.8394161 |
Export data for downstream analysis
Here I’m exporting the number of Cs and Ts at each position. Then I’m also providing the beta values.
mytable <- getData(meth)
write.table(x=mytable,file="methylation_data.tsv",sep="\t",quote=FALSE,row.names=FALSE)
mytable2 <- percMethylation(meth)
mytable3 <- cbind(mytable[,1:3],mytable2)
write.table(x=mytable3,file="methylation_betavals.tsv",sep="\t",quote=FALSE,row.names=FALSE)Proportion of CpG sites with usable data
- Percent CpG sites with usable data
fa <- read.fasta("amplicons_hg38.bed.fa")
# count CpG sites
cnt_cpg <- function(fa1) {
length(which(
sapply( 1:(length(fa1)-1), function(i) {
motif <- fa1[i:(i+1)]
sum(as.numeric(motif == c("c","g")) )==2
})
))
}
num_cpg <- lapply(fa, cnt_cpg)
start_pos <- sapply(strsplit(names(num_cpg),":"),"[[",2)
start_pos <- sapply(strsplit(start_pos,"-"),"[[",1)
end_pos <- sapply(strsplit(names(num_cpg),":"),"[[",2)
end_pos <- sapply(strsplit(end_pos,"-"),"[[",2)
chrs <- sapply(strsplit(names(num_cpg),":"),"[[",1)
res <- lapply(1:length(num_cpg),function(i) {
mychr <- chrs[i]
mysubset <- mytable3[ which(mytable3$chr==mychr),]
mystart <- start_pos[i]
mysubset <- mysubset[which(mysubset$start > mystart),]
myend <- end_pos[i]
mysubset <- mysubset[which(mysubset$end < myend),]
nrow(mysubset)
})
mydf <- as.data.frame(unlist(num_cpg))
mydf$covered_cpg <- unlist(res)
colnames(mydf)[1] <- "num_CpGs"
mydf %>% kbl() %>% kable_styling()| num_CpGs | covered_cpg | |
|---|---|---|
| 17:78358469-78358619 | 7 | 7 |
| 2:25161598-25161833 | 26 | 26 |
| 2:25168373-25168611 | 28 | 0 |
| 6:31575210-31575467 | 8 | 8 |
| 7:24283548-24283843 | 16 | 16 |
| 7:24283796-24283936 | 5 | 5 |
| 7:128241036-128241347 | 31 | 30 |
Basic plots
getCorrelation(meth,plot=TRUE)## pool1 pool10 pool11 pool12 pool13 pool14 pool15
## pool1 1.0000000 0.9686140 0.9646152 0.9671968 0.9800029 0.9844748 0.9809130
## pool10 0.9686140 1.0000000 0.9677930 0.9542965 0.9574251 0.9766997 0.9469722
## pool11 0.9646152 0.9677930 1.0000000 0.9599687 0.9562122 0.9681229 0.9409967
## pool12 0.9671968 0.9542965 0.9599687 1.0000000 0.9560373 0.9582407 0.9555830
## pool13 0.9800029 0.9574251 0.9562122 0.9560373 1.0000000 0.9766965 0.9769442
## pool14 0.9844748 0.9766997 0.9681229 0.9582407 0.9766965 1.0000000 0.9656264
## pool15 0.9809130 0.9469722 0.9409967 0.9555830 0.9769442 0.9656264 1.0000000
## pool16 0.9804794 0.9841877 0.9740267 0.9580132 0.9728363 0.9837550 0.9648048
## pool17 0.9843373 0.9770348 0.9736619 0.9637101 0.9710616 0.9829231 0.9680020
## pool18 0.9883871 0.9720777 0.9707586 0.9637344 0.9822067 0.9863576 0.9791588
## pool19 0.9833118 0.9689121 0.9601395 0.9564762 0.9825724 0.9844575 0.9774845
## pool2 0.9793783 0.9712971 0.9685827 0.9635627 0.9764209 0.9810620 0.9699718
## pool20 0.9847569 0.9753736 0.9757521 0.9645586 0.9772279 0.9892249 0.9705783
## pool21 0.9815487 0.9797288 0.9669327 0.9685774 0.9719447 0.9856450 0.9691192
## pool22 0.9899928 0.9654667 0.9596614 0.9570439 0.9842715 0.9840352 0.9840538
## pool23 0.9762508 0.9710549 0.9638446 0.9571882 0.9740411 0.9815250 0.9576326
## pool24 0.9826875 0.9708395 0.9727604 0.9570780 0.9790940 0.9881717 0.9676369
## pool3 0.9811607 0.9691977 0.9612452 0.9552345 0.9824457 0.9863586 0.9723400
## pool4 0.9820189 0.9650579 0.9619726 0.9495763 0.9816079 0.9832560 0.9714213
## pool5 0.9831481 0.9714966 0.9694796 0.9545339 0.9790436 0.9868997 0.9714101
## pool6 0.9890178 0.9760349 0.9746538 0.9653127 0.9796316 0.9893479 0.9769611
## pool7 0.9796586 0.9723353 0.9663075 0.9586774 0.9805615 0.9837378 0.9593856
## pool8 0.9823621 0.9681906 0.9653899 0.9614847 0.9805934 0.9833393 0.9768064
## pool9 0.9822698 0.9774732 0.9740198 0.9648510 0.9708775 0.9822815 0.9661920
## PoolM 0.1830119 0.1822520 0.1627453 0.1955849 0.2431440 0.1689727 0.1864937
## PoolMM 0.8391721 0.8300280 0.8114536 0.8224105 0.8595989 0.8316251 0.8197087
## pool16 pool17 pool18 pool19 pool2 pool20 pool21
## pool1 0.9804794 0.9843373 0.9883871 0.9833118 0.9793783 0.9847569 0.9815487
## pool10 0.9841877 0.9770348 0.9720777 0.9689121 0.9712971 0.9753736 0.9797288
## pool11 0.9740267 0.9736619 0.9707586 0.9601395 0.9685827 0.9757521 0.9669327
## pool12 0.9580132 0.9637101 0.9637344 0.9564762 0.9635627 0.9645586 0.9685774
## pool13 0.9728363 0.9710616 0.9822067 0.9825724 0.9764209 0.9772279 0.9719447
## pool14 0.9837550 0.9829231 0.9863576 0.9844575 0.9810620 0.9892249 0.9856450
## pool15 0.9648048 0.9680020 0.9791588 0.9774845 0.9699718 0.9705783 0.9691192
## pool16 1.0000000 0.9889649 0.9829374 0.9802303 0.9765107 0.9884553 0.9799709
## pool17 0.9889649 1.0000000 0.9846336 0.9754046 0.9745931 0.9883807 0.9805916
## pool18 0.9829374 0.9846336 1.0000000 0.9874680 0.9867965 0.9881144 0.9844406
## pool19 0.9802303 0.9754046 0.9874680 1.0000000 0.9867825 0.9866028 0.9830568
## pool2 0.9765107 0.9745931 0.9867965 0.9867825 1.0000000 0.9789463 0.9909652
## pool20 0.9884553 0.9883807 0.9881144 0.9866028 0.9789463 1.0000000 0.9816768
## pool21 0.9799709 0.9805916 0.9844406 0.9830568 0.9909652 0.9816768 1.0000000
## pool22 0.9810569 0.9840853 0.9891590 0.9886140 0.9773654 0.9886484 0.9783771
## pool23 0.9756081 0.9765019 0.9782272 0.9751134 0.9749364 0.9801330 0.9808282
## pool24 0.9832069 0.9821842 0.9838654 0.9859697 0.9825797 0.9868053 0.9843022
## pool3 0.9758655 0.9722346 0.9870965 0.9907363 0.9841706 0.9827739 0.9822831
## pool4 0.9824283 0.9805524 0.9835064 0.9844367 0.9727931 0.9884899 0.9721813
## pool5 0.9839485 0.9847904 0.9859786 0.9845782 0.9754142 0.9912610 0.9771664
## pool6 0.9890101 0.9918424 0.9911925 0.9866737 0.9851592 0.9912416 0.9857091
## pool7 0.9830570 0.9811826 0.9782986 0.9762426 0.9743060 0.9812904 0.9771809
## pool8 0.9787919 0.9770918 0.9895079 0.9893905 0.9891796 0.9828959 0.9866343
## pool9 0.9846963 0.9864884 0.9835734 0.9758289 0.9801890 0.9823853 0.9863912
## PoolM 0.1784083 0.1751420 0.1665435 0.1705830 0.1557932 0.1703691 0.1541538
## PoolMM 0.8603311 0.8503065 0.8312309 0.8298285 0.8136014 0.8465418 0.8156806
## pool22 pool23 pool24 pool3 pool4 pool5 pool6
## pool1 0.9899928 0.9762508 0.9826875 0.9811607 0.9820189 0.9831481 0.9890178
## pool10 0.9654667 0.9710549 0.9708395 0.9691977 0.9650579 0.9714966 0.9760349
## pool11 0.9596614 0.9638446 0.9727604 0.9612452 0.9619726 0.9694796 0.9746538
## pool12 0.9570439 0.9571882 0.9570780 0.9552345 0.9495763 0.9545339 0.9653127
## pool13 0.9842715 0.9740411 0.9790940 0.9824457 0.9816079 0.9790436 0.9796316
## pool14 0.9840352 0.9815250 0.9881717 0.9863586 0.9832560 0.9868997 0.9893479
## pool15 0.9840538 0.9576326 0.9676369 0.9723400 0.9714213 0.9714101 0.9769611
## pool16 0.9810569 0.9756081 0.9832069 0.9758655 0.9824283 0.9839485 0.9890101
## pool17 0.9840853 0.9765019 0.9821842 0.9722346 0.9805524 0.9847904 0.9918424
## pool18 0.9891590 0.9782272 0.9838654 0.9870965 0.9835064 0.9859786 0.9911925
## pool19 0.9886140 0.9751134 0.9859697 0.9907363 0.9844367 0.9845782 0.9866737
## pool2 0.9773654 0.9749364 0.9825797 0.9841706 0.9727931 0.9754142 0.9851592
## pool20 0.9886484 0.9801330 0.9868053 0.9827739 0.9884899 0.9912610 0.9912416
## pool21 0.9783771 0.9808282 0.9843022 0.9822831 0.9721813 0.9771664 0.9857091
## pool22 1.0000000 0.9747681 0.9834141 0.9830170 0.9903463 0.9884849 0.9901106
## pool23 0.9747681 1.0000000 0.9797276 0.9746924 0.9711361 0.9794025 0.9827784
## pool24 0.9834141 0.9797276 1.0000000 0.9817057 0.9825255 0.9858075 0.9891570
## pool3 0.9830170 0.9746924 0.9817057 1.0000000 0.9789947 0.9814283 0.9823688
## pool4 0.9903463 0.9711361 0.9825255 0.9789947 1.0000000 0.9932338 0.9850831
## pool5 0.9884849 0.9794025 0.9858075 0.9814283 0.9932338 1.0000000 0.9894326
## pool6 0.9901106 0.9827784 0.9891570 0.9823688 0.9850831 0.9894326 1.0000000
## pool7 0.9786787 0.9883015 0.9799857 0.9723199 0.9776920 0.9823807 0.9863953
## pool8 0.9848245 0.9741928 0.9822549 0.9867609 0.9802695 0.9795862 0.9870350
## pool9 0.9755593 0.9778436 0.9812686 0.9760814 0.9683549 0.9749323 0.9868380
## PoolM 0.1884014 0.2095912 0.1594451 0.1678360 0.1839793 0.1710796 0.1685785
## PoolMM 0.8500221 0.8278538 0.8221364 0.8315431 0.8472041 0.8427918 0.8443198
## pool7 pool8 pool9 PoolM PoolMM
## pool1 0.9796586 0.9823621 0.9822698 0.1830119 0.8391721
## pool10 0.9723353 0.9681906 0.9774732 0.1822520 0.8300280
## pool11 0.9663075 0.9653899 0.9740198 0.1627453 0.8114536
## pool12 0.9586774 0.9614847 0.9648510 0.1955849 0.8224105
## pool13 0.9805615 0.9805934 0.9708775 0.2431440 0.8595989
## pool14 0.9837378 0.9833393 0.9822815 0.1689727 0.8316251
## pool15 0.9593856 0.9768064 0.9661920 0.1864937 0.8197087
## pool16 0.9830570 0.9787919 0.9846963 0.1784083 0.8603311
## pool17 0.9811826 0.9770918 0.9864884 0.1751420 0.8503065
## pool18 0.9782986 0.9895079 0.9835734 0.1665435 0.8312309
## pool19 0.9762426 0.9893905 0.9758289 0.1705830 0.8298285
## pool2 0.9743060 0.9891796 0.9801890 0.1557932 0.8136014
## pool20 0.9812904 0.9828959 0.9823853 0.1703691 0.8465418
## pool21 0.9771809 0.9866343 0.9863912 0.1541538 0.8156806
## pool22 0.9786787 0.9848245 0.9755593 0.1884014 0.8500221
## pool23 0.9883015 0.9741928 0.9778436 0.2095912 0.8278538
## pool24 0.9799857 0.9822549 0.9812686 0.1594451 0.8221364
## pool3 0.9723199 0.9867609 0.9760814 0.1678360 0.8315431
## pool4 0.9776920 0.9802695 0.9683549 0.1839793 0.8472041
## pool5 0.9823807 0.9795862 0.9749323 0.1710796 0.8427918
## pool6 0.9863953 0.9870350 0.9868380 0.1685785 0.8443198
## pool7 1.0000000 0.9739478 0.9793116 0.2275080 0.8570260
## pool8 0.9739478 1.0000000 0.9771235 0.1767719 0.8201381
## pool9 0.9793116 0.9771235 1.0000000 0.1645937 0.8476075
## PoolM 0.2275080 0.1767719 0.1645937 1.0000000 0.2204892
## PoolMM 0.8570260 0.8201381 0.8476075 0.2204892 1.0000000## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
clusterSamples(meth, dist="correlation", method="ward", plot=TRUE)## The "ward" method has been renamed to "ward.D"; note new "ward.D2"
##
## Call:
## hclust(d = d, method = HCLUST.METHODS[hclust.method])
##
## Cluster method : ward.D
## Distance : pearson
## Number of objects: 26PCASamples(meth, screeplot=TRUE)
pc <- PCASamples(meth,obj.return=TRUE)
plot(pc$x[,1],pc$x[,2],bty="n",type="n")
grid()
text(pc$x[,1],pc$x[,2],labels=rownames(pc$x),cex=0.7)
Now to remove control samples and others not included on the samplesheet.
file.list <- file.list[which(file.list %in% samplesheet$poolID)]
# filter samplesheet for those with files
samplesheet <- samplesheet[which( samplesheet$poolID %in% file.list ),]
myobj <- methRead( location=as.list(paste("fastq/",file.list,".methylkit.tsv",sep="")),
sample.id=as.list(samplesheet$poolID),
header=FALSE,
assembly="hg38",
treatment=samplesheet$GWG,
context="CpG",
mincov = 5 )## Received list of locations.## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.myobjf <- filterByCoverage(myobj,lo.count=5,lo.perc=NULL,
hi.count=NULL,hi.perc=NULL)
meth <- unite(myobjf, destrand=FALSE)## uniting...# run another PCA analysis
getCorrelation(meth,plot=TRUE)## pool5 pool11 pool12 pool18 pool20 pool19 pool9
## pool5 1.0000000 0.9563093 0.9680151 0.9666401 0.9777120 0.9808063 0.9815729
## pool11 0.9563093 1.0000000 0.9535432 0.9376896 0.9405706 0.9572034 0.9359194
## pool12 0.9680151 0.9535432 1.0000000 0.9604026 0.9573077 0.9693893 0.9465748
## pool18 0.9666401 0.9376896 0.9604026 1.0000000 0.9622638 0.9631222 0.9549016
## pool20 0.9777120 0.9405706 0.9573077 0.9622638 1.0000000 0.9781469 0.9709876
## pool19 0.9808063 0.9572034 0.9693893 0.9631222 0.9781469 1.0000000 0.9634665
## pool9 0.9815729 0.9359194 0.9465748 0.9549016 0.9709876 0.9634665 1.0000000
## pool14 0.9780852 0.9634994 0.9741977 0.9634422 0.9763934 0.9856434 0.9618341
## pool16 0.9785444 0.9555693 0.9688982 0.9660912 0.9713283 0.9811943 0.9624942
## pool7 0.9895428 0.9556948 0.9735333 0.9611447 0.9770532 0.9809402 0.9799526
## pool10 0.9801700 0.9503693 0.9619082 0.9622695 0.9826172 0.9858435 0.9752330
## pool15 0.9754716 0.9484289 0.9671262 0.9685426 0.9796823 0.9820061 0.9646626
## pool6 0.9826724 0.9542636 0.9752599 0.9687567 0.9791817 0.9892856 0.9685015
## pool4 0.9790812 0.9590931 0.9680522 0.9721872 0.9756817 0.9872483 0.9654603
## pool13 0.9862903 0.9499909 0.9628320 0.9610674 0.9833462 0.9860572 0.9799956
## pool21 0.9758085 0.9537123 0.9653966 0.9628359 0.9774859 0.9831502 0.9570905
## pool22 0.9796600 0.9507727 0.9722183 0.9627875 0.9800279 0.9886083 0.9664387
## pool3 0.9787289 0.9499941 0.9616626 0.9617469 0.9848133 0.9868297 0.9678320
## pool23 0.9757320 0.9437029 0.9569218 0.9301664 0.9585953 0.9604974 0.9648743
## pool1 0.9839242 0.9589371 0.9732010 0.9530147 0.9744686 0.9828701 0.9719953
## pool2 0.9894509 0.9610423 0.9774602 0.9629079 0.9755070 0.9850180 0.9772413
## pool24 0.9767175 0.9512030 0.9663656 0.9641719 0.9818018 0.9846547 0.9578525
## pool8 0.9762158 0.9453353 0.9629491 0.9649161 0.9783438 0.9821816 0.9737239
## pool17 0.9797466 0.9564654 0.9734002 0.9691014 0.9739639 0.9841485 0.9637067
## pool14 pool16 pool7 pool10 pool15 pool6 pool4
## pool5 0.9780852 0.9785444 0.9895428 0.9801700 0.9754716 0.9826724 0.9790812
## pool11 0.9634994 0.9555693 0.9556948 0.9503693 0.9484289 0.9542636 0.9590931
## pool12 0.9741977 0.9688982 0.9735333 0.9619082 0.9671262 0.9752599 0.9680522
## pool18 0.9634422 0.9660912 0.9611447 0.9622695 0.9685426 0.9687567 0.9721872
## pool20 0.9763934 0.9713283 0.9770532 0.9826172 0.9796823 0.9791817 0.9756817
## pool19 0.9856434 0.9811943 0.9809402 0.9858435 0.9820061 0.9892856 0.9872483
## pool9 0.9618341 0.9624942 0.9799526 0.9752330 0.9646626 0.9685015 0.9654603
## pool14 1.0000000 0.9864699 0.9783652 0.9815199 0.9790506 0.9892715 0.9831794
## pool16 0.9864699 1.0000000 0.9761949 0.9742933 0.9728811 0.9866470 0.9794969
## pool7 0.9783652 0.9761949 1.0000000 0.9820409 0.9795117 0.9837336 0.9797803
## pool10 0.9815199 0.9742933 0.9820409 1.0000000 0.9871630 0.9866162 0.9837466
## pool15 0.9790506 0.9728811 0.9795117 0.9871630 1.0000000 0.9799285 0.9909937
## pool6 0.9892715 0.9866470 0.9837336 0.9866162 0.9799285 1.0000000 0.9838958
## pool4 0.9831794 0.9794969 0.9797803 0.9837466 0.9909937 0.9838958 1.0000000
## pool13 0.9830067 0.9814727 0.9843269 0.9885072 0.9772241 0.9889008 0.9808297
## pool21 0.9789707 0.9764804 0.9753710 0.9768158 0.9772377 0.9829280 0.9835878
## pool22 0.9841587 0.9824705 0.9788892 0.9873259 0.9833265 0.9874562 0.9849885
## pool3 0.9790901 0.9731390 0.9812515 0.9901737 0.9857433 0.9849445 0.9846880
## pool23 0.9604109 0.9542158 0.9798271 0.9613928 0.9484319 0.9663471 0.9517296
## pool1 0.9803822 0.9762697 0.9869247 0.9798420 0.9699832 0.9859932 0.9745331
## pool2 0.9846424 0.9835938 0.9917928 0.9819529 0.9786056 0.9863012 0.9817114
## pool24 0.9844542 0.9792174 0.9737323 0.9788961 0.9767644 0.9826205 0.9794268
## pool8 0.9773168 0.9740394 0.9802743 0.9894376 0.9872883 0.9815502 0.9837951
## pool17 0.9863794 0.9847159 0.9789428 0.9780222 0.9814210 0.9849176 0.9881471
## pool13 pool21 pool22 pool3 pool23 pool1 pool2
## pool5 0.9862903 0.9758085 0.9796600 0.9787289 0.9757320 0.9839242 0.9894509
## pool11 0.9499909 0.9537123 0.9507727 0.9499941 0.9437029 0.9589371 0.9610423
## pool12 0.9628320 0.9653966 0.9722183 0.9616626 0.9569218 0.9732010 0.9774602
## pool18 0.9610674 0.9628359 0.9627875 0.9617469 0.9301664 0.9530147 0.9629079
## pool20 0.9833462 0.9774859 0.9800279 0.9848133 0.9585953 0.9744686 0.9755070
## pool19 0.9860572 0.9831502 0.9886083 0.9868297 0.9604974 0.9828701 0.9850180
## pool9 0.9799956 0.9570905 0.9664387 0.9678320 0.9648743 0.9719953 0.9772413
## pool14 0.9830067 0.9789707 0.9841587 0.9790901 0.9604109 0.9803822 0.9846424
## pool16 0.9814727 0.9764804 0.9824705 0.9731390 0.9542158 0.9762697 0.9835938
## pool7 0.9843269 0.9753710 0.9788892 0.9812515 0.9798271 0.9869247 0.9917928
## pool10 0.9885072 0.9768158 0.9873259 0.9901737 0.9613928 0.9798420 0.9819529
## pool15 0.9772241 0.9772377 0.9833265 0.9857433 0.9484319 0.9699832 0.9786056
## pool6 0.9889008 0.9829280 0.9874562 0.9849445 0.9663471 0.9859932 0.9863012
## pool4 0.9808297 0.9835878 0.9849885 0.9846880 0.9517296 0.9745331 0.9817114
## pool13 1.0000000 0.9772053 0.9837275 0.9834984 0.9689537 0.9853962 0.9863770
## pool21 0.9772053 1.0000000 0.9812058 0.9784270 0.9521473 0.9764912 0.9796255
## pool22 0.9837275 0.9812058 1.0000000 0.9828888 0.9597880 0.9805891 0.9840617
## pool3 0.9834984 0.9784270 0.9828888 1.0000000 0.9552981 0.9762199 0.9774207
## pool23 0.9689537 0.9521473 0.9597880 0.9552981 1.0000000 0.9871625 0.9801812
## pool1 0.9853962 0.9764912 0.9805891 0.9762199 0.9871625 1.0000000 0.9905862
## pool2 0.9863770 0.9796255 0.9840617 0.9774207 0.9801812 0.9905862 1.0000000
## pool24 0.9797280 0.9884524 0.9815826 0.9753317 0.9546272 0.9772414 0.9810819
## pool8 0.9819853 0.9738501 0.9833155 0.9843079 0.9529379 0.9712346 0.9781993
## pool17 0.9784799 0.9808928 0.9826017 0.9796756 0.9473584 0.9716792 0.9819112
## pool24 pool8 pool17
## pool5 0.9767175 0.9762158 0.9797466
## pool11 0.9512030 0.9453353 0.9564654
## pool12 0.9663656 0.9629491 0.9734002
## pool18 0.9641719 0.9649161 0.9691014
## pool20 0.9818018 0.9783438 0.9739639
## pool19 0.9846547 0.9821816 0.9841485
## pool9 0.9578525 0.9737239 0.9637067
## pool14 0.9844542 0.9773168 0.9863794
## pool16 0.9792174 0.9740394 0.9847159
## pool7 0.9737323 0.9802743 0.9789428
## pool10 0.9788961 0.9894376 0.9780222
## pool15 0.9767644 0.9872883 0.9814210
## pool6 0.9826205 0.9815502 0.9849176
## pool4 0.9794268 0.9837951 0.9881471
## pool13 0.9797280 0.9819853 0.9784799
## pool21 0.9884524 0.9738501 0.9808928
## pool22 0.9815826 0.9833155 0.9826017
## pool3 0.9753317 0.9843079 0.9796756
## pool23 0.9546272 0.9529379 0.9473584
## pool1 0.9772414 0.9712346 0.9716792
## pool2 0.9810819 0.9781993 0.9819112
## pool24 1.0000000 0.9747160 0.9811697
## pool8 0.9747160 1.0000000 0.9764140
## pool17 0.9811697 0.9764140 1.0000000## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
## Warning in par(usr): argument 1 does not name a graphical parameter
clusterSamples(meth, dist="correlation", method="ward", plot=TRUE)## The "ward" method has been renamed to "ward.D"; note new "ward.D2"
##
## Call:
## hclust(d = d, method = HCLUST.METHODS[hclust.method])
##
## Cluster method : ward.D
## Distance : pearson
## Number of objects: 24PCASamples(meth, screeplot=TRUE)
pc <- PCASamples(meth,obj.return=TRUE)
plot(pc$x[,1],pc$x[,2],bty="n",type="n")
grid()
text(pc$x[,1],pc$x[,2],labels=rownames(pc$x),cex=0.7)
Look at association between GWG, age and BMI
plot(samplesheet$Age, samplesheet$GWG)
cor.test(samplesheet$Age, samplesheet$GWG, method="pearson")##
## Pearson's product-moment correlation
##
## data: samplesheet$Age and samplesheet$GWG
## t = -0.051491, df = 22, p-value = 0.9594
## alternative hypothesis: true correlation is not equal to 0
## 95 percent confidence interval:
## -0.4125471 0.3941649
## sample estimates:
## cor
## -0.01097728cor.test(samplesheet$Age, samplesheet$GWG, method="spearman")## Warning in cor.test.default(samplesheet$Age, samplesheet$GWG, method =
## "spearman"): Cannot compute exact p-value with ties##
## Spearman's rank correlation rho
##
## data: samplesheet$Age and samplesheet$GWG
## S = 2219.2, p-value = 0.8706
## alternative hypothesis: true rho is not equal to 0
## sample estimates:
## rho
## 0.03511084plot(samplesheet$BMI_1, samplesheet$GWG)
cor.test(samplesheet$BMI, samplesheet$GWG, method="pearson")##
## Pearson's product-moment correlation
##
## data: samplesheet$BMI and samplesheet$GWG
## t = 1.3509, df = 22, p-value = 0.1904
## alternative hypothesis: true correlation is not equal to 0
## 95 percent confidence interval:
## -0.1425404 0.6118548
## sample estimates:
## cor
## 0.2767707cor.test(samplesheet$BMI, samplesheet$GWG, method="spearman")## Warning in cor.test.default(samplesheet$BMI, samplesheet$GWG, method =
## "spearman"): Cannot compute exact p-value with ties##
## Spearman's rank correlation rho
##
## data: samplesheet$BMI and samplesheet$GWG
## S = 1680.6, p-value = 0.2032
## alternative hypothesis: true rho is not equal to 0
## sample estimates:
## rho
## 0.2692907Read amplicon features
bed <- read.table("amplicons_hg38.bed")
amp <- GRanges(seqnames=bed$V1,ranges=IRanges(bed$V2,bed$V3))
amp$gene_names <- bed$V4Statistical analysis
dm <- calculateDiffMeth(meth)## more than two groups detected:
## will calculate methylation difference as the difference of max(x) - min(x),
## where x is vector of mean methylation per group per region,but
## the statistical test will remain the same.## Warning: glm.fit: algorithm did not converge## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred## Warning: glm.fit: algorithm did not converge## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurreddm## chr start end strand pvalue qvalue meth.diff
## 1 17 78358500 78358500 + 1.747775e-11 2.484034e-11 23.99751483
## 2 17 78358506 78358506 + 1.717842e-19 5.921350e-19 24.50901836
## 3 17 78358514 78358514 + 1.015642e-03 4.376110e-04 32.20146116
## 4 17 78358539 78358539 + 2.022724e-05 1.255407e-05 15.83878261
## 5 17 78358556 78358556 + 1.075868e-05 7.236067e-06 26.10267924
## 6 17 78358581 78358581 + 1.459061e-04 7.450872e-05 27.47895893
## 7 17 78358587 78358587 + 4.220954e-17 1.163960e-16 24.87245077
## 8 2 25161599 25161599 + 5.913814e-01 1.443167e-01 13.71794872
## 9 2 25161616 25161616 + 1.931239e-01 5.325539e-02 1.06158246
## 10 2 25161619 25161619 + 3.041524e-12 4.933666e-12 12.16709088
## 11 2 25161623 25161623 + 4.212538e-17 1.163960e-16 17.90241924
## 12 2 25161628 25161628 + 1.576361e-02 5.795914e-03 17.82101495
## 13 2 25161637 25161637 + 5.969193e-11 7.482046e-11 12.88020529
## 14 2 25161653 25161653 + 1.371105e-14 2.908405e-14 18.68001982
## 15 2 25161661 25161661 + 1.022510e-07 8.811400e-08 26.55204114
## 16 2 25161671 25161671 + 1.286359e-19 5.067474e-19 22.44093960
## 17 2 25161686 25161686 + 1.164298e-16 2.918765e-16 25.76099134
## 18 2 25161689 25161689 + 2.277120e-01 6.156207e-02 26.57811571
## 19 2 25161699 25161699 + 6.179967e-06 4.484665e-06 42.83872687
## 20 2 25161716 25161716 + 1.801607e-11 2.484034e-11 21.06120636
## 21 2 25161720 25161720 + 1.144600e-24 1.052107e-23 18.43231761
## 22 2 25161728 25161728 + 2.702916e-14 4.968997e-14 23.00876180
## 23 2 25161742 25161742 + 3.127494e-05 1.724860e-05 17.98780805
## 24 2 25161764 25161764 + 8.989406e-01 2.100760e-01 10.32084263
## 25 2 25161766 25161766 + 3.717203e-04 1.708411e-04 15.22041456
## 26 2 25161785 25161785 + 3.030813e-33 4.178848e-32 13.93065932
## 27 2 25161792 25161792 + 4.477479e-02 1.452587e-02 15.32270736
## 28 2 25161799 25161799 + 4.277064e-01 1.072212e-01 7.38753209
## 29 2 25161804 25161804 + 3.244215e-04 1.569503e-04 7.78702876
## 30 2 25161811 25161811 + 5.520543e-03 2.174759e-03 11.09382014
## 31 2 25161813 25161813 + 9.980054e-02 2.927740e-02 0.11474469
## 32 2 25161817 25161817 + 8.188786e-04 3.584317e-04 0.19860973
## 33 2 25161825 25161825 + 9.539431e-02 2.890737e-02 0.17391304
## 34 5 865252 865252 + 2.711336e-06 2.076865e-06 79.08156620
## 35 5 865254 865254 + 2.117197e-02 7.582249e-03 2.25669958
## 36 5 865278 865278 + 4.430813e-01 1.100748e-01 13.19224561
## 37 5 865296 865296 + 3.706773e-02 1.261939e-02 97.70229770
## 38 5 865349 865349 + 2.094394e-05 1.255533e-05 17.23415561
## 39 5 865357 865357 + 1.802835e-05 1.156152e-05 17.12494615
## 40 5 865391 865391 + 2.464424e-01 6.597899e-02 3.95800374
## 41 5 865394 865394 + 4.224430e-09 4.480456e-09 4.96001791
## 42 5 865435 865435 + 9.929705e-02 2.927740e-02 6.59029476
## 43 5 865441 865441 + 2.048658e-05 1.255407e-05 7.43243243
## 44 5 865466 865466 + 4.753437e-03 1.927641e-03 7.55321233
## 45 5 865469 865469 + 9.526198e-01 2.189101e-01 9.18016691
## 46 5 865473 865473 + 3.660352e-01 9.260274e-02 5.25114155
## 47 5 865480 865480 + 6.998668e-09 7.088236e-09 4.81522956
## 48 5 865483 865483 + 7.001578e-01 1.678903e-01 0.08206812
## 49 5 865485 865485 + 1.040949e-01 3.021574e-02 0.30165913
## 50 5 10649447 10649447 + 3.966125e-02 1.317698e-02 4.61538462
## 51 5 10649449 10649449 + 3.140769e-01 8.170670e-02 0.48407023
## 52 5 10649486 10649486 + 1.674053e-14 3.297378e-14 6.61659024
## 53 5 10649495 10649495 + 1.590719e-52 4.386529e-51 34.85214074
## 54 5 10649503 10649503 + 6.398242e-12 9.802021e-12 5.39802562
## 55 5 10649506 10649506 + 3.367847e-01 8.679525e-02 0.10621349
## 56 5 10649508 10649508 + 2.598808e-12 4.479005e-12 0.10605860
## 57 5 131945728 131945728 + 5.942322e-03 2.307944e-03 0.22624434
## 58 5 131945736 131945736 + 6.857500e-02 2.148872e-02 0.25706941
## 59 5 131945738 131945738 + 3.942572e-02 1.317698e-02 0.28694405
## 60 5 131945745 131945745 + 8.215229e-02 2.545406e-02 38.99782135
## 61 5 131945789 131945789 + 2.523604e-01 6.691375e-02 1.60615693
## 62 6 31575257 31575257 + 5.569945e-01 1.371388e-01 16.82074987
## 63 6 31575316 31575316 + 1.453380e-04 7.450872e-05 11.69862600
## 64 6 31575322 31575322 + 3.219596e-02 1.123833e-02 21.46261574
## 65 6 31575391 31575391 + 8.524629e-01 2.009172e-01 19.07981968
## 66 6 31575397 31575397 + 2.532721e-02 8.954066e-03 26.18230525
## 67 6 31575399 31575399 + 2.091433e-03 8.738312e-04 20.93227144
## 68 6 31575414 31575414 + 1.837600e-01 5.170737e-02 29.69585630
## 69 6 31575441 31575441 + 1.717072e-04 8.609010e-05 31.82677571
## 70 7 24283574 24283574 + 2.391154e-05 1.373706e-05 18.33333333
## 71 7 24283578 24283578 + 3.571473e-01 9.119081e-02 4.04040404
## 72 7 24283596 24283596 + 2.955606e-05 1.663328e-05 17.85714286
## 73 7 24283618 24283618 + 1.057147e-02 3.993374e-03 21.66666667
## 74 7 24283628 24283628 + 9.516755e-05 5.145720e-05 27.58620690
## 75 7 24283641 24283641 + 2.637720e-06 2.076865e-06 29.82456140
## 76 7 24283672 24283672 + 6.252170e-02 1.981705e-02 32.75862069
## 77 7 24283696 24283696 + 4.192660e-09 4.480456e-09 26.66666667
## 78 7 24283698 24283698 + 1.784551e-21 9.842068e-21 38.54166667
## 79 7 24283710 24283710 + 2.087670e-23 1.439227e-22 43.00518135
## 80 7 24283713 24283713 + 7.843962e-01 1.864683e-01 22.80701754
## 81 7 24283722 24283722 + 7.197285e-09 7.088236e-09 26.22950820
## 82 7 24283724 24283724 + 3.597779e-04 1.681551e-04 27.41935484
## 83 7 24283731 24283731 + 1.488017e-08 1.414937e-08 26.66666667
## 84 7 24283776 24283776 + 5.074496e-03 2.028015e-03 29.50819672
## 85 7 24283820 24283820 + 9.385379e-01 2.174865e-01 2.20777593
## 86 7 24283854 24283854 + 3.096397e-01 8.131952e-02 2.68745408
## 87 7 24283859 24283859 + 1.384090e-02 5.157748e-03 3.37339238
## 88 7 24283894 24283894 + 1.938701e-03 8.224793e-04 3.61023446
## 89 7 24283905 24283905 + 9.825962e-01 2.239325e-01 2.49640809
## 90 7 128241074 128241074 + 8.975436e-02 2.750050e-02 25.54652555
## 91 7 128241076 128241076 + 1.724894e-02 6.258587e-03 18.02216539
## 92 7 128241078 128241078 + 8.430188e-06 5.811720e-06 22.38217652
## 93 7 128241090 128241090 + 1.222479e-06 1.021539e-06 17.50000000
## 94 7 128241092 128241092 + 5.913447e-02 1.896137e-02 17.12817585
## 95 7 128241095 128241095 + 1.789265e-09 2.055847e-09 29.96738335
## 96 7 128241108 128241108 + 3.947845e-06 2.942293e-06 15.05336079
## 97 7 128241116 128241116 + 8.097593e-03 3.101351e-03 26.24089253
## 98 7 128241118 128241118 + 4.194429e-04 1.865558e-04 13.36064713
## 99 7 128241132 128241132 + 3.543637e-02 1.221481e-02 12.68037518
## 100 7 128241151 128241151 + 4.418805e-08 4.061730e-08 8.42450300
## 101 7 128241155 128241155 + 8.064172e-08 7.173409e-08 11.23366013
## 102 7 128241160 128241160 + 6.468962e-11 7.755936e-11 8.91891892
## 103 7 128241163 128241163 + 9.660211e-02 2.895518e-02 15.32945736
## 104 7 128241178 128241178 + 6.697058e-01 1.619969e-01 24.61523663
## 105 7 128241183 128241183 + 1.290226e-04 6.842108e-05 11.05832629
## 106 7 128241193 128241193 + 1.142776e-01 3.282596e-02 15.98173516
## 107 7 128241204 128241204 + 9.650213e-15 2.217599e-14 20.30030030
## 108 7 128241207 128241207 + 2.077847e-01 5.673090e-02 20.21473159
## 109 7 128241216 128241216 + 8.150272e-06 5.762818e-06 18.45776772
## 110 7 128241227 128241227 + 4.257322e-02 1.397606e-02 41.53129479
## 111 7 128241240 128241240 + 1.341440e-01 3.813528e-02 24.22222222
## 112 7 128241245 128241245 + 1.111420e-05 7.297200e-06 24.44901945
## 113 7 128241259 128241259 + 3.516346e-04 1.671826e-04 28.34880637
## 114 7 128241277 128241277 + 3.045543e-11 3.999198e-11 12.39731262
## 115 7 128241286 128241286 + 1.916753e-01 5.325539e-02 27.41402116
## 116 7 128241291 128241291 + 3.782331e-04 1.709847e-04 21.03383459
## 117 7 128241297 128241297 + 1.876828e-06 1.522204e-06 23.63636364
## 118 7 128241316 128241316 + 2.184010e-05 1.281399e-05 24.33333333
## 119 7 128241319 128241319 + 2.872723e-04 1.414598e-04 35.09801687
## 120 7 128241321 128241321 + 2.215289e-03 9.117653e-04 24.26501035
## 121 8 22055661 22055661 + 2.808569e-21 1.290807e-20 23.26175098dm$pvalue<0.05## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE FALSE FALSE TRUE TRUE TRUE
## [13] TRUE TRUE TRUE TRUE TRUE FALSE TRUE TRUE TRUE TRUE TRUE FALSE
## [25] TRUE TRUE TRUE FALSE TRUE TRUE FALSE TRUE FALSE TRUE TRUE FALSE
## [37] TRUE TRUE TRUE FALSE TRUE FALSE TRUE TRUE FALSE FALSE TRUE FALSE
## [49] FALSE TRUE FALSE TRUE TRUE TRUE FALSE TRUE TRUE FALSE TRUE FALSE
## [61] FALSE FALSE TRUE TRUE FALSE TRUE TRUE FALSE TRUE TRUE FALSE TRUE
## [73] TRUE TRUE TRUE FALSE TRUE TRUE TRUE FALSE TRUE TRUE TRUE TRUE
## [85] FALSE FALSE TRUE TRUE FALSE FALSE TRUE TRUE TRUE FALSE TRUE TRUE
## [97] TRUE TRUE TRUE TRUE TRUE TRUE FALSE FALSE TRUE FALSE TRUE FALSE
## [109] TRUE TRUE FALSE TRUE TRUE TRUE FALSE TRUE TRUE TRUE TRUE TRUE
## [121] TRUEmin(dm$pvalue)## [1] 1.590719e-52plot(dm$meth.diff,-log10(dm$pvalue) )
hist(dm$meth.diff)
#dm.hyper=getMethylDiff(dm,difference=1,qvalue=0.01,type="hyper")
#dm.hypo=getMethylDiff(dm,difference=1,qvalue=0.01,type="hypo")Lets run a simple correlation test of GWG with Beta vals
Here we run a spearman correlation test of the assocation between GWG and beta vals.
z <- samplesheet$GWG
genes <- amp
genes %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | gene_names |
|---|---|---|---|---|---|
| 17 | 78358469 | 78358619 | 151 |
|
SOCS3 |
| 2 | 25161598 | 25161833 | 236 |
|
POMC_2 |
| 2 | 25168373 | 25168611 | 239 |
|
POMC_1 |
| 6 | 31575210 | 31575467 | 258 |
|
TNF |
| 7 | 24283548 | 24283843 | 296 |
|
NPY_1 |
| 7 | 24283796 | 24283936 | 141 |
|
NPY_2 |
| 7 | 128241036 | 128241347 | 312 |
|
LEP |
par(mfrow=c(1,1))
x <- lapply( 1:nrow(meth), function(i) {
x <- as.vector(percMethylation(meth)[i,])
cor <- cor.test(x,z,method="pearson")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
#plot(z,x,xlab="GWG",ylab="Beta",main="Pearson")
#mtext(HEADER)
#mylm <- lm( x ~ z )
#abline(mylm,lwd=3,lty=2,col="red")
cor <- cor.test(x,z,method="spearman")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
plot(rank(z),rank(x),xlab="rank(GWG)",ylab="rank(Beta)",main="Spearman")
mtext(HEADER)
mylm <- lm( rank(x) ~ rank(z) )
abline(mylm,lwd=3,lty=2,col="red")
c("p"=p,"r"=r)
})## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
Now let’s present the results.
xx <- as.data.frame(t(sapply(x,function(x){ x[c(2,1)] } )))
xx$FDR <- p.adjust(xx[,2],method="fdr")
xx <- data.frame(meth$chr,meth$start,xx)
colnames(xx) <- c("seqname","pos","rho","p","FDR")
gr <- GRanges(seqnames = xx$seqname, ranges = IRanges(xx$pos) )
gr$r <- xx$r
gr$p <- xx$p
gr$FDR <- xx$FDR
ol <- findOverlaps(gr,genes)
# off target gene methylation
ot <- gr[-queryHits(ol)]
ot %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR |
|---|---|---|---|---|---|---|---|
| 5 | 865252 | 865252 | 1 |
|
0.2305193 | 0.2784972 | 0.8498154 |
| 5 | 865254 | 865254 | 1 |
|
-0.4191261 | 0.0414860 | 0.5639518 |
| 5 | 865278 | 865278 | 1 |
|
0.0008732 | 0.9967691 | 0.9967691 |
| 5 | 865296 | 865296 | 1 |
|
0.0794593 | 0.7120731 | 0.9399774 |
| 5 | 865349 | 865349 | 1 |
|
-0.1934092 | 0.3651909 | 0.9399774 |
| 5 | 865357 | 865357 | 1 |
|
-0.3152177 | 0.1335208 | 0.6462409 |
| 5 | 865391 | 865391 | 1 |
|
0.1174426 | 0.5847003 | 0.9399774 |
| 5 | 865394 | 865394 | 1 |
|
-0.2693758 | 0.2030520 | 0.7445241 |
| 5 | 865435 | 865435 | 1 |
|
-0.0781495 | 0.7166267 | 0.9399774 |
| 5 | 865441 | 865441 | 1 |
|
0.2938248 | 0.1634429 | 0.6618646 |
| 5 | 865466 | 865466 | 1 |
|
-0.1938458 | 0.3640885 | 0.9399774 |
| 5 | 865469 | 865469 | 1 |
|
0.0571932 | 0.7906643 | 0.9427970 |
| 5 | 865473 | 865473 | 1 |
|
-0.1458209 | 0.4965765 | 0.9399774 |
| 5 | 865480 | 865480 | 1 |
|
0.3056128 | 0.1464245 | 0.6561988 |
| 5 | 865483 | 865483 | 1 |
|
-0.1078497 | 0.6159382 | 0.9399774 |
| 5 | 865485 | 865485 | 1 |
|
0.2003400 | 0.3479198 | 0.9399774 |
| 5 | 10649447 | 10649447 | 1 |
|
0.0235964 | 0.9128520 | 0.9604790 |
| 5 | 10649449 | 10649449 | 1 |
|
0.2938248 | 0.1634429 | 0.6618646 |
| 5 | 10649486 | 10649486 | 1 |
|
0.1484405 | 0.4887891 | 0.9399774 |
| 5 | 10649495 | 10649495 | 1 |
|
-0.0803325 | 0.7090426 | 0.9399774 |
| 5 | 10649503 | 10649503 | 1 |
|
-0.1060913 | 0.6217372 | 0.9399774 |
| 5 | 10649506 | 10649506 | 1 |
|
-0.1604138 | 0.4539892 | 0.9399774 |
| 5 | 10649508 | 10649508 | 1 |
|
-0.3478499 | 0.0957889 | 0.5639518 |
| 5 | 131945728 | 131945728 | 1 |
|
-0.3478499 | 0.0957889 | 0.5639518 |
| 5 | 131945736 | 131945736 | 1 |
|
0.2299217 | 0.2797799 | 0.8498154 |
| 5 | 131945738 | 131945738 | 1 |
|
-0.3928341 | 0.0575779 | 0.5639518 |
| 5 | 131945745 | 131945745 | 1 |
|
0.1648761 | 0.4413609 | 0.9399774 |
| 5 | 131945789 | 131945789 | 1 |
|
0.0960497 | 0.6552644 | 0.9399774 |
| 8 | 22055661 | 22055661 | 1 |
|
-0.1768188 | 0.4085028 | 0.9399774 |
# on target methylation
gr <- gr[queryHits(ol)]
gr$gene_names <- genes$gene_names[subjectHits(ol) ]
gr %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR | gene_names |
|---|---|---|---|---|---|---|---|---|
| 17 | 78358500 | 78358500 | 1 |
|
0.3353009 | 0.1092206 | 0.5639518 | SOCS3 |
| 17 | 78358506 | 78358506 | 1 |
|
0.0440956 | 0.8378923 | 0.9427970 | SOCS3 |
| 17 | 78358514 | 78358514 | 1 |
|
0.1309769 | 0.5418376 | 0.9399774 | SOCS3 |
| 17 | 78358539 | 78358539 | 1 |
|
0.2300827 | 0.2794339 | 0.8498154 | SOCS3 |
| 17 | 78358556 | 78358556 | 1 |
|
0.0794593 | 0.7120731 | 0.9399774 | SOCS3 |
| 17 | 78358581 | 78358581 | 1 |
|
0.2458000 | 0.2469636 | 0.8498154 | SOCS3 |
| 17 | 78358587 | 78358587 | 1 |
|
-0.1886067 | 0.3774446 | 0.9399774 | SOCS3 |
| 2 | 25161599 | 25161599 | 1 |
|
0.1466941 | 0.4939739 | 0.9399774 | POMC_2 |
| 2 | 25161616 | 25161616 | 1 |
|
0.0471517 | 0.8268175 | 0.9427970 | POMC_2 |
| 2 | 25161619 | 25161619 | 1 |
|
0.2719954 | 0.1985233 | 0.7445241 | POMC_2 |
| 2 | 25161623 | 25161623 | 1 |
|
0.0825154 | 0.7014852 | 0.9399774 | POMC_2 |
| 2 | 25161628 | 25161628 | 1 |
|
-0.0846984 | 0.6939552 | 0.9399774 | POMC_2 |
| 2 | 25161637 | 25161637 | 1 |
|
0.1510600 | 0.4810633 | 0.9399774 | POMC_2 |
| 2 | 25161653 | 25161653 | 1 |
|
0.0314345 | 0.8840703 | 0.9466593 | POMC_2 |
| 2 | 25161661 | 25161661 | 1 |
|
0.3383570 | 0.1058289 | 0.5639518 | POMC_2 |
| 2 | 25161671 | 25161671 | 1 |
|
0.0048025 | 0.9822315 | 0.9967691 | POMC_2 |
| 2 | 25161686 | 25161686 | 1 |
|
-0.0152806 | 0.9435035 | 0.9749080 | POMC_2 |
| 2 | 25161689 | 25161689 | 1 |
|
0.1122035 | 0.6016759 | 0.9399774 | POMC_2 |
| 2 | 25161699 | 25161699 | 1 |
|
-0.1741993 | 0.4155914 | 0.9399774 | POMC_2 |
| 2 | 25161716 | 25161716 | 1 |
|
-0.1536796 | 0.4733999 | 0.9399774 | POMC_2 |
| 2 | 25161720 | 25161720 | 1 |
|
-0.1803115 | 0.3991563 | 0.9399774 | POMC_2 |
| 2 | 25161728 | 25161728 | 1 |
|
-0.0720373 | 0.7379988 | 0.9399774 | POMC_2 |
| 2 | 25161742 | 25161742 | 1 |
|
0.0571932 | 0.7906643 | 0.9427970 | POMC_2 |
| 2 | 25161764 | 25161764 | 1 |
|
0.0969229 | 0.6523220 | 0.9399774 | POMC_2 |
| 2 | 25161766 | 25161766 | 1 |
|
-0.0013098 | 0.9951537 | 0.9967691 | POMC_2 |
| 2 | 25161785 | 25161785 | 1 |
|
0.3108518 | 0.1392807 | 0.6481907 | POMC_2 |
| 2 | 25161792 | 25161792 | 1 |
|
-0.0502078 | 0.8157746 | 0.9427970 | POMC_2 |
| 2 | 25161799 | 25161799 | 1 |
|
0.0585030 | 0.7859777 | 0.9427970 | POMC_2 |
| 2 | 25161804 | 25161804 | 1 |
|
-0.0397297 | 0.8537650 | 0.9427970 | POMC_2 |
| 2 | 25161811 | 25161811 | 1 |
|
-0.2261534 | 0.2879540 | 0.8498154 | POMC_2 |
| 2 | 25161813 | 25161813 | 1 |
|
0.1341203 | 0.5320960 | 0.9399774 | POMC_2 |
| 2 | 25161817 | 25161817 | 1 |
|
-0.3569757 | 0.0868225 | 0.5639518 | POMC_2 |
| 2 | 25161825 | 25161825 | 1 |
|
0.0848181 | 0.6935432 | 0.9399774 | POMC_2 |
| 6 | 31575257 | 31575257 | 1 |
|
0.1458209 | 0.4965765 | 0.9399774 | TNF |
| 6 | 31575316 | 31575316 | 1 |
|
0.1571723 | 0.4632800 | 0.9399774 | TNF |
| 6 | 31575322 | 31575322 | 1 |
|
-0.0366815 | 0.8648799 | 0.9427970 | TNF |
| 6 | 31575391 | 31575391 | 1 |
|
-0.0144075 | 0.9467273 | 0.9749080 | TNF |
| 6 | 31575397 | 31575397 | 1 |
|
-0.0488980 | 0.8205032 | 0.9427970 | TNF |
| 6 | 31575399 | 31575399 | 1 |
|
0.1126401 | 0.6002534 | 0.9399774 | TNF |
| 6 | 31575414 | 31575414 | 1 |
|
-0.2383780 | 0.2619761 | 0.8498154 | TNF |
| 6 | 31575441 | 31575441 | 1 |
|
-0.1161328 | 0.5889247 | 0.9399774 | TNF |
| 7 | 24283574 | 24283574 | 1 |
|
-0.1655748 | 0.4394009 | 0.9399774 | NPY_1 |
| 7 | 24283578 | 24283578 | 1 |
|
-0.0766178 | 0.7219640 | 0.9399774 | NPY_1 |
| 7 | 24283596 | 24283596 | 1 |
|
-0.0552148 | 0.7977568 | 0.9427970 | NPY_1 |
| 7 | 24283618 | 24283618 | 1 |
|
0.0422370 | 0.8446420 | 0.9427970 | NPY_1 |
| 7 | 24283628 | 24283628 | 1 |
|
0.0269067 | 0.9006813 | 0.9559863 | NPY_1 |
| 7 | 24283641 | 24283641 | 1 |
|
0.0847511 | 0.6937737 | 0.9399774 | NPY_1 |
| 7 | 24283672 | 24283672 | 1 |
|
0.0751406 | 0.7271230 | 0.9399774 | NPY_1 |
| 7 | 24283696 | 24283696 | 1 |
|
-0.3958763 | 0.0555014 | 0.5639518 | NPY_1 |
| 7 | 24283698 | 24283698 | 1 |
|
-0.1206670 | 0.5743568 | 0.9399774 | NPY_1 |
| 7 | 24283710 | 24283710 | 1 |
|
-0.4426874 | 0.0302883 | 0.5639518 | NPY_1 |
| 7 | 24283713 | 24283713 | 1 |
|
-0.3527195 | 0.0909225 | 0.5639518 | NPY_1 |
| 7 | 24283722 | 24283722 | 1 |
|
-0.1581808 | 0.4603787 | 0.9399774 | NPY_1 |
| 7 | 24283724 | 24283724 | 1 |
|
-0.0872307 | 0.6852553 | 0.9399774 | NPY_1 |
| 7 | 24283731 | 24283731 | 1 |
|
-0.2837018 | 0.1791257 | 0.6991682 | NPY_1 |
| 7 | 24283776 | 24283776 | 1 |
|
0.0399167 | 0.8530838 | 0.9427970 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.1226817 | 0.5679352 | 0.9399774 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.1226817 | 0.5679352 | 0.9399774 | NPY_2 |
| 7 | 24283854 | 24283854 | 1 |
|
-0.1283574 | 0.5500185 | 0.9399774 | NPY_2 |
| 7 | 24283859 | 24283859 | 1 |
|
-0.0925570 | 0.6670834 | 0.9399774 | NPY_2 |
| 7 | 24283894 | 24283894 | 1 |
|
-0.1327233 | 0.5364152 | 0.9399774 | NPY_2 |
| 7 | 24283905 | 24283905 | 1 |
|
0.0724739 | 0.7364658 | 0.9399774 | NPY_2 |
| 7 | 128241074 | 128241074 | 1 |
|
-0.0462785 | 0.8299786 | 0.9427970 | LEP |
| 7 | 128241076 | 128241076 | 1 |
|
-0.1392721 | 0.5163106 | 0.9399774 | LEP |
| 7 | 128241078 | 128241078 | 1 |
|
-0.3929307 | 0.0575111 | 0.5639518 | LEP |
| 7 | 128241090 | 128241090 | 1 |
|
-0.4012259 | 0.0519912 | 0.5639518 | LEP |
| 7 | 128241092 | 128241092 | 1 |
|
-0.0803325 | 0.7090426 | 0.9399774 | LEP |
| 7 | 128241095 | 128241095 | 1 |
|
-0.3329720 | 0.1118582 | 0.5639518 | LEP |
| 7 | 128241108 | 128241108 | 1 |
|
-0.4894170 | 0.0152117 | 0.5639518 | LEP |
| 7 | 128241116 | 128241116 | 1 |
|
-0.0340540 | 0.8744811 | 0.9447519 | LEP |
| 7 | 128241118 | 128241118 | 1 |
|
-0.3387936 | 0.1053508 | 0.5639518 | LEP |
| 7 | 128241132 | 128241132 | 1 |
|
-0.1693968 | 0.4287609 | 0.9399774 | LEP |
| 7 | 128241151 | 128241151 | 1 |
|
-0.2933882 | 0.1640987 | 0.6618646 | LEP |
| 7 | 128241155 | 128241155 | 1 |
|
-0.3366106 | 0.1077574 | 0.5639518 | LEP |
| 7 | 128241160 | 128241160 | 1 |
|
-0.3593133 | 0.0846306 | 0.5639518 | LEP |
| 7 | 128241163 | 128241163 | 1 |
|
-0.0969229 | 0.6523220 | 0.9399774 | LEP |
| 7 | 128241178 | 128241178 | 1 |
|
-0.0133218 | 0.9507367 | 0.9749080 | LEP |
| 7 | 128241183 | 128241183 | 1 |
|
-0.3772135 | 0.0692002 | 0.5639518 | LEP |
| 7 | 128241193 | 128241193 | 1 |
|
-0.0585540 | 0.7857956 | 0.9427970 | LEP |
| 7 | 128241204 | 128241204 | 1 |
|
-0.4344067 | 0.0339087 | 0.5639518 | LEP |
| 7 | 128241207 | 128241207 | 1 |
|
-0.0373365 | 0.8624892 | 0.9427970 | LEP |
| 7 | 128241216 | 128241216 | 1 |
|
-0.3488351 | 0.0947890 | 0.5639518 | LEP |
| 7 | 128241227 | 128241227 | 1 |
|
-0.1259835 | 0.5574806 | 0.9399774 | LEP |
| 7 | 128241240 | 128241240 | 1 |
|
-0.1039083 | 0.6289668 | 0.9399774 | LEP |
| 7 | 128241245 | 128241245 | 1 |
|
-0.2309559 | 0.2775624 | 0.8498154 | LEP |
| 7 | 128241259 | 128241259 | 1 |
|
-0.1846774 | 0.3876434 | 0.9399774 | LEP |
| 7 | 128241277 | 128241277 | 1 |
|
-0.4082113 | 0.0476702 | 0.5639518 | LEP |
| 7 | 128241286 | 128241286 | 1 |
|
-0.0410394 | 0.8489971 | 0.9427970 | LEP |
| 7 | 128241291 | 128241291 | 1 |
|
-0.4239286 | 0.0389736 | 0.5639518 | LEP |
| 7 | 128241297 | 128241297 | 1 |
|
-0.2076887 | 0.3301456 | 0.9399774 | LEP |
| 7 | 128241316 | 128241316 | 1 |
|
-0.4941086 | 0.0141222 | 0.5639518 | LEP |
| 7 | 128241319 | 128241319 | 1 |
|
-0.2265900 | 0.2869994 | 0.8498154 | LEP |
| 7 | 128241321 | 128241321 | 1 |
|
-0.5234710 | 0.0086622 | 0.5639518 | LEP |
Remove outliers
Two samples (pool8, pool17) showed unusual profiles that are consistent with incomplete bisulfite conversion.
file.list <- file.list[which(! file.list %in% c("pool8","pool17"))]
samplesheet <- samplesheet[which(! samplesheet$poolID %in% c("pool8","pool17")),]
myobj <- methRead( location=as.list(paste("fastq/",file.list,".methylkit.tsv",sep="")),
sample.id=as.list(samplesheet$poolID),
header=FALSE,
assembly="hg38",
treatment=samplesheet$GWG,
context="CpG",
mincov = 5 )## Received list of locations.## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.
## Reading file.myobjf <- filterByCoverage(myobj,lo.count=5,lo.perc=NULL,
hi.count=NULL,hi.perc=NULL)
meth <- unite(myobjf, destrand=FALSE)## uniting...Now run a spearman correlation test of GWG with Beta vals.
Have modified the script so it doesn’t plot the pearson values.
z <- samplesheet$GWG
genes <- amp
genes %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | gene_names |
|---|---|---|---|---|---|
| 17 | 78358469 | 78358619 | 151 |
|
SOCS3 |
| 2 | 25161598 | 25161833 | 236 |
|
POMC_2 |
| 2 | 25168373 | 25168611 | 239 |
|
POMC_1 |
| 6 | 31575210 | 31575467 | 258 |
|
TNF |
| 7 | 24283548 | 24283843 | 296 |
|
NPY_1 |
| 7 | 24283796 | 24283936 | 141 |
|
NPY_2 |
| 7 | 128241036 | 128241347 | 312 |
|
LEP |
par(mfrow=c(1,1))
x <- lapply( 1:nrow(meth), function(i) {
x <- as.vector(percMethylation(meth)[i,])
cor <- cor.test(x,z,method="pearson")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
# plot(z,x,xlab="GWG",ylab="Beta",main="Pearson")
# mtext(HEADER)
# mylm <- lm( x ~ z )
# abline(mylm,lwd=3,lty=2,col="red")
cor <- cor.test(x,z,method="spearman")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
plot(rank(z),rank(x),xlab="rank(GWG)",ylab="rank(Beta)",main="Spearman")
mtext(HEADER)
mylm <- lm( rank(x) ~ rank(z) )
abline(mylm,lwd=3,lty=2,col="red")
c("p"=p,"r"=r)
})## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
xx <- as.data.frame(t(sapply(x,function(x){ x[c(2,1)] } )))
xx$FDR <- p.adjust(xx[,2],method="fdr")
xx <- data.frame(meth$chr,meth$start,xx)
colnames(xx) <- c("seqname","pos","rho","p","FDR")
gr <- GRanges(seqnames = xx$seqname, ranges = IRanges(xx$pos) )
gr$r <- xx$r
gr$p <- xx$p
gr$FDR <- xx$FDR
ol <- findOverlaps(gr,genes)
# off target gene methylation
ot <- gr[-queryHits(ol)]
ot %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR |
|---|---|---|---|---|---|---|---|
| 16 | 14989709 | 14989709 | 1 |
|
-0.1591335 | 0.4793424 | 0.9090315 |
| 16 | 14989712 | 14989712 | 1 |
|
0.1204899 | 0.5932645 | 0.9090315 |
| 16 | 14989741 | 14989741 | 1 |
|
-0.2533304 | 0.2553109 | 0.8531121 |
| 16 | 14989762 | 14989762 | 1 |
|
-0.1627177 | 0.4693685 | 0.9090315 |
| 16 | 14989764 | 14989764 | 1 |
|
-0.1797546 | 0.4234437 | 0.9090315 |
| 16 | 14989771 | 14989771 | 1 |
|
0.2595660 | 0.2433981 | 0.8531121 |
| 16 | 14989775 | 14989775 | 1 |
|
0.1391830 | 0.5367482 | 0.9090315 |
| 16 | 14989785 | 14989785 | 1 |
|
-0.0584577 | 0.7960933 | 0.9321776 |
| 16 | 14989801 | 14989801 | 1 |
|
-0.1106982 | 0.6238336 | 0.9090315 |
| 16 | 14989804 | 14989804 | 1 |
|
0.1521988 | 0.4989383 | 0.9090315 |
| 16 | 14989809 | 14989809 | 1 |
|
-0.2158716 | 0.3346122 | 0.9090315 |
| 16 | 14989812 | 14989812 | 1 |
|
-0.0009303 | 0.9967218 | 0.9967218 |
| 16 | 14989820 | 14989820 | 1 |
|
0.0672026 | 0.7663560 | 0.9309958 |
| 16 | 14989827 | 14989827 | 1 |
|
-0.0332202 | 0.8833205 | 0.9785880 |
| 16 | 14989844 | 14989844 | 1 |
|
0.1124376 | 0.6183575 | 0.9090315 |
| 16 | 14989857 | 14989857 | 1 |
|
0.0854367 | 0.7054051 | 0.9090315 |
| 5 | 865252 | 865252 | 1 |
|
0.3269988 | 0.1374321 | 0.7238218 |
| 5 | 865254 | 865254 | 1 |
|
-0.3457331 | 0.1150198 | 0.7238218 |
| 5 | 865278 | 865278 | 1 |
|
-0.0164635 | 0.9420308 | 0.9785880 |
| 5 | 865296 | 865296 | 1 |
|
0.0232760 | 0.9181100 | 0.9785880 |
| 5 | 865349 | 865349 | 1 |
|
-0.2986135 | 0.1770467 | 0.7485262 |
| 5 | 865357 | 865357 | 1 |
|
-0.3173478 | 0.1501172 | 0.7238218 |
| 5 | 865391 | 865391 | 1 |
|
0.0885622 | 0.6951190 | 0.9090315 |
| 5 | 865394 | 865394 | 1 |
|
-0.2202700 | 0.3246148 | 0.9090315 |
| 5 | 865435 | 865435 | 1 |
|
-0.0079479 | 0.9719974 | 0.9811587 |
| 5 | 865441 | 865441 | 1 |
|
0.3298373 | 0.1338509 | 0.7238218 |
| 5 | 865466 | 865466 | 1 |
|
-0.2895302 | 0.1912293 | 0.7485262 |
| 5 | 865469 | 865469 | 1 |
|
0.1254631 | 0.5779855 | 0.9090315 |
| 5 | 865473 | 865473 | 1 |
|
-0.0607446 | 0.7882885 | 0.9309958 |
| 5 | 865480 | 865480 | 1 |
|
0.3099676 | 0.1603576 | 0.7322998 |
| 5 | 865483 | 865483 | 1 |
|
-0.0922550 | 0.6830324 | 0.9090315 |
| 5 | 865485 | 865485 | 1 |
|
0.1729417 | 0.4415102 | 0.9090315 |
| 5 | 10649447 | 10649447 | 1 |
|
0.0346693 | 0.8782669 | 0.9785880 |
| 5 | 10649449 | 10649449 | 1 |
|
0.4235089 | 0.0495251 | 0.7238218 |
| 5 | 10649486 | 10649486 | 1 |
|
0.1504422 | 0.5039636 | 0.9090315 |
| 5 | 10649495 | 10649495 | 1 |
|
-0.0215728 | 0.9240846 | 0.9785880 |
| 5 | 10649503 | 10649503 | 1 |
|
-0.1396557 | 0.5353520 | 0.9090315 |
| 5 | 10649506 | 10649506 | 1 |
|
-0.1940489 | 0.3868689 | 0.9090315 |
| 5 | 10649508 | 10649508 | 1 |
|
-0.3285286 | 0.1354936 | 0.7238218 |
| 5 | 131945728 | 131945728 | 1 |
|
-0.3631106 | 0.0967183 | 0.7238218 |
| 5 | 131945736 | 131945736 | 1 |
|
0.2180120 | 0.3297245 | 0.9090315 |
| 5 | 131945738 | 131945738 | 1 |
|
-0.4800902 | 0.0237408 | 0.5420813 |
| 5 | 131945745 | 131945745 | 1 |
|
0.2934628 | 0.1849974 | 0.7485262 |
| 5 | 131945789 | 131945789 | 1 |
|
0.0840205 | 0.7100822 | 0.9090315 |
| 8 | 22055661 | 22055661 | 1 |
|
-0.1669056 | 0.4578502 | 0.9090315 |
# on target methylation
gr <- gr[queryHits(ol)]
gr$gene_names <- genes$gene_names[subjectHits(ol) ]
gr %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR | gene_names |
|---|---|---|---|---|---|---|---|---|
| 17 | 78358500 | 78358500 | 1 |
|
0.2634157 | 0.2362265 | 0.8516588 | SOCS3 |
| 17 | 78358506 | 78358506 | 1 |
|
-0.0874268 | 0.6988498 | 0.9090315 | SOCS3 |
| 17 | 78358514 | 78358514 | 1 |
|
0.1044579 | 0.6436361 | 0.9090315 | SOCS3 |
| 17 | 78358539 | 78358539 | 1 |
|
0.1884785 | 0.4009050 | 0.9090315 | SOCS3 |
| 17 | 78358556 | 78358556 | 1 |
|
-0.0141927 | 0.9500161 | 0.9785880 | SOCS3 |
| 17 | 78358581 | 78358581 | 1 |
|
0.1612286 | 0.4734994 | 0.9090315 | SOCS3 |
| 17 | 78358587 | 78358587 | 1 |
|
-0.3514102 | 0.1087848 | 0.7238218 | SOCS3 |
| 2 | 25161599 | 25161599 | 1 |
|
0.1424943 | 0.5270047 | 0.9090315 | POMC_2 |
| 2 | 25161616 | 25161616 | 1 |
|
0.0908330 | 0.6876780 | 0.9090315 | POMC_2 |
| 2 | 25161619 | 25161619 | 1 |
|
0.3150770 | 0.1532178 | 0.7238218 | POMC_2 |
| 2 | 25161623 | 25161623 | 1 |
|
0.1288693 | 0.5676203 | 0.9090315 | POMC_2 |
| 2 | 25161628 | 25161628 | 1 |
|
-0.0868591 | 0.7007177 | 0.9090315 | POMC_2 |
| 2 | 25161637 | 25161637 | 1 |
|
0.0885622 | 0.6951190 | 0.9090315 | POMC_2 |
| 2 | 25161653 | 25161653 | 1 |
|
0.0993486 | 0.6600264 | 0.9090315 | POMC_2 |
| 2 | 25161661 | 25161661 | 1 |
|
0.3627643 | 0.0970606 | 0.7238218 | POMC_2 |
| 2 | 25161671 | 25161671 | 1 |
|
0.1277339 | 0.5710662 | 0.9090315 | POMC_2 |
| 2 | 25161686 | 25161686 | 1 |
|
0.1214891 | 0.5901809 | 0.9090315 | POMC_2 |
| 2 | 25161689 | 25161689 | 1 |
|
0.2123221 | 0.3428117 | 0.9090315 | POMC_2 |
| 2 | 25161699 | 25161699 | 1 |
|
-0.0760726 | 0.7365146 | 0.9090315 | POMC_2 |
| 2 | 25161716 | 25161716 | 1 |
|
-0.0073802 | 0.9739969 | 0.9811587 | POMC_2 |
| 2 | 25161720 | 25161720 | 1 |
|
-0.0266822 | 0.9061740 | 0.9785880 | POMC_2 |
| 2 | 25161728 | 25161728 | 1 |
|
0.0283853 | 0.9002132 | 0.9785880 | POMC_2 |
| 2 | 25161742 | 25161742 | 1 |
|
0.2316241 | 0.2996483 | 0.9090315 | POMC_2 |
| 2 | 25161764 | 25161764 | 1 |
|
0.2049420 | 0.3602355 | 0.9090315 | POMC_2 |
| 2 | 25161766 | 25161766 | 1 |
|
0.1203537 | 0.5936852 | 0.9090315 | POMC_2 |
| 2 | 25161785 | 25161785 | 1 |
|
0.4110193 | 0.0573960 | 0.7238218 | POMC_2 |
| 2 | 25161792 | 25161792 | 1 |
|
0.0936715 | 0.6784158 | 0.9090315 | POMC_2 |
| 2 | 25161799 | 25161799 | 1 |
|
0.0800466 | 0.7232603 | 0.9090315 | POMC_2 |
| 2 | 25161804 | 25161804 | 1 |
|
-0.0789112 | 0.7270396 | 0.9090315 | POMC_2 |
| 2 | 25161811 | 25161811 | 1 |
|
-0.1663379 | 0.4594030 | 0.9090315 | POMC_2 |
| 2 | 25161813 | 25161813 | 1 |
|
0.1408842 | 0.5317319 | 0.9090315 | POMC_2 |
| 2 | 25161817 | 25161817 | 1 |
|
-0.2558935 | 0.2503698 | 0.8531121 | POMC_2 |
| 2 | 25161825 | 25161825 | 1 |
|
-0.0146492 | 0.9484103 | 0.9785880 | POMC_2 |
| 6 | 31575257 | 31575257 | 1 |
|
0.1527130 | 0.4974719 | 0.9090315 | TNF |
| 6 | 31575316 | 31575316 | 1 |
|
0.1362495 | 0.5454491 | 0.9090315 | TNF |
| 6 | 31575322 | 31575322 | 1 |
|
-0.1862602 | 0.4065719 | 0.9090315 | TNF |
| 6 | 31575391 | 31575391 | 1 |
|
0.0295207 | 0.8962421 | 0.9785880 | TNF |
| 6 | 31575397 | 31575397 | 1 |
|
0.0107864 | 0.9620026 | 0.9811587 | TNF |
| 6 | 31575399 | 31575399 | 1 |
|
0.2793115 | 0.2080842 | 0.7704739 | TNF |
| 6 | 31575414 | 31575414 | 1 |
|
-0.2333273 | 0.2960082 | 0.9090315 | TNF |
| 6 | 31575441 | 31575441 | 1 |
|
-0.0465519 | 0.8370148 | 0.9616715 | TNF |
| 7 | 24283574 | 24283574 | 1 |
|
-0.0610743 | 0.7871648 | 0.9309958 | NPY_1 |
| 7 | 24283578 | 24283578 | 1 |
|
0.0185542 | 0.9346835 | 0.9785880 | NPY_1 |
| 7 | 24283596 | 24283596 | 1 |
|
0.0395145 | 0.8614031 | 0.9753077 | NPY_1 |
| 7 | 24283618 | 24283618 | 1 |
|
0.1663276 | 0.4594312 | 0.9090315 | NPY_1 |
| 7 | 24283628 | 24283628 | 1 |
|
0.0205792 | 0.9275723 | 0.9785880 | NPY_1 |
| 7 | 24283641 | 24283641 | 1 |
|
0.2011085 | 0.3694845 | 0.9090315 | NPY_1 |
| 7 | 24283672 | 24283672 | 1 |
|
0.1946695 | 0.3853225 | 0.9090315 | NPY_1 |
| 7 | 24283696 | 24283696 | 1 |
|
-0.3761133 | 0.0845000 | 0.7238218 | NPY_1 |
| 7 | 24283698 | 24283698 | 1 |
|
-0.0450119 | 0.8423400 | 0.9616715 | NPY_1 |
| 7 | 24283710 | 24283710 | 1 |
|
-0.5010097 | 0.0175410 | 0.5415473 | NPY_1 |
| 7 | 24283713 | 24283713 | 1 |
|
-0.3378954 | 0.1240482 | 0.7238218 | NPY_1 |
| 7 | 24283722 | 24283722 | 1 |
|
-0.1191043 | 0.5975515 | 0.9090315 | NPY_1 |
| 7 | 24283724 | 24283724 | 1 |
|
-0.0511539 | 0.8211430 | 0.9533609 | NPY_1 |
| 7 | 24283731 | 24283731 | 1 |
|
-0.1955349 | 0.3831719 | 0.9090315 | NPY_1 |
| 7 | 24283776 | 24283776 | 1 |
|
-0.0625884 | 0.7820100 | 0.9309958 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.1283016 | 0.5693421 | 0.9090315 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.1283016 | 0.5693421 | 0.9090315 | NPY_2 |
| 7 | 24283854 | 24283854 | 1 |
|
-0.1237600 | 0.5831987 | 0.9090315 | NPY_2 |
| 7 | 24283859 | 24283859 | 1 |
|
-0.1163798 | 0.6060190 | 0.9090315 | NPY_2 |
| 7 | 24283894 | 24283894 | 1 |
|
-0.1788275 | 0.4258786 | 0.9090315 | NPY_2 |
| 7 | 24283905 | 24283905 | 1 |
|
0.2128898 | 0.3414923 | 0.9090315 | NPY_2 |
| 7 | 128241074 | 128241074 | 1 |
|
-0.2083482 | 0.3521310 | 0.9090315 | LEP |
| 7 | 128241076 | 128241076 | 1 |
|
-0.2412752 | 0.2793842 | 0.8901311 | LEP |
| 7 | 128241078 | 128241078 | 1 |
|
-0.5035554 | 0.0168857 | 0.5415473 | LEP |
| 7 | 128241090 | 128241090 | 1 |
|
-0.3201863 | 0.1463039 | 0.7238218 | LEP |
| 7 | 128241092 | 128241092 | 1 |
|
-0.1101350 | 0.6256107 | 0.9090315 | LEP |
| 7 | 128241095 | 128241095 | 1 |
|
-0.2918834 | 0.1874833 | 0.7485262 | LEP |
| 7 | 128241108 | 128241108 | 1 |
|
-0.3406237 | 0.1208494 | 0.7238218 | LEP |
| 7 | 128241116 | 128241116 | 1 |
|
-0.0760726 | 0.7365146 | 0.9090315 | LEP |
| 7 | 128241118 | 128241118 | 1 |
|
-0.3565195 | 0.1033875 | 0.7238218 | LEP |
| 7 | 128241132 | 128241132 | 1 |
|
-0.2168638 | 0.3323411 | 0.9090315 | LEP |
| 7 | 128241151 | 128241151 | 1 |
|
-0.3264311 | 0.1381565 | 0.7238218 | LEP |
| 7 | 128241155 | 128241155 | 1 |
|
-0.4558681 | 0.0329863 | 0.6455884 | LEP |
| 7 | 128241160 | 128241160 | 1 |
|
-0.3758215 | 0.0847609 | 0.7238218 | LEP |
| 7 | 128241163 | 128241163 | 1 |
|
-0.2072128 | 0.3548206 | 0.9090315 | LEP |
| 7 | 128241178 | 128241178 | 1 |
|
-0.0633171 | 0.7795321 | 0.9309958 | LEP |
| 7 | 128241183 | 128241183 | 1 |
|
-0.3457331 | 0.1150198 | 0.7238218 | LEP |
| 7 | 128241193 | 128241193 | 1 |
|
-0.0880940 | 0.6966565 | 0.9090315 | LEP |
| 7 | 128241204 | 128241204 | 1 |
|
-0.4382692 | 0.0413295 | 0.7077678 | LEP |
| 7 | 128241207 | 128241207 | 1 |
|
-0.0945498 | 0.6755590 | 0.9090315 | LEP |
| 7 | 128241216 | 128241216 | 1 |
|
-0.2844208 | 0.1995369 | 0.7593486 | LEP |
| 7 | 128241227 | 128241227 | 1 |
|
-0.0868591 | 0.7007177 | 0.9090315 | LEP |
| 7 | 128241240 | 128241240 | 1 |
|
-0.0845882 | 0.7082060 | 0.9090315 | LEP |
| 7 | 128241245 | 128241245 | 1 |
|
-0.2469522 | 0.2678762 | 0.8737866 | LEP |
| 7 | 128241259 | 128241259 | 1 |
|
-0.3162124 | 0.1516619 | 0.7238218 | LEP |
| 7 | 128241277 | 128241277 | 1 |
|
-0.2895302 | 0.1912293 | 0.7485262 | LEP |
| 7 | 128241286 | 128241286 | 1 |
|
-0.1328433 | 0.5556326 | 0.9090315 | LEP |
| 7 | 128241291 | 128241291 | 1 |
|
-0.5313730 | 0.0109312 | 0.5415473 | LEP |
| 7 | 128241297 | 128241297 | 1 |
|
-0.1687040 | 0.4529493 | 0.9090315 | LEP |
| 7 | 128241316 | 128241316 | 1 |
|
-0.4929082 | 0.0197645 | 0.5415473 | LEP |
| 7 | 128241319 | 128241319 | 1 |
|
-0.3451654 | 0.1156572 | 0.7238218 | LEP |
| 7 | 128241321 | 128241321 | 1 |
|
-0.5308053 | 0.0110325 | 0.5415473 | LEP |
Genome landscape of methylation changes across each CPG site
Show the RHO/pval at each site, in context with the gene.
#load gene symbol : GRanges, one gene/row
data(genesymbol, package = "biovizBase")
#retrieve information of the gene of interest
wh <- genesymbol[c("LEP")]+3000
wh <- range(wh, ignore.strand = TRUE)
#Plot the different transcripts for our gene of interest
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...seqname <- c("chr7","chr7","chr7","chr7")
starts <- c( 127885000 , 127885500, 127886000, 127886500 )
ends <- c( 127885200 , 127885700, 127886200, 127886700 )
gene_data <- GRanges(seqname, IRanges(starts, ends))
gene_data$score <- c(0.5,1,2,5)
generange <- GRanges(seqname, IRanges(127885000, 127886700))
meth_track <- autoplot( gene_data , which = generange, geom = "bar") + theme_bw()## use score as y by defaulttracks(Genes=tx_track , Meth=meth_track, heights = c(0.3, 0.2)) + ylab("")
chainfile = system.file(package="liftOver", "extdata", "hg38ToHg19.over.chain")
ch = import.chain(chainfile)
genes2 <- genes
seqlevelsStyle(genes2) = "UCSC" # necessary
genes19 <- liftOver(genes2, ch)
genes19 <- unlist(genes19)
genome(genes19) <- "hg19"
gr38 <- gr
seqlevelsStyle(gr38) = "UCSC" # necessary
gr19 <- liftOver(gr38, ch)
gr19 <- unlist(gr19)
genome(gr19) <- "hg19"
ranges(gr19) <- ranges(gr19)+2
# LEP 7
generange <- genes19[7]
gr19$score <- gr19$r
gr19$sig <- as.character(as.numeric(gr19$p < 0.05))
gr19$sig <- gsub("0","black",gr19$sig)
gr19$sig <- gsub("1","red",gr19$sig)
meth_data <- gr19[queryHits(findOverlaps(gr19,generange))]
meth_track <- autoplot( meth_data , which = generange, geom = "bar", fill= meth_data$sig ) + theme_bw()## use score as y by defaultwh <- genesymbol[c("LEP")]+3000
wh <- range(wh, ignore.strand = TRUE)
#Plot the different transcripts for our gene of interest
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")
tx_track <- autoplot(Homo.sapiens, which = generange) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")
# TNF 4
generange <- genes19[4]
gr19$score <- gr19$r
gr19$sig <- as.character(as.numeric(gr19$p < 0.05))
gr19$sig <- gsub("0","black",gr19$sig)
gr19$sig <- gsub("1","red",gr19$sig)
meth_data <- gr19[queryHits(findOverlaps(gr19,generange)) ]
meth_track <- autoplot( meth_data , which = generange, geom = "bar", fill= meth_data$sig ) + theme_bw()## use score as y by defaultwh <- genesymbol[c("TNF")]+1000
wh <- range(wh, ignore.strand = TRUE)
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")
# SOCS3 1
generange <- genes19[1]
gr19$score <- gr19$r
gr19$sig <- as.character(as.numeric(gr19$p < 0.05))
gr19$sig <- gsub("0","black",gr19$sig)
gr19$sig <- gsub("1","red",gr19$sig)
meth_data <- gr19[queryHits(findOverlaps(gr19,generange)) ]
meth_track <- autoplot( meth_data , which = generange, geom = "bar", fill= meth_data$sig ) + theme_bw()## use score as y by defaultwh <- genesymbol[c("SOCS3")]+1000
wh <- range(wh, ignore.strand = TRUE)
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw() ## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")## Warning: Removed 1 rows containing missing values (geom_text).
# POMC_2 2
generange <- genes19[2]
gr19$score <- gr19$r
gr19$sig <- as.character(as.numeric(gr19$p < 0.05))
gr19$sig <- gsub("0","black",gr19$sig)
gr19$sig <- gsub("1","red",gr19$sig)
meth_data <- gr19[queryHits(findOverlaps(gr19,generange)) ]
meth_track <- autoplot( meth_data , which = generange, geom = "bar", fill= meth_data$sig ) + theme_bw()## use score as y by defaultwh <- genesymbol[c("POMC")]+1000
wh <- range(wh, ignore.strand = TRUE)
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")
# NPY_1 5
generange <- genes19[5]
gr19$score <- gr19$r
gr19$sig <- as.character(as.numeric(gr19$p < 0.05))
gr19$sig <- gsub("0","black",gr19$sig)
gr19$sig <- gsub("1","red",gr19$sig)
meth_data <- gr19[queryHits(findOverlaps(gr19,generange)) ]
meth_track <- autoplot( meth_data , which = generange, geom = "bar", fill= meth_data$sig ) + theme_bw()## use score as y by defaultwh <- genesymbol[c("NPY")]+1000
wh <- range(wh, ignore.strand = TRUE)
tx_track <- autoplot(Homo.sapiens, which = wh) + theme_bw()## Parsing transcripts...## Parsing exons...## Parsing cds...## Parsing utrs...## ------exons...## ------cdss...## ------introns...## ------utr...## aggregating...## Done## 'select()' returned 1:1 mapping between keys and columns## Constructing graphics...tracks(Genes=tx_track , Meth=meth_track, heights = c(0.1, 0.2)) + ylab("")
Graph of correlation coefficient and p-values across gene loci
xxgr <- GRanges(xx,seqnames=xx$seqname,ranges=IRanges(xx$pos,end=xx$pos),strand="+")
mygenenames <- unique(gr$gene_names)
sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
par(mfrow=c(2,1))
par(mar=c(5,4,2,2))
barplot(-log(x$p),names=x$pos,las=2,cex.names=0.5,ylab="-log(p) nominal",main=mygenename)
abline(h=-log(0.05))
barplot(x$rho,names=x$pos,las=2,cex.names=0.5,ylab="Spearman's rho")
})
## $SOCS3
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
##
## $POMC_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
##
## $TNF
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
##
## $NPY_1
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
##
## $NPY_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
##
## $LEP
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
## [27,] 31.9
## [28,] 33.1
## [29,] 34.3
## [30,] 35.5
## [31,] 36.7Scatterplot of GWG vs aggregated locus methylation
Need to include the formula of the association.
There are two sets of charts, the second set has y-axis set to 28%.
CHR=as.vector(seqnames(GRanges(meth)))
POS=as.character(start(ranges(GRanges(meth))))
CHRPOS=paste("chr",CHR,":",POS,sep="")
lapply(c(1,2,4:7), function(i) {
gene <- genes[i]
gname <- genes[i]$gene_names
myrows <- subjectHits( findOverlaps( gene , GRanges(getData(meth)[,1:3] )) )
betas <- percMethylation(meth)[myrows,]
cm <- colMeans(betas)
ct <- cor.test(cm,z,method="s")
mylm <- lm( cm ~ z )
SUBHEADER=paste( "Int=",signif(mylm$coefficients[1],3),
", slope=",signif(mylm$coefficients[2],3),
", r2adj=",signif(summary(mylm)$adj.r.squared,3),
", rho=",signif(ct$est,3),
", p=",signif(ct$p.value,3), sep="")
plot(z,cm,pch=19,xlab="GWG (kg)",ylab="% methylation",main=gname)
abline(mylm,lwd=3,lty=2,col="red")
mtext(SUBHEADER)
})## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## [[1]]
## NULL
##
## [[2]]
## NULL
##
## [[3]]
## NULL
##
## [[4]]
## NULL
##
## [[5]]
## NULL
##
## [[6]]
## NULLlapply(c(1,2,4:7), function(i) {
gene <- genes[i]
gname <- genes[i]$gene_names
myrows <- subjectHits( findOverlaps( gene , GRanges(getData(meth)[,1:3] )) )
betas <- percMethylation(meth)[myrows,]
cm <- colMeans(betas)
ct <- cor.test(cm,z,method="s")
mylm <- lm( cm ~ z )
SUBHEADER=paste( "Int=",signif(mylm$coefficients[1],3),
", slope=",signif(mylm$coefficients[2],3),
", r2adj=",signif(summary(mylm)$adj.r.squared,3),
", rho=",signif(ct$est,3),
", p=",signif(ct$p.value,3), sep="")
plot(z,cm,pch=19,xlab="GWG (kg)",ylab="% methylation",main=gname, ylim=c(0,28))
abline(mylm,lwd=3,lty=2,col="red")
mtext(SUBHEADER)
})## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## Warning in cor.test.default(cm, z, method = "s"): Cannot compute exact p-value
## with ties
## [[1]]
## NULL
##
## [[2]]
## NULL
##
## [[3]]
## NULL
##
## [[4]]
## NULL
##
## [[5]]
## NULL
##
## [[6]]
## NULLPermutation test
Here I’m going to resample the existing p-value data with random methylation direction.
From that distribution I can estimate the
scores <- -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE)
npermutes = 10000
permute_res <- sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
xscore <- mean(-log10(x$p) * as.data.frame(x)[,8])
permutes <- replicate(n=npermutes , mean( -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE ) ) )
greaterthan <- length(which(permutes > xscore))
lessthan <- length(which(permutes < xscore))
p_greater = greaterthan / ( greaterthan + lessthan )
p_less = lessthan / ( greaterthan + lessthan )
pval <- c(p_greater,p_less)
names(pval) = c("pval_greater","pval_less")
return(pval)
})
permute_res %>% kbl() %>% kable_styling()| SOCS3 | POMC_2 | TNF | NPY_1 | NPY_2 | LEP | |
|---|---|---|---|---|---|---|
| pval_greater | 0.5369 | 0.2077 | 0.4416 | 0.9044 | 0.4869 | 1 |
| pval_less | 0.4631 | 0.7923 | 0.5584 | 0.0956 | 0.5131 | 0 |
Test association of methylation with BMI
Now run a spearman correlation test of BMI with Beta vals.
z <- samplesheet$Del_BMI
genes <- amp
genes %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | gene_names |
|---|---|---|---|---|---|
| 17 | 78358469 | 78358619 | 151 |
|
SOCS3 |
| 2 | 25161598 | 25161833 | 236 |
|
POMC_2 |
| 2 | 25168373 | 25168611 | 239 |
|
POMC_1 |
| 6 | 31575210 | 31575467 | 258 |
|
TNF |
| 7 | 24283548 | 24283843 | 296 |
|
NPY_1 |
| 7 | 24283796 | 24283936 | 141 |
|
NPY_2 |
| 7 | 128241036 | 128241347 | 312 |
|
LEP |
par(mfrow=c(1,2))
x <- lapply( 1:nrow(meth), function(i) {
x <- as.vector(percMethylation(meth)[i,])
cor <- cor.test(x,z,method="pearson")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
#plot(z,x,xlab="GWG",ylab="Beta",main="Pearson")
#mtext(HEADER)
#mylm <- lm( x ~ z )
#abline(mylm,lwd=3,lty=2,col="red")
cor <- cor.test(x,z,method="spearman")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
plot(rank(z),rank(x),xlab="rank(GWG)",ylab="rank(Beta)",main="Spearman")
mtext(HEADER)
mylm <- lm( rank(x) ~ rank(z) )
abline(mylm,lwd=3,lty=2,col="red")
c("p"=p,"r"=r)
})## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
xx <- as.data.frame(t(sapply(x,function(x){ x[c(2,1)] } )))
xx$FDR <- p.adjust(xx[,2],method="fdr")
xx <- data.frame(meth$chr,meth$start,xx)
colnames(xx) <- c("seqname","pos","rho","p","FDR")
gr <- GRanges(seqnames = xx$seqname, ranges = IRanges(xx$pos) )
gr$r <- xx$r
gr$p <- xx$p
gr$FDR <- xx$FDR
ol <- findOverlaps(gr,genes)
# off target gene methylation
ot <- gr[-queryHits(ol)]
ot %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR |
|---|---|---|---|---|---|---|---|
| 16 | 14989709 | 14989709 | 1 |
|
-0.0993051 | 0.6601667 | 0.9667187 |
| 16 | 14989712 | 14989712 | 1 |
|
0.0910634 | 0.6869246 | 0.9701925 |
| 16 | 14989741 | 14989741 | 1 |
|
0.0034161 | 0.9879622 | 0.9952266 |
| 16 | 14989762 | 14989762 | 1 |
|
-0.0176139 | 0.9379875 | 0.9715310 |
| 16 | 14989764 | 14989764 | 1 |
|
-0.1921398 | 0.3916478 | 0.8506262 |
| 16 | 14989771 | 14989771 | 1 |
|
-0.0386479 | 0.8644152 | 0.9715310 |
| 16 | 14989775 | 14989775 | 1 |
|
0.0567624 | 0.8018913 | 0.9715310 |
| 16 | 14989785 | 14989785 | 1 |
|
-0.0292328 | 0.8972490 | 0.9715310 |
| 16 | 14989801 | 14989801 | 1 |
|
-0.0205489 | 0.9276785 | 0.9715310 |
| 16 | 14989804 | 14989804 | 1 |
|
0.0528567 | 0.8152869 | 0.9715310 |
| 16 | 14989809 | 14989809 | 1 |
|
0.1132183 | 0.6159058 | 0.9440211 |
| 16 | 14989812 | 14989812 | 1 |
|
0.4730764 | 0.0261730 | 0.5122438 |
| 16 | 14989820 | 14989820 | 1 |
|
0.3332365 | 0.1296505 | 0.6819432 |
| 16 | 14989827 | 14989827 | 1 |
|
0.0144109 | 0.9492486 | 0.9715310 |
| 16 | 14989844 | 14989844 | 1 |
|
-0.0324951 | 0.8858512 | 0.9715310 |
| 16 | 14989857 | 14989857 | 1 |
|
0.2205519 | 0.3239804 | 0.8506262 |
| 5 | 865252 | 865252 | 1 |
|
0.2553673 | 0.2513792 | 0.8373424 |
| 5 | 865254 | 865254 | 1 |
|
0.0141243 | 0.9502566 | 0.9715310 |
| 5 | 865278 | 865278 | 1 |
|
0.0728814 | 0.7472112 | 0.9715310 |
| 5 | 865296 | 865296 | 1 |
|
-0.1841808 | 0.4119240 | 0.8506262 |
| 5 | 865349 | 865349 | 1 |
|
-0.0971752 | 0.6670450 | 0.9667187 |
| 5 | 865357 | 865357 | 1 |
|
-0.3282486 | 0.1358470 | 0.6819432 |
| 5 | 865391 | 865391 | 1 |
|
0.3632769 | 0.0965542 | 0.6819432 |
| 5 | 865394 | 865394 | 1 |
|
0.1559322 | 0.4883399 | 0.8919551 |
| 5 | 865435 | 865435 | 1 |
|
0.5299436 | 0.0111879 | 0.3831859 |
| 5 | 865441 | 865441 | 1 |
|
0.1158192 | 0.6077672 | 0.9440211 |
| 5 | 865466 | 865466 | 1 |
|
-0.3073447 | 0.1641116 | 0.6819432 |
| 5 | 865469 | 865469 | 1 |
|
-0.2344633 | 0.2935954 | 0.8506262 |
| 5 | 865473 | 865473 | 1 |
|
-0.1446328 | 0.5207567 | 0.8919551 |
| 5 | 865480 | 865480 | 1 |
|
0.1146893 | 0.6112976 | 0.9440211 |
| 5 | 865483 | 865483 | 1 |
|
-0.3038270 | 0.1692414 | 0.6819432 |
| 5 | 865485 | 865485 | 1 |
|
0.3211296 | 0.1450520 | 0.6819432 |
| 5 | 10649447 | 10649447 | 1 |
|
0.0961539 | 0.6703524 | 0.9667187 |
| 5 | 10649449 | 10649449 | 1 |
|
-0.0333333 | 0.8829258 | 0.9715310 |
| 5 | 10649486 | 10649486 | 1 |
|
-0.1870057 | 0.4046626 | 0.8506262 |
| 5 | 10649495 | 10649495 | 1 |
|
0.1163842 | 0.6060052 | 0.9440211 |
| 5 | 10649503 | 10649503 | 1 |
|
-0.3293786 | 0.1344251 | 0.6819432 |
| 5 | 10649506 | 10649506 | 1 |
|
-0.2120994 | 0.3433302 | 0.8506262 |
| 5 | 10649508 | 10649508 | 1 |
|
0.1204539 | 0.5933757 | 0.9440211 |
| 5 | 131945728 | 131945728 | 1 |
|
-0.3269463 | 0.1374990 | 0.6819432 |
| 5 | 131945736 | 131945736 | 1 |
|
-0.0653963 | 0.7724738 | 0.9715310 |
| 5 | 131945738 | 131945738 | 1 |
|
-0.0761675 | 0.7361974 | 0.9715310 |
| 5 | 131945745 | 131945745 | 1 |
|
0.2261393 | 0.3115571 | 0.8506262 |
| 5 | 131945789 | 131945789 | 1 |
|
0.3209040 | 0.1453507 | 0.6819432 |
| 8 | 22055661 | 22055661 | 1 |
|
-0.1745763 | 0.4371388 | 0.8584949 |
# on target methylation
gr <- gr[queryHits(ol)]
gr$gene_names <- genes$gene_names[subjectHits(ol) ]
gr %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR | gene_names |
|---|---|---|---|---|---|---|---|---|
| 17 | 78358500 | 78358500 | 1 |
|
0.2186441 | 0.3282893 | 0.8506262 | SOCS3 |
| 17 | 78358506 | 78358506 | 1 |
|
-0.2016949 | 0.3680608 | 0.8506262 | SOCS3 |
| 17 | 78358514 | 78358514 | 1 |
|
0.2039548 | 0.3626042 | 0.8506262 | SOCS3 |
| 17 | 78358539 | 78358539 | 1 |
|
0.0327684 | 0.8848972 | 0.9715310 | SOCS3 |
| 17 | 78358556 | 78358556 | 1 |
|
0.0152542 | 0.9462825 | 0.9715310 | SOCS3 |
| 17 | 78358581 | 78358581 | 1 |
|
0.1740113 | 0.4386470 | 0.8584949 | SOCS3 |
| 17 | 78358587 | 78358587 | 1 |
|
-0.1864407 | 0.4061092 | 0.8506262 | SOCS3 |
| 2 | 25161599 | 25161599 | 1 |
|
0.1988701 | 0.3749474 | 0.8506262 | POMC_2 |
| 2 | 25161616 | 25161616 | 1 |
|
0.2598870 | 0.2427947 | 0.8373424 | POMC_2 |
| 2 | 25161619 | 25161619 | 1 |
|
0.5937854 | 0.0035740 | 0.3831859 | POMC_2 |
| 2 | 25161623 | 25161623 | 1 |
|
0.5395481 | 0.0095538 | 0.3831859 | POMC_2 |
| 2 | 25161628 | 25161628 | 1 |
|
-0.0220339 | 0.9224668 | 0.9715310 | POMC_2 |
| 2 | 25161637 | 25161637 | 1 |
|
0.1581921 | 0.4819795 | 0.8919551 | POMC_2 |
| 2 | 25161653 | 25161653 | 1 |
|
0.3096046 | 0.1608736 | 0.6819432 | POMC_2 |
| 2 | 25161661 | 25161661 | 1 |
|
0.3062147 | 0.1657475 | 0.6819432 | POMC_2 |
| 2 | 25161671 | 25161671 | 1 |
|
0.0751413 | 0.7396317 | 0.9715310 | POMC_2 |
| 2 | 25161686 | 25161686 | 1 |
|
0.2096046 | 0.3491689 | 0.8506262 | POMC_2 |
| 2 | 25161689 | 25161689 | 1 |
|
0.3322034 | 0.1309170 | 0.6819432 | POMC_2 |
| 2 | 25161699 | 25161699 | 1 |
|
0.1802260 | 0.4222086 | 0.8506262 | POMC_2 |
| 2 | 25161716 | 25161716 | 1 |
|
0.2649718 | 0.2333672 | 0.8373424 | POMC_2 |
| 2 | 25161720 | 25161720 | 1 |
|
0.3757063 | 0.0848641 | 0.6819432 | POMC_2 |
| 2 | 25161728 | 25161728 | 1 |
|
0.1435028 | 0.5240536 | 0.8919551 | POMC_2 |
| 2 | 25161742 | 25161742 | 1 |
|
0.3067797 | 0.1649281 | 0.6819432 | POMC_2 |
| 2 | 25161764 | 25161764 | 1 |
|
0.2310735 | 0.3008311 | 0.8506262 | POMC_2 |
| 2 | 25161766 | 25161766 | 1 |
|
0.0559322 | 0.8047342 | 0.9715310 | POMC_2 |
| 2 | 25161785 | 25161785 | 1 |
|
0.5141244 | 0.0143733 | 0.3938289 | POMC_2 |
| 2 | 25161792 | 25161792 | 1 |
|
0.2293786 | 0.3044896 | 0.8506262 | POMC_2 |
| 2 | 25161799 | 25161799 | 1 |
|
0.0457627 | 0.8397430 | 0.9715310 | POMC_2 |
| 2 | 25161804 | 25161804 | 1 |
|
0.1451978 | 0.5191119 | 0.8919551 | POMC_2 |
| 2 | 25161811 | 25161811 | 1 |
|
0.0299435 | 0.8947641 | 0.9715310 | POMC_2 |
| 2 | 25161813 | 25161813 | 1 |
|
0.3299449 | 0.1337165 | 0.6819432 | POMC_2 |
| 2 | 25161817 | 25161817 | 1 |
|
-0.1007873 | 0.6553956 | 0.9667187 | POMC_2 |
| 2 | 25161825 | 25161825 | 1 |
|
0.1660697 | 0.4601376 | 0.8755396 | POMC_2 |
| 6 | 31575257 | 31575257 | 1 |
|
-0.0581921 | 0.7970009 | 0.9715310 | TNF |
| 6 | 31575316 | 31575316 | 1 |
|
-0.0197740 | 0.9303992 | 0.9715310 | TNF |
| 6 | 31575322 | 31575322 | 1 |
|
-0.2526137 | 0.2567035 | 0.8373424 | TNF |
| 6 | 31575391 | 31575391 | 1 |
|
-0.1118644 | 0.6201598 | 0.9440211 | TNF |
| 6 | 31575397 | 31575397 | 1 |
|
-0.0305085 | 0.8927894 | 0.9715310 | TNF |
| 6 | 31575399 | 31575399 | 1 |
|
0.0683616 | 0.7624376 | 0.9715310 | TNF |
| 6 | 31575414 | 31575414 | 1 |
|
-0.2548023 | 0.2524658 | 0.8373424 | TNF |
| 6 | 31575441 | 31575441 | 1 |
|
0.0079096 | 0.9721322 | 0.9865342 | TNF |
| 7 | 24283574 | 24283574 | 1 |
|
0.2123457 | 0.3427568 | 0.8506262 | NPY_1 |
| 7 | 24283578 | 24283578 | 1 |
|
-0.0807837 | 0.7208101 | 0.9715310 | NPY_1 |
| 7 | 24283596 | 24283596 | 1 |
|
-0.0612801 | 0.7864634 | 0.9715310 | NPY_1 |
| 7 | 24283618 | 24283618 | 1 |
|
0.3085082 | 0.1624389 | 0.6819432 | NPY_1 |
| 7 | 24283628 | 24283628 | 1 |
|
0.1515522 | 0.5007851 | 0.8919551 | NPY_1 |
| 7 | 24283641 | 24283641 | 1 |
|
0.1464438 | 0.5154934 | 0.8919551 | NPY_1 |
| 7 | 24283672 | 24283672 | 1 |
|
-0.0462217 | 0.8381560 | 0.9715310 | NPY_1 |
| 7 | 24283696 | 24283696 | 1 |
|
-0.5348893 | 0.0103201 | 0.3831859 | NPY_1 |
| 7 | 24283698 | 24283698 | 1 |
|
-0.0168338 | 0.9407289 | 0.9715310 | NPY_1 |
| 7 | 24283710 | 24283710 | 1 |
|
-0.3830089 | 0.0785078 | 0.6801308 | NPY_1 |
| 7 | 24283713 | 24283713 | 1 |
|
-0.4038837 | 0.0623042 | 0.6801308 | NPY_1 |
| 7 | 24283722 | 24283722 | 1 |
|
-0.0919088 | 0.6841625 | 0.9701925 | NPY_1 |
| 7 | 24283724 | 24283724 | 1 |
|
-0.1884163 | 0.4010633 | 0.8506262 | NPY_1 |
| 7 | 24283731 | 24283731 | 1 |
|
-0.2098056 | 0.3486963 | 0.8506262 | NPY_1 |
| 7 | 24283776 | 24283776 | 1 |
|
-0.1809599 | 0.4202898 | 0.8506262 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
-0.0570622 | 0.8008653 | 0.9715310 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
-0.0570622 | 0.8008653 | 0.9715310 | NPY_2 |
| 7 | 24283854 | 24283854 | 1 |
|
-0.2423729 | 0.2771351 | 0.8506262 | NPY_2 |
| 7 | 24283859 | 24283859 | 1 |
|
-0.2638419 | 0.2354412 | 0.8373424 | NPY_2 |
| 7 | 24283894 | 24283894 | 1 |
|
-0.2796611 | 0.2074917 | 0.7896212 | NPY_2 |
| 7 | 24283905 | 24283905 | 1 |
|
0.0288136 | 0.8987151 | 0.9715310 | NPY_2 |
| 7 | 128241074 | 128241074 | 1 |
|
-0.2028249 | 0.3653266 | 0.8506262 | LEP |
| 7 | 128241076 | 128241076 | 1 |
|
-0.3519775 | 0.1081756 | 0.6819432 | LEP |
| 7 | 128241078 | 128241078 | 1 |
|
0.0000000 | 1.0000000 | 1.0000000 | LEP |
| 7 | 128241090 | 128241090 | 1 |
|
-0.4079097 | 0.0594971 | 0.6801308 | LEP |
| 7 | 128241092 | 128241092 | 1 |
|
-0.0615819 | 0.7854355 | 0.9715310 | LEP |
| 7 | 128241095 | 128241095 | 1 |
|
-0.2952812 | 0.1821631 | 0.7130385 | LEP |
| 7 | 128241108 | 128241108 | 1 |
|
0.1423729 | 0.5273603 | 0.8919551 | LEP |
| 7 | 128241116 | 128241116 | 1 |
|
-0.0864407 | 0.7020953 | 0.9715310 | LEP |
| 7 | 128241118 | 128241118 | 1 |
|
-0.4022600 | 0.0634645 | 0.6801308 | LEP |
| 7 | 128241132 | 128241132 | 1 |
|
-0.1355932 | 0.5474044 | 0.9010509 | LEP |
| 7 | 128241151 | 128241151 | 1 |
|
-0.1338983 | 0.5524692 | 0.9010509 | LEP |
| 7 | 128241155 | 128241155 | 1 |
|
-0.3949153 | 0.0689196 | 0.6801308 | LEP |
| 7 | 128241160 | 128241160 | 1 |
|
0.0717514 | 0.7510096 | 0.9715310 | LEP |
| 7 | 128241163 | 128241163 | 1 |
|
-0.3819210 | 0.0794313 | 0.6801308 | LEP |
| 7 | 128241178 | 128241178 | 1 |
|
0.0997457 | 0.6587470 | 0.9667187 | LEP |
| 7 | 128241183 | 128241183 | 1 |
|
-0.0299435 | 0.8947641 | 0.9715310 | LEP |
| 7 | 128241193 | 128241193 | 1 |
|
-0.0746606 | 0.7412417 | 0.9715310 | LEP |
| 7 | 128241204 | 128241204 | 1 |
|
-0.3158193 | 0.1521993 | 0.6819432 | LEP |
| 7 | 128241207 | 128241207 | 1 |
|
-0.2229443 | 0.3186249 | 0.8506262 | LEP |
| 7 | 128241216 | 128241216 | 1 |
|
-0.4762713 | 0.0250416 | 0.5122438 | LEP |
| 7 | 128241227 | 128241227 | 1 |
|
-0.2107345 | 0.3465173 | 0.8506262 | LEP |
| 7 | 128241240 | 128241240 | 1 |
|
-0.1666667 | 0.4585034 | 0.8755396 | LEP |
| 7 | 128241245 | 128241245 | 1 |
|
-0.3909605 | 0.0720002 | 0.6801308 | LEP |
| 7 | 128241259 | 128241259 | 1 |
|
-0.4209040 | 0.0510935 | 0.6801308 | LEP |
| 7 | 128241277 | 128241277 | 1 |
|
-0.2429379 | 0.2759820 | 0.8506262 | LEP |
| 7 | 128241286 | 128241286 | 1 |
|
-0.0655367 | 0.7719978 | 0.9715310 | LEP |
| 7 | 128241291 | 128241291 | 1 |
|
-0.1881356 | 0.4017780 | 0.8506262 | LEP |
| 7 | 128241297 | 128241297 | 1 |
|
-0.1382137 | 0.5396160 | 0.9010509 | LEP |
| 7 | 128241316 | 128241316 | 1 |
|
0.0245832 | 0.9135270 | 0.9715310 | LEP |
| 7 | 128241319 | 128241319 | 1 |
|
-0.1497175 | 0.5060438 | 0.8919551 | LEP |
| 7 | 128241321 | 128241321 | 1 |
|
-0.4355933 | 0.0427307 | 0.6801308 | LEP |
Graph of correlation coefficient and p-values across gene loci
xxgr <- GRanges(xx,seqnames=xx$seqname,ranges=IRanges(xx$pos,end=xx$pos),strand="+")
mygenenames <- unique(gr$gene_names)
sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
par(mfrow=c(2,1))
par(mar=c(5,4,2,2))
barplot(-log(x$p),names=x$pos,las=2,cex.names=0.5,ylab="-log(p) nominal",main=mygenename)
abline(h=-log(0.05))
barplot(x$rho,names=x$pos,las=2,cex.names=0.5,ylab="Spearman's rho")
})
## $SOCS3
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
##
## $POMC_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
##
## $TNF
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
##
## $NPY_1
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
##
## $NPY_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
##
## $LEP
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
## [27,] 31.9
## [28,] 33.1
## [29,] 34.3
## [30,] 35.5
## [31,] 36.7Permutation test
Here I’m going to resample the existing p-value data with random methylation direction.
From that distribution I can estimate the
scores <- -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE)
npermutes = 10000
permute_res <- sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
xscore <- mean(-log10(x$p) * as.data.frame(x)[,8])
permutes <- replicate(n=npermutes , mean( -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE ) ) )
greaterthan <- length(which(permutes > xscore))
lessthan <- length(which(permutes < xscore))
p_greater = greaterthan / ( greaterthan + lessthan )
p_less = lessthan / ( greaterthan + lessthan )
pval <- c(p_greater,p_less)
names(pval) = c("pval_greater","pval_less")
return(pval)
})
permute_res %>% kbl() %>% kable_styling()| SOCS3 | POMC_2 | TNF | NPY_1 | NPY_2 | LEP | |
|---|---|---|---|---|---|---|
| pval_greater | 0.4351 | 0.0007 | 0.7064 | 0.9376 | 0.9036 | 0.9937 |
| pval_less | 0.5649 | 0.9993 | 0.2936 | 0.0624 | 0.0964 | 0.0063 |
Test association of methylation with maternal age
Now run a spearman correlation test of maternal age with Beta vals.
z <- samplesheet$Age
genes <- amp
genes %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | gene_names |
|---|---|---|---|---|---|
| 17 | 78358469 | 78358619 | 151 |
|
SOCS3 |
| 2 | 25161598 | 25161833 | 236 |
|
POMC_2 |
| 2 | 25168373 | 25168611 | 239 |
|
POMC_1 |
| 6 | 31575210 | 31575467 | 258 |
|
TNF |
| 7 | 24283548 | 24283843 | 296 |
|
NPY_1 |
| 7 | 24283796 | 24283936 | 141 |
|
NPY_2 |
| 7 | 128241036 | 128241347 | 312 |
|
LEP |
par(mfrow=c(1,2))
x <- lapply( 1:nrow(meth), function(i) {
x <- as.vector(percMethylation(meth)[i,])
cor <- cor.test(x,z,method="pearson")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
#plot(z,x,xlab="GWG",ylab="Beta",main="Pearson")
#mtext(HEADER)
#mylm <- lm( x ~ z )
#abline(mylm,lwd=3,lty=2,col="red")
cor <- cor.test(x,z,method="spearman")
p <- cor$p.value
r <- cor$estimate
CHR=as.vector(seqnames(GRanges(meth)))[i]
POS=as.character(start(ranges(GRanges(meth)))[i])
CHRPOS=paste("chr",CHR,":",POS,sep="")
HEADER = paste("Site",i,CHRPOS,"p=",round(p,3)," r=",round(r,3))
plot(rank(z),rank(x),xlab="rank(GWG)",ylab="rank(Beta)",main="Spearman")
mtext(HEADER)
mylm <- lm( rank(x) ~ rank(z) )
abline(mylm,lwd=3,lty=2,col="red")
c("p"=p,"r"=r)
})## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
## Warning in cor.test.default(x, z, method = "spearman"): Cannot compute exact p-
## value with ties
xx <- as.data.frame(t(sapply(x,function(x){ x[c(2,1)] } )))
xx$FDR <- p.adjust(xx[,2],method="fdr")
xx <- data.frame(meth$chr,meth$start,xx)
colnames(xx) <- c("seqname","pos","rho","p","FDR")
gr <- GRanges(seqnames = xx$seqname, ranges = IRanges(xx$pos) )
gr$r <- xx$r
gr$p <- xx$p
gr$FDR <- xx$FDR
ol <- findOverlaps(gr,genes)
# off target gene methylation
ot <- gr[-queryHits(ol)]
ot %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR |
|---|---|---|---|---|---|---|---|
| 16 | 14989709 | 14989709 | 1 |
|
-0.1698490 | 0.4498433 | 0.8255698 |
| 16 | 14989712 | 14989712 | 1 |
|
-0.0261366 | 0.9080847 | 0.9794662 |
| 16 | 14989741 | 14989741 | 1 |
|
-0.2367860 | 0.2887003 | 0.7031160 |
| 16 | 14989762 | 14989762 | 1 |
|
-0.0393836 | 0.8618580 | 0.9745175 |
| 16 | 14989764 | 14989764 | 1 |
|
-0.1198022 | 0.5953905 | 0.8848622 |
| 16 | 14989771 | 14989771 | 1 |
|
0.1478733 | 0.5113567 | 0.8756983 |
| 16 | 14989775 | 14989775 | 1 |
|
0.2785964 | 0.2092996 | 0.6993671 |
| 16 | 14989785 | 14989785 | 1 |
|
0.0191896 | 0.9324517 | 0.9794662 |
| 16 | 14989801 | 14989801 | 1 |
|
0.1164006 | 0.6059540 | 0.8848622 |
| 16 | 14989804 | 14989804 | 1 |
|
-0.0319726 | 0.8876751 | 0.9745175 |
| 16 | 14989809 | 14989809 | 1 |
|
-0.3511533 | 0.1090615 | 0.6326998 |
| 16 | 14989812 | 14989812 | 1 |
|
-0.1212101 | 0.5910412 | 0.8848622 |
| 16 | 14989820 | 14989820 | 1 |
|
-0.1279685 | 0.5703536 | 0.8848622 |
| 16 | 14989827 | 14989827 | 1 |
|
0.1098508 | 0.6265082 | 0.8848622 |
| 16 | 14989844 | 14989844 | 1 |
|
-0.0624475 | 0.7824892 | 0.9344516 |
| 16 | 14989857 | 14989857 | 1 |
|
-0.2986565 | 0.1769814 | 0.6993671 |
| 5 | 865252 | 865252 | 1 |
|
0.2565300 | 0.2491523 | 0.7031160 |
| 5 | 865254 | 865254 | 1 |
|
-0.3938757 | 0.0697195 | 0.5786634 |
| 5 | 865278 | 865278 | 1 |
|
-0.3206625 | 0.1456710 | 0.6652307 |
| 5 | 865296 | 865296 | 1 |
|
-0.0192965 | 0.9320761 | 0.9794662 |
| 5 | 865349 | 865349 | 1 |
|
-0.2605028 | 0.2416401 | 0.7031160 |
| 5 | 865357 | 865357 | 1 |
|
-0.0709430 | 0.7537304 | 0.9344516 |
| 5 | 865391 | 865391 | 1 |
|
-0.0039728 | 0.9860007 | 0.9860007 |
| 5 | 865394 | 865394 | 1 |
|
-0.0533492 | 0.8135950 | 0.9366598 |
| 5 | 865435 | 865435 | 1 |
|
0.1668580 | 0.4579803 | 0.8255698 |
| 5 | 865441 | 865441 | 1 |
|
0.3842275 | 0.0774829 | 0.5786634 |
| 5 | 865466 | 865466 | 1 |
|
0.0800237 | 0.7233363 | 0.9344516 |
| 5 | 865469 | 865469 | 1 |
|
-0.2383686 | 0.2853943 | 0.7031160 |
| 5 | 865473 | 865473 | 1 |
|
-0.4506302 | 0.0353165 | 0.5786634 |
| 5 | 865480 | 865480 | 1 |
|
0.2888800 | 0.1922732 | 0.6993671 |
| 5 | 865483 | 865483 | 1 |
|
0.0665568 | 0.7685418 | 0.9344516 |
| 5 | 865485 | 865485 | 1 |
|
-0.0134940 | 0.9524738 | 0.9794662 |
| 5 | 10649447 | 10649447 | 1 |
|
-0.2159108 | 0.3345222 | 0.7638257 |
| 5 | 10649449 | 10649449 | 1 |
|
0.0669702 | 0.7671423 | 0.9344516 |
| 5 | 10649486 | 10649486 | 1 |
|
0.1418861 | 0.5287880 | 0.8848622 |
| 5 | 10649495 | 10649495 | 1 |
|
-0.2491519 | 0.2634991 | 0.7031160 |
| 5 | 10649503 | 10649503 | 1 |
|
-0.4835477 | 0.0226102 | 0.5786634 |
| 5 | 10649506 | 10649506 | 1 |
|
-0.0074498 | 0.9737516 | 0.9809116 |
| 5 | 10649508 | 10649508 | 1 |
|
-0.1210023 | 0.5916822 | 0.8848622 |
| 5 | 131945728 | 131945728 | 1 |
|
-0.2592907 | 0.2439163 | 0.7031160 |
| 5 | 131945736 | 131945736 | 1 |
|
-0.1808520 | 0.4205717 | 0.8231188 |
| 5 | 131945738 | 131945738 | 1 |
|
0.0324606 | 0.8859714 | 0.9745175 |
| 5 | 131945745 | 131945745 | 1 |
|
0.1192923 | 0.5969693 | 0.8848622 |
| 5 | 131945789 | 131945789 | 1 |
|
0.2082888 | 0.3522715 | 0.7656209 |
| 8 | 22055661 | 22055661 | 1 |
|
0.1010229 | 0.6546384 | 0.9059137 |
# on target methylation
gr <- gr[queryHits(ol)]
gr$gene_names <- genes$gene_names[subjectHits(ol) ]
gr %>% kbl() %>% kable_styling()| seqnames | start | end | width | strand | r | p | FDR | gene_names |
|---|---|---|---|---|---|---|---|---|
| 17 | 78358500 | 78358500 | 1 |
|
-0.2429090 | 0.2760410 | 0.7031160 | SOCS3 |
| 17 | 78358506 | 78358506 | 1 |
|
-0.4409819 | 0.0399460 | 0.5786634 | SOCS3 |
| 17 | 78358514 | 78358514 | 1 |
|
-0.2582327 | 0.2459146 | 0.7031160 | SOCS3 |
| 17 | 78358539 | 78358539 | 1 |
|
-0.3967135 | 0.0675523 | 0.5786634 | SOCS3 |
| 17 | 78358556 | 78358556 | 1 |
|
-0.1861545 | 0.4068431 | 0.8154197 | SOCS3 |
| 17 | 78358581 | 78358581 | 1 |
|
-0.2797993 | 0.2072576 | 0.6993671 | SOCS3 |
| 17 | 78358587 | 78358587 | 1 |
|
-0.3870652 | 0.0751352 | 0.5786634 | SOCS3 |
| 2 | 25161599 | 25161599 | 1 |
|
-0.1782089 | 0.4275072 | 0.8249082 | POMC_2 |
| 2 | 25161616 | 25161616 | 1 |
|
-0.0539167 | 0.8116462 | 0.9366598 | POMC_2 |
| 2 | 25161619 | 25161619 | 1 |
|
-0.0652676 | 0.7729103 | 0.9344516 | POMC_2 |
| 2 | 25161623 | 25161623 | 1 |
|
-0.1566422 | 0.4863371 | 0.8542075 | POMC_2 |
| 2 | 25161628 | 25161628 | 1 |
|
-0.2440440 | 0.2737332 | 0.7031160 | POMC_2 |
| 2 | 25161637 | 25161637 | 1 |
|
-0.2366660 | 0.2889521 | 0.7031160 | POMC_2 |
| 2 | 25161653 | 25161653 | 1 |
|
-0.2270177 | 0.3096308 | 0.7313694 | POMC_2 |
| 2 | 25161661 | 25161661 | 1 |
|
-0.3314459 | 0.1318513 | 0.6420154 | POMC_2 |
| 2 | 25161671 | 25161671 | 1 |
|
-0.4693591 | 0.0275403 | 0.5786634 | POMC_2 |
| 2 | 25161686 | 25161686 | 1 |
|
-0.3439318 | 0.1170512 | 0.6326998 | POMC_2 |
| 2 | 25161689 | 25161689 | 1 |
|
-0.2951230 | 0.1824084 | 0.6993671 | POMC_2 |
| 2 | 25161699 | 25161699 | 1 |
|
-0.2968257 | 0.1797793 | 0.6993671 | POMC_2 |
| 2 | 25161716 | 25161716 | 1 |
|
-0.3972810 | 0.0671251 | 0.5786634 | POMC_2 |
| 2 | 25161720 | 25161720 | 1 |
|
-0.0964825 | 0.6692874 | 0.9169237 | POMC_2 |
| 2 | 25161728 | 25161728 | 1 |
|
-0.1685607 | 0.4533391 | 0.8255698 | POMC_2 |
| 2 | 25161742 | 25161742 | 1 |
|
-0.2349633 | 0.2925373 | 0.7031160 | POMC_2 |
| 2 | 25161764 | 25161764 | 1 |
|
-0.1333729 | 0.5540435 | 0.8848622 | POMC_2 |
| 2 | 25161766 | 25161766 | 1 |
|
-0.4761697 | 0.0250770 | 0.5786634 | POMC_2 |
| 2 | 25161785 | 25161785 | 1 |
|
0.0601597 | 0.7902827 | 0.9344516 | POMC_2 |
| 2 | 25161792 | 25161792 | 1 |
|
-0.0908071 | 0.6877627 | 0.9287511 | POMC_2 |
| 2 | 25161799 | 25161799 | 1 |
|
0.2786642 | 0.2091841 | 0.6993671 | POMC_2 |
| 2 | 25161804 | 25161804 | 1 |
|
0.1146439 | 0.6114394 | 0.8848622 | POMC_2 |
| 2 | 25161811 | 25161811 | 1 |
|
0.3456345 | 0.1151304 | 0.6326998 | POMC_2 |
| 2 | 25161813 | 25161813 | 1 |
|
0.2584951 | 0.2454179 | 0.7031160 | POMC_2 |
| 2 | 25161817 | 25161817 | 1 |
|
-0.1398898 | 0.5346614 | 0.8848622 | POMC_2 |
| 2 | 25161825 | 25161825 | 1 |
|
0.2375039 | 0.2871976 | 0.7031160 | POMC_2 |
| 6 | 31575257 | 31575257 | 1 |
|
-0.0079456 | 0.9720054 | 0.9809116 | TNF |
| 6 | 31575316 | 31575316 | 1 |
|
0.4148749 | 0.0548705 | 0.5786634 | TNF |
| 6 | 31575322 | 31575322 | 1 |
|
0.3999479 | 0.0651450 | 0.5786634 | TNF |
| 6 | 31575391 | 31575391 | 1 |
|
0.1135089 | 0.6149946 | 0.8848622 | TNF |
| 6 | 31575397 | 31575397 | 1 |
|
0.2718537 | 0.2209940 | 0.7031160 | TNF |
| 6 | 31575399 | 31575399 | 1 |
|
0.2065861 | 0.3563101 | 0.7656209 | TNF |
| 6 | 31575414 | 31575414 | 1 |
|
0.4614135 | 0.0306533 | 0.5786634 | TNF |
| 6 | 31575441 | 31575441 | 1 |
|
0.6135154 | 0.0023924 | 0.1638798 | TNF |
| 7 | 24283574 | 24283574 | 1 |
|
0.5441016 | 0.0088507 | 0.4041827 | NPY_1 |
| 7 | 24283578 | 24283578 | 1 |
|
0.1530286 | 0.4965730 | 0.8611455 | NPY_1 |
| 7 | 24283596 | 24283596 | 1 |
|
0.3282058 | 0.1359011 | 0.6420154 | NPY_1 |
| 7 | 24283618 | 24283618 | 1 |
|
0.7986216 | 0.0000084 | 0.0011463 | NPY_1 |
| 7 | 24283628 | 24283628 | 1 |
|
0.1669375 | 0.4577632 | 0.8255698 | NPY_1 |
| 7 | 24283641 | 24283641 | 1 |
|
0.0447101 | 0.8433847 | 0.9628642 | NPY_1 |
| 7 | 24283672 | 24283672 | 1 |
|
-0.1074819 | 0.6340097 | 0.8863197 | NPY_1 |
| 7 | 24283696 | 24283696 | 1 |
|
0.1267504 | 0.5740585 | 0.8848622 | NPY_1 |
| 7 | 24283698 | 24283698 | 1 |
|
0.1295516 | 0.5655542 | 0.8848622 | NPY_1 |
| 7 | 24283710 | 24283710 | 1 |
|
0.1619861 | 0.4713956 | 0.8387169 | NPY_1 |
| 7 | 24283713 | 24283713 | 1 |
|
0.0752012 | 0.7394309 | 0.9344516 | NPY_1 |
| 7 | 24283722 | 24283722 | 1 |
|
0.3412925 | 0.1200744 | 0.6326998 | NPY_1 |
| 7 | 24283724 | 24283724 | 1 |
|
0.3714947 | 0.0887002 | 0.5786634 | NPY_1 |
| 7 | 24283731 | 24283731 | 1 |
|
0.0668577 | 0.7675232 | 0.9344516 | NPY_1 |
| 7 | 24283776 | 24283776 | 1 |
|
0.2901296 | 0.1902703 | 0.6993671 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.2060186 | 0.3576623 | 0.7656209 | NPY_1 |
| 7 | 24283820 | 24283820 | 1 |
|
0.2060186 | 0.3576623 | 0.7656209 | NPY_2 |
| 7 | 24283854 | 24283854 | 1 |
|
-0.1992080 | 0.3741196 | 0.7791827 | NPY_2 |
| 7 | 24283859 | 24283859 | 1 |
|
-0.0647000 | 0.7748356 | 0.9344516 | NPY_2 |
| 7 | 24283894 | 24283894 | 1 |
|
-0.1118062 | 0.6203430 | 0.8848622 | NPY_2 |
| 7 | 24283905 | 24283905 | 1 |
|
-0.0590246 | 0.7941566 | 0.9344516 | NPY_2 |
| 7 | 128241074 | 128241074 | 1 |
|
-0.0578895 | 0.7980353 | 0.9344516 | LEP |
| 7 | 128241076 | 128241076 | 1 |
|
-0.3371213 | 0.1249668 | 0.6340906 | LEP |
| 7 | 128241078 | 128241078 | 1 |
|
-0.0340527 | 0.8804167 | 0.9745175 | LEP |
| 7 | 128241090 | 128241090 | 1 |
|
-0.3853626 | 0.0765373 | 0.5786634 | LEP |
| 7 | 128241092 | 128241092 | 1 |
|
-0.2888800 | 0.1922732 | 0.6993671 | LEP |
| 7 | 128241095 | 128241095 | 1 |
|
-0.3843360 | 0.0773921 | 0.5786634 | LEP |
| 7 | 128241108 | 128241108 | 1 |
|
-0.1867221 | 0.4053885 | 0.8154197 | LEP |
| 7 | 128241116 | 128241116 | 1 |
|
-0.2678809 | 0.2280827 | 0.7031160 | LEP |
| 7 | 128241118 | 128241118 | 1 |
|
-0.1129413 | 0.6167753 | 0.8848622 | LEP |
| 7 | 128241132 | 128241132 | 1 |
|
-0.2474493 | 0.2668830 | 0.7031160 | LEP |
| 7 | 128241151 | 128241151 | 1 |
|
-0.3422292 | 0.1189951 | 0.6326998 | LEP |
| 7 | 128241155 | 128241155 | 1 |
|
-0.3802547 | 0.0808617 | 0.5786634 | LEP |
| 7 | 128241160 | 128241160 | 1 |
|
0.0312149 | 0.8903212 | 0.9745175 | LEP |
| 7 | 128241163 | 128241163 | 1 |
|
-0.3013660 | 0.1728956 | 0.6993671 | LEP |
| 7 | 128241178 | 128241178 | 1 |
|
-0.2091991 | 0.3501231 | 0.7656209 | LEP |
| 7 | 128241183 | 128241183 | 1 |
|
-0.0295123 | 0.8962716 | 0.9745175 | LEP |
| 7 | 128241193 | 128241193 | 1 |
|
-0.1846606 | 0.4106858 | 0.8154197 | LEP |
| 7 | 128241204 | 128241204 | 1 |
|
-0.1271299 | 0.5729030 | 0.8848622 | LEP |
| 7 | 128241207 | 128241207 | 1 |
|
-0.1986966 | 0.3753727 | 0.7791827 | LEP |
| 7 | 128241216 | 128241216 | 1 |
|
-0.2854748 | 0.1978036 | 0.6993671 | LEP |
| 7 | 128241227 | 128241227 | 1 |
|
0.0119184 | 0.9580180 | 0.9794662 | LEP |
| 7 | 128241240 | 128241240 | 1 |
|
0.0896720 | 0.6914789 | 0.9287511 | LEP |
| 7 | 128241245 | 128241245 | 1 |
|
-0.3740117 | 0.0863924 | 0.5786634 | LEP |
| 7 | 128241259 | 128241259 | 1 |
|
0.0130535 | 0.9540237 | 0.9794662 | LEP |
| 7 | 128241277 | 128241277 | 1 |
|
-0.1713984 | 0.4456584 | 0.8255698 | LEP |
| 7 | 128241286 | 128241286 | 1 |
|
0.0726457 | 0.7480031 | 0.9344516 | LEP |
| 7 | 128241291 | 128241291 | 1 |
|
-0.2179370 | 0.3298950 | 0.7638257 | LEP |
| 7 | 128241297 | 128241297 | 1 |
|
-0.0777975 | 0.7307525 | 0.9344516 | LEP |
| 7 | 128241316 | 128241316 | 1 |
|
-0.0218566 | 0.9230888 | 0.9794662 | LEP |
| 7 | 128241319 | 128241319 | 1 |
|
-0.0136211 | 0.9520269 | 0.9794662 | LEP |
| 7 | 128241321 | 128241321 | 1 |
|
-0.0805913 | 0.7214494 | 0.9344516 | LEP |
Graph of correlation coefficient and p-values across gene loci
xxgr <- GRanges(xx,seqnames=xx$seqname,ranges=IRanges(xx$pos,end=xx$pos),strand="+")
mygenenames <- unique(gr$gene_names)
sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
par(mfrow=c(2,1))
par(mar=c(5,4,2,2))
barplot(-log(x$p),names=x$pos,las=2,cex.names=0.5,ylab="-log(p) nominal",main=mygenename)
abline(h=-log(0.05))
barplot(x$rho,names=x$pos,las=2,cex.names=0.5,ylab="Spearman's rho")
})
## $SOCS3
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
##
## $POMC_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
##
## $TNF
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
##
## $NPY_1
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
##
## $NPY_2
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
##
## $LEP
## [,1]
## [1,] 0.7
## [2,] 1.9
## [3,] 3.1
## [4,] 4.3
## [5,] 5.5
## [6,] 6.7
## [7,] 7.9
## [8,] 9.1
## [9,] 10.3
## [10,] 11.5
## [11,] 12.7
## [12,] 13.9
## [13,] 15.1
## [14,] 16.3
## [15,] 17.5
## [16,] 18.7
## [17,] 19.9
## [18,] 21.1
## [19,] 22.3
## [20,] 23.5
## [21,] 24.7
## [22,] 25.9
## [23,] 27.1
## [24,] 28.3
## [25,] 29.5
## [26,] 30.7
## [27,] 31.9
## [28,] 33.1
## [29,] 34.3
## [30,] 35.5
## [31,] 36.7Permutation test
Here I’m going to resample the existing p-value data with random methylation direction.
From that distribution I can estimate the
scores <- -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE)
npermutes = 10000
permute_res <- sapply(mygenenames, function(mygenename) {
mygene <- gr[gr$gene_names==mygenename,]
myol <- findOverlaps(xxgr,mygene)
x <- xxgr[queryHits(myol),]
xscore <- mean(-log10(x$p) * as.data.frame(x)[,8])
permutes <- replicate(n=npermutes , mean( -log10(gr$p) * sample(c(-1,1),length(gr$p),replace=TRUE ) ) )
greaterthan <- length(which(permutes > xscore))
lessthan <- length(which(permutes < xscore))
p_greater = greaterthan / ( greaterthan + lessthan )
p_less = lessthan / ( greaterthan + lessthan )
pval <- c(p_greater,p_less)
names(pval) = c("pval_greater","pval_less")
return(pval)
})
permute_res %>% kbl() %>% kable_styling()| SOCS3 | POMC_2 | TNF | NPY_1 | NPY_2 | LEP | |
|---|---|---|---|---|---|---|
| pval_greater | 0.9999 | 0.8843 | 0 | 0 | 0.5296 | 0.906 |
| pval_less | 0.0001 | 0.1157 | 1 | 1 | 0.4704 | 0.094 |
Session info
sessionInfo()## R version 4.2.0 (2022-04-22)
## Platform: x86_64-pc-linux-gnu (64-bit)
## Running under: Ubuntu 20.04.4 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/blas/libblas.so.3.9.0
## LAPACK: /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3.9.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## attached base packages:
## [1] parallel stats4 stats graphics grDevices utils datasets
## [8] methods base
##
## other attached packages:
## [1] seqinr_4.2-8
## [2] gplots_3.1.1
## [3] methylKit_1.18.0
## [4] limma_3.48.3
## [5] RColorBrewer_1.1-2
## [6] dplyr_1.0.8
## [7] kableExtra_1.3.4
## [8] reshape2_1.4.4
## [9] ggbio_1.40.0
## [10] ggplot2_3.3.5
## [11] liftOver_1.16.0
## [12] Homo.sapiens_1.3.1
## [13] TxDb.Hsapiens.UCSC.hg19.knownGene_3.2.2
## [14] org.Hs.eg.db_3.13.0
## [15] GO.db_3.13.0
## [16] OrganismDbi_1.34.0
## [17] GenomicFeatures_1.44.2
## [18] AnnotationDbi_1.54.1
## [19] Biobase_2.52.0
## [20] gwascat_2.24.0
## [21] rtracklayer_1.52.1
## [22] GenomicRanges_1.44.0
## [23] GenomeInfoDb_1.28.4
## [24] IRanges_2.26.0
## [25] S4Vectors_0.30.2
## [26] BiocGenerics_0.38.0
##
## loaded via a namespace (and not attached):
## [1] backports_1.4.1 Hmisc_4.6-0
## [3] BiocFileCache_2.0.0 systemfonts_1.0.4
## [5] plyr_1.8.6 lazyeval_0.2.2
## [7] splines_4.2.0 BiocParallel_1.26.2
## [9] digest_0.6.29 ensembldb_2.16.4
## [11] htmltools_0.5.2 fansi_1.0.2
## [13] magrittr_2.0.2 checkmate_2.0.0
## [15] memoise_2.0.1 BSgenome_1.60.0
## [17] cluster_2.1.3 tzdb_0.2.0
## [19] Biostrings_2.60.2 readr_2.1.2
## [21] matrixStats_0.61.0 R.utils_2.11.0
## [23] svglite_2.1.0 bdsmatrix_1.3-4
## [25] prettyunits_1.1.1 jpeg_0.1-9
## [27] colorspace_2.0-3 blob_1.2.2
## [29] rvest_1.0.2 rappdirs_0.3.3
## [31] xfun_0.30 tcltk_4.2.0
## [33] crayon_1.5.0 RCurl_1.98-1.6
## [35] jsonlite_1.8.0 graph_1.70.0
## [37] survival_3.3-1 VariantAnnotation_1.38.0
## [39] glue_1.6.2 gtable_0.3.0
## [41] zlibbioc_1.38.0 XVector_0.32.0
## [43] webshot_0.5.2 DelayedArray_0.18.0
## [45] scales_1.1.1 mvtnorm_1.1-3
## [47] DBI_1.1.2 GGally_2.1.2
## [49] Rcpp_1.0.8.2 emdbook_1.3.12
## [51] viridisLite_0.4.0 progress_1.2.2
## [53] htmlTable_2.4.0 mclust_5.4.9
## [55] foreign_0.8-82 bit_4.0.4
## [57] Formula_1.2-4 htmlwidgets_1.5.4
## [59] httr_1.4.2 ellipsis_0.3.2
## [61] farver_2.1.0 R.methodsS3_1.8.1
## [63] pkgconfig_2.0.3 reshape_0.8.8
## [65] XML_3.99-0.9 nnet_7.3-17
## [67] sass_0.4.0 dbplyr_2.1.1
## [69] utf8_1.2.2 labeling_0.4.2
## [71] tidyselect_1.1.2 rlang_1.0.2
## [73] munsell_0.5.0 tools_4.2.0
## [75] cachem_1.0.6 cli_3.2.0
## [77] generics_0.1.2 RSQLite_2.2.10
## [79] ade4_1.7-18 fastseg_1.38.0
## [81] evaluate_0.15 stringr_1.4.0
## [83] fastmap_1.1.0 yaml_2.3.5
## [85] knitr_1.37 bit64_4.0.5
## [87] caTools_1.18.2 purrr_0.3.4
## [89] KEGGREST_1.32.0 AnnotationFilter_1.16.0
## [91] nlme_3.1-157 RBGL_1.68.0
## [93] R.oo_1.24.0 xml2_1.3.3
## [95] biomaRt_2.48.3 compiler_4.2.0
## [97] rstudioapi_0.13 filelock_1.0.2
## [99] curl_4.3.2 png_0.1-7
## [101] tibble_3.1.6 bslib_0.3.1
## [103] stringi_1.7.6 highr_0.9
## [105] lattice_0.20-45 ProtGenerics_1.24.0
## [107] Matrix_1.4-1 vctrs_0.3.8
## [109] pillar_1.7.0 lifecycle_1.0.1
## [111] BiocManager_1.30.16 jquerylib_0.1.4
## [113] snpStats_1.42.0 data.table_1.14.2
## [115] bitops_1.0-7 qvalue_2.24.0
## [117] R6_2.5.1 BiocIO_1.2.0
## [119] latticeExtra_0.6-29 KernSmooth_2.23-20
## [121] gridExtra_2.3 dichromat_2.0-0
## [123] gtools_3.9.2 MASS_7.3-56
## [125] assertthat_0.2.1 SummarizedExperiment_1.22.0
## [127] rjson_0.2.21 withr_2.5.0
## [129] GenomicAlignments_1.28.0 Rsamtools_2.8.0
## [131] GenomeInfoDbData_1.2.6 mgcv_1.8-40
## [133] hms_1.1.1 grid_4.2.0
## [135] rpart_4.1.16 coda_0.19-4
## [137] rmarkdown_2.13 MatrixGenerics_1.4.3
## [139] biovizBase_1.40.0 bbmle_1.0.24
## [141] numDeriv_2016.8-1.1 base64enc_0.1-3
## [143] restfulr_0.0.13