Abstract

Background

   Colorectal cancer (CRC) is a disease with high morbidity and mortality
   rates globally. Long noncoding RNAs (lncRNAs) play a fundamental role
   in tumor progression, and increasing attention has been paid to their
   role in CRC. This study aimed to determine the function of lncRNA
   DICER1 antisense RNA 1 (DICER1‐AS1) in CRC and confirm its potential
   regulatory mechanisms in CRC.

Methods

   The publicly available dataset was used to assess DICER1‐AS1 function
   and expression in CRC. RT–qPCR or western blot assays were performed to
   verify DICER1‐AS1, miR‐650, and mitogen‐activated protein kinase 1
   (MAPK1) expression in CRC cells or tissues. To determine the function
   of DICER1‐AS1, we performed CCK‐8, colony formation, transwell, cell
   cycle, and in vivo animal assays. Using RNA sequence analysis,
   luciferase reporter assays, and bioinformatics analysis, the connection
   between DICER1‐AS1, MAPK1, and miR‐650 was investigated.

Results

   DICER1‐AS1 was significantly upregulated in CRC tissue compared to
   normal colon tissue. High DICER1‐AS1 expression suggested a poor
   prognosis in CRC patients. Functionally, upregulation of DICER1‐AS1
   effectively promoted CRC proliferation, migration, and invasion ex vivo
   and tumor progression in vivo. Mechanistically, DICER1‐AS1 functions as
   a competitive endogenous RNA (ceRNA) that sponges miR‐650 to upregulate
   MAPK1, promotes ERK1/2 phosphorylation, and sequentially activates the
   MAPK/ERK signaling pathway.

Conclusion

   Our investigations found that upregulation of DICER1‐AS1 activates the
   MAPK/ERK signaling pathway by sponging miR‐650 to promote CRC
   progression, revealing a possible clinically significant biomarker and
   therapeutic target.

   Keywords: colorectal cancer, DICER1‐AS1, malignant proliferation,
   MAPK/ERK pathway, MAPK1, miR‐650
     __________________________________________________________________

   DICER1‐AS1 sponges miR‐650 to upregulate MAPK1 expression, promoting
   ERK1/2 phosphorylation and activating the MAPK/ERK pathway, thus
   promoting CRC progression.

   graphic file with name CAM4-12-8351-g004.jpg

1. INTRODUCTION

   Colorectal cancer (CRC) continues to be one of the most detrimental
   diseases affecting human health and is the third most frequently
   diagnosed and the second most lethal cancer worldwide.[36] ^1 , [37]^2
   , [38]^3 Clinically, CRC is usually diagnosed at an intermediate or
   late stage, and most patients have malignant hyperplasia and
   metastases. Moreover, despite advances in treatment strategies in
   recent years, including improved surgical techniques, chemotherapy, and
   targeted drugs, the prognosis of CRC patients is still not
   optimistic.[39] ^4 Therefore, there is a need to further elucidate the
   mechanisms of colon carcinogenesis and progression to improve early
   diagnosis and find more treatment methods.

   LncRNAs are noncoding RNAs that are more than 200 nucleotides in length
   and cannot encode proteins. There is growing evidence that lncRNAs can
   exert biological effects through a variety of mechanisms, such as
   serving as a guide for chromatin modification complexes, a scaffold for
   proteins, a decoy for mRNAs, and a sponge for miRNAs.[40] ^5 , [41]^6
   Especially, the role of lncRNAs in cancer progression through sponge
   for miRNAs has received increasing attention, for example, SNHG6
   promotes colorectal cancer cell proliferation by sponging miR‐26a/b and
   miR‐214 to regulate EZH2 expression[42] ^7 ; TINCR promotes
   hepatocellular carcinoma progression by sponging miR‐195‐3p to regulate
   ST6GAL1 expression[43] ^8 ; and LINC00680 promotes esophageal squamous
   cell carcinoma progression by sponging miR‐423‐5p to regulate PAK6
   expression.[44] ^9 Moreover, there is strong evidence that abnormal
   expression or function of lncRNAs is strongly correlated with the
   development of human diseases, especially in cancer. A variety of
   biological functions can be performed by lncRNAs in human tumors,
   including cell proliferation, differentiation, migration, invasion,
   apoptosis, and resistance to drugs.[45] ^10 For example, lncRNAs
   HOTAIR, GClnc1, SLCO1C1, FAM225A, and TINCR were proven to play a role
   in carcinogenesis,[46] ^8 , [47]^11 , [48]^12 , [49]^13 , [50]^14 and
   in CRC, GLCC1 can stabilize c‐Myc to promote CRC progression.[51] ^15
   FEZF1‐AS1 promotes CRC tumor growth by activating the PKM2 signaling
   pathway.[52] ^16 These studies indicate that lncRNAs play a significant
   role in human tumors by participating in the regulation of multiple
   intracellular processes.

   DICER1‐AS1 was shown to be an oncogenic factor in osteosarcoma that
   promotes osteosarcoma cell progression by regulating the miR‐30b/ATG5
   pathway.[53] ^17 Hu et al. showed that DICER1‐AS1 is a suppressor
   molecule in pancreatic cancer that inhibits pancreatic cancer cell
   proliferation by promoting the maturation of miR‐5586‐5p.[54] ^18
   Moreover, Ma et al. elucidated that DICER1‐AS1 regulates the
   miR‐296‐5p/STAT3 pathway and thus promotes CRC progression ex vivo.[55]
   ^19 However, DICER1‐AS1 in colon tumorigenesis remains unclear, and its
   role and mechanism in CRC require further study.

   In our research, we demonstrated that DICER1‐AS1 is a cancer‐promoting
   factor that is significantly upregulated in CRC, and higher DICER1‐AS1
   expression indicates a poor prognosis for CRC patients. Moreover,
   DICER1‐AS1 can promote CRC cell progression. As a ceRNA, DICER1‐AS1
   binds to miR‐650, thereby increasing MAPK1 expression, promoting ERK1/2
   phosphorylation and activating the MAPK/ERK signaling pathway. Our
   study suggests that DICER1‐AS1 is a clinically significant biomarker
   and therapeutic target.

2. MATERIALS AND METHODS

2.1. Clinical samples and cell culture

   Our clinical samples were obtained from patients undergoing surgical
   resections at Sun Yat‐Sen Memorial Hospital between June and August
   2020, and all of these recruited patients signed their written consent
   forms. Our study experimental protocols were all authorized by the
   Institutional Review Board Committee of Sun Yat‐Sen Memorial Hospital.

   For cell culture, we purchased normal intestinal epithelial cells
   (NCM460) and human CRC cell lines (RKO, LOVO, HCT116, and SW480) from
   the American Type Culture Collection (ATCC). DMEM (Gibco) containing
   10% fetal bovine serum (Gibco) was used for cell culture in an
   incubator at 37°C and 5% CO2.

2.2. RT–qPCR assays and separation of nuclear and cytoplasmic RNA

   TRIzol reagent (Thermo Fisher Scientific), chloroform, isopropanol, and
   75% ethanol were used to isolate total RNA from cell lines, and then
   A260/A280 values were measured to clarify the quality of the RNA. cDNA
   synthesis and quantitative PCR were performed as previously
   described.[56] ^20 GAPDH or U6 was used as an internal reference gene,
   and the relative expression levels of the genes were calculated by the
   2−△△ct method. All primer sequences were as follows (5′‐3′): GAPDH
   (ACAACTTTGGTATCGTGGAAGG, GCCATCACGCCACAGTTTC); DICER1‐AS1
   (CATGTGTTGTGAGGGTTCTTCTG, TCCAGACCACACATCCATATTCC); MAPK1
   (GCACCAACCATCGAGCAAAT, CTTGAGGTCACGGTGCAGAA). U6, hsa‐miR‐3612 and
   hsa‐miR‐650 primers were provided by RiboBio.

   To isolate nuclear and cytoplasmic RNA, we first isolated total RNA
   with TRIzol reagent and then used nuclear and cytoplasmic protein
   extraction kits (KeyGEN BioTECH). DICER1‐AS1 expression was measured by
   RT–qPCR.

2.3. Cell transfection

   We purchased lentivirus overexpressing DICER1‐AS1 from Hanbio
   Biotechnology (China). CRC cells were transfected with lentivirus
   overexpressing DICER1‐AS1 (DICER1‐AS1‐OE) and 5 mg/mL polybrene for
   48 h. After transfection, the successfully transfected lentiviral
   vector cells were screened with 5 μg/mL puromycin (Cayman Chemical
   Company, USA). Then, we separated the single clone cells by puromycin
   and clarified the expression of DICER1‐AS1 by RT–qPCR assay. The clone
   with the highest DICER1‐AS1 expression was selected for subsequent
   experiments. The mimics of miR‐650 and negative controls were designed
   and supplied by RiboBio. We routinely performed cell transfection with
   miR‐650 and negative controls using Lipofectamine 3000 reagent
   (Invitrogen).

2.4. RNA sequencing

   We extracted total RNA from SW480 cells transfected with lentivirus
   overexpressing DICER1‐AS1, and RNA sequencing was performed by Novogene
   (China). Differentially expressed genes were identified and displayed
   using scatter plots. The Gene Ontology (GO) database was used to
   describe the molecular functions, cellular environment, and biological
   processes involved in the differentially expressed genes. Pathway
   enrichment analysis of differentially expressed genes was performed
   using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

2.5. Cell proliferation assay

   For CCK‐8 assays, transfected cells (1 × 10^3) were placed into 96‐well
   dishes for 4 days. Ten microliters of CCK‐8 reagent (APExBIO, USA) was
   added to each well and incubated for 2 h at 37°C, followed by
   absorbance readings at 450 nm every day. For the colony formation
   assay, transfected cells (2 × 10^3) were inoculated into 6‐well plates,
   and the medium was changed every 3–5 days. After 14 days of incubation,
   each chamber was fixed, stained, and then photographed to determine the
   number of colony‐forming units.

2.6. Transwell assay

   For migration assays, a membrane pore size of 8 mm (Corning, USA)
   transwell chambers were coated without Matrigel (Corning). Briefly, we
   added 200 μl of serum‐free DMEM suspension containing 2 × 10^5 cells to
   the upper chamber, and 600 μl of 20% FBS media was placed into a
   24‐well culture plate for incubation. After 48 h, the cells were fixed
   and stained, inverted microscope images were taken, and the average
   values were taken for statistical analysis. Matrigel was plated on top
   of the upper membrane for cell invasion, and the other steps were the
   same as those in the migration assays.

2.7. Western blot assay

   Cells were harvested, lysed with RIPA lysis buffer (Beyotime, China),
   incubated, and centrifuged, and protein concentrations were assayed
   with a BCA assay kit (Beyotime, China). The expression levels of the
   proteins of interest were detected by western blotting as described
   previously.[57] ^21 The primary and secondary antibodies were as
   follows: GAPDH rabbit mAb (1:3000, CST), p‐ERK1/2 rabbit mAb (1:2000,
   CST), and HRP‐conjugated anti‐rabbit IgG (1:1000, EpiZyme
   Biotechnology). These bands were detected with the Omni‐ECL kit
   (EpiZyme Biotechnology) in a MiniChemi 610 imaging system, and related
   data were analyzed by ImageJ.

2.8. Flow cytometry assay

   Flow cytometry was used to analyze whether DICER1‐AS1 regulates the CRC
   cell cycle. The experimental protocol was as described previously.[58]
   ^22 The cell phase distribution was measured using MODFIT LT3.1
   software (Verity Software House, USA).

2.9. Fluorescence in situ hybridization (FISH)

   A fluorescence in situ hybridization kit (RiboBio, China) was used to
   observe the location of DICER1‐AS1 in CRC cells. Briefly, the
   transfected cells were fixed at a density of approximately 60%–70%,
   permeated with Triton X‐100, blocked with prehybridization solution and
   incubated overnight at 37°C with Cy3‐labeled DICER1‐AS1 or 18 s FISH
   Probe Mix in darkness. Finally, DAPI (diamidino‐2‐phenylindole) was
   used to counterstain the nuclei.

2.10. Luciferase reporter assays

   We predicted the 3′UTR of DICER1‐AS1 and MAPK1 with potential miR‐650
   binding sites and their mutant forms from public databases and
   designed, synthesized, and cloned them into the psiCHECK2
   dual‐luciferase vector from IGEbio (China), named DICER1‐AS1 (WT),
   DICER1‐AS1 (MUT), MAPK1 (WT), and MAPK1 (MUT), respectively. We
   cotransfected dual‐luciferase reporter plasmids with miR‐650 mimics or
   mimics control into SW480 and LOVO cells. After 48 h, a Duo‐LiteTM
   Luciferase Assay System (Vazyme, China) was used to detect the relative
   luciferase activities.

2.11. Animal experiments

   For in vivo experiments, HCT116 cells (5 × 10^6/0.1 ml PBS) transfected
   with lentivirus overexpressing DICER1‐AS1 and the negative control were
   inoculated subcutaneously into the right axilla and posterior flank of
   the same BALB/C nude mice (4–5 weeks old, male). Each tumor was
   measured every 6 days, and volume = length × width^2/2 was applied to
   calculate tumor volume. The mice were euthanized 30 days later, and the
   subcutaneous tumors were harvested, weighed, and photographed. The
   experimental animals were approved by the Institutional Animal Care and
   Use Committee of Sun Yat‐Sen University.

2.12. Statistical analysis

   GraphPad Prism 8 (GraphPad software package, USA) was applied for
   statistical analysis of the data and is shown as the mean ± standard
   deviation (SD) in this study. Student's t‐test or one‐way ANOVA was
   used to compare data between groups, and statistical significance was
   defined as p < 0.05.

3. RESULTS

3.1. DICER1‐AS1 is upregulated in CRC and correlates with poor patient
prognosis

   To discover the clinical significance of DICER1‐AS1, we analyzed its
   expression levels in publicly available databases. As shown in NCBI
   ([59]https://www.ncbi.nlm.nih.gov/), DICER1‐AS1 was significantly
   downregulated in normal colon tissue (Figure [60]1A). The TCGA database
   revealed significantly higher expression of DICER1‐AS1 in COAD and READ
   tumor tissues than in normal tissues (Figure [61]1B). We further
   reviewed publicly available databases to explore the clinical
   significance of DICER1‐AS1 in CRC tumorigenesis. As shown in the TCGA
   database, patients in TNM stages III‐IV expressed more DICER1‐AS1 than
   those in TNM stages I‐II, suggesting that higher expression of
   DICER1‐AS1 was associated with more aggressive tumors (Figure [62]1C).
   The Kaplan–Meier survival analysis in the GEPIA database showed that
   higher DICER1‐AS1 expression was associated with lower overall survival
   (OS) and disease‐free survival (DFS) rates. (Figure [63]1D‐E). In
   addition, DICER1‐AS1 was overexpressed in circulating cancer cells
   (CTCs) from patients with CRC (Figure [64]1F‐G), suggesting the
   possibility that tumor metastasis could be enhanced by DICER1‐AS1.
   Next, RT–qPCR experiments were conducted on NCM460 and four cancer cell
   lines (SW480, RKO, LOVO, and HCT116) to detect the expression of
   DICER1‐AS1. Compared to normal colorectal epithelial cells, NCM460,
   LOVO, RKO, SW480, and HCT116 cells showed significantly higher
   DICER1‐AS1 expression levels (Figure [65]1H). To determine whether the
   clinical samples showed consistent trends, we performed RT–qPCR assays
   for eight pairs of CRC tissues and adjacent normal tissues, which
   revealed that DICER1‐AS1 levels were significantly higher in CRC
   tissues (Figure [66]1I). In conclusion, these findings indicate that
   DICER1‐AS1 may be involved in the pathogenesis and progression of CRC.

FIGURE 1.

   FIGURE 1
   [67]Open in a new tab

   DICER1‐AS1 is upregulated in CRC and correlates with poor patient
   prognosis. (A) NCBI results of downregulated DICER1‐AS1 in normal colon
   tissues. (B) DICER1‐AS1 expression in human CRC and normal tissues was
   analyzed from TCGA database. (C) DICER1‐AS1 expression in all stages of
   CRC (p < 0.05). (D, E) Kaplan–Meier analysis of overall survival (D)
   and disease‐free survival (E) in two groups stratified by low and high
   expression of DICER1‐AS1 in CRC patients based on clinical data derived
   from the GEPIA database. (F‐G) DICER1‐AS1 overexpression is found in
   circulating cancer cells (CTCs) from CRC. (H) DICER1‐AS1 expression in
   CRC cell lines (SW480, RKO, LOVO, and HCT116) compared with the normal
   colorectal epithelial cell line NCM460 measured by RT–qPCR. (I) RT–qPCR
   analysis of DICER1‐AS1 expression in eight pairs of CRC and
   corresponding normal tissues. The data are presented as the mean ± SD,
   *p < 0.05, **p < 0.01, ***p < 0.001.

3.2. DICER1‐AS1 promotes CRC cell progression in vitro

   To assess the biological effect of DICER1‐AS1 in CRC, lentivirus was
   stably transfected into SW480 and LOVO cells to construct a cell model
   of DICER1‐AS1 overexpression. We selected four lines of DICER1‐AS1‐OE
   cells, SW480 oe#2, SW480 oe#3, LOVO oe#2, and LOVO oe#4, for further
   study. Transfection efficiency was verified using RT–qPCR
   (Figure [68]2A). Then, the CCK‐8 assay demonstrated that upregulation
   of DICER1‐AS1 significantly promoted SW480 and LOVO cell proliferation
   (Figure [69]2B). Similarly, SW480 and LOVO cells were also found to
   have a marked increase in colony formation when DICER1‐AS1 was
   overexpressed (Figure [70]2C‐D). In addition, we explored whether
   DICER1‐AS1 promotes metastasis in CRC cells. As shown in the migration
   assay, upregulation of DICER1‐AS1 remarkably promoted the migration of
   SW480 and LOVO cells. In the invasion assay, the number of invaded
   cells was significantly increased in the DICER1‐AS1‐upregulated cells
   (Figure [71]2E, F). Furthermore, cell cycle analysis revealed an
   increase in the S phase fraction and a decrease in the G1 phase
   fraction with overexpression of DICER1‐AS1 (Figure [72]2G, H),
   suggesting that high DICER1‐AS1 can promote CRC cell cycle progression,
   which may be partially responsible for promoting cell proliferation.
   Taken together, DICER1‐AS1, as a carcinogenic factor, promotes CRC cell
   progression in vitro.

FIGURE 2.

   FIGURE 2
   [73]Open in a new tab

   DICER1‐AS1 promotes CRC cell progression in vitro. (A) The relative
   DICER1‐AS1 expression level in SW480 and LOVO cells transfected with
   DICER1‐AS1‐OE or the negative control (NC). (B) CCK‐8 assay of SW480
   and LOVO cells transfected with DICER1‐AS1‐OE or the negative control
   (NC). (C‐D) Representative images (C) and quantification (D) of the
   colony formation assay in SW480 and LOVO cells transfected with
   DICER1‐AS1‐OE or the negative control (NC). (E‐F) Representative images
   (left) and quantification (right) of transwell migration and invasion
   assays in SW480 and LOVO cells transfected with DICER1‐AS1‐OE or the
   negative control (NC) (magnification, ×100, scale bar, 500 μm). (G‐H)
   Representative images (G) and quantification (H) of flow cytometric
   analysis of the cell cycle in SW480 and LOVO cells transfected with
   DICER1‐AS1‐OE or the negative control (NC).The data are presented as
   the mean ± SD, *p < 0.05, **p < 0.01, ***p < 0.001.

3.3. DICER1‐AS1 activates the MAPK/ERK signaling pathway

   Having clarified that DICER1‐AS1 could promote CRC cell progression, we
   further explored its potential mechanisms. Therefore, we performed RNA
   sequencing analysis on DICER1‐AS1‐upregulated SW480 cells. In total,
   477 genes were upregulated and 1747 genes were downregulated in the
   DICER1‐AS1‐upregulated SW480 group (∣FC∣ > 1 and P < 0.05)
   (Figure [74]3A). Interestingly, by analyzing the differentially
   expressed genes, we found that biological processes related to ncRNA
   processing were enriched, indicating that these genes may be associated
   with underlying mechanisms (Figure [75]3B). Furthermore, we performed
   KEGG pathway analysis of genes that are dysregulated due to DICER1‐AS1
   upregulation. The results showed that the MAPK signaling pathway was
   significantly enriched (Figure [76]3C), which has been linked to
   increased tumorigenesis and progression in CRC.[77] ^23 , [78]^24 Thus,
   we considered that DICER1‐AS1 may regulate CRC cells by activating the
   MAPK signaling pathway. Subsequently, phosphorylated ERK1/2 protein
   levels were markedly increased in DICER1‐AS1‐upregulated SW480 and LOVO
   cells, as shown by western blotting (Figure [79]3D, E), and ERK
   inhibitors partially alleviated these effects (Figure [80]3F, G). These
   data suggest that DICER1‐AS1 activates the MAPK/ERK pathway in CRC
   cells to promote tumorigenesis.

FIGURE 3.

   FIGURE 3
   [81]Open in a new tab

   DICER1‐AS1 activates the MAPK/ERK signaling pathway. (A) Gene
   expression profiles of SW480 cells transfected with DICER1‐AS1‐OE or
   the negative control (NC). (B) GO functional annotation clustering of
   genes regulated by DICER1‐AS1 in SW480 cells is shown. The ten most
   enriched groups according to GO analysis are ranked based on p values.
   (C) Enriched KEGG pathway analysis showing the most enriched pathways.
   (D, E) Western blot analysis of p‐ERK1/2 expression in SW480 (D) and
   LOVO (E) cells transfected with DICER1‐AS1‐OE or the negative control
   (NC). (F, G) Western blot analysis of p‐ERK1/2 expression in SW480 (F)
   and LOVO (G) cells cotransfected with DICER1‐AS1‐OE or the negative
   control (NC) together with ERK inhibitor (80 nM). The data are
   presented as the mean ± SD, *p < 0.05, **p < 0.01, ***p < 0.001.

3.4. DICER1‐AS1 is predominantly distributed in the cytoplasm and
competitively binds miR‐650

   The specific mechanism by which DICER1‐AS1 activates the MAPK/ERK
   signaling pathway remains unclear. We predicted its subcellular
   localization in LncLocator
   ([82]http://www.csbio.sjtu.edu.cn/cgi‐bin/lncLocator.py), which showed
   that DICER1‐AS1 was mainly distributed within the cytoplasm
   (Figure [83]4A). Then, we performed RT–qPCR of DICER1‐AS1 in both the
   nucleus and cytoplasm and a FISH assay to confirm its location
   (Figure [84]4B, C). Based on the distribution of DICER1‐AS1 in CRC
   cells, we hypothesized that DICER1‐AS1 functions as a ceRNA to sponge
   miRNA. We used the starBase, lncbase, and miRDB databases to identify
   its binding miRNAs. Two miRNAs (hsa‐miR‐3612 and hsa‐miR‐650) had
   potential complementary binding sequences with DICER1‐AS1
   (Figure [85]4D). Then, we analyzed the relationship between miR‐3612,
   miR‐650 and DICER1‐AS1 expression in CRC cells by RT–qPCR, which showed
   that miR‐650 expression was decreased in CRC cells overexpressing
   DICER1‐AS1, but miR‐3612 expression was not affected (Figure [86]4E).
   Therefore, we considered miR‐650 to be a possible downstream gene of
   DICER1‐AS1. We predicted the possible binding sites between miR‐650 and
   the 3’‐UTR of DICER1‐AS1 using public databases and constructed the
   corresponding luciferase reporter vector, including DICER1‐AS1 wild
   type and mutant type (Figure [87]4F). We performed a dual‐luciferase
   reporter assay and revealed that upregulation of miR‐650 significantly
   reduced the luciferase activity of the wild‐type DICER1‐AS1 gene
   fragment compared to that of the mutant DICER1‐AS1 vector
   (Figure [88]4G). Based on the above results, we tentatively speculated
   that DICER1‐AS1 may exert oncogenic effects through competitive binding
   of miR‐650.

FIGURE 4.

   FIGURE 4
   [89]Open in a new tab

   DICER1‐AS1 is predominantly distributed in the cytoplasm and
   competitively binds miR‐650. (A) DICER1‐AS1 was predicted to be located
   mainly in the cytoplasm using the bioinformatics tools in lncLocator.
   (B) A nuclear‐cytoplasmic fractionation assay indicated that DICER1‐AS1
   was mainly localized in the cytoplasm of LOVO cells. (C) The
   localization of DICER1‐AS1 was observed in SW480 and LOVO cells by
   FISH. The nuclei were stained with DAPI (magnification, ×400, scale
   bar, 20 μm). (D) Two miRNAs were predicted to harbor complementary
   sequences to DICER1‐AS1 according to the lncbase, starBase and miRDB
   databases. (E) Relative levels of miR‐3612 and miR‐650 in SW480 and
   LOVO cells transfected with DICER1‐AS1‐OE or the negative control (NC).
   (F) Schematic diagram showing the sequence of miR‐650 and the 3′‐UTR of
   DICER1‐AS1, containing the wild type and mutant types. (G) Luciferase
   reporter assay indicated that DICER1‐AS1 WT activity was inhibited
   following transfection of SW480 and LOVO cells with miR 650 mimics. The
   data are presented as the mean ± SD, *p < 0.05, **p < 0.01,
   ***p < 0.001.

3.5. MiR‐650 inhibits CRC cell proliferation

   We examined the function of miR‐650 in CRC cells by transfecting
   miR‐650 mimics and mimic controls into SW480 and LOVO cells to
   construct a cell model in which miR‐650 is overexpressed, and we used
   RT–qPCR to detect transfection efficiency (Figure [90]5A). By using the
   CCK‐8 assay and colony formation assay, we found that miR‐650
   upregulation inhibited the growth of SW480 and LOVO cells
   (Figure [91]5B‐E). Furthermore, to confirm whether the function of
   DICER1‐AS1 was mediated by miR‐650, we transfected miR‐650 mimics and
   mimic controls into DICER1‐AS1‐overexpressing SW480 and LOVO cells. As
   shown in Figure [92]5F‐I, the proliferation ability of
   DICER1‐AS1‐overexpressing CRC cells was significantly affected by
   miR‐650 mimics. These results demonstrated that DICER1‐AS1 exerts a
   carcinogenic effect by competitively sponging miR‐650.

FIGURE 5.

   FIGURE 5
   [93]Open in a new tab

   MiR‐650 inhibits CRC cell proliferation. (A) Expression level of
   miR‐650 in SW480 and LOVO cells transfected with miR‐650 mimics or
   miR‐Ctrl. (BC) CCK‐8 assay of SW480 and LOVO cells transfected with
   miR‐650 mimics or miR‐Ctrl. (D, E) Representative images (left) and
   quantification (right) of the colony formation assay in SW480 and LOVO
   cells with miR‐650 mimics or miR‐Ctrl. (F, G) CCK‐8 assays of SW480 (F)
   and LOVO (G) cells cotransfected with DICER1‐AS1‐OE or negative control
   (NC) together with miR‐650 mimics or miR‐Ctrl. (H, I) Representative
   images (H) and quantification (I) of the colony formation assay in
   SW480 and LOVO cells cotransfected with DICER1‐AS1‐OE or negative
   control (NC) together with miR‐650 mimics or miR‐Ctrl. The data are
   presented as the mean ± SD, *p < 0.05, **p < 0.01, ***p < 0.001.

3.6. DICER1‐AS1 sponges miR‐650 to upregulate MAPK1 expression, promoting
ERK1/2 phosphorylation, and activating the MAPK/ERK pathway

   To identify the target genes of miR‐650 controlled by DICER1‐AS1, we
   performed bioinformatics prediction analysis in different databases,
   including PicTar, miRDB, and starBase. Figure [94]6A shows the
   overlapping genes, including miR‐650 target genes predicted by public
   databases and upregulated mRNAs from RNA sequencing of SW480 cells
   transfected with DICER1‐AS1‐OE. We found that MAPK1 was included, which
   is an important component of the MAPK/ERK signaling pathway. In
   addition, the GEPIA database showed an upregulated expression level of
   MAPK1 in CRC (Figure [95]6B). Furthermore, we predicted the possible
   binding region of miR‐650 to the 3’‐UTR of MAPK1 through public
   databases, constructed MAPK1 wild‐type and mutant luciferase reporter
   vectors, and performed dual‐luciferase reporter assays, which showed
   that miR‐650 mimics showed decreased luciferase activity of MAPK1
   wild‐type gene fragments in LOVO cells compared with MAPK1 mutant
   vectors (Figure [96]6C, D). To determine whether DICER1‐AS1 activates
   the MAPK signaling pathway by relieving the repression of miR‐650 on
   MAPK1, we assessed the correlations between DICER1‐AS1, MAPK1, and
   miR‐650 expression levels in CRC cells by RT–qPCR. The results revealed
   that MAPK1 expression increased with overexpression of DICER1‐AS1 and
   decreased with overexpression of miR‐650 (Figure [97]6E, F). In
   addition, western blot analysis revealed that DICER1‐AS1 overexpression
   increased phosphorylated ERK1/2 protein levels, and this effect could
   be alleviated by the upregulation of miR‐650 (Figure [98]6G, H).
   Collectively, these results illustrated that DICER1‐AS1 sponges miR‐650
   to upregulate MAPK1 expression, promoting ERK1/2 phosphorylation and
   activating the MAPK/ERK signaling pathway.

FIGURE 6.

   FIGURE 6
   [99]Open in a new tab

   DICER1‐AS1 sponges miR‐650 to upregulate MAPK1 expression, promoting
   ERK1/2 phosphorylation and activating the MAPK/ERK pathway. (A) Venn
   diagram exhibiting the overlapping target genes of miR‐650 predicted by
   starBase, miRDB and PicTar and the uptrend of mRNA in RNA sequencing of
   SW480 cells transfected with DICER1‐AS1‐OE compared with the negative
   control (NC). (B) The GEPIA database showed an upregulated expression
   level of MAPK1 in CRC. (C) Schematic diagram showing the sequence of
   miR‐650 and the 3′‐UTR of MAPK1, containing the wild type and mutant
   types. (D) Luciferase reporter assay indicated that MAPK1 WT activity
   was inhibited following transfection of the cells with miR 650 mimics
   in LOVO cells. (E) Relative levels of MAPK1 in SW480 and LOVO cells
   transfected with DICER1‐AS1‐OE or the negative control (NC). (G)
   Relative levels of MAPK1 in SW480 and LOVO cells transfected with
   miR‐650 mimics or miR‐Ctrl. (H, I) Western blot analysis of p‐ERK1/2
   expression in SW480 cells cotransfected with DICER1‐AS1‐OE or the
   negative control (NC) together with miR‐650 mimics or miR‐Ctrl. The
   data are presented as the mean ± SD, *p < 0.05, **p < 0.01,
   ***p < 0.001.

3.7. DICER1‐AS1 facilitates CRC cell tumorigenesis in vivo

   To further clarify whether DICER1‐AS1 can facilitate CRC tumor growth
   in vivo, we performed in vivo nude mouse experiments. For the creation
   of a human CRC xenograft tumor model, equal amounts of HCT116 cells
   overexpressing DICER1‐AS1 and controls were inoculated subcutaneously
   into nude mice.

   There was a significant increase in weight and tumor size in the
   DICER1‐AS1 overexpression group compared with the control group
   (Figure [100]7A‐C). Moreover, we performed western blotting assay on
   subcutaneous tumor tissues and showed that there were higher levels of
   phosphorylated ERK1/2 proteins in the group overexpressing DICER1‐AS1,
   indicating that DICER1‐AS1 expression is positively correlated with
   MAPK/ERK activity (Figure [101]7D). In conclusion, these findings
   indicate that DICER1‐AS1 facilitates CRC cell tumorigenesis in vivo.

FIGURE 7.

   FIGURE 7
   [102]Open in a new tab

   DICER1‐AS1 facilitates CRC cell tumorigenesis in vivo. (A) Imaging of
   mice (left) and xenograft tumors (right) showed that overexpression of
   DICER1‐AS1 led to larger tumors. (B, C) The nude mouse xenograft model
   showed that overexpression of DICER1‐AS1 promoted tumor growth (B) and
   tumor weights (C) compared with those of the negative control (NC)
   cells. (D) Relative expression levels of p‐ERK1/2 were observed in
   subcutaneous tumor tissues by western blot assays. The data are
   presented as the mean ± SD, *p < 0.05, **p < 0.01, ***p < 0.001.

4. DISCUSSION

   In the past decade, colorectal cancer (CRC) has remained one of the
   most common and lethal tumors, and it is still a worldwide problem
   affecting human health.[103] ^3 Hence, a deep understanding of CRC
   development is essential. Recently, the role of long noncoding RNAs in
   human carcinomas, especially in CRC, has gained more attention. Our
   study revealed that lncRNA DICER1‐AS1 was aberrantly upregulated in CRC
   tissues and cell lines and that high levels were correlated with poor
   patient outcomes. DICER1‐AS1 functions as a ceRNA to bind miR‐650 to
   upregulate MAPK1 expression, promote phosphorylation of ERK1/2 and
   activate the MAPK/ERK pathway, thereby promoting CRC cell progression
   ex vivo and in vivo.

   Several previous studies have reported that DICER1‐AS1 is associated
   with the tumorigenesis and progression of human tumors.[104] ^17 ,
   [105]^18 , [106]^19 However, there is a lack of clarity regarding the
   mechanism and role of DICER1‐AS1 in CRC. We first found the expression
   level and clinical significance of DICER1‐AS1 in CRC tumors and normal
   tissues by bioinformatics analysis, which showed that DICER1‐AS1 was
   expressed at low levels in normal colon tissues and significantly
   upregulated in CRC tissues; in addition, DICER1‐AS1 was strongly
   associated with disease progression and a poor prognosis. Then, we
   conducted functional experiments and showed that DICER1‐AS1
   significantly promoted CRC progression both ex vivo and in vivo. Ma et
   al. also observed similar effects of DICER1‐AS1 on CRC cell lines.[107]
   ^19 However, we validated that DICER1‐AS1 promoted CRC growth ex vivo,
   further indicating that it may be a therapeutic target in CRC.

   Next, we performed RNA sequencing analysis on DICER1‐AS1‐upregulated
   SW480 cells to explore the mechanisms of DICER1‐AS1. An analysis of
   gene expression profiling revealed that overexpression of DICER1‐AS1
   significantly activated MAPK signaling pathways, which are widely
   recognized as important to cell proliferation and migration of human
   cancers.[108] ^25 , [109]^26 For example, exon 12‐containing LHX6 can
   facilitate cervical cancer cell growth by altering the MAPK signaling
   pathway[110] ^27 ; SMIM30 promotes hepatocellular carcinoma development
   by MAPK pathway activation[111] ^28 ; and BATF2 inhibits gastric cancer
   cell progression by inhibiting ERK signaling.[112] ^29 In addition,
   mounting evidence has proven that activation of the MAPK pathway can
   promote CRC progression.[113] ^23 , [114]^30 , [115]^31 , [116]^32
   Therefore, we inferred that DICER1‐AS1 may promote CRC progression
   through the MAPK signaling pathway. Moreover, extracellular
   signal‐associated kinase (ERK1/2) is an important molecule that
   activates the MAPK/ERK pathway. We confirmed that high DICER1‐AS1
   expression increased phosphorylated ERK1/2 protein levels by western
   blotting assays, and the addition of ERK inhibitors partially
   alleviated these effects, suggesting that DICER1‐AS1 activates the
   MAPK/ERK pathway to promote tumorigenesis in CRC.

   To explore how DICER1‐AS1 activates the MAPK/ERK pathway, we
   investigated the localization of DICER1‐AS1 in CRC cells; it is mainly
   distributed in the cytoplasm according to RT–qPCR assays of cytoplasmic
   and nuclear RNA in CRC cells, FISH assays, and reliable public online
   databases. Thus, we considered that DICER1‐AS1 exerts its biological
   function through a ceRNA mechanism. LncRNAs can bind competitively to
   miRNAs, thereby indirectly regulating the expression of miRNA target
   genes.[117] ^33 Interestingly, we proved that DICER1‐AS1 acts as a
   sponge for miR‐650 by bioinformatics prediction, RT–qPCR, and
   dual‐luciferase reporter assays. It has been previously shown that
   miR‐650 can function as a tumorigenic miRNA in various solid tumors.
   These include gastric cancer, oral cancer, prostate cancer, and
   anaplastic thyroid cancer.[118] ^34 However, previous studies have
   reported that in CRC, miR‐650 not only inhibits tumor growth but also
   promotes tumor progression. For example, miR‐650 was downregulated in
   CRC as a tumor suppressor.[119] ^35 A study from Zhou et al. showed
   that miR‐650 could directly target ANXA2, thereby promoting CRC cell
   proliferation.[120] ^36 In our study, miR‐650 was shown to be a
   suppressor molecule of CRC and could inhibit cell growth, while we
   clarified the interrelationship between DICER1‐AS1 and miR‐650 in CRC
   by rescue experiments, which showed that miR‐650 inhibited the
   proliferation of CRC cells and partially rescued the overexpression of
   DICER1‐AS1.

   Studies have shown that as ceRNAs, lncRNAs can exert biological
   functions by altering the target proteins of miRNAs. Our research
   reveals that MAPK1 is a downstream target of miR‐650 based on
   bioinformatics analysis, RNA sequencing data, and dual‐luciferase
   reporter experiments. In addition, miR‐650 was negatively correlated
   with MAPK1 expression at the mRNA level. MAPK1 is an important
   serine/threonine protein kinase in the MAPK/ERK pathway that activates
   the pathway by phosphorylating multiple substrates in the cellular
   compartment; consequently, cell proliferation, metabolism, and
   transcription are all affected by this process.[121] ^37 , [122]^38 In
   recent research, MAPK1 has been identified as an important regulator of
   cancer‐related cell activities, including migration and proliferation,
   by activating MAPK signaling. For example, GK‐IT1 competitively binds
   to MAPK1 and activates the MAPK/ERK pathway by regulating MAPK1
   phosphorylation, thereby promoting the progression of esophageal
   squamous cell carcinoma.[123] ^39 LINC00483 promotes gastric cancer
   development by adsorbing miR‐490‐3p and upregulating MAPK1
   expression.[124] ^40 miR‐20a can inhibit breast cancer cell growth by
   directly targeting MAPK1 to inhibit the MAPK/ERK pathway.[125] ^41 It
   has also been shown that miR‐422a inhibits cell growth by targeting
   MAPK1 in CRC.[126] ^42 The present study demonstrated that MAPK1 was
   upregulated in CRC cells. Moreover, this was the first study to uncover
   the interaction of MAPK1 with miR‐650 and show that DICER1‐AS1 promotes
   CRC cell proliferation by competitively sponging miR‐650 to upregulate
   MAPK1 expression, promoting ERK1/2 phosphorylation, and activating the
   MAPK/ERK pathway.

5. CONCLUSION

   To summarize, we identified DICER1‐AS1 as an upregulated lncRNA in CRC
   that is associated with a poor prognosis. Moreover, we found that
   DICER1‐AS1 could effectively promote CRC progression by acting as a
   ceRNA that sponges miR‐650 to upregulate MAPK1, promoting ERK1/2
   phosphorylation, and activating the MAPK/ERK signaling pathway. Our
   findings demonstrate that DICER1‐AS1 may be a clinically significant
   biomarker and therapeutic target.

AUTHOR CONTRIBUTIONS

   Wenfei Li: Writing – original draft (lead); writing – review and
   editing (equal). Chuanfeng Ke: Data curation (equal). Cuiyan Yang:
   Resources (equal). Jieyao Li: Supervision (equal). Qikui Chen: Project
   administration (equal). Zhongsheng Xia: Project administration (equal).
   Jihao Xu: Writing – review and editing (equal).

CONFLICT OF INTEREST

   The authors declare that they have no conflict of interest.

ETHICS STATEMENT

   All the enrolled patients and their respective guardians had written
   consent prior to use the clinical samples and pathological features for
   research purposes. The overall protocol strictly adhered to guideline
   of the Institutional Review Board Committee at Sun Yat‐Sen Memorial
   Hospital, Sun Yat‐Sen University.

CONSENT FOR PUBLICATION

   All authors give consent for the publication of the manuscript in
   Cancer Medicine.

ACKNOWLEDGMENT