Abstract

Purpose

   This study aims to confirm the efficacy of Xijiao Dihuang decoction
   (XJDHT), a classic prescription, in treating psoriasis and to explore
   the potential therapeutic mechanism.

Methods

   For pharmacodynamic analysis, a mouse model of imiquimod cream
   (IMQ)-induced psoriasis was constructed. Active ingredients and genes
   of XJDHT, as well as psoriasis-related targets, were obtained from
   public databases. Intersecting genes (IGEs) of XJDHT and psoriasis were
   collected by Venn Diagram. A protein–protein interaction (PPI) network
   of IGEs is constructed through the STRING database. The Molecular
   Complex Detection (MCODE) and Cytohubba plug-ins of Cytoscape software
   were used to identified hub genes. In addition, we conducted enrichment
   analysis of IGEs using the R package clusterProfiler. Hub genes were
   validated via external GEO databases. The influence of XJDHT on Hub
   gene expression was examined by qPCR and ELISA, and molecular docking
   was used to evaluate the binding efficacy between active ingredients
   and hub genes.

Results

   The results revealed that XJDHT possesses 92 potential genes for
   psoriasis, and 8 Hub genes were screened. Enrichment analysis suggested
   that XJDHT ameliorate psoriasis through multiple pathways, including
   AGE-RAGE, HIF-1, IL-17 and TNF signaling pathway. Validation data
   confirmed the differential expression of IL6, VEGFA, TNF, MMP9, STAT3,
   and TLR4. Molecular docking revealed a strong affinity between active
   ingredients and Hub genes. The efficacy of XJDHT in improving psoriatic
   lesions in model mice was demonstrated by PASI score and HE staining,
   potentially attributed to the down-regulation of VEGFA, MMP9, STAT3,
   TNF, and IL-17A, as evidenced by ELISA and qPCR.

Conclusion

   This study employed network pharmacology and in vitro experiments to
   identify the potential mechanisms underlying the therapeutic effects of
   XJDHT on psoriasis, providing a new theoretical basis for its clinical
   application in the treatment of psoriasis.

   Keywords: psoriasis, Xijiao Dihuang decoction, network pharmacology,
   molecular docking, angiogenesis

Introduction

   Psoriasis, a prevalent chronic inflammatory skin disease, is
   characterized by inflammation, hyperproliferation of the epidermis,
   abnormal epidermal maturation, and vascular changes. It afflicts
   approximately 125 million individuals worldwide.[42]1–3 Patients with
   psoriasis may also suffer from metabolic diseases, such as dyslipidemia
   and hypertension, as well as an increased risk of cardiovascular
   disease and cancer.[43]4–7 Despite extensive research, the pathogenesis
   of psoriasis remains elusive and may be driven by immune regulation and
   environmental factors. This presents significant challenges for
   effective treating, and currently, there are no curative approaches
   available. While glucocorticoids, immunosuppressants, and tretinoin
   have demonstrated specific efficacy, their adverse reactions and
   recurrence during treatment should be taken seriously. For instance,
   long-term use of methotrexate (MTX) can cause nausea, leukopenia, and
   elevated liver transaminases.[44]8

   With its systematic treatment methods and more than 2000 years of
   clinical experience, Traditional Chinese medicine (TCM) is widely used
   in the prevention and treatment of diseases.[45]9 Meanwhile, TCM has a
   rich history and extensive experience in treating psoriasis.
   Xiao-yin-fang is a formula composed of 5 herbs, which has been shown to
   inhibit γδT17 cell polarization and play a role in improving the
   symptoms of psoriasis-like skin lesions.[46]10 Radix Rehmanniae Recens
   is the most frequently used herb in the clinical treatment of psoriasis
   and treats psoriasis by reducing oxidative stress and activating the
   AMPK pathway.[47]11,[48]12 Indigo exerts psoriasis intervention by
   regulating cell proliferation, differentiation, and inflammatory
   response.[49]13 Nevertheless, TCM, characterized by the use of compound
   formulations (Fu-Fang), is multicomponent and multitarget agents,
   making it difficult to complete pharmacological and toxicological
   studies. In this context, Hopkins proposed a method of “network
   pharmacology” based on the idea that multiple active ingredients act on
   multiple targets.[50]14 Currently, with the development of
   high-throughput detection technology, network pharmacology provides a
   more efficient and convenient means for the systematic study of TCM
   prescriptions and complex diseases. Tao[51]15 employed a network
   pharmacology approach to investigate the mechanism of action of Huashi
   Baidu Formula on COVID-19, and outcomes demonstrated that active
   ingredients of HSBDF had therapeutic benefits via regulating MAPK
   signaling route, TNF signaling pathway and PI3K-Akt signaling pathway
   through ACE2. Research on the mechanism of TCM treatment of psoriasis
   through network pharmacology has also been widely reported. By using
   network pharmacological analysis, researchers discovered that Jueyin
   granules upregulated VDR expression levels in IMQ-induced psoriasis
   models, which may be its mechanism for ameliorating psoriasis.[52]16

   Xijiao Dihuang decoction (XJDHT), a classic TCM formula of Beiji
   Qianjin Yaofang, consists of four herbs: Bubalus bubalis Linnaeus.,
   Rehmannia glutinosa Libosch, Paeonia lactiflora PalL. and Paeonia
   suffruticosa Andr., which has the effect of clearing heat and removing
   toxins, cooling blood and dispersing blood stasis.[53]17 While main
   clinical manifestation of psoriasis is blood heat and blood stasis,
   which coincides with the main therapeutic effect of XJDHT. However, the
   exact efficacy of XJDHT in the treatment of psoriasis has yet to be
   reported, and its underlying mechanism remains elusive.

   In this research, we performed an IMQ-induced psoriasis-like mice model
   to evaluate the ameliorative effect of XJDHT on psoriasis.
   Subsequently, a network pharmacology method was employed to explore the
   pharmacological mechanism and validate by bioinformatics. Finally, the
   analysis was reconfirmed by molecular biology experiments.

Materials and Methods

Materials and Reagent

   Shuiniujiao (Bubalus bubalis Linnaeus., 30g, Cat: 220803), Shengdihaung
   (Rehmannia glutinosa Libosch., 24g, Cat: 220616), Chishao (Paeonia
   lactiflora PalL, 12g, Cat: 220522) and Mudanpi (Paeonia suffruticosa
   Andr., 9g, Cat: 220911) were obtained from the Department of Pharmacy,
   Dermatology Hospital of Jiangxi Province. Imiquimod cream was purchased
   from Mingxin Pharmaceutical Co., LTD., (IMQ, Cat. no. 40210904,
   Sichuan, China); Methotrexate tablets (MTX, Cat. no. 210801, Xinyi
   Pharmaceutical Co., LTD., Shanghai, China); Hematoxylin dye liquor
   (Cat. no. ZLI-9610, Zhongshan Jinqiao Biotechnology Co., LTD., Beijing,
   China); Eosin dye liquor (Cat. no. G1100) and 50 TAE buffer (Cat. no.
   T1060) were purchased from Solaibao Technology Co., LTD. (Beijing,
   China); Mouse IL-17A (Cat. no. MM-0759M2), TNF-α (Cat. no. MM-0132M2)
   Enzyme-linked immunosorbent assay (ELISA) kit were purchased from
   Jiangsu Enzyme Free Industry Co., LTD. (Nanjing, China); Trizon Reagent
   (Cat. no. CW0580S) and ultrapure RNA extraction kit (Cat. no. CW0581M)
   were purchased from CWBIO (Beijing, China); HiScript II Q RT SuperMix
   for qPCR (+ gDNA wiper) and ChamQ Universal SYBR qPCR Master Mix were
   obtained from Novizan Biotechnology Co., LTD. (Nanjing, China); The
   mRNA primers were synthesized by General Biotech Co., LTD. (Chuzhou,
   Anhui).

Preparation of XJDHT Decoction Mixture

   The XJDHT mixture was soaked in 10 volumes of water for 0.5 h and then
   extracted by reflux for 2 h. The aqueous extract was filtered, and the
   residue was refluxed again with 8 volumes of water for 1 h. The
   combined filtrates obtained were concentrated to a residue in a vacuum
   evaporator, yielding an extract concentration of 2.5 g/mL. The extract
   was then stored at −80 °C.

Animals

   Twenty male BALB/C mice were obtained from Zhonghong Boyuan
   Biotechnology Co., Ltd (Cat. no. SYXK 2020-0001). Mice weighing 20–25 g
   were all housed in specific pathogen-free (SPF) facility. All animal
   experimental procedures followed the guidelines in the Laboratory
   Animals Manual of the NIH Guide for the Care and Use of Animals. This
   study was approved by the Dermatology Hospital of Jiangxi Province
   Animal Ethics Committee (NO.KY2021-02-01).

Construction of Psoriasis-Like Animals Model and XJDHT Administration

   To construct a psoriasis-like mouse model, 50mg of 5% IMQ was applied
   topically to the shaved area (3×2.5cm) on the back of mice. The control
   group received a similar daily dose of vehicle Vaseline cream.

   The BALB/C mice were randomly divided into four groups (n=5): control
   group (CON) and Model group (Model), mice only received distilled water
   orally daily; MTX-treated group (MTX), mice received 1 mg/kg of MTX
   orally daily; XJDHT group (XJDHT), mice were administered at 25.0 g/kg
   of XJDHT orally each day. On the final day animals were euthanized and
   the shaved back skin was immediately excised ([54]Figure 1A).

Figure 1.

   [55]Figure 1
   [56]Open in a new tab

   Ameliorating effect of XJDHT on IMQ-induced psoriasis-like skin
   lesions. (A) Trial schema. (B) Psoriasis-like skin lesions
   manifestations of each group on day 7. (C) Cumulative PASI scores of
   mice in each treatment groups. (D) H&E staining of skin tissues. (E)
   Average epidermal thickness of each group. Data are presented as mean ±
   SEM. ***P<0.001, **P<0.01, *P<0.05, vs control group; ^###P<0.001,
   ^##P<0.01, vs model group.

Psoriasis Area and Severity Index (PASI) and Histopathological Examination

   The severity of skin lesions in mice was assessed daily using the PASI
   scoring system and photographs were taken,[57]18 PASI score items
   included erythema, scale and thickness of skin lesions, and the score
   range was 0 to 4:0, None; 1, Mild; 2, Moderate; 3, Severe; 4, Extremely
   severe. All the skin specimens were pre-fixed in 10% formalin,
   subsequently embedded in paraffin, sectioned, and stained with
   hematoxylin and eosin, then examined by microscope (BX43, Olympus,
   Tokyo, Japan). Image J software was used to calculate the average
   epidermal thickness at the lesion skin.

Collection of Compounds and Prediction of Putative Targets in XJDHT

   The TCMSP database ([58]https://old.tcmsp-e.com/tcmsp.php),[59]19
   PubChem database ([60]https://pubchem.ncbi.nlm.nih.gov), STITCH
   database ([61]http://stitch.embl.de)[62]20 and Swiss Target Prediction
   database ([63]http://www.swisstargetprediction.ch/)[64]21 were used to
   identify active ingredient and potential targets of XJDHT.

Collection of Psoriasis-Associated Genes

   Genes associated with psoriasis were obtained by searching keyword
   “psoriasis” in GeneCards ([65]https://www.genecards.org/) and DisGeNET
   database ([66]https://www.disgenet.org/).

   Then, a Venny tool from the online data analysis website
   ([67]http://bioinformatics.psb.ugent.be/webtools/Venn/) was used to
   collect the intersection genes (IGEs) of XJDHT and psoriasis.

Protein–Protein Interaction (PPI) Network

   The PPI network of IGEs was constructed using the STRING online
   database ([68]http://string-db.org) with a confidence score of 0.7,
   which provided the basis for the functional study of the
   proteome.[69]22 Results and network data were imported into Cytoscape
   (version 3.7) for visualization. For hub gene identification of IGEs,
   the Molecular Complex Detection (MCODE) plug-in was used to identify
   the most important subclusters of strongly interacting nodes. In
   addition, the plug-in “CytoHubba” enabled us to predict the top 15
   significant genes according to the maximal clique centrality (MCC)
   algorithm. Finally, genes of MCODE significant module and the
   significant genes predicted by CytoHubba were intersected to obtain the
   hub genes of XJDHT in the treatment of psoriasis.

GO and KEGG Enrichment Analyses

   KEGG (Kyoto encyclopedia of genes and genomes) pathway and GO (Gene
   ontology) term enrichment were acquired using clusterProfiler (v3.6.3)
   R package.[70]23 The screening criteria was P-adjust <0.01.

Expression of Hub Genes in Validation Dataset

   The validating dataset [71]GSE13355 (180 samples)[72]24 was obtained
   from Gene Expression Omnibus (GEO) database
   ([73]https://www.ncbi.nlm.nih.gov/geo/), which was used to analyze the
   differential expression of hub genes. A total of 58 psoriasis lesions
   tissue samples (PP) and 58 non-lesions tissue samples (PN) within the
   database were selected for analysis.

Ingredient-Gene Molecular Docking

   Molecular docking was used to verify the binding ability of the active
   ingredients and hub genes. The 3D structure of ingredients was
   downloaded from PubChem database and then imported into Chemdraw 3D.
   The MM2 module is used for energy minimization to obtain the lowest
   energy dominant conformation as a ligand. The protein structures were
   downloaded from UniProt database ([74]https://www.uniprot.org/) as
   receptors, visualized separately using PYMOL, dehydrated, hydrogenated
   and charge calculated by Mgtools (version 1.5.6). Ligand and receptor
   were saved separately as pdbqt files. Subsequently, molecular docking
   was performed using Autodock vina (version 1.5.6), and the higher
   scoring conformations were visualized using PYMOL and Discovery studio.

Quantitative PCR

   This experiment was conducted with reference to protocols and
   guidelines in the published literature. Total RNA was obtained from the
   skin tissue using TRIzol and purified using an Ultrapure RNA extraction
   kit. RNA was reverse transcribed to cDNA using the HiScript II Q RT
   SuperMix for qPCR, qPCR was performed with ChamQ Universal SYBR qPCR
   Master Mix. Sequences of the primers are presented in [75]Table 1.
   β-actin was used to housekeep the expression levels of gene and the
   relative expression levels of hub genes were calculated using the
   2^−ΔΔCt method.

Table 1.

   q-PCR Primer Sequences
    Genes    Primer Sequences (5’-3’)
   β-actin F AGGGAAATCGTGCGTGAC
           R CATACCCAAGAAGGAAGGCT
   STAT3   F AGGAGGGCAGTTTGAGTCG
           R TATGGGGTTCGGCTGCTTAG
   VEGF    F AGACAGAACAAAGCCAGAAAATCAC
           R CACGTCTGCGGATCTTGGA
   MMP-9   F GGACCCGAAGCGGACATTG
           R CGTCGTCGAAATGGGCATCT
   [76]Open in a new tab

ELISA

   The concentrations of TNF-ɑ and IL-17A were detected by ELISA. Use the
   corresponding ELISA kit, and testing was performed according to the
   specifications of kit manufacturer.

Results

Effects of XJDHT on Skin Lesion Status and PASI Score

   During the experiment, the characteristics and health of the mice, such
   as food and water consumption and breathing patterns, were normal. The
   model mice began exhibiting erythema, scaling, and thickness 2 days
   after receiving IMQ treatment as compared to the control group, while
   XJDHT significantly improved these psoriatic skin lesions symptoms
   ([77]Figure 1B). Additionally, XJDHT reduced the PASI score compared to
   the model group, and the outcomes were comparable to the MTX group
   ([78]Figure 1C).

Effect of XJDHT on Histomorphology

   HE staining showed that the epidermal layer of the skin in the control
   group was thin, and the cells in each layer were normal without
   lesions. The back skin of the model group showed the characteristic
   pathological changes of psoriasis, such as parakeratosis and
   hyperkeratosis, spinous layer hypertrophy, epidermal process
   elongation, and inflammatory cell infiltration. However, the
   pathological alterations were improved to varying degrees by the
   intervention of XJDHT and MTX ([79]Figure 1D). In addition, the skin
   thickness was significantly reduced in the XJDHT group compared to
   model group ([80]Figure 1E).

Targets Screening of XJDHT and Psoriasis

   The active ingredients of XJDHT were screened from the TCMSP database
   with criteria oral bioavailability (OB) ≧30% and drug like (DL) ≧0.18,
   and the constructs of active components were converted to SDF and
   SMILES formats through the PubChem database. Then, the SDF and SMILES
   files were imported into the Swiss Target Prediction database with
   “probability” >0 and into the STITCH database with “score” >0.4, and
   the species was set to “Homo sapiens”. Combining the results of the
   above two databases, 280 XJDHT-related genes were obtained. Meanwhile,
   1631 psoriasis-related genes were collected through GeneCards and
   DisGeNET databases. Finally, integrating the genes of XJDHT and
   psoriasis, 92 intersecting genes (IGEs) were considered as targets of
   XJDHT for the treatment of psoriasis ([81]Figure 2A, [82]Supplementary
   Table 1).

Figure 2.

   [83]Figure 2
   [84]Open in a new tab

   Analysis of the potential genes of XJDHT for the treatment of
   psoriasis. (A) Venn diagram of 92 intersecting genes. (B) Construction
   of a PPI network of IGEs.

PPI Network Construction and Hub Gene Screening

   A PPI network of IGEs was constructed through the STRING database, and
   the proteins that lack structure or interact with no other genes were
   eliminated. The PPI network consisted of 76 nodes and 363 edges
   ([85]Figure 2B), and then interaction information of the PPI network
   imported to Cytoscape for visualization. The top 3 significant clusters
   (cluster 1, cluster 2 and cluster 3) were identified by subcluster
   analysis using the MCODE ([86]Figure 3A–C). Additional, top 15
   significant genes were identified by MCC algorithm of Cytoscape plug-in
   cytohubba ([87]Figure 3D). Finally, based on the above data, 8 genes
   were identified as hub genes for XJDHT to treat psoriasis ([88]Figure
   3E, [89]Table 2).

Figure 3.

   [90]Figure 3
   [91]Open in a new tab

   Identification of Hub genes using Cytoscape and plug-in. (A) Cluster 1.
   (B) Cluster 2. (C) Cluster 3. (D) The network of top 15 hub genes
   screened by CytoHubba MCC algorithm. (E) Venn diagram to screen out
   intersection hub genes.

Table 2.

   Information of the 8 Hub Genes
   UniProt ID Gene Symbol                    Protein Name
   [92]P15692 VEGFA       Vascular endothelial growth factor A
   [93]O00206 TLR4        Toll-like receptor 4
   [94]P00533 EGFR        Epidermal growth factor receptor
   [95]P02768 ALB         Albumin
   [96]P40763 STAT3       Signal transducer and activator of transcription 3
   [97]P14780 MMP9        Matrix metalloproteinase-9
   [98]P05231 IL6         Interleukin-6
   [99]P01375 TNF         Tumor necrosis factor
   [100]Open in a new tab

Enrichment Analysis of IGEs

   Functional enrichment analysis can further clarify the biological
   function of IGEs involved in the treatment of psoriasis with XJDHT. We
   enriched 1074 GO terms including 1007 biological processes (BP), 30
   cell components (CC) and 37 molecular functions (MF)
   ([101]Supplementary Table 2). The most significant terms of BP, CC and
   MF were visualized by histogram ([102]Figure 4A). The BP terms
   demonstrated that IGEs were mostly involved in response to
   lipopolysaccharide, response to molecule of bacterial origin, response
   to nutrient levels, leukocyte cell–cell adhesion, etc. Additionally,
   the KEGG pathway enrichment analysis screened 82 significant entries,
   which suggested IGEs were mostly involved in AGE-RAGE signaling pathway
   in diabetic complications, HIF-1 signaling pathway, IL-17 signaling
   pathway and TNF signaling pathway, etc. ([103]Supplementary Table 3).
   The top 10 terms pathways were presented as bubble charts ([104]Figure
   4B). Further, the top 10 pathways, ingredients, IGEs and Hub genes were
   selected to construct a “herb-ingredient-IGEs-pathway” network of XJDHT
   for psoriasis treatment by Cytoscape software ([105]Figure 5).
   Rehmaionoside A, Rehmaionoside B, Albiflorin, Paeonoside, and
   Oxypaeoniflorin were considered as the key action ingredients with the
   highest degree values in the network ([106]Table 3).

Figure 4.

   [107]Figure 4
   [108]Open in a new tab

   GO and KEGG pathway enrichment analyses of IGEs. (A) GO term enrichment
   analysis. (B) KEGG pathway enrichment analysis.

Figure 5.

   [109]Figure 5
   [110]Open in a new tab

   Schematic diagram of “herb-ingredient-IGEs-pathway” network. Green
   diamonds represent the herbs in XJDHT, blue rectangle represent the
   major active ingredient, yellow circle represents represent IGEs, red
   circle represents the Hub targets, pink V shape represent significant
   pathways, edges represent interactions among them.

Table 3.

   The Information About XJDHT Key Active Ingredients
   PubChem CID Molecule Names  Molecular Formula Molecular Weight (g/mol)
   Degree
   10023290    Rehmaionoside A C19H34O8          390.5                    26
   10430488    Rehmaionoside B C19H34O8          390.5                    26
   24868421    Albiflorin      C23H28O11         480.5                    26
   442924      Paeonoside      C15H20O8          328.31                   22
   21631105    Oxypaeoniflorin C23H28O12         496.5                    19
   [111]Open in a new tab

Differential Expression of the 8 Hub Genes

   The limma package of R software was used to perform differential
   analysis on the validating [112]GSE13355 dataset with |log FC|>1,
   P<0.05 as the filter conditions, and draw the volcano and heat map of
   the differential gene ([113]Figure 6A and [114]B). The results of
   differential expression analysis showed that compared with PN tissue,
   the expression levels of IL6, VEGFA, TNF, MMP9 and STAT3 were
   significantly increased in PP tissue (P<0.05), and the expression level
   of TLR4 decreased. Nevertheless, there were no significant differences
   in ALB and EGFR expression (P>0.05; [115]Figure 6C).

Figure 6.

   [116]Figure 6
   [117]Open in a new tab

   Verification of 8 hub genes expression in [118]GSE13355 databases. (A)
   Volcano map. (B) Heat map. (C) Expression levels of hub genes. ***P<
   0.001, **P< 0.01, ^nsP>0.05, vs Non-lesional tissue samples.

Molecular Docking

   We selected key action ingredients as ligand molecules, and IL6 (1ALU),
   VEGFA (1MKK), TLR4 (2Z62), TNF (2AZ5), MMP9 (6ESM) and STAT3 (6NUQ) as
   receptor proteins for molecular docking, then calculated binding energy
   and evaluated binding activity. Their binding energies to each other
   are shown in [119]Figure 7A. The binding energy between TNF and
   Oxypaeoniflorin was −7.8 kcal/mol, indicating a very strong ability to
   bind ([120]Figure 7B). The amino acid residues LEU187, ALA189, ALA191,
   HIS226, GLN227, VAL223, HIS230, HLS236 and TYR248 of MMP9 form hydrogen
   bonds with Oxypaeoniflorin with good affinity, and the binding energy
   is −8.7 kcal/mol ([121]Figure 7C). The binding energy of STAT 3 and
   Albiflorin is −6.5 kcal/mol, and the interaction force is mainly on the
   hydrogen bonds ([122]Figure 7D). The binding energy of VEGFA and
   Oxypaeoniflorin is −7.9 kcal/mol, and forms hydrogen bonds with amino
   acid residues TYR21, SER24, TYR25, CYS26, ALA104, LEU66, SER50, CYS60
   and ASN62, respectively. In addition, hydrophobic functional groups in
   the active ingredient can form hydrophobic interactions with amino acid
   residues TYR25, ALA104, LEU66, and ASN62 ([123]Figure 7E).

Figure 7.

   [124]Figure 7
   [125]Open in a new tab

   Molecular docking diagram of active ingredients and Hub genes. (A)
   Heatmap of binding energy (kcal/mol). (B) Molecular docking of
   Oxypaeoniflorin and TNF. (C) Molecular docking of Oxypaeoniflorin and
   MMP9. (D) Molecular docking of Albiflorin and STAT3. (E) Molecular
   docking of Oxypaeoniflorin and VEGFA.

XJDHT Regulated the Expression of Hub Genes

   The regulation of XJDHT on the expression of IL6, TNF-α, VEGFA, MMP9
   and STAT3 was further clarified by animal experiments. As shown in
   [126]Figure 8A, MMP9, STAS3 and VEGFA were elevated in model group
   compared with the control, while XJDHT and MTX reversed these
   tendencies. Meanwhile, compared with the control group, IL-6 and TNF
   were increased in model group, while relative to model rats, IL-6 and
   TNF were decreased by XJDHT as well as MTX group ([127]Figure 8B).
   Angiogenesis is a significant aspect of psoriasis, and VEGFA is a
   crucial component of angiogenesis.[128]25 We therefore sliced the
   dorsal skin of each mice group at the conclusion of the experiment to
   investigate the distribution of blood vessels. According to the
   findings, the vascular tortuosity and amount of neovascularization at
   the lesions in the IMQ model group significantly increased as compared
   to the control group; however, in the MTX and XJDHT groups, these
   alterations were reversed ([129]Figure 8C).

Figure 8.

   [130]Figure 8
   [131]Open in a new tab

   Validation of hub genes. (A) The expression level of STAT3, MMP9 and
   VEGFA in each group detected by q-PCR assay. (B) ELISA analyzed the
   level of TNF-α and IL-17A in each group. (C) Angiogenesis of lesion
   skin in each group. Data are presented as mean ± SEM. ***P< 0.001, **P<
   0.01, vs control group; ^###P< 0.001, ^##P< 0.01, vs model group.

Discussion

   XJDHT is a classic Chinese medicine formula remedy with numerous
   clinical applications, including a notable improvement in sepsis,
   allergic purpura and psoriasis. In this work, the beneficial impact of
   XJDHT on the psoriasis-like lesion model mice has been confirmed. We
   investigated the active compounds, potential genes, and pathways of
   XJDHT for the treatment of psoriasis by network pharmacology theory and
   bioinformatics analytic methods. Through molecular docking and in vivo
   experiments, we validated our findings and gained insight into the
   molecular mechanisms of XJDHT in treating psoriasis. Overall, this work
   contributed to initially clarify the molecular mechanism of XJDHT for
   the treatment of psoriasis.

   Through network analysis and molecular docking, 5 main active
   components of XJDHT, Rehmaionoside A, RehmaionosideB, Albiflorin,
   Paeonoside, Oxypaeoniflorin, were selected. Previous reports suggest
   that these five ingredients have significant pharmacological properties
   including alleviation of depression, inflammation, and
   sepsis.[132]26–29 Therefore, we hypothesize that these 5 compounds may
   have an essential function in the treatment of psoriasis based on the
   interference with inflammation. This is similar to previous findings
   that XJDHT can reduce erlotinib-induced dermatitis by inhibiting the
   increase of inflammatory cytokines and chemokines.[133]30

   Through constructing a PPI network, we performed topological analysis
   of 92 IGEs and screened 8 hub genes by Cytohubba and MCODE plugins. We
   subsequently examined the expression level of hub genes GEO validation
   set, IL6, MMP9, STAT3, TNF and VEGFA were up-regulated in lesion
   samples, while TLR4 was down-regulated. Molecular docking is an
   important technique for drug discovery based on structural analysis of
   small molecules and proteins. VEGFA, STAT3, MMP9, and TNF were
   effectively bind to the active compounds (binding energy <-5) evaluate
   by molecular docking.

   VEGFA is an essential factor in promoting angiogenesis, which is one of
   the pathological symptoms of psoriasis. Previous research has
   demonstrated that inhibiting VEGFA expression greatly improves immune
   infiltration, epidermal thickness, and angiogenesis in
   psoriasis.[134]31,[135]32 It has been found that XJDHT can affect
   neovascularization exerting neuroprotective effects against acute
   ischemic stroke.[136]33 Our experiments also corroborate this idea that
   XJDHT reverses the increase in the number of neovascularization and
   vascular tortuosity in psoriasis models. MMP-9 is a proteolytic enzyme
   involved in wound healing, inflammatory responses, and cell
   mobilization. Jiaoling Chen reported that MMP9 influenced skin VEC
   (vessels within epithelial circle) vascular permeability and cytokine
   release via ERK=1/2 and MAPK signaling, whereas MMP9 suppression
   effectively reduced psoriatic-like symptoms in model mice.[137]34
   Besides, MMP-9 involve in angiogenesis of psoriasis by release VEGF,
   and stimulate the release of VEGF,[138]35 suggesting that it has the
   potential to indirectly influence the angiogenesis of psoriasis. STAT3,
   a crucial regulator of the inflammatory response, has been linked to
   the pathological development of most diseases, an increasing number of
   studies have discovered that it is also intimately connected to the
   progression of psoriasis.[139]36,[140]37 By repeatedly phosphorylating
   STAT3, the researchers found that mice acquired psoriatic skin lesions;
   however, inhibition of STAT3 phosphorylation and activation revealed
   significant improvement in inflammatory skin lesions.[141]38 The
   disease process of psoriasis is aggravated by STAT3 phosphorylation,
   which disrupts γδT cells and encourages the generation of IL-17 in the
   skin.[142]39 Additionally, the amount of IL-21 activated by STAT3
   promotes keratinocyte proliferation, which is related to the severity
   of psoriasis.[143]40 TNF-α is an inflammatory cytokine with a proven
   role in the pathogenesis of psoriasis, and TNF-α inhibitors adalimumab,
   infliximab and etanercept are utilized extensively in the clinical
   treatment of psoriasis.[144]41 More importantly, Hub genes were
   up-regulated in the skin tissues of psoriasis model mice during the in
   vivo experiments, while the XJDHT and MTX groups were able to reverse
   this upregulation, proving the validity of this study’s findings.

   There are limitations in this study: firstly, the study only carried
   out in vivo experiments and not in vitro experimental studies, which
   could not fully reflect the pathologic changes in psoriasis. In
   addition, changes in the protein expression level of hun gene were not
   detected in this study. We will investigate the ameliorative effect of
   XJDHT on psoriasis at the cellular level in subsequent studies and
   examine the changes in the expression levels of the relevant proteins
   with various techniques.

Conclusions

   Comprehensive network pharmacological analysis, molecular docking, and
   in vitro experiments indicate that the probable mechanism of XJDHT for
   the treatment of psoriasis involves the regulation of Hub genes VEGFA,
   MMP9, TNF, STAT3, and IL-17 signaling pathways, which influence the
   development of psoriasis angiogenesis and inflammation. These findings
   provide a theoretical foundation for the therapeutic application of
   XJDHT in the treatment of psoriasis.

Acknowledgments