Abstract

   Background: Protein casein 2A2 (BTN2A2) is a costimulatory molecule
   first identified in antigen-presenting cells. Studies have shown the
   involvement of BTN2A2 in immunity. However, the exact role and the
   mechanism of BTN2A2 in tumors are still unclear.

   Methods: First, we performed real-time PCR to measure BTN2A2 expression
   in glioma cell lines. Next, we performed Genes Ontology (GO) and Kyoto
   Encyclopedia of Genes and Genomes (KEGG) enrichment analyses to
   understand the mechanism of BTN2A2 in glioma. Next, we used the
   “ESTIMATE”, “ssGSEA” and “CIBERSORT” algorithms to analyze the
   correlation between BTN2A2 and immune cell infiltration (ICI). Finally,
   we performed immunohistochemistry, growth curve, transwell, and colony
   formation assays to determine the functions of BTN2A2 in glioma.

   Results: Our results showed an increase in BTN2A2 expression levels in
   glioma tissues and cells. Next, we determined that BTN2A2 was
   correlated with the prognosis of patients with glioma. Then, using the
   ESTIMATE, ssGSEA, and CIBERSORT algorithms, we discovered that BTN2A2
   was significantly associated with immune cell infiltration (ICI) in
   glioma. We observed an increase in BTN2A2 expression levels with an
   increase in the patient’s tumor grade. Furthermore, BTN2A2
   significantly enhanced the proliferative and migratory abilities of
   glioma cells.

   Conclusions: Our results showed a significant increase in BTN2A2
   expression levels in glioma cells and tissues. Furthermore, the
   prognosis of patients expressing high BTN2A2 levels was poor. Moreover,
   BTN2A2 was correlated with progression and ICI in patients with glioma.
   Together, this indicates that BTN2A2 could be a therapeutic target for
   patients with glioma.

   Keywords: glioma, BTN2A2, immune infiltration, cell proliferation, cell
   migration

INTRODUCTION

   In humans, gliomas are among the most common type of cancer of the
   central nervous system, of which glioblastoma (GBM) is the most lethal
   type of glioma. World Health Organization (WHO) grade IV gliomas
   account for 70% of all disseminated gliomas. However, the survival of
   patients with grade IV gliomas is 15 months [[38]1]. Only two standard
   therapeutic approaches, including maximum safe surgical resection and
   combined chemoradiotherapy, are available for patients with glioma
   [[39]2]. Temozolomide (TMZ) is the first-line chemotherapeutic drug
   widely used for treating patients with glioma. However, chemoresistance
   in patients with gliomas is primarily responsible for treatment
   failure. Highly active O[6]-methylguanine DNA methyltransferase (MGMT)
   could reduce the effect of alkylating agents, such as TMZ, thereby
   enhancing the tolerance of patients to chemotherapy. Furthermore,
   mutations in epidermal growth factor receptor, Galectin-1, mouse double
   minute 2, p53, and phosphatase and tensin homolog deleted on chromosome
   ten and changes in the activity of related signaling pathways are
   involved in regulating the progression of gliomas [[40]3]. Significant
   advancements have been made in diagnosing or treating patients with
   glioma. Additionally, methylation in MGMT promoter [[41]4], deletion in
   chromosome 1p and 19q [[42]5], and isocitrate dehydrogenase (IDH) 1 and
   IDH2 mutations [[43]6] are used for diagnosing or treating patients
   with glioma. Despite these advancements, the survival rate of patients
   has not significantly improved. Therefore, identifying new biomarkers
   or therapeutic targets for treating patients with glioma is an urgent
   need.

   Butyrophilin is the major protein associated with fat droplets in milk
   [[44]7]. Protein casein 2A2 (BTN2A2) is a costimulatory molecule. It
   was first discovered in antigen-presenting cells and involved in
   immunity [[45]8]. Nevertheless, the role and the mechanisms of BTN2A2
   in tumor onset and progression are yet to be determined.

   In this study, we demonstrated that BTN2A2 expression was significantly
   high in glioma tissues and cell lines. BTN2A2 regulates glioma
   development via several immune-related signaling pathways. Furthermore,
   we used several algorithms and demonstrated a significant correlation
   between BTN2A2 and immune cell infiltration (ICI). Our study is the
   first to determine the involvement of BTN2A2 in glioma, thus suggesting
   that BTN2A2 could be a therapeutic target for treating patients in the
   future.

MATERIALS AND METHODS

Dataset retrieval and bioinformatics analysis

   Transcriptomic and clinical information of 703 patients with glioma
   (LGG + GBM) were retrieved from the Cancer Genome Atlas (TCGA)
   database. Next, we performed Kaplan-Meier (KM) analysis to determine
   the patient’s overall survival (OS). We used the Tumor immune
   estimation resource (TIMER) ([46]https://cistrome.shinyapps.io/timer/)
   [[47]9], Gene expresssion profiling interactive analysis (GEPIA)
   ([48]http://gepia.cancer-pku.cn/) [[49]10], and the Chinese glioma
   genome atlas (CGGA) ([50]http://www.cgga.org.cn/) databases to
   determine BTN2A2 expression in tumor and normal tissue. In addition,
   the retrieved [51]GSE34152, [52]GSE50161, and [53]GSE66354 database
   ([54]https://www.ncbi.nlm.nih.gov/gds) [[55]11]. We evaluated the RNA
   seq data using the Xiantaoxueshu database
   ([56]https://www.xiantao.love/writings). The significance of BTN2A2 in
   predicting patient prognosis was determined using the mRNAseq_325
   obtained from CGGA and Rembrandt as well as Phillips datasets.

Gene function enrichment analysis

   The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes
   (KEGG) pathway enrichment analysis to determine biological processes
   (BPs) and molecular functions (MFs) enriched by BTN2A2 among patients
   from TCGA. Gene set enrichment analysis (GSEA) was conducted to explore
   the functions and underlying mechanisms of BTN2A2 based on patients
   from the TCGA cohort.

Correlation between BTN2A2 and tumor immune microenvironment (TIME) in glioma

   To study the correlation between BTN2A2 and ICI, we analyzed the data
   on ICI in patients from the TCGA cohort using the “Cell-type
   Identification by Estimating Relative Subsets of RNA Transcripts”
   (CIBERSORT) algorithm.

Cell cultures

   We purchased glioma cells, including HAC, T98G, LN229, A172, and SF295
   from the Kunming Institute of Zoology Cell Bank and cultured them in
   DMEM (Corning, NY, USA) supplemented with 1% penicillin/streptomycin
   and 10% fetal bovine serum at 37°C, 95% air, and 5% CO[2].

Cell transfection

   Control and BTN2A2 siRNA plasmids were synthesized by GenePharma
   (Shanghai, China). We seeded SF295 and LN229 cells in to a 6-well plate
   and transfected them with siRNA using Lipofectamine 3000 reagent
   (Invitrogen, CA, USA). Scrambled siRNA was used as the negative
   control.

   BTN2A2 siRNA sequence: GGAGAUGUUUGGAAACCAAUA.

Quantitative real-time polymerase chain reaction (qRT-PCR)

   We isolated total RNA using the TRIzol reagent (Invitrogen). Next, we
   reverse transcribed RNA using EasyScript First-Strand cDNA Synthesis
   SuperMix Kit (TransGen Biotech, China) and performed RT-qPCR with the
   aid of FastStart Universal SYBR Green Master Mix (Roche, TIANGEN
   Biotech, Beijing, China) on applied Biosystems 7500.

   The sequences of primers are as follows: BTN2A2-FP:
   CTGTCATCCTGACCGCATCT, BTN2A2-RP: CGCAATTCTTCTTGAAGTTGCT, β-actin-FP:
   CTTCGCGGGCGACGAT, β-actin-RP: CCATAGGAATCCTTCTGACC.

   Finally, we measured gene expression levels using the 2^−ΔΔCt method.

Immunohistochemistry (IHC)

   First, we dewaxed and treated the slides using 3% hydrogen peroxide.
   Next, we performed antigen retrieval using an antigen retrieval kit
   (Transgenitor bio) and blocked the proteins using 5% BSA (Bioss).
   Subsequently, the slides were incubated with the diluted primary
   antibody (anti-BTN2A2, ab233763, Abcam) overnight. Finally, the
   sections were stained with a DAB kit (K5007, Agilent Technologies, CA,
   USA) and counterstained using hematoxylin. The slides were visualized
   using a laboratory microscope (Nikon, Japan).

Growth Curve

   We seeded 1 × 10^4 cells in 6-well plates for 24 hours and digested
   them with trypsin. Next, we extracted 20 μL cells, placed them on
   slides, and counted the cells daily for six days.

Colony formation experiment

   We seeded the cells transfected with siRNA in 6-well plates. We changed
   the medium every two days for 14 days. Next, we fixed the cells using a
   fixative, stained them with crystal violet, and photographed them for
   statistical analysis.

Transwell assay

   We used a transwell cell culture system to determine the migratory
   ability of cancer cells. First, we suspended 1 × 10^5 cells in 1 mL
   serum-free DMEM. Next, we seeded 100 μL cells suspension on a transwell
   chamber and cultured it for 24 hours. Subsequently, we fixed the cells
   with 4% paraformaldehyde for 20 minutes, stained them using crystal
   violet, and counted the cells.

Statistical analysis

   We determined BTN2A2 expression in tumors using the TIMER, GEPIA 2, and
   TCGA databases. We performed the survival analysis using the log-rank
   test. Next, the correlation between genes was assessed using the
   P-value and Spearman correlation modulus. Furthermore, we determined
   BTN2A2 expression in normal glial and tumor cells using analysis of
   variance. P < 0.05 indicated the significance level.

Data availability statement

   GBMLGG (Glioma) data from the RNAseq data of level 3 HTSeq - FPKM
   format in TCGA ([57]https://portal.gdc.cancer.gov/) (glioma) project.
   The gene expression profiling data sets ([58]GSE34152), ([59]GSE50161),
   and ([60]GSE66354) were obtained from the GEO database
   ([61]https://www.ncbi.nlm.nih.gov/gds), and they were used to analyze
   the differential expression of genes.

RESULTS

BTN2A2 expression in patients with cancer

   We determined the difference in BTN2A2 expression in tumor and normal
   tissues using the differential gene expression module of TIMER. The
   results demonstrated an increase in BTN2A2 expression in patients with
   GBM, LGG, CHOL, HNSC, KIRC, LIHC, KIRP, STAD, DLBC, PAAD, SARC, SKCM
   and THYM. However, our results revealed a decrease in BTN2A2 expression
   in patients with KICH, LUAD, LUSC, PRAD, OV, UCS, UCEC, ACC, BRCA,
   COAD, PCPG, READ, TGCT, and THCA ([62]Figure 1A–[63]1C). Aberrant
   BTN2A2 expression in various cancers indicates that BTN2A2 could be an
   important cancer biomarker. However, the functions of BTN2A2 in glioma
   is still unclear.

Figure 1.

   [64]Figure 1
   [65]Open in a new tab

   BTN2A2 expression in patients with cancer. (A) BTN2A2 expression in
   pan-cancer using TIMER. (B) BTN2A2 expression in pan-cancer using GEPIA
   2. (C) BTN2A2 expression in pan-cancer using TCGA. Abbreviations: ACC:
   Adrenocortical carcinoma; BRCA: Bladder Urothelial carcinoma; CESC:
   Cervical squamous cell carcinoma and endocervical adenocarcinoma; DLBC:
   Lymphoid Neoplasm Diffuse Large B-cell Lymphoma; LAML: Acute Myeloid
   Leukemia; LUSC: Lung squamous cell carcinoma; MESO: Mesothelioma; PAAD:
   Pancreatic adenocarcinoma; PCPG: Pheochromocytoma and Paraganglioma;
   READ: Rectum adenocarcinoma; SARC: Sarcoma; TGCT: Testicular Germ Cell
   Tumors; THYM: Thymoma; UCS: Uterine carcinosarcoma; UVM: Uveal
   Melanoma; BLCA: Bladder urothelial carcinoma; CHOL: Cholangiocarcinoma;
   COAD: Colon adenocarcinoma; ESCA: Esophageal carcinoma; HNSC: Head and
   neck squamous cell carcinoma; KICH: Kidney Chromophobe; KIRP: Kidney
   renal clear cell carcinoma; KIRC: Kidney renal clear cell carcinoma;
   LIHC: Liver hepatocellular carcinoma; LUAD: Lung adenocarcinoma; PRAD:
   Prostate adenocarcinoma; SKCM: Skin Cutaneous Melanoma; STAD: Stomach
   adenocarcinoma; THCA: Thyroid carcinoma; UCEC: Uterine corpus
   endometrial carcinoma. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

BTN2A2 expression in glioma and the correlation between BTN2A2 expression and
clinicopathological features (CFs) of patients with glioma

   Our analysis showed a significant increase in BTN2A2 expression in
   patients with glioma from TCGA and GEO cohorts ([66]Figure 2A–[67]2C).
   Next, we performed qRT-PCR to determine BTN2A2 expression in glioma
   cell lines. We observed an increase in BTN2A2 expression in glioma
   cells ([68]Figure 2D). Further, we observed a significant correlation
   between BTN2A2 and CFs, such as WHO grade, the status of IDH and 1p/19q
   codeletion in patients with glioma from TCGA and GEO cohorts. The
   results demonstrated a significant difference in BTN2A2 expression in
   patients with different tumor grades, tissue categories, and IDH
   mutations as well as 1p/19q codeletion status ([69]Figure 2E–[70]2G).
   Finally, logistics regression analysis and baseline data showed a
   significant correlation between BTN2A2 expression and CFs of patients
   in TCGA cohort ([71]Tables 1 and [72]2). These results indicate the
   significance of BTN2A2 in clinical settings.

Figure 2.

   [73]Figure 2
   [74]Open in a new tab

   Correlation between BTN2A2 expression and CFs. (A) BTN2A2 expression in
   patients with glioma in TCGA cohort. (B, C) BTN2A2 expression in
   patients with glioma in GEO cohort. (D) BTN2A2 expression in normal
   human astrocytes cells (NHA) and glioma cells (A172, T98G, LN229, and
   SF295) was determined using qRT-PCR. (E–G) Correlation between BTN2A2
   expression and CFs (grade, IDH status, 1p/19q codeletion, age, primary
   therapeutic outcome, and histological type). ^*P < 0.05, ^**P < 0.01,
   ^***P < 0.001.

Table 1. Correlation between BTN2A2 and CFs of patients in TCGA cohort.

   Clinicopathological features Low BTN2A2 expression High BTN2A2
   expression P-value
   n 348 348
   WHO grade, n (%)
    G2 175 (27.6%) 49 (7.7%) <0.001
    G3 118 (18.6%) 125 (19.7%)
    G4 13 (2%) 155 (24.4%)
   IDH status, n (%)
    WT 37 (5.4%) 209 (30.5%) <0.001
    Mut 308 (44.9%) 132 (19.2%)
   1p/19q codeletion, n (%)
    codel 144 (20.9%) 27 (3.9%) <0.001
    non-codel 203 (29.5%) 315 (45.7%)
   Primary therapy outcome, n (%)
    PD 52 (11.3%) 60 (13%) <0.001
    SD 96 (20.8%) 51 (11%)
    PR 42 (9.1%) 22 (4.8%)
    CR 101 (21.9%) 38 (8.2%)
   Age, n (%)
    ≤60 312 (44.8%) 241 (34.6%) <0.001
    >60 36 (5.2%) 107 (15.4%)
   Histological type, n (%)
    Astrocytoma 96 (13.8%) 99 (14.2%) <0.001
    Glioblastoma 13 (1.9%) 155 (22.3%)
    Oligoastrocytoma 91 (13.1%) 43 (6.2%)
    Oligodendroglioma 148 (21.3%) 51 (7.3%)
    Age, median (IQR) 40 (32, 51) 53 (37, 63)
   [75]Open in a new tab

Table 2. Correlation between BTN2A2 and CFs of patients.

   Clinicopathological features Total (N) Odds ratio (OR) P-value
   WHO grade (G3&G4 vs. G2) 635 7.634 (5.263–11.236) <0.001
   IDH status (Mut vs. WT) 686 0.076 (0.050–0.113) <0.001
   1p/19q codeletion (non-codel vs. codel) 689 8.276 (5.371–13.180) <0.001
   Primary therapy outcome (SD vs. PD) 259 0.460 (0.277–0.759) 0.003
   Age (>60 vs. ≤60) 696 3.848 (2.568–5.882) <0.001
   Histological type (Glioblastoma vs. Astrocytoma) 363 11.562
   (6.348–22.658) <0.001
   [76]Open in a new tab

Significance of BTN2A2 in predicting the prognosis of patients with glioma

   Next, we determined the significance of BTN2A2 in predicting the
   prognosis of patients with glioma. Hence, we determined the effect of
   BTN2A2 expression on the survival of patients using TCGA, CGGA,
   Rembrandt, and Phillips datasets. The results demonstrated that the
   survival of patients expressing low BTN2A2 levels was good and the
   survival of patients expressing high BTN2A2 levels was poor ([77]Figure
   3A–[78]3F). We used the KM ([79]Figure 4A–[80]4F), Nomogram ([81]Figure
   4G), and Calibration analysis ([82]Figure 4H) to investigate the
   significance of BTN2A2 in predicting the prognosis of patients with
   different CFs. A significant correlation between the effect of BTN2A2
   on the patient prognosis and age, the status of IDH mutation, 1p/19q
   co-deletion, tumor grade, primary therapy outcome, and type of tumor
   tissues. These results indicate that BTN2A2 could be used for
   predicting the patient’s prognosis.

Figure 3.

   [83]Figure 3
   [84]Open in a new tab

   Survival curve for determining the prognostic significance of BTN2A2.
   (A–C) The significance of BTN2A2 in predicting the prognosis of
   patients with glioma from the TCGA cohort. (D–F) The significance of
   BTN2A2 in predicting the prognosis of patients with glioma using CGGA,
   REMBRANDT, and Phillips databases.

Figure 4.

   [85]Figure 4
   [86]Open in a new tab

   Analyzing the prognostic value of BTN2A2 in different glioma subgroups.
   (A–F) Correlation between total survival and glioma grade, IDH
   mutation, and 1p/19q codeletion status, age, primary therapeutic
   outcome, and histological types. ^*P < 0.05, ^**P < 0.01, ^***P <
   0.001. (G) Construction of a nomogram to determine the OS of patients
   with glioma. (H) The calibration curve was used to determine the OS of
   patients from the TCGA cohort.

GSEA of BTN2A2 in patients with glioma

   We performed the GO and KEGG pathway enrichment analysis to determine
   the functions of BTN2A2. The GO-BP terms such as lymphocyte, B cells,
   and neutrophil-mediated immunity, immune responses mediated by
   immunoglobulin, immune effector process regulation, the activation of B
   cells, the B cell receptor signaling pathway, and the positive
   regulation of B cell activation were enriched by BTN2A2 ([87]Figure
   5A). The GO-cellular component (CC) terms enriched by BTN2A2 were
   immunoglobulin and T cell receptor complexes, collagen-containing
   extracellular matrix (ECM), cytoplasmic vesicles and vacuolar lumen,
   synaptic and postsynaptic membranes, and basement membrane, etc.,
   ([88]Figure 5B). The GO-MF terms, such as antigen binding functions,
   immunoglobulin receptor, protease, ECM, and the cytokine, peptide
   receptor, G protein-coupled peptide receptor (GPCR), and
   neurotransmitter receptor activities were enriched by BTN2A2
   ([89]Figure 5C).

Figure 5.

   [90]Figure 5
   [91]Open in a new tab

   Enrichment analysis of BTN2A2 in glioma. (A–C) The GO enrichment
   analysis was performed on BTN2A2 using TCGA. (D) The KEGG pathway
   analysis of BTN2A2 using the TCGA database.

   The KEGG pathway enrichment analysis showed the enrichment of the
   chemokine, interleukin 17 (IL-17), phosphatidylinositide 3-kinases
   (PI3K-Akt), Janus kinase signal transduction and transcriptional
   activator (JAK-STAT), HIF-1 signaling pathways, the interaction between
   ECM-receptors, and phagosome were enriched by BTN2A2 ([92]Figure 5D).
   Further, most of these pathways regulated immune responses. The
   JAK-STAT signaling pathway mediates immunomodulatory processes,
   including the recognition of tumor cells and tumor cells escaping
   immune surveillance [[93]12]. The PI3K-AKT signaling pathway could
   attenuate the effector functions of immune cells and alter the tumor
   microenvironment (TME) [[94]13]. A study showed highly active IL-17
   signaling pathway was correlated to high CD8+ T cell infiltration and
   changes in the TIME in breast cancers [[95]14].

   We performed GSEA to determine the underlying mechanisms of BTN2A2 in
   patients with glioma in our cohort. The results showed BTN2A2 was
   associated with the CTLA4, MHC, chemokine, JAK-STAT signaling pathways,
   antigen processing and presentation, PD1 blockade cancer immunotherapy,
   immune cells-microRNAs interactions in the TME, and apoptosis
   ([96]Figure 6A–[97]6I).

Figure 6.

   [98]Figure 6
   [99]Open in a new tab

   GSEA of BTN2A2 in glioma. (A–I) The CTLA4, MHC, Th1-Th2, chemokine, and
   JAK-STAT signaling pathway, the processing and presentation of
   antigens, and apoptosis were determined using GSEA.

   These results showed a significant effect of BTN2A2 on activating
   immune system in patients with glioma.

Role of BTN2A2 in the TIME

   The GO and KEGG pathway enrichment analysis demonstrated correlation
   between BTN2A2 and immune regulation. Hence, we determine the
   correlation between BTN2A2 expression and the ICI. The ESTIMATE results
   showed a high correlation between BTN2A2 expression and stromal cells
   as well as immune cells ([100]Figure 7A). Next, we used the ssGSEA and
   CIBERSORT algorithms to determine the correlation between BTN2A2
   expression and ICI. The results demonstrated a significant correlation
   between BTN2A2 and macrophages, activated, immature, myeloid, and
   plasmacytoid dendritic cells, neutrophils, CD8+ and CD4+ T cells,
   monocytes, T cell regulatory, type 1, 2, and 17 T helper (Th) cells, B
   cells, cytotoxic cells, Th cells, natural killer cells, and follicular
   Th cells ([101]Figure 7B–[102]7G).

Figure 7.

   [103]Figure 7
   [104]Open in a new tab

   Correlation between BTN2A2 and ICI in patients with glioma. (A)
   Correlation between BTN2A2 and stromal, immune, and ESTIMATE scores of
   patients with glioma using ESTIMATE algorithm. (B–E) Correlation
   between BTN2A2 and ICIs in patients with glioma using the ssGSEA
   algorithm. (F, G) Correlation between BTN2A2 and ICI in patients with
   glioma using the CIBERSORT algorithm. ^*P < 0.05, ^**P < 0.01, ^***P <
   0.001.

   Immune checkpoint blocking (ICB) is used as a therapeutic strategy for
   treating patients with cancers [[105]12]. ICB therapy has
   revolutionized cancer treatment [[106]13]. Therefore, we investigated
   the correlation between BTN2A2 expression and immune checkpoint
   molecules, such as PDCD1LG2 (PD-L2), CD274 (PD-L1), PDCD1 (PD-1),
   TIGIT, SIGLEC15, IDO1, LAG3, CTLA-4, and HAVCR2. The results showed a
   significant positive correlation between BTN2A2 and immune checkpoint
   gene expression ([107]Figure 8A–[108]8D), thereby indicating the
   significance of BTN2A2 in the immunotherapy of glioma.

Figure 8.

   [109]Figure 8
   [110]Open in a new tab

   The correlation between BTN2A2 expression and immune checkpoint genes.
   (A, B) Correlation between BTN2A2 expression and immune checkpoint
   genes in patients with glioma using TCGA and TISIDB databases. (C, D)
   Analyzing the correlation between BTN2A2 expression and immune
   checkpoint genes in patients with glioma using Spearman^’s correlation.

Knockdown of BTN2A2 inhibits the migration and proliferation of glioma cells

   We performed IHC on three gliomas and one normal tissue. The results
   demonstrated an increase in BTN2A2 expression was observed with
   increasing glioma grade ([111]Figure 9A). To determine the functions of
   BTN2A2 in glioma cells, BTN2A2 expression was knockdown in SF295 and
   LN229 cells using siRNA. Next, we performed qRT-PCR to determine
   knockdown efficiency ([112]Figure 9B, [113]9C). The growth curve and
   colony formation assays showed that the knockdown of BTN2A2 could
   inhibit SF295 and LN229 cell proliferation ([114]Figure 9D–[115]9G).
   Next, we performed a transwell assay to determine if BTN2A2 could
   regulate the migration of cancer cells. The results demonstrated a
   significant decrease in the migratory abilities of BTN2A2 knockdown
   cells compared to control cells ([116]Figure 9H, [117]9I). Together,
   this indicates that BTN2A2 overexpression could promote the
   proliferative and migratory abilities of glioma cells.

Figure 9.

   [118]Figure 9
   [119]Open in a new tab

   Knockdown of BTN2A2 expression inhibits the proliferation and migration
   of glioma cells. (A) IHC shows BTN2A2 expression in glioma and normal
   brain tissues. (B, C) The efficacy of BTN2A2 knockdown in SF295 and
   LN229 using qRT-PCR. (D, E) BTN2A2 knockdown inhibits the growth of
   SF295 and LN229 cells determined using growth curve. (F, G) BTN2A2
   knockdown inhibits the migration of SF295 and LN229 cells determined
   using the colony information assay. (H, I) BTN2A2 knockdown inhibits
   the migration of SF295 and LN229 cells determined using the transwell
   assay. Scale bar = 250 um. Abbreviations: NC: Negative control; siRNA:
   Knockdown of BTN2A2. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001.

DISCUSSION

   In gliomas, the status of IDH mutations and 1p/19q co-deletion are
   widely used markers based on WHO guidelines (2016) for predicting the
   patient prognosis [[120]14]. In addition, the mutation in TERT
   promoters is considered a molecular hallmark of GBM and is frequently
   used as a biomarker for predicting the prognosis of patients with GBM
   [[121]15]. Patients with WHO grade II and III gliomas and secondary GBM
   (WHO Grade IV) frequently harbor IDH mutations; However, the IDH
   mutation rate in patients with primary GBM (WHO Grade IV) is low
   [[122]6, [123]16–[124]18]. The deletion in chromosomal 1p/19q is
   primarily detected in patients with oligodendrogliomas; However,
   chromosomal 1p/19q deletion is rare in patients with astrocytomas
   [[125]19, [126]20]. Therefore, identifying new markers for predicting
   the patient prognosis to improve the diagnosis and treatment outcomes
   is the need of the hour.

   We used bioinformatics analysis to determine the involvement of BTN2A2
   in patients with glioma, including CFs, prognosis, and functional
   analysis. We observed an increase in BTN2A2 expression in patients from
   GEO and TCGA cohorts. Furthermore, IHC analysis demonstrated an
   increase in BTN2A2 expression in glioma tissues compared to normal
   brain tissues. In addition, the OS of patients expressing high BTN2A2
   levels was poor compared to patients expressing low BTN2A2 levels. The
   GO-BP terms enriched by BTN2A2 were immunity mediated by lymphocytes,
   neutrophils, and B cells, immune responses mediated by immunoglobulin,
   the regulation of immune effector process, the activation of B cells,
   the B cell receptor signaling pathway, and the positive regulation of B
   cell activation. The GO-CC terms, including immunoglobulin complex,
   collagen-containing ECM, cytoplasmic vesicle and vacuolar lumen,
   synaptic and postsynaptic membranes, T cell receptor complex, and
   basement membrane, etc., were enriched by BTN2A2. Furthermore, the
   GO-MF terms include antigen binding functions, immunoglobulin receptor,
   cytokine, protease, and ECM binding, the cytokine, peptide receptor,
   GPCR, and neurotransmitter receptor activities were enriched by BTN2A2.
   The KEGG pathway enrichment analysis showed the enrichment of the
   chemokine, IL-17, JAK-STAT, PI3K-Akt, and HIF-1 signaling pathway, the
   interaction between ECM-receptor and phagosome. Next, we performed GSEA
   on our cohort to determine the underlying mechanisms of BTN2A2 in
   glioma. The results revealed BTN2A2 was associated with the CTLA4, MHC,
   chemokine, and JAK-STAT signaling pathway, the processing and
   presentation of antigens, PD1 blockade immunotherapy, interactions
   between immune cells and microRNAs in the TME, and apoptosis.

   Recently, immunotherapy has emerged as a new and attractive platform
   for treating patients with glioma [[127]21]. However, immunotherapy for
   treating patients with glioma in clinical settings is ineffective
   [[128]22]. Therefore, identifying a new marker as a target for
   immunotherapy for patients with glioma is the need of the hour. Hence,
   we used the ESTIMATE, ssGSEA, and CIBERSORT algorithms to determine the
   correlation between BTN2A2 and immune cells. Our results showed a high
   correlation between BTN2A2 and ICIs in patients with gliomas. In the
   late 19th century, the concept of immunotherapy was proposed, which
   refers to using an individual’s immune system to attack and destroy
   cancer cells [[129]13]. ICB therapy has revolutionized cancer treatment
   [[130]23]. A study has showed that immune checkpoint gene expression
   restricts immune surveillance in the TME [[131]24]. Studies have shown
   that antibodies against CD274, CTLA-4, and PDCD1 (immune checkpoint
   molecules) could promote antitumor T cell activity and improve clinical
   outcomes in various cancers [[132]25–[133]28]. Our results showed an
   association between BTN2A2 and CTLA-4, CD274, HAVCR2, LAG3, PDCD1LG2,
   PDCD1, and SIGLEC15 (immune checkpoint molecules) in patients with
   glioma. These results indicate that BTN2A2 could be a potential
   immunomarker for patients with glioma. Importantly, our results
   demonstrated that knockdown of BTN2A2 could significantly inhibit the
   proliferative and migratory abilities of glioma cells. Together, our
   results reveal the significance of BTN2A2 in glioma. This indicates
   that BTN2A2 could be used as a marker for predicting prognosis and
   serve as a novel therapeutic target in the future.

CONCLUSION

   In conclusion, our results showed an increase in BTN2A2 expression in
   glioma cells and tissues. Further, the prognosis of patients expressing
   high BTN2A2 levels was poor. Importantly, we showed a correlation
   between BTN2A2, progression, and ICI in patients with glioma. Together,
   our results suggest that BTN2A2 could be a therapeutic target for
   patients with glioma.

Footnotes

   AUTHOR CONTRIBUTIONS: Xi Chen designed this work and analyzed data, Xi
   Chen and Heping Wang performed a related assay, Haitao Xu collected the
   data, Lihong Yang cultured cells, Lishi Shao collated the data, Shanrui
   Pu answered the questions of reviewers, while Heping Wang, Xiaobin
   Huang and Jun Pu supervised and wrote the manuscript. All authors read
   and approved the final manuscript.

   CONFLICTS OF INTEREST: The authors declare no conflicts of interest
   related to this study.

   Ethical Statement: This study was reviewed and approved by the Ethics
   Committee of the Second Affiliated Hospital of Kunming Medical
   University (PJ-2021-208).

   FUNDING: This work was supported by the National Nature Science
   Foundation of China (82160512) and Yunnan Applied Basic Research
   Projects (2017FE467 and 2018FE001). The authors would like to thank the
   Department of Neurosurgery, the Second Affiliated Hospital of Kunming
   Medical University, Kunming, 650223, China for their support.

REFERENCES