Abstract
Background
Hepatocellular carcinoma (HCC) is one of the most common cancers
worldwide, with a high mortality and poor survival rate. Abnormal tumor
metabolism is considered a hallmark of HCC and is a potential
therapeutic target. This study aimed to identify metabolism-related
biomarkers to evaluate the prognosis of patients with HCC.
Method
The Cancer Genome Atlas (TCGA) database was used to explore
differential metabolic pathways based on high and low
epithelial-mesenchymal transition (EMT) groupings. Genes in
differential metabolic pathways were obtained for HCC
metabolism-related molecular subtype analysis. Differentially expressed
genes (DEGs) from the three subtypes were subjected to Lasso Cox
regression analysis to construct prognostic risk models. Stard5
expression in HCC patients was detected by western blot and
immunohistochemistry (IHC), and the role of Stard5 in the metastasis of
HCC was investigated by cytological experiments.
Results
Unsupervised clustering analysis based on metabolism-related genes
revealed three subtypes in HCC with differential prognosis. A risk
prognostic model was constructed based on 11 genes (STARD5, FTCD,
SCN4A, ADH4, CFHR3, CYP2C9, CCL14, GADD45G, SOX11, SCIN, and SLC2A1)
obtained by LASSO Cox regression analysis of the three subtypes of
DEGs. We validated that the model had a good predictive power. In
addition, we found that the high-risk group had a poor prognosis,
higher proportion of Tregs, and responded poorly to chemotherapy. We
also found that Stard5 expression was markedly decreased in HCC
tissues, which was associated with poor prognosis and EMT. Knockdown of
Stard5 contributed to the invasion and migration of HCC cells.
Overexpression of Stard5 inhibited EMT in HCC cells.
Conclusion
We developed a new model based on 11 metabolism-related genes, which
predicted the prognosis and response to chemotherapy or immunotherapy
for HCC. Notably, we demonstrated for the first time that Stard5 acted
as a tumor suppressor by inhibiting metastasis in HCC.
Supplementary Information
The online version contains supplementary material available at
10.1186/s12935-023-03097-0.
Keywords: HCC, EMT, Metabolic reprogramming, Prognostic model, Stard5
Introduction
Hepatocellular carcinoma (HCC) is one of the most common malignant
tumors and is the third leading cause of cancer-related deaths
worldwide [[41]1]. The 5 year survival rate is less than 12%. Most HCC
cases are at advanced stages when diagnosed [[42]2], thereby leading to
poor prognosis and posing challenge to treatment. Traditionally,
clinical staging and vascular tumor invasion are essential contributors
to clinical outcomes and may help to predict survival [[43]3]. However,
these clinicopathological risk factors are limited in terms of
prognostic evaluation and are insufficient to distinguish between
high-risk and low-risk patients. Sensitivity to adjuvant chemotherapy
is even more unpredictable. Thus, there is an urgent need to explore
novel prognosis-related genes, building a comprehensive model to
predict clinical outcomes.
Epithelial-mesenchymal transition (EMT) is a favorable feature of
malignant cells [[44]4]. Some cells lose their epithelial
characteristics and obtain a mesenchymal phenotype during the
transition, eventually leading to a loss of intercellular junctions
[[45]4]. Thus, EMT not only promotes invasion and metastasis, but also
leads to enhanced stemness of tumor cells, contributing to the
development of chemoresistance [[46]5], immunosuppression [[47]6] and
targeted therapy resistance [[48]7]. Therefore, developing new
therapeutic strategies to control EMT is essential in oncogenesis,
metastasis, and treatment. Unfortunately, reversing EMT in tumor cells
has not yet been achieved [[49]8].
Metabolic reprogramming is generally recognized to be a new hallmark of
cancer [[50]4], most notably the “Warburg effect.” In addition to
dysregulated glucose metabolism, metabolic reprogramming in tumor cells
is characterized by abnormal nucleotide metabolism, amino acid
metabolism, mitochondrial biosynthesis, and the rest of pathways
[[51]9]. The study of these metabolic reprogramming will shed light on
the molecular events of malignancy and facilitate to identify
preferable approaches for diagnosis and treatment. Recent findings
suggested that metabolic demand is altered in EMT-activated cells to
meet increased motility and aggressiveness [[52]10]. In some cases,
metabolic reprogramming can also drive EMT, and the link between the
two is reciprocal. In certain cancer types, tumors undergoing metabolic
reprogramming are correlated with worse survival [[53]11]. Metabolic
reprogramming of cancer cells has tremendous impact on immune
microenvironment [[54]12], thereby influencing the efficacy of
immunotherapy. Therefore, understanding the mechanisms of metabolic
reprogramming in different EMT states is crucial for improving patient
survival.
In this study, The Cancer Genome Atlas (TCGA)-LICH was used to analyze
differential metabolic pathways according to different EMT status
groups. Based on the unsupervised cluster analysis of the differential
metabolic pathway genes, three clusters with significant differences in
survival were obtained. Using differential expression analysis and
LASSO-Cox regression, 11 genes were selected to establish a prognostic
risk model. This prognostic model may help to optimize risk
stratification and identify appropriate therapeutic strategies for HCC
patients. Moreover, the correlation between Stard5 and EMT has been
broadly verified in vitro and in patients, which provides a target for
exploring the interaction between EMT and metabolic reprogramming.
Materials and methods
Data acquisition
The mRNA expression profiles of HCC patients and the corresponding
clinical profiles, including age, gender, grade, stage, alcohol
consumption, Hepatitis B, Hepatitis C and survival time, were
downloaded from the TCGA-LIHC database ([55]https://gdc.nci.nih.gov/)
and were detailed in Table. [56]1. Validation dataset [57]GSE14520 was
downloaded from Gene Expression Omnibus (GEO) database, and survival
information for the samples was shown in Table. [58]2.
Table 1.
The clinical characteristics of TCGA-LIHC samples
TCGA-tumor
Age
> 65 138
< = 65 229
Negative 40
Gender
MALE 248
FEMALE 119
Grade
G1 55
G2 176
G3 119
G4 12
NA 5
Stage
Stage I 171
Stage II 85
Stage III 83
Stage IV 4
[Discrepancy] 2
NA 22
Alcohol consumption
Yes 115
No 252
Hepatitis B
Yes 103
No 264
Hepatitis C
Yes 56
No 311
EMT group
EMT-H 19
EMT-L 348
Cluster
Cluster1 251
Cluster2 104
Cluster3 12
OS
Alive 237
Dead 130
[59]Open in a new tab
Table 2.
Survival information for [60]GSE14520 data set
[61]GSE14520
OS
Alive 136
Dead 85
[62]Open in a new tab
Calculation of EMT enrichment scores
A total of 145 epithelium (EPI) genes and 170 mesenchyme (MES) genes
were obtained from PMID: 25214461 [[63]13]. Based on the above gene
sets, the samples’ EPI enrichment score and MES enrichment score were
calculated by the R package GSVA (v1.34.0), and the EMT enrichment
score was subtracted from the two. Surv_cutpoint of R package survminer
(v0.4.8) was used to find the most appropriate node to differentiate
EMT-H from EMT-L groups. Survival analysis of the two groups was
performed by the R package surv (v3.2–7). Differences in clinical
characteristics between the EMT subgroups were detected using Kruskal
wallis test.
Calculation of metabolic signature enrichment scores
Enrichment scores for metabolic pathways were calculated for samples
based on metabolic pathway-related genes provided by PMID: 33917859
[[64]14]. The differences of metabolic enrichment scores between EMT
groups were analyzed using Kruskal wallis test.
Subtypes identification based on metabolic reprogramming
A subtype analysis related to metabolic reprogramming of HCC was
performed based on genes of metabolic pathways, which had significant
differences between the EMT-H and EMT-L groups. Unsupervised cluster
analysis was applied to all samples in the TCGA-LIHC dataset through
the R package ConsensusClusterPlus (v1.50.0) with the algorithm
K-means. The clusters were then analyzed for survival using R package
survival and survminer.
Functional enrichment analysis
Differentially expressed genes (DEGs) of the clusters were acquired by
the R package limma [[65]15]. A threshold of |
[MATH: log2fol
dchange<
/mi> :MATH]
|> 1 and adjusted p < 0.05, were considered for DEGs. Overlapping DEGs
from the three clusters were used for subsequent analysis. The Kyoto
Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and Gene
Ontology term (GO) analysis, which consists of biological processes
(BP), cellular component (CC), and molecular function (MF), were
performed using DEGs shared by the three clusters [[66]16].
Construction of a prognostic model
Univariate Cox regression analysis was applied to the significant DEGs,
using p < 0.01 as the threshold, in combination with the overall
survival data. DEGs were then further filtered by LASSO-Cox regression
analysis, and risk score models were constructed, a process that
resorted to the R package glmnet (v4.0–2). Lambda screening was used
for cross-validation. The model corresponding to lambda.min was used to
collect the gene expression matrix. The risk score for each sample was
calculated using the following equation:
[MATH: RScorei=∑<
/mo>j=1nexpji×βj :MATH]
. The median risk score was used to classify high-and low-risk groups.
A p-value of Kaplan–Meier survival analysis < 0.05 was considered to
indicate a significant difference between the two groups. The area
under the curve (AUC) values for the model were calculated using the
survival data and demonstrated by time-dependent receiver operating
characteristic (ROC) curves, with AUC values greater than 0.6
indicating good predictive power of the prediction model.
Immune cell infiltration and chemotherapy resistance prediction analysis
To explore the response of patients to Erlotinib, Shikonin, Metformin,
Bortezomib, Metformin, and Lapatinib, the predictive value of IC50 was
obtained using the R package pRRophetic (v 0.5) analysis. The
difference in IC50 between the high-and low-risk groups was tested
using the Wilcoxon test. R package CIBERSORT (v1.03) was used to
analyze the proportion of immune cells in all patients.
Clinical HCC patient samples and cell culture
To validate the expression levels of genes in the prognostic model, we
collected 80 tumors and adjacent normal tissues from patients with HCC.
All patients participating in this study signed an informed consent
form. This project was approved by the Human Research Ethics Committee
of Zhongshan Hospital, Fudan University (Y2021-242). Tumors and
adjacent normal tissues were then collected from patients who underwent
surgical resection of the liver. All tissues were obtained immediately
after surgical resection and frozen at − 80 °C. Huh7 cells, derived
from the Chinese Academy of Sciences, were cultured in DMEM medium
(D5796, sigma) containing 10% fetal bovine serum (16140071, Gibco) at
37 °C and 5% CO[2].
Quantitative real-time PCR analysis
Total RNA was extracted from the tumors and adjacent normal tissues and
reverse transcribed to cDNA using the Kit (EZBioscience, MN, USA).
Then, quantitative PCR amplification was operated by a CFX384 real-time
PCR machine (Bio-Rad, USA) using SYBR Green (Vazyme, China). Gene
abundances were normalized to GAPDH. The primer sequences were shown in
Table [67]3.
Table 3.
Primer sequences for Real-time PCR
Gene Primer sequences
STARD5-F CCGGGAAGGCAATGGAGTTT
STARD5-R TCATCCCACTTCACTCGTAGG
FTCD-F TCCCGACTTATCGACATGAGC
FTCD-R GCCGTACAGGTAAACTGGC
SCN4A-F TTCACAGGGATCTACACCTTTGA
SCN4A-R CACAAACTCTGTCAGGTACGC
ADH4-F AGTTCGCATTCAGATCATTGCT
ADH4-R CTGGCCCAATACTTTCCACAA
CFHR3-F TACCAATGCCAGTCCTACTATGA
CFHR3-R CCGACCACTCTCCATTACTACA
CYP2C9-F GCCTGAAACCCATAGTGGTG
CYP2C9-R GGGGCTGCTCAAAATCTTGATG
CCL14-F CCAAGCCCGGAATTGTCTTCA
CCL14-R GGGTTGGTACAGACGGAATGG
GADD45G-F CAGATCCATTTTACGCTGATCCA
GADD45G-R TCCTCGCAAAACAGGCTGAG
SOX11-F AGCAAGAAATGCGGCAAGC
SOX11-R ATCCAGAAACACGCACTTGAC
SCIN-F ATGGCTTCGGGAAAGTTTATGT
SCIN-R CATCCACCATATTGTGCTGGG
SLC2A1-F ATTGGCTCCGGTATCGTCAAC
SLC2A1-R GCTCAGATAGGACATCCAGGGTA
[68]Open in a new tab
Immunohistochemistry (IHC)
HCC and adjacent normal tissues were deparaffinized, rehydrated,
blocked for endogenous peroxidase activity, antigen repair, and
blocking, before being incubated overnight at 4 °C with primary
antibodies against Stard5(ab178688, Abcam), N-cadherin, vimentin,
E-cadherin and zo-1(9782 T, CST). The sections were then incubated with
horseradish peroxidase-conjugated secondary antibodies for 1 h at room
temperature and stained with 3, 3-diaminobenzidine tetrahydrochloride
(DAB). Finally, cells were observed under a microscope.
Construction of stable cell lines
The cDNA or shRNA (Genepharma, China) targeting Stard5 were recombined
into lentiviral vectors to overexpress or knockdown Stard5, then
transfected into 293 T cells. The mature infectious lentivirus was
collected after 72 h. Stable Stard5-overexpressing and Stard5-knockdown
Huh7 cell lines were constructed and verified by western blot.
Western blot
Cells were lysed to extract total protein and heated to 100 °C for
20 min. Protein was added onto 8–12% SDS-PAGE electrophoreses and
transferred to the PVDF membrane, then the blocked PVDF membrane was
incubated with 1:1000 diluted Stard5 (ab178688, Abcam), β-Actin
(3700 T, CST), N-cadherin, vimentin, E-cadherin and zo-1 (9782 T, CST)
antibody at 4 °C overnight. After washing with TBST, the PVDF membrane
was incubated with a 1:10000 diluted secondary antibody for 1.5 h at
room temperature. Finally, a chemiluminescence analysis was performed.
Wound healing assay
The cells were inoculated in six-well plates at 1 × 10^6 cells per well
to form a dense monolayer after 12 h. Lines were drawn with a 200 μL
tip to the cell layer to form straight cell wounds. After washing with
PBS, the cells were incubated with serum-free medium at 37 °C for 48 h.
The wound width was recorded at 0 and 48 h.
Transwell migration and invasion assays
80 μl BD Matrigel mixture (diluted 1:10 with DMEM) was pre-coated in a
transwell chamber (3513, Corning) at 37 °C overnight. Cells were
diluted with serum-free DMEM and 4 × 10^4 cells were added to the upper
chamber. Then, 500 μl of DMEM containing 30% fetal bovine serum was
added to the bottom chamber. After incubation at 37 °C for 48 h, the
chambers were fixed in 4% paraformaldehyde for 2 h. Cells in the upper
chamber were removed, then stained with crystal violet, washed with PBS
and photographed under a microscope.
Statistical analysis
R software (version 4.0.1) and GraphPad Prism (version 9.0) were used
for statistical analysis of the experimental data. Pair or unpaired
Student t-tests were used for comparison of data between two groups.
The Mann–Whitney test was used when the data did not conform to a
normal distribution. One-way analysis of variance (ANOVA) was used to
compare three or more groups. Differences between the groups were
considered statistically significant at p < 0.05.
Results
Cluster 1 has the best prognosis based on subtypes identification of
differential metabolic pathways between EMT subgroups
The study flowchart was shown in Fig. [69]1. First, we downloaded the
expression data and clinical data of LIHC from the UCSC Xena database,
removing the cases with missing survival information, and finally
included 367 cancer samples. Expression matrix, which contains 16515
protein-coding genes, was subsequently used in the analysis. Based on
the EMT score of each sample, we obtained 348 EMT-L samples and 19
EMT-H samples. Kaplan–Meier survival analysis showed that the overall
survival (OS) of the EMT-L group was significantly longer than that of
the EMT-H group (Fig. [70]2a). We then compared the clinical
characteristics between the EMT subgroups. No significant differences
in clinical characteristics were observed, possibly due to the small
sample size of EMT-H samples (Additional file [71]1: Fig. S1a). Next,
we obtained the genes of LIPID, NUCLEOTIDE, Carbohydrate, TCA, ENERGY,
VITAMIN, and AMINOACID metabolic pathways and calculated the pathway
enrichment scores for each sample. We found that LIPID, ENERGY,
Carbohydrate, VITAMIN, and AMINOACID levels were significantly
different between the EMT subgroups (Fig. [72]2b). It is implied that
metabolic reprogramming occurred when tumors underwent EMT. The shared
signature genes in the different metabolic pathways were also shown,
with LIPID and VITAMIN sharing the most signature genes [[73]26]
(Additional file [74]1: Fig. S1b). Then, unsupervised cluster analysis
based on the genes contained in these five metabolic pathways was
performed (Fig. [75]2c). The most appropriate number of cluster was
three (Fig. [76]2d, e). The Kaplan–Meier curves showed significant
differences in survival among the three subtypes (Fig. [77]2f). Heat
maps showed that enrichment scores for three critical metabolic
pathways were also different among the three subtypes (Fig. [78]2h). We
further investigated the differences in age, gender, grade, stage,
alcohol consumption, Hepatitis B, Hepatitis C, and EMT subgroups among
the three clusters, and found that the grade, stage, and EMT groups
differed significantly (Fig. [79]2i).
Fig. 1.
[80]Fig. 1
[81]Open in a new tab
Flowchart illustrating the process of establishing a prognostic model
for HCC in this study
Fig. 2.
[82]Fig. 2
[83]Open in a new tab
Subtype identification based on differential metabolic pathways between
EMT subgroups. a. KM curves for EMT subgroup. b. Heat map of enrichment
scores for seven metabolic pathways. c. Heat map of unsupervised
cluster analysis of patients. d. Cumulative distribution profile. e.
Unsupervised cluster fragmentation. f. KM curves for survival analysis
of each subtype. g. PCA results based on different subtypes. h. Heat
map of enrichment scores for differential metabolic pathways. i.
Distribution of three subtypes in subgroups with different clinical
characteristics. * p < 0.05, ** p < 0.01, and *** p < 0.001
Functional enrichment analysis
We retrieved the DEGs among clusters, including 1739 DEGs between
cluster1 and cluster2, 4779 DGEs between cluster1 and cluster3, 2519
DEGs between cluster2 and cluster3, and finally obtained 638 DEGs after
intersection of the three clusters (Additional file [84]2: Fig. S2a).
Functional enrichment analysis was then performed on the 638 DEGs. The
pathways enriched by KEGG and BP were mainly focused on metabolic
pathways related to catabolic or biosynthetic process (Fig. [85]3a, b).
The pathways enriched for CC mainly focused on cell adhesion, such as
collagen-containing extracellular matrix, apical part of cell, etc.
(Fig. [86]3c). The pathways enriched for MF mainly involved
metabolism-related enzyme activity (Fig. [87]3d).
Fig. 3.
[88]Fig. 3
[89]Open in a new tab
Functional enrichment analysis of differentially expressed genes
(DEGs). a KEGG pathway enrichment analysis results, showing only the
first 20 pathways. b–d GO enrichment analysis results, showing only the
first 20 terms. (b) molecular function, (c) biological process and (d)
cellular components
Development and estimation of the prognostic model consist with eleven
metabolism‑related genes
We identified 150 genes that were significantly associated with overall
survival (P < 0.01) by univariate Cox regression analysis from 638 DEGs
(Additional file [90]3: Fig S3a), and top six genes showed the
Kaplan–Meier curve (Additional file [91]3: Fig. S3b). Eleven genes were
then selected as active covariates to evaluate the patients’ risk score
using the Lasso Cox regression algorithm (Fig. [92]4a–c). The risk
score was calculated using the following formula: risk score
[MATH:
=STARD5
×(-0.0699)+FTCD×(-0.0335)+SCN4A×(-0.0281)+ADH4×(-0.0134)+CFHR3×(-0.0050)+CYP2C9×(-0.0043)+CCL14
mn>×(-0.0016)+GADD45G×(-0.0013)+SOX11
mn>×0.0151+SCIN×0.0231+SLC2A1×0.0723 :MATH]
. The above equation shows that high levels of STARD5, FTCD, SCN4A,
ADH4, CFHR3, CYP2C9, CCL14, and GADD45G were prognosis-protective
factors associated with low risk. However, high expression of SOX11,
SCIN, and SLC2A1 was associated with high risk. We divided the sample
into high (n = 183) and low-risk groups (n = 184) using the median risk
score as the cut-off point, and the expression of 11 genes was shown in
the heat map (Fig. [93]4d). Kaplan–Meier curve showed that the
high-risk group had a lower survival rate than low-risk group
(Fig. [94]4e, g, h) (p < 0.0001). The prognostic model area under the
curve (AUC) values of the time-dependent ROC curve were 0.77, 0.71, and
0.69 for 1 year, 3 year, and 5 year survival, respectively, which
demonstrated that the multi-gene signature had better prognostic
performance in predicting patient outcomes (Fig. [95]4f). Next, we
performed risk stratification of patients according to their clinical
characteristics. The results showed significant differences in risk
scores between grade, stage, and EMT subgroups (Fig. [96]4i), which
supported the accuracy of our risk model. Additionally, compared to the
low-risk group, the number of plasma cells, Tregs, and macrophages M0
was significantly higher, while T cells CD4 + memory resting, NK cells
activated, monocytes, mast cells resting were significantly lower
(Fig. [97]4j). We also analyzed response to the drugs Erlotinib,
Shikonin, Metformin, Bortezomib, Metformin, and Lapatinib, and found
that the high-risk group was more likely to show resistance to the
drugs (Fig. [98]4k). Hence, our risk model might be useful in
predicting the response to immunotherapy and chemotherapy in patients
with HCC.
Fig. 4.
[99]Fig. 4
[100]Open in a new tab
Eleven-genes-based prognostic model construction. a Lasso-Cox
regression coefficient selection and variable screening. b
Cross-validation in the LASSO-Cox regression model to select the tuning
parameter. c. Display of regression coefficients corresponding to
filtered variables. d. Heat maps of gene expression in prediction
models. e. Validation of KM curves for models. f. Validation of ROC
curves. g. Distribution of risk scores for all samples. h. Scatter
plots of survival time for all patients. i. Correlation of risk scores
with various clinical characteristics. j. Analysis of the difference in
the proportion of immune-infiltrating cells between high- and low-risk
groups. k Prediction of chemotherapy resistance in patients from high
and low-risk groups. * p < 0.05, ** p < 0.01, and *** p < 0.001
External prognostic and diagnostic validation of the eleven-genes-based
prognostic model
We downloaded the [101]GSE14520 dataset as a validation set, from which
221 samples with survival data were extracted. Risk scores were
calculated according to the model of each patient. The expression of
some genes in the prognostic model was shown in the heat map
(Fig. [102]5a). Kaplan–Meier survival analysis showed that the
high-risk group had poorer OS rate than low-risk group (p = 0.0035)
(Fig. [103]5b, d, e). The prognostic model AUC values of the
time-dependent ROC curve were 0.66, 0.68, and 0.67 for 1 year, 3 ear,
and 5 year survival, respectively, indicating good predictive power of
the prediction model (Fig. [104]5c). In addition, we also used the
LIRI-JP database from ICGC data portal as a validation set, which also
validated the stability of the model (Additional file [105]4: Fig.
S4a–e).
Fig. 5.
[106]Fig. 5
[107]Open in a new tab
External validation of the efficacy for the risk model using
[108]GSE14520. a. Heat maps of gene expression in prediction models. b.
Validation of KM curves for models. c. Validation of ROC curves. d.
Distribution of risk scores for all samples. e. Scatter plots of
survival times for all patients
Validation of expression level of eleven genes in HCC tissues
To validate whether the expression of the 11 genes in HCC tissues was
consistent with our model, we determined their expression in tumors and
adjacent normal tissues of 28 HCC patients by qRT-PCR. The results
suggested that the mRNA levels of STARD5, FTCD, SCN4A, ADH4, CFHR3,
CYP2C9, CCL14, and GADD45G were downregulated (Fig. [109]6a–h), and
SOX11, SCIN, and SLC2A1 were overexpressed in HCC tissues
(Fig. [110]6i–k). Furthermore, the representative protein expression of
nine genes in HCC and normal liver tissues was retrieved from the Human
Protein Atlas ([111]https://www.proteinatlas.org), of which two genes
were not found. Consistent with the qRT-PCR results, the protein level
of STARD5, FTCD, ADH4, CYP2C9, CCL14, and GADD45G were low in HCC
tissues (Additional file [112]5: Fig. S5a–f). SOX11, SCIN, and SLC2A1
were overexpressed in HCC tissues (Additional file [113]5: Fig. S5g–i).
Fig. 6.
[114]Fig. 6
[115]Open in a new tab
The qRT-PCR results of 11genes. a–h. STARD5, FTCD, SCN4A, ADH4, CFHR3,
CYP2C9, CCL14, and GADD45G were weakly expressed in HCC tissues. i–k.
SOX11, SCIN, and SLC2A1 were upregulated in HCC tissues. N adjacent
normal tissue, T tumor tissue
Stard5 down-regulation is associated with poor prognosis of HCC
Currently few studies are available on Stard5 in cancer, with one paper
showing that hypermethylation of the STARD5 in clear cell renal cell
carcinoma is significantly associated with poor prognosis [[116]17].
Our prognostic model indicated that Stard5 deficiency in HCC was
associated with poor prognosis, and we observed that STARD5 mRNA was
markedly decreased in 82% (23/28) of HCC tumors compared to the
corresponding adjacent normal liver tissue (Fig. [117]6a). Western blot
analysis of six randomly selected pairs of HCC samples showed that
Stard5 expression was significantly reduced in tumors (Fig. [118]7a).
Furthermore, in 80 HCC patients, Stard5 expression was scored as
moderately positive in 25%, while 36.25% were strongly positive,
compared to 28.75% moderately positive and 52.5% strongly positive in
adjacent normal liver tissue (Fig. [119]7b, c). Next, patients were
divided into low (negative and weakly positive) and high (moderately
and strongly positive) expression groups based on Stard5 expression in
the tumor tissue. Kaplan–Meier survival analysis showed that low Stard5
expression was associated with significantly poorer TTR (Fig. [120]7d)
and shorter OS (Fig. [121]7e) than high Stard5 expression. Together,
these data suggest that reduced Stard5 expression in tumor tissues may
be an important indicator of poor prognosis in HCC.
Fig. 7.
[122]Fig. 7
[123]Open in a new tab
Stard5 downregulation is associated with poor prognosis of HCC. a. Six
pairs of tumor and para-tumor tissues were randomly selected for
western blot analysis (left panel). The relative intensity of Stard5
protein was normalized to β-actin (right panel). b, c. Representative
IHC image percentage of Stard5 expression in HCC tumor (T) and
para-tumor tissues (N). Scale bar, 500 μm or 125 μm. d, e Time to
recurrence and overall survival of HCC patients in the high and low
group were estimated using the Kaplan–Meier method. * p < 0.05
Stard5 deficiency promotes EMT and metastasis in HCC
Stard5 was derived from our EMT-related prognostic model, so we first
examined the impact of Stard5 on EMT. Western blot analysis showed that
knockdown of Stard5 increased the expression of mesenchymal markers
(N-cadherin and Vimentin) and decreased the expression of epithelial
markers (E-cadherin and zo-1) in Huh 7 cells (Fig. [124]8a). EMT is an
important step before cell invasion and migration, and we subsequently
explored the role of stard5 in the invasion and migration of Huh 7
cells. In the wound-healing and transwell assays, the migration and
invasion abilities decreased in shSTARD5 cell line (Fig. [125]8b–d).
Furthermore, overexpression of Stard5 in Huh 7 cells decreased the
levels of Vimentin and N-cadherin and increased those of E-cadherin and
zo-1 (Fig. [126]9a). Upregulation of Stard5 inhibited cell invasion and
migration (Fig. [127]9b–d). We then detected N-cadherin, Vimentin,
E-cadherin, zo-1 as well as Stard5 protein in 15 human HCC samples.
Stard5 expression was scored and classified into stard5 low- and high-
expression groups according to the median. The expression of
mesenchymal markers (N-cadherin and Vimentin) was negatively associated
with Stard5 expression, while epithelial markers (E-cadherin and zo-1)
were positively associated with Stard5 expression (Fig. [128]10a).
These data suggest that Stard5 deficiency induces EMT, resulting in HCC
metastasis.
Fig. 8.
[129]Fig. 8
[130]Open in a new tab
Knockdown of Stard5 promotes migration and invasion of HCC cells. a.
Representative image of western blot showing the effect of stard5
downregulation on the EMT pathway. b–d. Wound-healing and transwell
assays were used to determine the migration (b, c) and invasion (d)
abilities of the referred HCC stable cells. Scale bar, 50 μm.
Quantification of the relative area or relative number of cells (b-d,
right panel) was performed by ImageJ. **p < 0.01, ***p < 0.001
Fig. 9.
[131]Fig. 9
[132]Open in a new tab
Stard5 overexpression inhibits migration and invasion of HCC cells. a.
Representative image of western blot showing the effect of stard5
overexpression on the EMT pathway. b–d. Wound-healing and transwell
assays were used to determine the migration (b, c) and invasion (d)
abilities of the referred HCC stable cells. Scale bar, 50 μm.
Quantification of the relative area or relative number of cells (b–d,
right panel) was performed by ImageJ. ***p < 0.001
Fig. 10.
[133]Fig. 10
[134]Open in a new tab
The correlation between Stard5 and EMT in HCC tissues. (a)
Representative IHC images of Stard5, N-cadherin, Vimentin, E-cadherin
and zo-1 expression in HCC patient paraffin section. Pearson’s
correlation of IHC score was calculated in 15 HCC tissues
Discussion
In our study, we constructed a risk model selected from multiple
metabolic pathways based on differences between the high and low EMT
groups in HCC, which contained 11 metabolism-related genes. The
high-risk group had poorer prognosis than the low-risk group. The
high-risk group was positively associated with Tregs and negatively
associated with CD4 + T cells, NK cells. In addition, the high-risk
group was more likely to develop drug resistance. These revealed that
our model might support the prediction of patients’ response to
chemotherapy and immunotherapy and provide a reference for
individualized therapy for patients with HCC. More importantly, we
demonstrated for the first time that Stard5 expression was positively
correlated with survival time of HCC patients and negatively correlated
with EMT, providing a precise therapeutic target.
EMT is a key cellular process that transforms polarized epithelial
cells into a mesenchymal phenotype with increased cell motility. In
cancer, EMT allows malignant cells to separate from the primary tumor
and spread into the circulation, a critical process for invasion and
metastasis [[135]18]. Altogether, EMT is an inevitable state that
occurs prior to invasion and metastasis and could be used for
predicting cancer progression and prognosis. Therefore, it is logical
to group patients according to their EMT enrichment scores, which may
eliminate the impact of many confounders on prognosis.
We can reasonably speculate that the energy requirements of a cell
switching between motion and resting states must be altered, ultimately
leading to metabolic reprogramming. In fact, recent evidence suggests
that the link between EMT and metabolism is reciprocal, and that
altered metabolism can drive EMT in some cases. Multiple metabolic
pathways, involving in glucose metabolism, lipid metabolism, amino
acids metabolism, mitochondrial biosynthesis, and many other events,
are simultaneously altered in tumor progression and metastasis
[[136]14]. Currently prognostic models of HCC are mostly constructed
from mono-metabolic part, rather than multiple metabolic parts. In
contrast, we screened and constructed risk model by comparing metabolic
pathways of carbohydrates, LIPID, NUCLEOTIDE, TCA, ENERG, VITAMIN, and
AMINOACID between EMT subgroups. It will be more reliable in predicting
prognosis, in view of its closer proximity to the molecular biological
level of cancer cells prior to invasion. In our study, there were
differences in metabolism between the EMT groups, most notably in terms
of energy and lipids. We classified patients with HCC into three
molecular subtypes based on genes of differential metabolic pathways.
Prognostic differences existed among these three subtypes, and cluster
1 had the best prognosis. The KEGG analysis showed a major focus on
cell polarity, extracellular matrix, and lipid metabolic pathways.
Thus, targeting specific metabolic enzymes has the potential to reverse
EMT and ultimately limit cancer metastasis.
In recent years, molecular prognostic markers have received increasing
attention for predicting the survival of HCC [[137]19, [138]20].
Compared to single gene marker, multi-gene models have the advantage of
higher predictive accuracy and more individualized results. Based on
the DEGs among 3 clusters, a prognostic risk model including 11 genes
(STARD5, FTCD, SCN4A, ADH4, CFHR3, CYP2C9, CCL14, GADD45G, SOX11, SCIN,
and SLC2A1) was developed using univariate Cox and LASSO-Cox
regression. External databases validated this risk model as valid and
stable in predicting the prognosis of patients with HCC. SLC2A1, also
named GLUT1, have been widely confirmed overexpressing in HCC and
promoting metastasis [[139]21]. SOX11 was also significantly
upregulated in HCC [[140]22]. FTCD, ADH4, CFHR3, CYP2C9, CCL14, GADD45G
was down-regulated in HCC [[141]23–[142]28]. These papers supported the
high accuracy of our prognostic model. Among them, FTCD and CFHR3 have
been reported to play a suppressive role in the invasion and migration
of HCC [[143]23, [144]29]. No studies have shown a link between the
remaining molecules and EMT in HCC. In addition, there are no reports
on the expression of SCN4A or SCIN in HCC. We demonstrate for the first
time that they were risk factors for HCC and were associated with EMT,
which contributes to a better understanding of the molecular mechanisms
of HCC progression. These molecules may be crucial triggers in
controlling HCC metastasis.
Then, tumor microenvironment of patients was analyzed in the two
groups. High risk group tended to be more immunosuppressed, with higher
Tregs, and fewer CD8 + T, CD4 + T, and NK cells. In addition, patients
in the high-risk group were more resistant to chemotherapy. These
results imply that the risk model can help predict the effectiveness of
immunotherapy and chemotherapy. Targeting these metabolic genes may
improve the response of patients to treatment and provide new ideas for
personalized medicine.
Stard5 became the focus of our attention, which had hardly been studied
in cancers. Stard5, a lipid-binding protein, has a conserved
steroidogenic acute regulatory protein-related lipid transfer domain
[[145]30]. It is involved in the regulation of cholesterol homeostasis
in vivo by binding and transporting cholesterol and other
sterol-derived molecules to the liver [[146]31]. In hepatocytes, Stard5
reduces lipid accumulation, suggesting that Stard5 dysregulation may
play an important role in fatty liver disease [[147]31]. Mutations in
the STARD gene may lead to autoimmune diseases or cancer [[148]32].
Additionally, Mulford et al. showed that knockdown of Stard5 expression
resulted in reduced sensitivity of lung cancer cells to etoposide
[[149]33]. In the present study, we demonstrated for the first time
that Stard5 was down regulated in HCC tissue, and low Stard5 expression
suggested poor prognosis. Stard5 deficiency contributed to the invasion
and migration in HCC cell lines, while overexpression of Stard5 showed
the opposite effect. The protein expression of EMT pathway was
associated with Stard5 expression. These data suggest that Stard5 was a
protective factor in patients with HCC.
Studies have found that endoplasmic reticulum (ER) stress increases
Stard5 expression in mouse hepatocytes, and that Stard5 plays a key
role in ER cholesterol homeostasis during ER stress [[150]31].
When tumor cells experience ER stress in response to intrinsic and
extrinsic changes, a network of adaptive signals, known as the unfolded
protein response (UPR), will be evoked to restore protein homeostasis.
UPR hyperactivation has been demonstrated to regulate cell survival,
angiogenesis, inflammation, invasion, and metastasis [[151]34]. Tumors
exploit UPR signaling to promote EMT [[152]35]. Therefore, we speculate
that when ER stress occurs, Stard5 may transport excess cholesterol
from the ER to the Golgi and then to the efflux pathway during the UPR,
preventing excessive cholesterol accumulation in the ER, restoring ER
homeostasis, and promoting apoptosis. When stard5 deficiency, ER stress
induces cholesterol imbalance, the UPR may be hyperactive and unfolded
proteins activate ER-resident sensors, which in turn promotes the EMT.
However, it remains to be experimentally verified. Targeting stard5
directly during EMT with concomitant metabolic reprogramming may offer
a prospective direction for targeting therapy.
Some limitations remain in our study, the function of stard5 in
inhibiting EMT still needs to be further explored. The role of the
other 10 genes in HCC remains to be studied in vitro and in vivo.
Furthermore, normal tissues require the same metabolic pathways for
their survival and proliferation. This implies that targeting tumor
metabolism faces a series of challenges.
Conclusions
In conclusion, we constructed a multigene prognostic model associated
with EMT and metabolic reprogramming that can effectively predict the
prognosis of HCC patients and determine whether patients will be able
to respond to chemotherapy or immunotherapy. For the first time, we
show that Stard5 can act as a tumor suppressor to inhibit EMT as well
as tumor progression. Our findings provide a reference for studying the
interaction between EMT and metabolic reprogramming and inhibiting
tumor metastasis through therapeutic approaches targeting key metabolic
molecules. This provides the basis for the development of precision
medicine for targeted metabolism in the treatment of aggressive tumors.
Supplementary Information
[153]12935_2023_3097_MOESM1_ESM.pdf^ (143.3KB, pdf)
Additional file 1: Figure S1. Clinical characteristics and common
signature gene analysis of metabolic pathways. (a). Heat map of the
distribution of clinical characteristics in EMT subgroups. (b). Upset
map of genes shared by metabolic pathways.
[154]12935_2023_3097_MOESM2_ESM.pdf^ (1.1MB, pdf)
Additional file 2: Figure S2. (a) Heat map of differentially expressed
genes by subtype.
[155]12935_2023_3097_MOESM3_ESM.pdf^ (819.6KB, pdf)
Additional file 3: Figure S3. Cox regression analysis of 638 DEGs. (a).
Forest plots for bulk univariate cox regression analysis, showing only
the top 20 genes. (b). KM curves for bulk univariate cox regression
analysis, showing only the top 6 genes.
[156]12935_2023_3097_MOESM4_ESM.ai^ (1.4MB, ai)
Additional file 4: Figure S4. External validation of the efficacy for
the risk model using LIRI-JP database. (a). Heat maps of gene
expression in prediction models. (b). Validation of KM curves for
models. (c). Validation of ROC curves. (d). Distribution of risk scores
for all samples. (e). Scatter plots of survival times for all patients.
[157]12935_2023_3097_MOESM5_ESM.pdf^ (3.2MB, pdf)
Additional file 5: Figure S5. Immunohistochemical staining of genes in
risk model. (a-f) STARD5, FTCD, ADH4, CYP2C9, CCL14, and GADD45G
were expressed at low levels in HCC tissues. (g-i) SOX11, SCIN, and
SLC2A1 were upregulated in HCC tissues.
Acknowledgements