Abstract

   Biomaterials encounter considerable challenges in extensive bone defect
   regeneration. The amelioration of outcomes may be attainable through
   the orchestrated modulation of both innate and adaptive immunity.
   Silicon‐hydroxyapatite, for instance, which solely focuses on
   regulating innate immunity, is inadequate for long‐term bone
   regeneration. Herein, extra manganese (Mn)‐doping is utilized for
   enhancing the osteogenic ability by mediating adaptive immunity.
   Intriguingly, Mn‐doping engenders heightened recruitment of CD4^+ T
   cells to the bone defect site, concurrently manifesting escalated T
   helper (Th) 2 polarization and an abatement in Th1 cell polarization.
   This consequential immune milieu yields a collaborative elevation of
   interleukin 4, secreted by Th2 cells, coupled with attenuated
   interferon gamma, secreted by Th1 cells. This orchestrated interplay
   distinctly fosters the osteogenesis of bone marrow stromal cells and
   effectuates consequential regeneration of the mandibular bone defect.
   The modulatory mechanism of Th1/Th2 balance lies primarily in the
   indispensable role of manganese superoxide dismutase (MnSOD) and the
   phosphorylation of adenosine 5′‐monophosphate‐activated protein kinase
   (AMPK). In conclusion, this study highlights the transformative
   potential of Mn‐doping in amplifying the osteogenic efficacy of
   silicon‐hydroxyapatite nanowires by regulating T cell‐mediated adaptive
   immunity via the MnSOD/AMPK pathway, thereby creating an
   anti‐inflammatory milieu favorable for bone regeneration.

   Keywords: bone regeneration, hydroxyapatite nanowires, manganese,
   manganese superoxide dismutase, silicon, T lymphocytes
     __________________________________________________________________

   In the context of bone healing, the introduction of manganese‐doped
   silicon‐hydroxyapatite nanowires (Mn‐SiHANWs) induces T helper (Th) 2
   cells while concurrently inhibiting Th1 cell polarization.
   Mechanistically, the presence of Mn‐SiHANWs activates manganese
   superoxide dismutase (MnSOD) and leads to the phosphorylation of
   adenosine 5′‐monophosphate‐activated protein kinase (AMPK). This
   anti‐inflammatory environment, characterized by elevated interleukin
   (IL)‐4 and decreased interferon gamma (IFN‐γ), ultimately promotes bone
   marrow stromal cell (BMSC) osteogenesis.

   graphic file with name ADVS-11-2305890-g007.jpg

1. Introduction

   Bone defect regeneration is crucial for restoring craniofacial function
   and aesthetics.^[ [48]^1 ^] Clinical evidence underscores that natural
   healing of large bone defects is limited to 10% of the defect area,
   necessitating recourse to autologous bone grafting or biomaterial
   implantation.^[ [49]^2 ^] While traditional biomaterials, such as
   calcium phosphate bioceramics, are widely used in bone repair due to
   their excellent biocompatibility, their limited bioactivity remains
   constrained in meeting the demand for mass bone osteogenesis and
   functional reconstruction.^[ [50]^3 ^] The paradigm of
   “osteoimmunology,” as introduced by Arron and Choi in 2000, introduces
   novel strategies for orchestrating osteogenesis and, consequently,
   effective bone regeneration.^[ [51]^4 ^] In this evolving landscape,
   biomaterials embrace a new role as pivotal regulators of
   osteoimmunology in bone healing, ushering forth intrinsic inflammatory
   responses upon implantation.^[ [52]^5 ^] The cascade of local
   inflammation commences with the recruitment of neutrophils, monocytes,
   and macrophages—the vanguards of innate immunity—succeeded by a
   protracted lymphocyte infiltration, namely T and B cells, emblematic of
   adaptive immunity.^[ [53]^6 ^] Our previously established (T cell
   receptor β chain‐deficient) Tcrβ ^−/− transgenic mouse model confirmed
   that T cell immunodeficiency inhibited bone repair, which provided
   compelling evidence that T cells are critical for bone regeneration.^[
   [54]^6 ^] Despite prevailing biomaterial interventions predilection for
   innate immune system modulation, their influence remains confined
   therein which compels the exploration of avenues to extend their
   purview to the adaptive immune domain. We have previously undertaken
   silicon (Si) doping to enhance angiogenesis and osteogenesis within
   nanosized hydroxyapatite.^[ [55]^7 ^] Notably, Si, during the early
   inflammatory phase post‐implantation, exhibits immunoregulatory
   properties that inhibit macrophage‐mediated pro‐inflammatory
   responses^[ [56]^8 ^] while activating monocytes.^[ [57]^9 ^] In
   addressing the exigency for substantial bone regeneration, we postulate
   that the immunoregulatory and osteogenic effects of Si‐hydroxyapatite
   could be enhanced through the infusion of novel elements capable of
   finely regulating T cell dynamics during bone healing.

   The intrinsic modulation of infiltrating T cells assumes a pivotal role
   in both pro‐ and anti‐inflammatory tenets through polarization into
   distinct subsets. The secretion of interferon gamma (IFN‐γ),
   interleukin (IL)−12, and tumor necrosis factor (TNF)‐α secreted by T
   helper (Th) 1 cells orchestrates macrophage‐mediated infection
   resistance, osteoclastogenesis induction, and fibrogenesis promotion.^[
   [58]^10 ^] Conversely, Th2 cells secrete IL‐4, IL‐10, and IL‐13, which
   prevent bone destruction and promote bone healing.^[ [59]^11 ^]
   Therefore, creating an immune microenvironment that eliminates Th1
   while promoting Th2 polarization at the site of the defect may block
   the pro‐inflammatory reaction and promote osteogenesis.^[ [60]^10 ,
   [61]^11 , [62]^12 ^]

   The equilibrium of Th1/Th2 dynamics is subject to the sway of
   multifaceted determinants.^[ [63]^13 ^] Peptide dosage, T cell receptor
   (TCR) affinity,^[ [64]^14 ^] energy metabolism (e.g., oxidative
   phosphorylation [OXPHOS], glycolysis, and fatty acid metabolism),^[
   [65]^15 ^] as well as lysosomal functionality, constitute a subset of
   these influential factors. OXPHOS exerted a negative regulatory effect
   on Th1‐related functions, while the inhibition of Th2 responses in an
   allergic asthma model is observed as a result of abnormalities in
   OXPHOS.^[ [66]^16 ^] The metabolic processes of glutamine and
   glycolysis have been found to facilitate the synthesis of IFN‐γ by Th1
   cells.^[ [67]^17 ^] The augmentation of Th2 cell responses is
   facilitated by the accumulation of adenosine triphosphate (ATP) and the
   process of fatty acid oxidation.^[ [68]^18 ^] Manganese superoxide
   dismutase (MnSOD), stationed within mitochondria, assumes a cardinal
   role in energy metabolism. Previous studies have reported that MnSOD
   deficiency leads to defective T cell development and apoptosis.^[
   [69]^19 ^] MnSOD decreases hyperoxia‐induced IL‐8 production, curbing
   hyperoxic lung injury. Additionally, it curtails lung inflammation by
   hampering the secretion of pro‐inflammatory cytokines, including TNF‐α,
   IL‐1β, and IL‐6, while concurrently promoting the secretion of the
   anti‐inflammatory cytokine IL‐10.^[ [70]^20 ^] It is reasonable to
   assume that MnSOD serves as a potential mediator of Th1/Th2 balance
   within the purview of energy metabolic regulation.

   As a trajectory to establish a MnSOD‐mediated anti‐inflammatory
   environment, we intended to introduce manganese (Mn) to the
   regenerative milieu. The Mn ion operates within the enzyme active
   center, thereby exerting control over the enzymatic activity of
   MnSOD.^[ [71]^21 ^] The integration of Mn ions into Si‐hydroxyapatite
   nanowires emerges as a proposition to magnify their immunoregulatory
   and osteogenic effects for mass bone regeneration. This undertaking,
   however, hinges upon the strategic manipulation of T
   lymphocyte‐mediated adaptive immunity via Mn‐doping. In this study,
   animal models and cell cultures collectively indicated that Mn‐doping
   environments stimulate a shift from Th1 to Th2 polarization. Then, a
   series of experiments were conducted to explain how this biological
   process promotes osteogenesis. The underlying mechanism by which
   Mn‐doping manipulates T lymphocyte polarization has been unraveled,
   thereby enriching our understanding of the importance of Mn in adaptive
   immunity and simultaneously charting the theoretical terrain for
   harnessing T lymphocyte polarization in bone regeneration. Clinically,
   this study may provide insights concerning the incorporation of Mn in
   traditional biomaterials for extensive immunoregulation in mass bone
   defects.

2. Results and Discussions

2.1. Characteristics and Biological Effects of Manganese‐Doped
Silicon‐Hydroxyapatite Nanowires

   Herein, manganese has been successfully doped into
   silicon‐hydroxyapatite nanowires (Mn‐SiHANWs), which is supposed to
   expand the immunomodulatory effect of silicon‐hydroxyapatite nanowires
   (SiHANWs) from macrophage‐mediated innate immunity to T cell‐mediated
   adaptive immunity (Figure [72] 1A). Different Mn/(Calcium (Ca)+Mn) mole
   ratios (0.05 and 0.1) of Mn‐SiHANWs (5% Mn‐SiHANWs and 10% Mn‐SiHANWs)
   were synthesized by hydrothermal reaction. Synchronously, SiHANWs were
   fabricated as a control. Scanning electron microscope (SEM) and
   transmission electron microscope (TEM) micrographs uniformly presented
   short‐wire–like morphologies (Figure [73]1B,C). The mean diameter
   ≈15 nm (Figure [74]1D and Table [75]S1, Supporting Information)
   (SiHANWs, 14.35 ± 2.92 nm; 5% Mn‐SiHANWs, 19.34 ± 3.95 nm; 10%
   Mn‐SiHANWs, 13.98 ± 3.75 nm) resonates with hydroxyapatite nanocrystals
   encountered within bone tissue.^[ [76]^22 ^] The lengths range from
   50.33 to 449.44 nm (Figure [77]1D and Table [78]S1, Supporting
   Information) (Mn‐SiHANWs, 50.33 to 212.52 nm; 5% Mn‐SiHANWs, 52.57 to
   449.44 nm; 10% Mn‐SiHANWs, 67.14 to 204.16 nm).

Figure 1.

   Figure 1
   [79]Open in a new tab

   Schematic representation and characteristics of silicon‐hydroxyapatite
   nanowire (SiHANW), 5% manganese‐doped silicon‐hydroxyapatite nanowire
   (Mn‐SiHANW), and 10% Mn‐SiHANW. A) An Illustrative diagram depicting
   the designation and function of silicon‐hydroxyapatite nanowires doped
   with or without manganese. B) Scanning electron microscope (SEM). C)
   Transmission electron microscope (TEM). D) Key parameters of SiHANW, 5%
   Mn‐SiHANW, and 10% Mn‐SiHANW. E) Scanning electron microscopy‐energy
   dispersive spectroscopy (SEM‐EDS) quantification of manganese
   (Mn)/(Calcium (Ca)+Mn) mole ratios. F) Elemental mapping of Ca, Mn, and
   silicon (Si). G) Inductively coupled plasma optical emission
   spectroscopy (ICP‐OES) assessment of Mn/(Ca+Mn) molar ratios. H) Pondus
   hydrogenii (pH) measurements in phosphate‐buffered saline (PBS)
   supplemented with SiHANW, 5% Mn‐SiHANW, and 10% Mn‐SiHANW. I) X‐ray
   diffraction (XRD) patterns. J) Fourier transform infrared spectroscopy
   (FTIR) spectra of SiHANW, 5% Mn‐SiHANW, and 10% Mn‐SiHANW.

   The Mn/(Ca+Mn) mole ratios were 0.067 ± 0.002 and 0.101 ± 0.009, tested
   and calculated by scanning electron microscopy‐energy dispersive
   spectroscopy (SEM‐EDS) (Figure [80]1E and Table [81]S2, Supporting
   Information). According to the elemental mapping, Mn disperses in 5%
   Mn‐SiHANWs and 10% Mn‐SiHANWs, whereas Si is homogeneously distributed
   in all groups (Figure [82]1F).

   The supernatants of 5% Mn‐SiHANWs or 10% Mn‐SiHANWs dissolved in
   phosphate‐buffered saline (PBS) over durations of 1, 3, 7, 14, 21, and
   28 days have been assessed through inductively coupled plasma optical
   emission spectroscopy (ICP‐OES). The calculated Mn/(Ca+Mn) ratios rose
   from 0.005 to 0.022 and from 0.017 to 0.033 for 5% Mn‐SiHANWs and 10%
   Mn‐SiHANWs, respectively (Figure [83]1G and Table [84]S3, Supporting
   Information). Concomitantly, pondus hydrogenii (pH) values ranged from
   7.11 to 7.59 (Figure [85]1H). Subsequent X‐ray diffraction (XRD)
   profiles meticulously align with hydroxyapatite crystal structures of
   SiHANWs, 5% Mn‐SiHANWs, and 10% Mn‐SiHANWs, validating their structural
   congruence (Figure [86]1I, JCPDS card No. 09–0432). Fourier transform
   infrared spectroscopy (FTIR) spectra were identified according to the
   parameters of hydroxyapatite. Noteworthy peaks at 563.66, 964, and
   1032.01 cm^−1 demonstrate the presence of PO[4] ^3−. Characteristic
   peaks at 3445.69 cm^−1 resonate with the OH group (Figure [87]1J).

   The strategic determination of an optimal ion‐doped biomaterial
   concentration assumes pivotal significance to preclude undesirable side
   effects caused by overdosage while maintaining osteogenic efficacy.^[
   [88]^23 ^] In pursuit of this, the concentrations from 0 to 100 µg
   mL^−1 of SiHANWs, 5% Mn‐SiHANWs, and 10% Mn‐SiHANWs were analyzed.
   According to the immunostainings, bone marrow stromal cells (BMSCs)
   retained normal morphologies after co‐culturing with 0.1 and 1 µg mL^−1
   suspending liquid of SiHANWs, 5% Mn‐SiHANWs, and 10% Mn‐SiHANWs
   (Figure [89]S1A, Supporting Information). Corresponding cell counting
   kit‐8 (CCK‐8) assays supported these findings and depicted mild
   toxicity in 10 and 100 µg mL^−1 suspending liquid, especially for 10%
   Mn‐SiHANWs (Figure [90]S1A, Supporting Information). Further
   substantiation is presented through safranin‐O staining, elucidating
   the mineralization induced by 1 µg mL^−1 SiHANWs, 5% Mn‐SiHANWs, and
   10% Mn‐SiHANWs in BMSC (Figure [91]S1B,C, Supporting Information).
   Noteworthy elevations were evident in osteonectin (Figure [92]S1E,
   Supporting Information) in the 5% Mn‐SiHANW group. Runt‐relate
   transcription factor 2 (Runx2) increased in the SiHANW, 5% Mn‐SiHANW,
   and 10% Mn‐SiHANW groups (Figure [93]S1D, Supporting Information).
   Equally, osteocalcin (OCN) (Figure [94]S1F, Supporting Information)
   registers marked augmentation within the precincts of the 5% Mn‐SiHANW
   and 10% Mn‐SiHANW groups.

   The bone‐mimicking nanosized structure affords hydroxyapatite a potent
   osteogenic ability by promoting BMSC stretching, cellular adhesion,
   cell‐extracellular matrix interactions, cell proliferation, and
   osteogenesis, surmounting the capabilities of analogous micron‐sized
   particles of the same composition.^[ [95]^24 ^] The fortification of
   hydroxyapatite with bioactive ions (including zinc (Zn), magnesium, Mn,
   copper, strontium, and Si) confers multiple osteogenic‐related
   functions spanning mechanical properties, antibacterial ability, and
   osteoimmunomodulatory potency.^[ [96]^23 , [97]^25 ^] Mn can improve
   the mechanical properties of hydroxyapatite, promote osteoblast
   proliferation and mineralization, and inhibit osteoclastic effects.^[
   [98]^26 ^]

   The Mn‐SiHANWs synthesized in this study exhibit a bone‐mimicking
   nanowire structure akin to SiHANWs. Intriguingly, certain Mn‐doping
   concentrations stimulated prominent proliferation, osteogenic, and
   mineralization effects within BMSC in vitro. These effects coincide
   with those of other Mn‐doped hydroxyapatite materials in bone
   regeneration.^[ [99]^27 ^]

2.2. Facilitation of Murine Mandibular Bone Healing by Mn‐SiHANW

   The divergences between in vitro and in vivo osteogenic responses
   confer formidable challenges upon biomaterial engineering, especially
   within ion‐doped biomaterials.^[ [100]^24 , [101]^28 ^] In order to
   assess the osteogenic effects of SiHANWs, 5% Mn‐SiHANWs, and 10%
   Mn‐SiHANWs in vivo, they were dispersed in Gelma hydrogels (Gelma),
   resulting in the formulations Gelma+SiHANW, Gelma+5%Mn‐SiHANW, and
   Gelma+10%Mn‐SiHANW, with Gelma serving as the control. Subsequent
   administration of these formulations involved their injection into the
   mandibular bone defects, undertaken in accordance with a standardized
   procedure that was described in our previous study.^[ [102]^29 ^]

   The injectability, SEM, and mechanical properties are displayed in
   Figure [103]S2, Supporting Information. The great injectability of
   Gelma does not change with the presence of Mn‐SiHANW (Figure [104]S2A,
   Supporting Information). The mechanical properties were analyzed by
   dynamic sweep frequency rheological studies (Figure [105]S2B,
   Supporting Information). From 0.1 to 10 Hz, the storage modulus (G′)
   surpassed the loss modulus (G″), indicating that all groups of
   hydrogels possess satisfying stability and elastic solids
   (Figure [106]S2B, Supporting Information). All groups present
   interconnected porous network structures (Figure [107]S2C, Supporting
   Information), allowing the infiltration of immunocytes and tissue
   regeneration.

   As shown in 2D reconstructions, SiHANWs, 5% Mn‐SiHANWs, and 10%
   Mn‐SiHANWs strengthened Gelma's ability to promote murine mandibular
   bone healing. Eight weeks after the surgery, the Gelma+5%Mn‐SiHANW
   group exhibited substantial bone growth (Figure [108] 2A). Quantitative
   scrutiny of micro‐computed tomography (micro‐CT) results corroborates
   these observations, revealing noteworthy amplifications in bone mineral
   density (BMD, surging by 1.3‐fold compared to the Gelma+SiHANW group)
   and bone volume/total tissue volume (BV/TV, augmenting by 1.2‐fold
   compared to the Gelma+SiHANW group) within the Gelma+5%Mn‐SiHANW
   assembly (Table [109]S4, Supporting Information). Conversely, the
   Gelma+10%Mn‐SiHANW group exhibited less bone formation compared with
   the Gelma+5%Mn‐SiHANW and Gelma+SiHANW groups (Figure [110]2B,C).
   Histological analysis indicates the emergence of nascent bone across
   all groups, notably pronounced in the Gelma+SiHANW and
   Gelma+5%Mn‐SiHANW groups (Figure [111]2D). Moreover, Gelma+5%Mn‐SiHANW
   and Gelma+10%Mn‐SiHANW exhibit superior deposition of mature bone
   within the defect area, with Gelma+SiHANW displaying a comparatively
   diminished extent of mature bone (Figure [112]2E,F). Notably,
   Gelma+5%Mn‐SiHANW induced more OCN expression, emblematic of heightened
   bone maturation and formation during the latter stages of osteogenesis
   (Figure [113]2G,H).

Figure 2.

   Figure 2
   [114]Open in a new tab

   Differential Efficacy of Gelma Hydrogels (Gelma), Gelma+SiHANW,
   Gelma+5%Mn‐SiHANW, and Gelma+10%Mn‐SiHANW in mandibular bone healing.
   A) Three dimensional (3D) reconstructed micro‐CT images of mandibles
   after implantation for 8 weeks. B) Quantitative analysis of bone
   volume/total tissue volume (BV/TV). C) Quantitative analysis of bone
   mineral density (BMD). D) Histological evaluation of new bone formation
   revealed by hematoxylin and eosin (H&E) staining. E) Masson staining
   and F) quantification of mature bone. G) Immunohistochemical staining
   and quantification H) of Osteocalcin (OCN), NB, BV, and MB. The arrows
   denote new bone, blood vessels, mature bone, and osteoblasts. N = 5, *P
   < 0.05, **P < 0.01, ***P < 0.001.

   These findings allude to the augmentation of bone filling within the
   defect region upon judicious Mn concentration. Intriguingly, the
   unsatisfactory osteogenic outcome associated with 10% Mn‐SiHANW could
   be attributed to an over‐release of Mn released during implantation.
   This proposed a much more sensitive reaction in murine mandibular bone
   than that in BMSC in vitro. Thus, 10% Mn‐SiHANW was eliminated from
   subsequent experimental groups.

2.3. Mn‐SiHANWs Assist Bone Healing by Increasing Th2 Cell Polarization While
Decreasing Th1 Cell Polarization

   An exploration into the pivotal functional types of immune subsets
   conducive to bone healing in a Mn‐existing environment precipitated an
   examination of mandibular bone tissue, wherein Gelma+SiHANW and
   Gelma+5%Mn‐SiHANW were implanted, followed by their subsequent analysis
   through ribose nucleic acid (RNA)‐sequence methodologies (Figure [115]
   3A). Employing hierarchical clustering techniques, the variance in gene
   expression attributable to the diverse immune cell markers was
   dissected to discern the specific cell type that evinced the most
   pronounced alteration in gene expression in response to Mn stimulation
   (Figure [116]3A). The heatmap showed that CD4^+ T cells exhibited the
   most conspicuous modulation in gene expression, characterized by
   opposing expression patterns. Notably, flow cytometry analysis
   corroborated these observations, with CD4^+ T cells exhibiting more
   frequent aggregation at the implantation site within the
   Gelma+5%Mn‐SiHANW assembly (4.068% ± 0.684%) in comparison to the
   Gelma+SiHANW assembly (2.694% ± 0.142%, Figure [117]3B). T cell
   infiltration, particularly T helper cells, augments tissue
   regeneration. The infiltration of T cells enhanced mandibular bone
   healing, as shown by Yu et al.^[ [118]^6 ^] Furthermore, gut‐primed T
   cells affect bone health in contexts such as osteoporosis and the bony
   callus phase of fracture healing.^[ [119]^30 ^] We therefore speculated
   that the abundant infiltration of CD4^+ T cells may be a crucial factor
   fostering favorable bone healing within the purview of
   Gelma+5%Mn‐SiHANW implantation. In addition to CD4^+ T cells, it is
   worth noting that neutrophils, macrophages, and B cells may also
   undergo alterations in response to Mn‐doing. Consequently, future
   investigations should consider the involvement of additional immune
   cell types in order to comprehensively capture the entirety of immune
   reactions.

Figure 3.

   Figure 3
   [120]Open in a new tab

   Polarization of local and systemic T cells after implantation of Gelma,
   Gelma+SiHANW, and Gelma+5%Mn‐SiHANW into the mandibular defects. A)
   Heatmap illustrating gene expression profiles of immune cells
   surrounding wound areas treated with Gelma+SiHANW or Gelma+5%Mn‐SiHANW.
   B) CD4^+ T cell proportion in murine mandibular bone defects on day 4.
   C) Schematic representation of generating mandibular bone defects in
   CD4^+ T cell‐depleted and control mice via intermittent treatment of
   anti‐CD4 antibodies and saline intravenously, respectively, followed by
   mandibular defect establishment. D) Detection of CD4^+ T cell depletion
   efficiency. CD4^+ T cells were undetectable after treatment with
   anti‐CD4 antibodies. E) The osteogenic abilities of control and CD4^+ T
   cell‐depleted murine mandibular defects treated with Gelma+5%Mn‐SiHANW
   analyzed by three constructed images. F) BV/TV. G) BMD. H) Histological
   assessment of bone formation using H&E, Masson, and OCN staining. I)
   Quantification of mature bone using Masson staining. J) Quantification
   of OCN. NB: New bone; BV: Blood vessel; MB: Mature bone; Arrow:
   Osteoblast. N ≥ 3, *P < 0.05, **P < 0.01, ***P < 0.001.

   In vivo CD4^+ T depletion has been extensively performed to study T
   helper cell subsets. Recombination activating gene 1‐deficient (Rag1
   ^−/− ) and Tcr‐β ^−/− transgenic mice were frequently utilized to study
   immune deficiencies, whereas in our study, CD4 knockout techniques or
   anti‐CD4 neutralized antibody injections can directly highlight our
   primary pursuit.^[ [121]^31 ^] Generating CD4 knockout mice engenders
   substantial financial resources and temporal investments, whereas the
   employment of anti‐CD4 antibodies pertains to immunological techniques
   that effectuate changes within the immune system and its reactions.^[
   [122]^32 ^] Consequently, the present study has adopted the use of
   anti‐CD4 antibodies to establish the indispensability of CD4^+ T cells
   during bone repair.

   To elucidate the specific contribution of CD4^+ T cells to the process
   of bone regeneration, a murine model with depleted CD4^+ T cells was
   generated through tail vein injection of anti‐CD4 antibodies
   (Figure [123]3C). A parallel group of mice receiving saline injections
   intravenously served as the control for the CD4^+ T cell‐depleted
   groups. Three weeks post‐injection, CD4^+ T cells were scarcely spotted
   among the blood cells of CD4^+ T cell‐depleted mice (saline group:
   18.200% ± 3.290%, CD4^+ T cell‐depleted group: 0.888% ± 0.105%, P <
   0.001, n = 3, Figure [124]3D). Intriguingly, the percentage of CD8^+ T
   cells was moderately enriched following CD4^+ T cell depletion (saline
   group: 12.167% ± 1.443%, CD4^+ T cell depleted group: 19.420% ± 1.502%,
   P < 0.001, n = 3, Figure [125]S3, Supporting Information). This may be
   a compensating reaction, and a similar phenomenon has been seen in the
   increase of TCR‐γδ population after CD4^+ or CD8^+ T cell depletion.^[
   [126]^33 ^] Previous studies indicated, controversially, that CD8^+ T
   cells are associated with impaired cancellous bone repair while
   inducing bone formation via secreting Wnt10b in osteoporosis.^[
   [127]^34 ^] Nevertheless, the role of CD8^+ T cells in Mn‐related bone
   repair remains ambiguous.

   After CD4^+ T cells were successfully depleted, a circular mandibular
   defect was made, followed by instant Gelma+5%Mn‐SiHANW implantation.
   After 8 weeks of recovery, micro‐CT imaging revealed discernibly
   aggravated bone abnormalities in CD4^+ T cell‐depleted mice
   (Figure [128]3E). This was further corroborated by quantification,
   indicating a significant reduction in both BMD and BV/TV within the
   CD4^+ T cell‐depleted group (Figure [129]3F,G and Table [130]S5,
   Supporting Information). Notably, markers of bone formation, including
   new bone formation, mature bone deposition, and OCN expression, all
   exhibited a notable decline in the CD4^+ T cell‐depleted mice
   (Figure [131]3H–J). These findings underscore the pivotal role of CD4^+
   T cells in mandibular bone regeneration. A similar indispensable
   function of CD4^+ T cells has been proposed in diverse tissues such as
   tendons, liver, skin, and lungs, wherein their contributions encompass
   immune cell recruitment, inflammation control, angiogenesis, matrix
   formation, and fibrogenic prevention.^[ [132]^35 ^] The main subsets of
   CD4^+ T cells, including Th1, Th2, Th17, Th22, Treg, and γδ T,
   manipulate the intrinsic balance of pro‐ and anti‐inflammatory
   responses via secreting an array of cytokines such as IFN‐γ, TNF‐α,
   IL‐2, IL‐4, IL‐6, IL‐10, IL‐12, IL‐13, IL‐17, IL‐22, IL‐33, and TGF‐β.

   To delineate the roles of CD4^+ T cell subsets in the Mn‐existing bone
   defect milieu, bone tissue from the mandibular defect area implanted
   with Gelma, Gelma+SiHANW, and Gelma+5%Mn‐SiHANW was collected
   independently at 1‐, 4‐, and 7 days intervals post‐surgery. The
   quantification of cytokine production was executed via an enzyme‐linked
   immunosorbent assay (ELISA). Th2‐derived IL‐4 exhibited heightened
   expression in the Gelma+5%Mn‐SiHANW group, concomitant with a
   suppression of Th1‐derived IFN‐γ within both Gelma+SiHANW and
   Gelma+5%Mn‐SiHANW groups on day 4 (Figure [133] 4A,B). This dynamic
   shift is further underscored by the discernible augmentation of the
   IL‐4/IFN‐γ ratio within the defect region implanted with
   Gelma+5%Mn‐SiHANW (Figure [134]4C). The T cell polarization was
   examined by flow cytometry. Gelma+SiHANW and Gelma+5%Mn‐SiHANW
   restrained Th1 (T‐bet^+) cell polarization in both the blood and the
   mandible, with a more pronounced effect observed in the blood on day 1
   and in the mandible on days 1 and 4 (Figure [135]4D–G). Remarkably, on
   the day immediately following implantation, the Th2 (Gata3^+) cell
   population in the Gelma+5%Mn‐SiHANW group appeared diminished relative
   to the Gelma+SiHANW group (Figure [136]4K). However, Th2 cells in the
   Gelma+5%Mn‐SiHANW group gradually accumulated at the defect site and in
   the circulation, ultimately exceeding the Th2 population in the
   Gelma+SiHANW group by day 4 (Figure [137]4H–K). The ratio of Th2/Th1 in
   the defect area exhibited steady augmentation from days 1 to 4
   following Gelma+5%Mn‐SiHANW implantation (Figure [138]4M), in contrast
   to the constant ratio within the Gelma or Gelma+SiHANW groups
   (Figure [139]4M). Systemically, in blood samples, the ratios of Th2/Th1
   rose prominently in both Gelma+SiHANW and Gelma+5%Mn‐SiHANW groups at
   day 1 (Figure [140]4L). On day 4, only blood samples from the
   Gelma+5%Mn‐SiHANW group presented comparatively high Th2/Th1 ratios
   (Figure [141]4L). Collectively, both SiHANW and Mn‐SiHANW inhibited the
   Th1‐related pro‐inflammatory reaction generated by Gelma implantation.
   Mn‐SiHANW further inhibited the pro‐inflammatory reaction and elevated
   the Th2‐related anti‐inflammatory reaction compared to SiHANW.
   Therefore, Mn‐doping can skew the Th1/Th2 balance toward an
   anti‐inflammatory milieu.

Figure 4.

   Figure 4
   [142]Open in a new tab

   T cell function and polarization post Gelma, Gelma+SiHANW, and
   Gelma+5%Mn‐SiHANW implantation. A–C) Enzyme‐linked immunosorbent assay
   (ELISA) quantification of Interferon gamma (IFN‐γ), interleukin (IL)−4,
   and IL‐4/IFN‐γ ratios 4 days post‐implantation. D) The proportion of
   T‐bet^+ cells in the blood and E) mandible 4 days after implantation.
   F) The proportion of T‐bet^+ cells in the blood and G) mandible from
   day 1 to day 7 after implantation. H) The proportion of Gata3^+ cells
   in the blood and I) mandible 4 days after implantation. J) The
   proportion of Gata3^+ cells in the blood and K) mandible from day 1 to
   day 7 after implantation. L) The proportion of Gata3^+/T‐bet^+ cells in
   the blood and M) mandible from day 1 to day 7. N > 3, *P < 0.05, **P <
   0.01, ***P < 0.001.

   Mn‐SiHANW in this investigation is not the only case that can
   manipulate the Th1/Th2 balance. The balance turbulences across diverse
   pathological and physiological contexts. For instance,
   probiotic‐derived polysaccharide capsules orchestrate a balanced
   Th1/Th2 response to confer protection against allergy disorders.^[
   [143]^36 ^] The catalpol‐regulated Th1/Th2 balance alleviates estrogen
   deficiency‐induced osteoporosis.^[ [144]^37 ^] Zn^2+ signaling alters
   the Th1/Th2 balance to favor Th1 cell development.^[ [145]^38 ^] In
   parallel, the augmentation in surface roughness and hydrophilicity of
   titanium implants locally attracts Th2 cells to expedite bone
   regeneration.^[ [146]^39 ^] A porcine tissue‐derived extracellular
   matrix bio‐scaffold favored muscle regeneration and repair by
   polarizing Th1 to Th2 through the mTOR/Rictor pathway.^[ [147]^31a ^]
   However, it is imperative to exercise prudence in over‐inducing
   Th1‐to‐Th2 polarization, given the potential compromise of the capacity
   to combat bacterial infections due to the attenuation of Th1‐mediated
   antimicrobial responses.^[ [148]^40 ^] Our objective should encompass
   the harmonization of Th1 and Th2 functions to advance the ultimate
   objective of efficacious bone defect healing, rather than merely
   emphasizing Th2 polarization. Herein, we elaborate on the local and
   systemic phenotypic and functional changes that Mn‐doping brought to T
   cells. The functionality of Th2 cells is prominently augmented, while
   Th1 cell function is suppressed but not entirely eradicated. Further
   investigations are still required to ascertain whether the
   antimicrobial potency remains sufficiently robust to address the
   infected bone defects. Thus, the Mn‐induced antibiotic effect warrants
   consideration, necessitating an intricate dissection of the
   interactions amongst pathogenic bacteria, recruited neutrophils,
   monocytes, inflammatory macrophages, and Th1 cells. The subsequent part
   of the manuscript will entail an in vitro examination, striving to
   elucidate the multifactorial components underlying Mn‐induced
   osteogenesis.

2.4. Mn‐SiHANW–Induced Th1/Th2 Balance Affects BMSC Osteogenesis

   The pivotal role of T helper cells in the context of Mn‐SiHANW–assisted
   bone defect healing was underscored through in vivo experiments. To
   delve deeper into the mechanistic intricacies of the Mn‐imbued
   osteogenic milieu, we embarked on a series of subsequent
   investigations. Initially, murine BMSCs were subjected to incubation in
   conditioned mediums derived from three distinct groups: PBS (Control),
   SiHANWs, or 5% Mn‐SiHANWs, in combination with or without T helper
   cells. This study delineated that Mn amplifies the osteogenic potential
   of SiHANWs, and this effect is further potentiated upon co‐culture with
   T helper cells (Figure [149] 5A,B). Notably, the osteogenic
   markers—OCN, osteopontin (Opn), osteonectin, and Collagen I—unfolded a
   trend wherein T helper cells co‐existing with 5% Mn‐SiHANW (Th+5%
   Mn‐SiHANW) notably intensified BMSC osteogenesis, particularly in the
   late stage of osteogenic progression (Figure [150]5C). Evidently,
   beyond its direct promotion of osteogenesis, Mn‐SiHANW orchestrates an
   indirect osteogenic influence via modulation of T helper cell function.

Figure 5.

   Figure 5
   [151]Open in a new tab

   In vitro osteogenic effects and effective cytokine responses induced by
   Mn‐SiHANW–stimulated T helper (Th) cells. A) Alkaline phosphatase (ALP)
   staining and B) quantification of bone marrow stromal cells (BMSCs)
   incubated in conditioned medium derived from PBS (Control), SiHANWs, or
   5% Mn‐SiHANWs with or without T helper cells. *P < 0.05, **P < 0.01,
   ***P < 0.001. C) RT‐PCR analysis of OCN, Osteopontin (Opn),
   Osteonectin, and Collagen I gene expressions in BMSC stimulated by the
   conditioned medium. *P < 0.05, **P < 0.01, ***P < 0.001 versus the
   Th+PBS group. D) IL‐4, E) IFN‐γ, and F) their ratio in conditioned
   medium of Th+PBS, Th+SiHANWs, or Th+5%SiHANWs. G) Reverse transcription
   polymerase chain reaction (RT‐PCR) analysis of anti‐ and
   pro‐inflammatory genes. *P < 0.05, **P < 0.01, ***P < 0.001. H) Flow
   cytometry analysis of Th1 (T‐bet^+) and Th2 (Gata3^+). I) The
   proportion of Th1, J) Th2, and K) their ratio of CD4^+ T cells
   stimulated with PBS, SiHANWs, and 5% Mn‐SiHANWs. *P < 0.05, **P < 0.01,
   ***P < 0.001. L) ALP staining and M) quantification of BMSC stimulated
   by the conditioned medium supplemented with IL‐4 recombinant protein,
   anti‐IL‐4 antibodies, or IFN‐γ recombinant protein. *P < 0.05, **P <
   0.01. N) RT‐PCR analysis of OCN, Opn, Osteonectin, and Collagen I gene
   expressions in BMSC stimulated by the conditioned medium. #P < 0.05,
   ##P < 0.01, ###P < 0.001 versus the Th+SiHANW group; +P < 0.05, ++P <
   0.01, +++P < 0.001 versus the Th+5% Mn‐SiHANW group. N = 3.

   Unveiling the underlying mechanisms governing this Mn‐SiHANW–induced
   BMSC osteogenesis was pursued by dissecting the effective components
   within the conditioned medium. Employing an ensemble of techniques
   encompassing ELISA, reverse transcription polymerase chain reaction
   (RT‐PCR), and flow cytometry, the Th+5%Mn‐SiHANW group displayed
   heightened IL‐4 protein and attenuated IFN‐γ protein levels in
   comparison to the Th+SiHANW group (Figure [152]5D–F). In sharp
   contrast, marginal secretion of IFN‐γ and IL‐4 was noted in the Th+PBS
   group, possibly attributable to insufficient stimulation of CD4^+ T
   cells (Figure [153]5E,F). Furthermore, the expression profiles of genes
   associated with Th1 (T‐bet and IFN‐γ) exhibited reduction, while those
   indicative of Th2 (Gata3, IL‐4, IL‐13, and IL‐10) displayed elevation
   within the Th+5%Mn‐SiHANW group (Figure [154]5G). Flow cytometry data
   accentuated an augmented population of Gata3^+ cells, coupled with a
   decline in T‐bet^+ cells within the Th+5%Mn‐SiHANW group
   (Figure [155]5H–K).

   These in vitro findings mirror the observations in the murine
   mandibular bone healing model, collectively endorsing that the presence
   of Mn fosters a milieu wherein naïve T helper cells undergo Th2
   polarization while concurrently curbing Th1 polarization. This dynamic
   shift is paralleled by corresponding alterations in cytokine
   production, inducing an anti‐inflammatory microenvironment with
   elevated IL‐4 and decreased IFN‐γ. IL‐4 and IFN‐γ are the main
   cytokines that distinguish Th1 and Th2 cells, and control the balance
   of Th1 and Th2 cells. IL‐4 promotes Th2 cell development from naive
   helper T cells. Th2 cells create more IL‐4 as a result of being
   activated by IL‐4, creating a positive feedback loop.^[ [156]^41 ^]
   IFN‐γ is mostly secreted by Th1 cells, while on the flip side, it
   induces naive T helper cells to develop into Th1 cells. From an
   interaction standpoint, IL‐4 inhibits the generation of Th1 cells and
   IFN‐γ while IFN‐γ inhibits the development of Th2 cells. IFN‐γ and IL‐4
   have critical roles in osteogenesis in addition to their
   immunoregulatory roles. It has been proven that IL‐4 stimulates
   osteoblast differentiation and bone regeneration.^[ [157]^42 ^] IFN‐γ
   plays a dual role in osteogenesis in a dose‐dependent manner.^[
   [158]^43 ^]

   To corroborate the osteogenic effects of IL‐4 and IFN‐γ generated by
   Mn‐induced T helper cells, alkaline phosphatase (ALP) activity and
   osteogenic gene expressions of BMSC incubated in conditioned medium
   supplemented with differentiation cytokines and antibodies were
   analyzed (Figure [159]5L–N). Anti‐IL‐4 antibodies were administered to
   the Th+5%Mn‐SiHANW group, neutralizing the IL‐4 concentration.
   Consequently, the osteogenic effects were diminished, as evidenced by
   diminished ALP activity and osteogenic gene expression. Conversely, the
   addition of IL‐4 recombinant protein to the Th+SiHANW group augmented
   BMSC osteogenesis. The preceding results imply that IL‐4 is an
   efficient osteogenic factor produced by T helper cells stimulated with
   Mn‐HANW. IFN‐γ recombinant protein was additionally administered to the
   Th+5%Mn‐SiHANW group to mitigate the effect of Th1 function impairment.
   Moreover, ALP activity and osteogenic gene expression were
   significantly down‐regulated. These results indicated that IL‐4 and
   IFN‐γ are efficacious factors of Mn‐SiHANW–stimulated T helper cells
   and that IL‐4 induces osteogenesis in BMSC while IFN‐γ inhibits it.

2.5. Mn‐SiHANWs Increase Th2 and Inhibit Th1 Polarization under the
Manipulation of MnSOD

   The tunability of T helper cells can be effectively harnessed through
   various factors encompassing geography, parameters, scaffold structure,
   surface properties, chemical components, and stiffness of implanted
   biomaterials.^[ [160]^35 , [161]^39 , [162]^44 ^] Multiple
   sophisticated artificial antigen‐presenting cells (aAPC) were created
   by arranging receptor‐targeting cytokines and nanoparticles in
   intricate patterns.^[ [163]^45 ^] These types of aAPCs enable robust T
   cell activation. However, few of them are applied to bone tissue
   regeneration. Despite the fact that receptor‐targeting cytokines can
   support the adaptive immunomodulatory function of implanted
   biomaterials, challenges pertaining to stability, cost‐effectiveness,
   ease of manufacture, and controlled release persist, necessitating
   further refinement.^[ [164]^45a ^] Against this backdrop, the
   biomaterial used in this study offers an alternate approach to the
   stated issues and is capable of modulating a certain subset of T cells
   to some extent during bone healing due to its controlled release of Mn,
   stable properties, bone‐mimicking crystal morphology,
   cost‐effectiveness, and ease of manufacture.

   In the following paragraphs, we will explore the mechanism underlying
   the effect of Mn‐SiHANWs on Th1/Th2 polarization. First, T helper cells
   were co‐cultured in vitro with PBS (Control), SiHANWs, and 5%
   Mn‐SiHANWs. Carboxy‐fluorescein‐succinimidyl‐ester analysis indicated
   that T helper cells proliferated actively in response to SiHANWs and 5%
   Mn‐SiHANWs between days 3 and 5 (Figure [165]S4, Supporting
   Information). Subsequently, the SiHANW and 5% Mn‐SiHANW groups were
   subjected to RNA sequencing (Figure [166] 6A–C). A constellation of
   1287 genes was up‐regulated, whereas 2652 genes were down‐regulated in
   the 5% Mn‐SiHANW group (Figure [167]6A). Among these disparate genes,
   superoxide dismutase 2 (Sod2), or specifically MnSOD, along with genes
   related to Th2 cells, surfaced with heightened expression, while those
   associated with Th1 cells were down‐regulated in the 5% Mn‐SiHANW group
   (Figure [168]6B). This proposition is substantiated by RT‐PCR data
   showcasing a surge in MnSOD expression in the 5% Mn‐SiHANW group
   (Figure [169]6F). Intriguingly, CD4^+ T cells treated with 5% Mn‐SiHANW
   exhibited robust cytoplasmic fluorescent signals indicative of MnSOD
   protein localization at a cytoplasmic pole (Figure [170]6D,E). Further
   corroborating this effect, western blot analysis revealed elevated
   MnSOD protein levels in the 5% Mn‐SiHANW group, in contrast to the
   SiHANW group, which displayed comparably nominal levels
   (Figure [171]6G,I). Notably, MnSOD is a critical enzyme in OXPHOS for
   maintaining redox status and energy metabolism. The MnSOD enzyme
   activity was enhanced prominently in the 5% Mn‐SiHANW group
   (Figure [172]6J). This finding indicated that the Mn‐existing milieu
   can activate the MnSOD enzyme, which may sequentially regulate the
   Th1/Th2 balance.

Figure 6.

   Figure 6
   [173]Open in a new tab

   Manganese superoxide dismutase (MnSOD) role in Mn‐SiHANW–induced
   Th1/Th2 polarization. A) Volcano plot illustrating the differentially
   expressed genes between T cells treated with SiHANW or 5% Mn‐SiHANW in
   vitro. B) Hierarchical clustering of RNA‐sequence data indicating
   expression levels of Sod2 (MnSOD) and genes promoting Th1 or Th2
   differentiation. Expression levels are indicated by color differences,
   as shown in the bottom bar. C) Pathway enrichment by KEGG analysis of
   differential genes. D) Immunofluorescence of MnSOD, CD4, and DAPI in
   CD4^+ T cells treated with Control, SiHANW, and 5% Mn‐SiHANW. MnSOD:
   red; CD4: green; DAPI: blue. Scale bar: 20 µm. E) Fluorescence
   intensity of MnSOD/DAPI. F) Gene expression pattern of MnSOD. G)
   Western blot and H) protein level analysis of MnSOD. I) MnSOD activity
   of CD4^+ T cells stimulated by PBS (Control), SiHANWs, or 5%
   Mn‐SiHANWs. J) Western blotting and K) protein levels of phosphorylated
   (P)‐AMPK and AMPK. *P < 0.05, **P < 0.01, ***P < 0.001.

   Under inflammatory conditions, MnSOD expression varies across diverse
   tissues.^[ [174]^20a ^] Notably, it exerts divergent effects on
   multiple immune cells. For instance, escalated MnSOD levels coincide
   with the considerable suppression of pro‐inflammatory cytokines such as
   IL1b, IL‐6, and IL‐8.^[ [175]^46 ^] Further manifestations encompass
   heightened neutrophil antithrombotic functionality,^[ [176]^47 ^]
   attenuated CD8^+ T cell response,^[ [177]^48 ^] augmented CD68^+
   macrophage recruitment within lung adenocarcinoma,^[ [178]^49 ^] and a
   proclivity toward M2 macrophage polarization in breast cancer.^[
   [179]^50 ^] Our research indicates that MnSOD promotes the polarization
   of Th2 cells while inhibiting the polarization of Th1 cells, thereby
   completing the framework of MnSOD‐mediated immunology. Further research
   should elaborate on how mitochondrion behaves and OXPHOS changes under
   the Mn‐induced hyperfunction of MnSOD.

   In the oral and maxillofacial environment, Mn‐doping biomaterials may
   provide a promising strategy for bone regeneration in cases of
   pathological disorders like periodontitis. These conditions are
   characterized by excessive pro‐inflammatory responses and a breakdown
   of the inflammatory balance.

2.6. Mn‐SiHANW Modulates the Th1/Th2 Balance by Targeting AMPK

   To gain insight into how Mn‐SiHANW modulates the Th1/Th2 balance, a
   KEGG pathway enrichment analysis was performed. The results suggested
   that differential genes were enriched in Th1 and Th2 cell
   differentiation, OXPHOS, and the adenosine 5′‐monophosphate–activated
   protein kinase (AMPK) pathway (Figure [180]6C and Table [181]S6,
   Supporting Information). Based on these results, it seems that
   Mn‐SiHANW may regulate the Th1/Th2 balance via AMPK‐related and
   OXPHOS‐involved energy metabolism.

   Exploration into the underlying mechanics of T cell polarization,
   particularly concerning the modulation of T helper cells infiltrating
   local inflammatory microenvironments, has revealed the pivotal
   regulatory role of energy metabolism.^[ [182]^51 ^] AMPK is a pivotal
   orchestrator of energy metabolism integral to processes of
   anti‐inflammation and tissue regeneration.^[ [183]^52 ^] Within the
   energy metabolism continuum, AMPK signaling inhibits glycolysis,
   glutaminolysis, and fatty acid synthesis while supporting fatty acid
   oxidation and OXPHOS, thereby bolstering ATP production.^[ [184]^53 ^]
   Anomalies in OXPHOS were implicated in hampered Th2 responses in
   allergic asthma models.^[ [185]^16 ^] Conversely, glycolysis was
   implicated in fostering Th1‐driven IFN‐γ production within the inflamed
   area.^[ [186]^17 ^] Notably, fatty acid oxidation and ATP accumulation
   were associated with enhanced Th2 cell responses.^[ [187]^18 ^] In
   certain instances, AMPK activation has been reported to reduce the
   severity of dextran sodium sulfate‐induced colitis in mice via
   diminishing Th1 polarization,^[ [188]^54 ^] and also alleviating
   autoimmune encephalomyelitis by attenuating Th1‐favored IFN‐γ and TNF
   production while concurrently augmenting Th2‐primed IL‐4 and IL‐10.^[
   [189]^55 ^] Furthermore, AMPK has proven pivotal in orchestrating the
   transition of M1 to M2 macrophages during muscle healing processes,^[
   [190]^56 ^] further underscoring its influential role in shaping
   immunomodulated profiles conducive to Th2 amplification and Th1
   attenuation.

   Thus, we sought to verify the specific role of Mn‐SiHANW–induced AMPK
   activation in the Th1/Th2 balance. The ratio of phosphorylated‐AMPK
   (p‐AMPK)/AMPK was detected in the presence of PBS, SiHANW, and
   5%Mn‐SiHANW. The ratio of p‐AMPK/AMPK rose in the 5% Mn‐SiHANW group,
   whereas it fell in the SiHANW group (Figure [191]6H,K). To determine
   whether AMPK activation could restore the Th1/Th2 balance in the SiHANW
   group, 5‐aminoimidazole‐4‐carboxamide ribonucleoside (AICAR) was added
   to the SiHANW group (SiHANW+AICAR). While Compound C was applied to
   inhibit the AMPK pathway in 5%Mn‐SiHANW–treated CD4^+ T cells
   (5%Mn‐SiHANW+Compound C) (Figure [192] 7A).

Figure 7.

   Figure 7
   [193]Open in a new tab

   The MnSOD/adenosine 5′‐monophosphate‐activated protein kinase (AMPK)
   axis modulates Th1/Th2 balance in the Mn‐SiHANW–induced milieu. A)
   Experimental groups (SiHANWs, SiHANW+AMPK agonist
   5‐aminoimidazole‐4‐carboxamide ribonucleoside [AICAR], 5% Mn‐SiHANW,
   and 5% Mn‐SiHANW+Compound C) for assessing Th1/Th2 balance upon
   stimulation with the AMPK activator or inhibitor. B) Protein level
   assessments concerning IL‐4, C) IFN‐γ, and D) IL‐4/IFN‐γ ratios in the
   conditioned medium. E,F) Transcriptional factor analysis involving G,H)
   Gata3, T‐bet, and I) Gata3/T‐bet in CD4^+ T cells in response to four
   different stimuli. J) Experimental groups (5% Mn‐SiHANW+scrambled
   shRNA, 5% Mn‐SiHANW+MnSOD shRNA, and 5% Mn‐SiHANW+MnSOD shRNA+AICAR)
   elucidating MnSOD role and its connection to the AMPK signaling pathway
   in Th1/Th2 balance. K) Protein level assessments concerning IL‐4, L)
   IFN‐γ, and M) IL‐4/IFN‐γ ratios in the conditioned medium. N,O)
   Transcriptional factor analysis involving Gata3, P,Q) T‐bet, and R)
   Gata3/T‐bet in CD4^+ T cells under three different stimuli. S) Relative
   intensity of MnSOD, T‐bet, Gata3, IFN‐γ, IL‐4, IL‐10, and IL‐13 under
   different stimuli. T) MnSOD activities of CD4^+ T cells treated with an
   AMPK activator or inhibitor. U) MnSOD activities in 5%
   Mn‐SiHANW+scrambled shRNA, 5% Mn‐SiHANW+MnSOD shRNA, and 5%
   Mn‐SiHANW+MnSOD shRNA+AICAR groups. *P < 0.05, **P < 0.01, ***P <
   0.001.

   To analyze the functional change, the conditioned medium was assembled
   for IL‐4 and IFN‐γ quantification. The 5%Mn‐SiHANW and SiHANW+AICAR
   groups contained more IL‐4 and less IFN‐γ than those in the SiHANW
   group, indicating that the introduction of Compound C significantly
   increased IFN‐γ while inhibiting IL‐4 secretion (Figure [194]7B–D).
   T‐bet and Gata3 were quantified using flow cytometry. Notably, the
   5%Mn‐SiHANW+Compound C group displayed augmented proportions of T‐bet+
   cells, whereas the SiHANW+AICAR cohort evinced a decline in T‐bet^+
   cell proportions (Figure [195]7E,F). In contrast to T‐bet^+ cells,
   histograms and statistical analysis revealed an inverted trend in
   Gata3^+ cells, with AICAR treatment augmenting Gata3^+ cell proportions
   in the SiHANW group, while Compound C addition to the 5%Mn‐SiHANW group
   curtailed Gata3^+ cell proportions (Figure [196]7G,I).

   In light of the cumulative functional and transcriptional factor
   analyses, it becomes apparent that AMPK signaling potently tips the
   Th1/Th2 balance in favor of Th2 polarization rather than Th1
   polarization. Nevertheless, this work did not incorporate an
   investigation into the response of energy metabolism to AMPK activation
   under conditions when Mn is present. Future studies will aim to provide
   a more comprehensive understanding of the metabolic alterations
   associated with OXPHOS, glycolysis, and fatty acid metabolism.

2.7. Mn‐SiHANW Modulates Th1/Th2 Balance via the MnSOD/AMPK Pathway

   MnSOD serves as the upstream regulator of AMPK in multiple
   circumstances. MnSOD sustains AMPK activation in aggressive breast
   cancer^[ [197]^57 ^] and colorectal cancer.^[ [198]^58 ^] Remarkably,
   compounds such as quercetin promote AMPK protein phosphorylation
   through the up‐regulation of MnSOD expression, augmenting osteogenic
   differentiation, and the antioxidant response within BMSC.^[ [199]^59
   ^] In the Control, SiHANW, and 5%Mn‐SiHANW groups, the relative protein
   levels of MnSOD were found to be proportional to the phosphorylated
   (P)‐AMPK levels (Figure [200]6I,K). These clues prompted us to assume a
   regulatory relationship between MnSOD and the AMPK pathway in
   5%Mn‐SiHANW–induced Th1 and Th2 polarization.

   With the aim of substantiating this hypothesis, MnSOD shRNA was
   employed to impair MnSOD expression within CD4^+ T cells (MnSOD shRNA
   group), while scrambled shRNA served as a control (scrambled shRNA
   group). Subsequently, AICAR was introduced to the MnSOD shRNA group to
   ascertain whether AMPK activation could rectify the dwindling
   Th2‐to‐Th1 population ratio (Figure [201]7J). Following a 3 days
   incubation period within 5%Mn‐SiHANWs, the three groups underwent
   functional assessments, encompassing quantification of IL‐4 and IFN‐γ
   protein levels. Impressively, the 5%Mn‐SiHANW+MnSOD shRNA group
   exhibited minimal IL‐4 secretion juxtaposed against heightened IFN‐γ
   levels. Notably, AMPK activation within the 5%Mn‐SiHANW+MnSOD shRNA
   group abrogated the altered IL‐4/IFN‐γ ratio, restoring it to baseline
   levels (Figure [202]7K–M). Concomitantly, the proportion of Gata3^+
   cells was attenuated within the 5%Mn‐SiHANW+MnSOD shRNA group, yet
   reinvigorated upon supplementary AICAR stimulation (Figure [203]7P,Q).
   Curiously, T‐bet^+ cell proportions remained unaltered in response to
   similar stimuli (Figure [204]7N,O). Comparatively, the relative mRNA
   expression pattern in the 5%Mn‐SiHANW+MnSOD shRNA group revealed a
   decrement in Sod2, Gata3, IL‐4, IL‐10, and IL‐13 expressions,
   contrasted by heightened T‐bet and IFN‐γ levels, particularly when
   AICAR was introduced (Figure [205]7S). After AICAR was additionally
   added, Gata3 and IL‐4 increased, while T‐bet and IFN‐γ decreased
   (Figure [206]7S). Based on the preceding results, the AMPK signaling
   pathway acted downstream of MnSOD in the Th1/Th2 balance in the
   Mn‐existing milieu.

   This research unveils intriguing parallels with previously documented
   mutual interactions between MnSOD and AMPK, reinforcing the presence of
   a similar pathway within our investigative purview. Remarkably, AMPK
   activation in the SiHANW group was also associated with heightened
   MnSOD activity (Figure [207]7T). Conversely, in the 5% Mn‐SiHANW group,
   AMPK inhibition elicited a decline in MnSOD activity (Figure [208]7T).
   Noteworthy observations unfolded upon MnSOD shRNA infection, where
   MnSOD activity witnessed a notable decline, subsequently exhibiting a
   measured resurgence upon exposure to AICAR (Figure [209]7U).
   Collectively, these outcomes establish AMPK as a downstream influencer
   of MnSOD, as underscored by its intricate and inverse modulation of
   MnSOD protein activity.

3. Conclusion

   The intricate orchestration of T cell polarization has emerged as a
   focal point of interest, finding application across diverse therapeutic
   domains. Employing ingeniously tailored biomaterials to finely regulate
   the equilibrium between pro‐inflammatory and anti‐inflammatory T cell
   subsets stands as a promising avenue for driving comprehensive bone
   regeneration. Within the ambit of this investigation, we harnessed the
   potency of Mn ion incorporation into Si‐hydroxyapatite nanowires,
   propelling osteogenic outcomes through two pivotal mechanisms: 1) Mn,
   administered at an optimal dosage, effectively stimulates BMSC to
   engage in proficient osteogenic differentiation and robust
   mineralization; 2) The strategic inclusion of Mn imparts an
   anti‐inflammatory and regenerative milieu by adroitly modulating the
   Th1/Th2 cell equilibrium and the attendant cytokine repertoire, thereby
   markedly augmenting the osteogenic trajectory. Throughout this process,
   the MnSOD/AMPK pathway emerges as a linchpin, orchestrating the
   Mn‐induced immunomodulatory dynamics. This exposition underscores the
   fact that Mn‐doping amplifies the osteogenic efficacy of biomaterials,
   assuming the role of a precision immunoregulator in the intricate
   landscape of bone defect healing. It follows that the Mn‐SiHANW
   framework holds auspicious prospects for clinical translation,
   accentuated by attributes including facile and cost‐effective
   manufacturing, structural stability, and commendable biocompatibility.

4. Experimental Section

Synthesis and Characterization of Si‐Hydroxyapatite Nanowires with or without
Mn‐Doping

   The elementary method of synthesizing Si‐hydroxyapatite nanowires with
   or without Mn‐doping was detailed in the work by Lin et al.^[ [210]^60
   ^] Briefly, Ca(NO[3])[2]·4H[2]O, MnCl[2], CaCl[2], and
   Na[2]SiO[3]·9H[2]O were solubilized in distilled water to initiate the
   formation of precursors through a hydrothermal route. These precursors
   were devised with distinct Mn/(Ca+Mn) mole ratios, specifically 0,
   0.05, and 0.1, corresponding to the fabrication of SiHANWs, 5%
   Mn‐SiHANWs, and 10% Mn‐SiHANWs. The ensuing process encompassed
   thorough rinsing with distilled water and anhydrous ethanol, succeeded
   by drying to eliminate any residual moisture. The prepared precursors
   were subsequently amalgamated with an aqueous solution of Na[3]PO[4],
   subjected to a 120 °C heat treatment for 24 h, and then processed
   through sequential steps of washing, filtration, and 180 °C drying for
   an additional 24 h.

   The architectural attributes and elemental distribution of Ca, Mn, and
   Si were scrutinized employing SEM (ZEISS GeminiSEM 300, Germany) and
   TEM (FEI Talos F200S, USA). Thorough physicochemical evaluations were
   conducted. Infrared spectra analysis was conducted on small pellets
   containing 1 mg of the sample, encompassing a spectral range of 500 to
   4000 cm^−1, employing FTIR (Thermo Scientific Nicolet iS5, USA). The
   crystalline structures were meticulously examined using XRD (Bruker D8
   Advance, Germany) with a scanning velocity of 0.02°, an operational
   voltage of 40 kV, and a 2θ range spanning from 10° to 80°. The
   quantification of Mn and Ca ions leached over specified durations (days
   1, 3, 7, 14, 21, and 28) was executed via ICP‐OES (Agilent 730 [OES],
   USA). In a concise outline, 5 mg of the sample was suitably diluted
   with 10 mL of PBS solution (pH 7.4) and incubated at 37 °C. Subsequent
   calculations encompassed the determination of Mn/(Ca+Mn) mole ratios,
   accompanied by recording pH values at predefined intervals.

Proliferation Activity and Morphology Analysis of BMSC

   BMSCs were extracted from the long bones of male C57BL/6 mice (3 weeks
   old). The proliferation of BMSC was evaluated through the deployment of
   the CCK‐8 assay (Dojindo, Japan). BMSCs were seeded at a density of 3 ×
   10^3 cells per well in 96‐well flat‐bottomed cell culture plates and
   exposed to varying concentrations (0.1, 1, 10, and 100 µg mL^−1) of
   SiHANWs, 5% Mn‐SiHANWs, and 10% Mn‐SiHANWs suspending solutions. On
   days 1, 3, and 7, 10 µL of CCK‐8 solution were introduced to each well
   and incubated at 37 °C for an hour. Subsequently, absorbance readings
   were recorded at 450 nm to quantify the proliferation activity of BMSC.
   The impact of distinct concentrations of SiHANWs, 5% Mn‐SiHANWs, and
   10% Mn‐SiHANWs on the morphology of BMSC was evaluated through
   dual‐staining utilizing phalloidin and 4′6‐diamidino‐2‐phenylindole
   (DAPI, 1:200, Thermo Fisher Scientific, Warsaw, Poland). This
   visualization was facilitated by confocal laser scanning microscopy
   (Leica, Germany).

Osteogenic Differentiation Analysis

   The assessment of osteogenic differentiation was conducted by
   cultivating BMSC in distinct conditioned mediums. The expression levels
   of Runx2, osteonectin, Opn, and Collagen I in BMSC were scrutinized
   through RT‐PCR on the 7^th day of culture. Total RNA was extracted from
   CD4^+ T cells utilizing TRIzol (Invitrogen, Japan), followed by reverse
   transcription using PrimeScript reverse transcriptase (Takara, Japan).
   RT‐PCR was executed on the LC96 platform (Roche) with the application
   of TB Green Premix Ex Taq (Tli RNaseH Plus, Takara, Japan). The
   specific primers employed for real‐time PCR are enlisted in
   Table [211]S7, Supporting Information. The quantification of target
   gene expressions was achieved using the 2^−ΔΔCt method, employing GAPDH
   as the internal reference gene.

   Qualitative assessment of ALP activity was conducted through the
   BCIP/NBT alkaline phosphatase color development kit, whereas the
   alkaline phosphatase assay kit (Beyotime, China) enabled quantitative
   measurement. Alizarin Red S staining kit (Beyotime, China) was used to
   observe the mineralization of BMSC. The amount of calcium deposits was
   measured after adding 100 nm cetylpyridinium chloride. The absorbance
   was measured at 562 nm.

CD4^+ T Cell‐Depleted Murine Model and Mandibular Defect Surgery

   Male C57BL/6 mice (8 weeks old) were purchased from Vital River
   Laboratory Animal Technology (Beijing, China). The animals were kept in
   a 12/12 hours dark/light cycle at 25 °C. C57BL/6 (male, 8 weeks) were
   housed in accredited animal facilities in specific pathogen‐free
   conditions at Shanghai Ninth People's Hospital (Shanghai, China). All
   animal experiments were conducted in strict compliance with the
   guidelines of the Animals Committee of Shanghai Ninth People's Hospital
   (SH9H‐2023‐A802‐1).

   The mice were randomly divided into two groups: the CD4^+ T
   cell‐depleted group, subjected to intravenous administration of
   anti‐CD4 antibodies, and the control group, treated with saline. After
   a 3 weeks interval, CD4^+ T cells were collected from blood cells and
   quantified using flow cytometry to verify whether the model was
   established successfully.^[ [212]^61 ^]

   Murine mandibular bone defects were generated according to the authors'
   previous article.^[ [213]^29 ^] Briefly, mice were anesthetized through
   the inhalation of 2% isoflurane. Subsequently, the masseter muscles
   were meticulously dissected between the superior and inferior branches
   of the facial nerve following a 5 mm mandibular skin incision, followed
   by an incision of the periosteum. Employing a dental bur,
   full‐thickness penetrating defects with a diameter of 2.3 mm were
   meticulously fashioned, with continuous saline irrigation for cooling.
   Subsequent to cleansing of the surgical site with saline, the surgical
   defect was loaded with 5 µL of gelatin methacryloyl (Gelma, EFL‐GM,
   Yongqinquan Intelligent Equipment Co., Ltd., China)‐loaded solutions
   encompassing PBS, SiHANW, 5% Mn‐SiHANW, and 10% Mn‐SiHANW (referred to
   as Gelma, Gelma+SiHANW, Gelma+5%Mn‐SiHANW, and Gelma+10%Mn‐SiHANW). The
   surgical site was subsequently sealed utilizing a 5‐0 suture.
   Euthanasia of timed mice was executed through CO[2] administration,
   followed by a thoracotomy procedure to ensure complete cessation of
   vital functions.

Micro‐CT and Histological Examination

   Eight weeks post‐implantation, C57BL/6 mice were humanely euthanized,
   and their mandibles were excised and subjected to fixation in 4%
   paraformaldehyde. Subsequent Micro‐CT scanning of the mandibles was
   conducted utilizing the SkyScan 1076 system (Belgium) at a spatial
   resolution of 24 µm. For the purpose of 3D reconstruction, gray scale
   settings were adjusted within the range of 120 to 255. Parameters
   include BV/TV, and BMD was computed. For histological evaluation,
   specimens were sectioned to a thickness of 4 µm, followed by processing
   for standard hematoxylin and eosin (H&E) staining and Masson staining.
   Immunohistochemistry analysis was performed after employing
   heat‐mediated antigen retrieval using sodium citrate buffer (pH = 6,
   ab208572, abcam, UK) for a duration of 20 min. The application of
   primary antibodies targeting OCN protein (1:150, 23418‐1‐AP,
   proteintech, UK) ensued, and after an overnight incubation at 4 °C,
   sections were visualized using an HRP‐conjugated compact polymer
   system, with DAB serving as the chromogen. Visual documentation of all
   stained paraffin sections was achieved via Olympus microscopy.

CD4^+ T Cell Subset's Functional Analysis

   Functional analysis of CD4^+ T cell subsets was conducted utilizing
   flow cytometry analysis and ELISA techniques. Mice were euthanized at
   postoperative intervals of 1, 4, or 7 days following the mandibular
   defect surgery described earlier. Blood and mandibular bone defect site
   samples were collected. Bone tissue was gently triturated, and the
   resultant cellular suspension was filtered through a 70 µm filter (BD
   Falcon). Red blood cells were lysed using an
   ammonium‐chloride–potassium buffer. The inclusion of a Live/Dead kit
   (BV510, Zombie Aqua fixable viability kit, BioLegend), CD45 (Alexa
   Flour 700, BioLegend, USA), CD3 (APC‐Cy7, BD Biosciences, USA), and CD4
   (PerCP‐Cy5.5, BioLegend) was executed as per manufacturers’ protocols.
   Following fixation and permeabilization using a flow cytometry
   permeabilization/wash buffer (BD Biosciences), Gata3 (APC, BioLegend),
   and T‐bet (BV421, BioLegend) antibodies were introduced. Stained cells
   were subsequently analyzed using a BD LSRFortessa flow cytometer, and
   data interpretation was accomplished utilizing Flowjo software (BD
   Biosciences). The gating strategy is elucidated in Figure [214]S4A,
   Supporting Information.

   In the context of ELISA, the supernatant extracted from the ground
   mandibular defect area was subjected to examination. Concentrations of
   IL‐4 and IFN‐γ were quantified employing ELISA kits (R&D Systems) as
   per the manufacturer's instructions.

CD4^+ T Cell Culture and Assessment

   A single‐cell suspension derived from the spleen of male C57BL/6 mice
   (8 weeks old) was prepared for the isolation of CD4^+ T cells employing
   MojoSort mouse CD4 nanobeads (BioLegend, USA). The isolated T cells
   were resuspended in RPMI 1640 medium supplemented with 10% fetal bovine
   serum and 1% penicillin–streptomycin (HyClone, Thermo Scientific).
   These cells were cultured in humidified air comprising 5% CO[2] at 37
   °C. Subsequently, the cells were stimulated with anti‐CD3 antibodies
   (5 µg mL^−1, BioLegend) and anti‐CD28 antibodies (2 µg mL^−1,
   BioLegend), followed by incubation with PBS (Control), SiHANWs, or 5%
   Mn‐SiHANWs at a concentration of 1 µg mL^−1 within RPMI 1640 media, and
   incubated at 37 °C for a duration of 72 h. After the 72 h incubation
   period, the conditioned media was collected from the supernatant of the
   CD4^+ T cells by passing through PES filters (Merck Millipore).

   Subsequent quantification of IL‐4 and IFN‐γ concentrations was
   accomplished using ELISA techniques. Moreover, CD4^+ T cells were
   retrieved and subjected to flow cytometry analysis. Prior to the
   inclusion of CD3 (APC‐Cy7, BD Biosciences, USA), CD4 (PerCP‐Cy5.5,
   BioLegend), Gata3 (APC, BioLegend), and T‐bet (BV421, BioLegend)
   antibodies, cells were treated with a Live/Dead kit (BV510, Zombie Aqua
   fixable viability kit, BioLegend). The gating strategy is delineated in
   Figure [215]S5B, Supporting Information. The specific primers for
   RT‐PCR targeting the genes under examination are detailed in
   Table [216]S7, Supporting Information. The expression of target genes
   was calculated.

MnSOD Expression and Activity

   MnSOD gene expression was analyzed by RT‐PCR using a forward MnSOD
   primer (5′‐GTTGTGTCCTTTTTTGTCACC‐3′) and a reverse MnSOD primer
   (5′‐TTCCTGTCTTTTCCTCCCC‐3′).

   Western blotting was employed to analyze the protein levels of MnSOD.
   In brief, CD4^+ T cells stimulated by PBS (Control), SiHANWs, or
   5%Mn‐SiHANWs were harvested, cold PBS‐washed, and subsequently lysed
   with ice‐chilled RIPA buffer containing protease and phosphatase
   inhibitors for a duration of 10 min. The resulting lysates were then
   subjected to centrifugation at 120 000 rpm for 5 min. Protein
   concentrations were determined utilizing the BCA protein assay kit
   (Beyotime). Subsequently, the protein bands were incubated overnight at
   4 °C with MnSOD mouse monoclonal antibody (1:1000, Cell Signaling
   Technology, USA) and GAPDH (1:1000, Proteintech).
   Horseradish‐peroxidase–conjugated secondary antibodies (Proteintech)
   were applied to the samples for 1 h at room temperature. Following
   washing with tris buffered saline tween, the hybridized bands were
   visualized through the utilization of the highly sensitive ECL (Thermo
   Fisher Scientific, USA).

   Immunofluorescence staining was implemented to visualize the MnSOD
   protein. CD4^+ T cells were labeled with FITC anti‐mouse CD4
   (BioLegend) antibody for 30 min and subjected to three cold PBS washes.
   These cells were then fixed on slides with 4% paraformaldehyde and
   permeabilized with 0.2% Triton X‐100 in PBS for a duration of 15 min.
   After a 1 h blocking step with 1% BSA at room temperature, the samples
   were incubated overnight at 4 °C with MnSOD mouse monoclonal antibody
   (1:200, Cell Signaling Technology, USA). Subsequent incubation with
   Cy3‐conjugated goat anti‐mouse IgG (1:200, Proteintech) was performed
   for 1 h at room temperature. Nuclei were stained with DAPI (BioLegend).

   The activity of MnSOD was gauged utilizing the Cu/Zn‐SOD and MnSOD
   assay kit with WST‐8 (Beyotime). In a nutshell, CD4^+ T cells were
   washed and homogenized with cold PBS. Subsequent determination of
   protein concentration was conducted using the BCA protein assay kit
   (Thermo Scientific). Samples were subjected to incubation with
   Cu/Zn‐SOD inhibitors at 37 °C, followed by incubation with a working
   solution. Absorbance measurements were taken at 562 nm. One unit of SOD
   was defined as the amount of MnSOD required to neutralize 50% of the
   superoxide radical.

RNA Sequencing and Lentivirus Knockdown of MnSOD

   Total RNA was isolated from the mandibular defect area subjected to
   distinct GelMa‐loaded SiHANWs and 5% Mn‐SiHANWs, as well as CD4^+ T
   cells cultured with SiHANWs or 5% Mn‐SiHANWs. TRIzol reagent (Takara,
   Japan) was employed for this purpose. The sequencing platform utilized
   was the Illumina HiSeq X Ten platform, with differential expression
   analysis carried out using the DESeq (2012) R package. Genes displaying
   a significance threshold of P < 0.05 were classified as differentially
   expressed. Enrichment of pathways was performed through KEGG
   ([217]http://www.kegg.com). The CellMarker database
   ([218]http://biocc.hrbmu.edu.cn/CellMarker/ or
   [219]http://bio‐bigdata.hrbmu.edu.cn/CellMarker/) was used for
   distinguishing different immune cell types in tissues.^[ [220]^62 ^]

   The MnSOD shRNA lentivirus was constructed by Genomeditech (Shanghai,
   China). Primary CD4^+ T cells were infected with Mnsod shRNA lentivirus
   at 5 µg mL^−1. The culture medium was replaced after 16 h of infection.

AMPK Pathway Analysis and In Vitro Small Molecular Treatment

   Western blotting was used to assess the protein levels of AMPK and
   p‐AMPK. Protein bands were exposed to AMPK mouse monoclonal antibody
   (1:1000, Cell Signaling Technology), P‐AMPK mouse monoclonal antibody
   (1:1000, Cell Signaling Technology), and GAPDH (1:1000, Proteintech)
   overnight at 4 °C. The subsequent steps had been previously outlined.

   CD4^+ T cells stimulated with SiHANWs or 5% Mn‐SiHANWs were subjected
   to incubation with AICAR (0.1 mm) or Compound C (1.25 µm) (Sellect,
   USA) for a duration of 3 days, followed by subsequent analyses.

Statistical Analysis

   For statistical analysis, SPSS 23.0 software was employed. Unpaired
   Student's t‐test was utilized for pairwise comparisons. A one‐way
   analysis of variance was conducted, followed by Tukey's multiple
   comparison test for comparisons involving more than two groups. Data
   are represented as the mean ± standard deviation (SD) from a minimum of
   three independent experiments. A significance level of P < 0.05 was
   considered statistically significant.

Conflict of Interest

   The authors declare no conflict of interest.

Supporting information

   Supporting Information
   [221]Click here for additional data file.^ (779.9KB, pdf)

Acknowledgements