Abstract
Skin wounds, leading to infections and death, have a huge negative
impact on healthcare systems around the world. Antibacterial therapy
and the suppression of excessive inflammation help wounds heal. To
date, the application of wound dressings, biologics and biomaterials
(hydrogels, epidermal growth factor, stem cells, etc.) is limited due
to their difficult and expensive preparation process. Cinnamomum
burmannii (Nees & T. Nees) Blume is an herb in traditional medicine,
and its essential oil is rich in D-borneol, with antibacterial and
anti-inflammatory effects. However, it is not clear whether Cinnamomum
burmannii essential oil has the function of promoting wound healing.
This study analyzed 32 main components and their relative contents of
essential oil using GC-MS. Then, network pharmacology was used to
predict the possible targets of this essential oil in wound healing. We
first proved this essential oil’s effects in vitro and in vivo.
Cinnamomum burmannii essential oil could not only promote the
proliferation and migration of skin stromal cells, but also promote
M2-type polarization of macrophages while inhibiting the expression of
pro-inflammatory cytokines. This study explored the possible mechanism
by which Cinnamomum burmannii essential oil promotes wound healing,
providing a cheap and effective strategy for promoting wound healing.
Keywords: Cinnamomum burmannii, wound healing, macrophages, essential
oil
1. Introduction
Skin is the body’s largest organ, providing a natural barrier against
external damage and exerting a variety of essential protective
functions [[42]1]. Wound is the disruption of the functional and
anatomical intactness of the epidermis or subcutaneous tissues caused
by external physical or chemical influences on the skin [[43]2]. Skin
wounds have a significant impact on the global healthcare system. It is
calculated that nearly 1 billion people are affected by acute and/or
chronic wounds [[44]3,[45]4]. Appropriate medicines and formulations
are necessary to prevent wound development and accelerate healing due
to the rising medical costs [[46]5].
Skin wounds can be classed as acute or chronic depending on the
pathogenesis and consequences [[47]6]. Wound repair is a multi-step
process that involves coordinating multiple cell types and signaling
molecules [[48]7]. The process can be classified into four distinctive
but interlinked stages: hemostasis, inflammation, proliferation and
remodeling [[49]7]. Hemostasis begins immediately after injury.
Activated platelets form fibrin clots and last from seconds to minutes
[[50]8,[51]9]. The inflammatory phase occurs after hemostasis and is
characterized by successive infiltration of neutrophils, macrophages
and lymphocytes [[52]10]. In particular, factors such as infection can
extend this period. An excessive inflammatory reaction interferes with
continued wound healing and eventually results in scarring through
continued stimulation of fibroblasts. The proliferative stage is
primarily controlled by fibroblast and angiogenesis processes and is
characterized by the formation of granulation tissue [[53]11]. During
wound healing, new blood vessels and fibroblasts are generated, which
in turn produce myofibroblasts. The contraction of myofibroblasts leads
to a reduction in the wound area. The final stage of wound healing,
known as the maturation stage, begins 2–3 weeks after tissue injury.
During this stage, the formation of granulation tissue ceases, and
collagen remodeling takes place [[54]12].
The switch from the initially inflammatory phase to the proliferative
phase is a critical point in determining the outcome of healing, and
excessive inflammation is detrimental to wound repair [[55]10,[56]13].
Macrophages are recognized as the primary contributors to the
transition from the inflammatory phase to the proliferation phase. They
play a critical role in inflammation, fibrosis and wound healing by
releasing cytokines and growth factors. There are two major subtypes of
macrophages: classically activated M1 macrophages, which have
inflammatory properties, and alternative activated M2 macrophages,
which have anti-inflammatory properties. Macrophage M1 polarization can
be induced by lipopolysaccharide (LPS) through the activation of the
major transcription factor nuclear factor κB (NF-κB). Inhibition of the
NF-κB pathway is effective in suppressing macrophage M1 polarization
[[57]14]. Jian Xie et al. constructed aligned nanofibers. The material
was found to enhance wound healing by reducing the pro-inflammatory M1
phenotype, upregulating the pro-healing M2 phenotype and attenuating
the local inflammatory reaction of skin wounds [[58]15]. Zhuolong Tu et
al. designed bioactive materials with anti-inflammatory, antioxidant,
and antibacterial properties and M2 polarization function to provide
efficient strategies for wound repair in the treatment of diabetes
mellitus [[59]16]. These findings suggest that inhibiting macrophage M1
polarization and the secretion of inflammatory factors contributes to
promoting wound healing.
Cinnamomum burmannii is a valuable timber tree with aromatic properties
that belongs to the Lauraceae family [[60]17]; it is a medicinal plant
that has been classified into four chemotypes based on the varying
compositions of its essential oil from leaves and bark: cymene/cineol
type, cineol type, cineol/borneol type and borneol type
[[61]18,[62]19]. The chemical type of the Meipian tree (Cinnamomum
burmannii) from Meizhou city of Guangdong Province is the borneol type,
and its fresh leaves are rich in D-borneol. Cinnamomum burmannii is an
ancient herb with satisfactory curative effects in China. It contains
more than 100 monoterpene and sesquiterpene compounds, including
borneol, 1,8-cineol, linalool and cinnamaldehyde [[63]19]. Cinnamomum
burmannii has been proven to have effects on analgesia, antibacterial
activity, antidiabetic properties, antifungal activity, antioxidant
activity and antirheumatic properties. The bark powder of Cinnamomum
burmannii can be used to treat nausea, gastrointestinal upset, cough,
chest discomfort, stomach pain and diarrhea [[64]20].
Essential oils (EOs) are products obtained from plants by distillation
with water or steam, or by mechanical processes or “dry distillation”,
and then by physical separation of the essential oils from the aqueous
phase [[65]21]. EOs have been extensively studied for their treatment
potential in a variety of diseases [[66]14,[67]22]. Studies indicate
that essential oils have a positive effect on cardiovascular disease,
respiratory disease, and wound healing [[68]23,[69]24,[70]25]. The
essential oil of Bursera morelensis has been found to promote wound
healing in mice by stimulating the migration of fibroblast cells to the
wound site, making them actively involved in collagen production and
promoting collagen remodeling [[71]26]. The chemical diversity of
essential oils and their ability to interact with various biological
targets at the cellular and multicellular levels account for their
diverse pharmacological properties. As a result, essential oils are a
promising source for the development of new drugs [[72]27]. However,
there have been no reports about the effects of Cinnamomum burmannii
essential oils (BEOs) on wound healing.
In this study, GC-MS was used to determine the essential oil components
of the Cinnamomum burmannii tree, and network pharmacological
prediction was used to explore the pharmacological mechanism of BEO.
Subsequently, the antibacterial activity of Cinnamomum burmannii
essential oil on common Escherichia coli and Staphylococcus aureus on
the skin surface was explored. The possible molecular mechanism and
application of prune tree essential oil in promoting wound healing were
verified firstly in vitro and in vivo. The study found an affordable
and readily available treatment for skin wounds and established a
foundation for the future development of BEO for use on the skin.
2. Results
2.1. Chemical Characterization of Essential Oil
The essential oil extracted from Cinnamomum burmannii was analyzed
using GC-MS to identify its constituents. The outcomes are presented in
[73]Figure 1 and [74]Table 1. The NIST11 standard mass spectrum library
identified thirty-two types of chemical compounds with a match degree
of over 80%, accounting for 95.44% of the total components in BEO. The
main compounds were endo-borneol (43.34%), linalyl propanoate (11.91%),
bornyl ester (10.48%) and eucalyptol (8.42%). Other important
components were (+)-2-bornanone (3.80%), α-terpineol (2.03%),
caryophyllene (1.84%) and terpinen-4-ol (1.69%) ([75]Table 1).
Figure 1.
[76]Figure 1
[77]Open in a new tab
GC-MS analysis of Cinnamomum burmannii essential oil total ion flow
diagram.
Table 1.
Chemical composition of Cinnamomum burmannii essential oil.
Number Rt (min) Abundance (%) Compound SI (%)
1 3.2 0.53 Propylene Glycol 90
2 6.09 1.57 (+)-α-Pinene 96
3 6.52 0.86 Camphene 97
4 7.34 0.59 β-Thujene 93
5 7.4 1.19 β-Pinene 97
6 8.02 0.52 β-Myrcene 87
7 8.61 0.26 α-Thujene 87
8 9.16 1.56 o-Cymene 97
9 9.28 1.49 D-Limonene 99
10 9.36 8.42 Eucalyptol 97
11 11.89 0.19 (+)-4-Carene 97
12 12.77 11.91 Linalyl propionate 97
13 13.31 0.28 Linalyl acetate 84
14 13.93 3.8 (+)-2-Bornanone 98
15 15.16 43.34 endo-Borneol 96
16 15.69 1.69 Terpinen-4-ol 96
17 16.59 2.03 α-Terpineol 91
18 20.1 10.48 Isobornyl acetate 99
19 25.56 1.84 Caryophyllene 99
20 27.0 0.67 1,5,9,9-Tetramethyl-1,4,7-cycloundecatriene 98
21 27.28 0.01 Humulene 81
22 28.21 0.13 β-copaene 93
23 28.42 0.13 β-Selinene 99
24 28.78 0.29 Bicyclogermacrene 93
25 30.05 0.03 Cadina-1(10),4-diene 91
26 32.41 0.32 (−)-Spathulenol 91
27 32.92 0.63 Guaiol 99
28 34.2 0.04 (+/−)-Cadinene 89
29 34.36 0.39 1H-Cycloprop[e]azulen-7-ol,
decahydro-1,1,7-trimethyl-4-methylene-,
[1ar-(1aalpha,4aalpha,7beta,7abeta,7balpha)]- 86
30 35.05 0.1 (−)-α-Gurjunene 96
31 35.13 0.06 Oxo-Tremorine 90
32 35.45 0.09 β-Eudesmene 93
[78]Open in a new tab
2.2. BEO Network and Shared Targets with Wound Healing
After 32 candidate bioactive ingredients were eliminated, 168 potential
targets were obtained from the drug database for further analysis. The
2447 wound-healing-related targets in the database were then compared
with the aforementioned 704 potential targets for compounds in BEO, and
71 overlapping targets were found ([79]Figure 2A). The results showed
that the BEO has the potential to promote wound healing. A
component–target network was constructed based on 71 assumed targets
for BEO wound-healing treatment, as shown in [80]Figure 2B.
Figure 2.
[81]Figure 2
[82]Figure 2
[83]Figure 2
[84]Open in a new tab
Network pharmacology predicts the possible factors of BEO promoting
wound healing. (A) Compound–disease targets were intersected using a
Venn diagram. (B) The herb–component–target network for Cinnamomum
burmannii essential oil in wound-healing treatment. Yellow: herb; Pink:
component; Purple: target. (C) The top 20 core genes of the PPI
network. (D) Protein–protein interaction (PPI) network of intersecting
targets. Green: protein target; Yellow: core protein target; Pink:
Visual analysis of core protein target interactions. (E) GO analysis.
(F) KEGG analysis. BP: biological process, CC: cellular component, MF:
molecular function.
The above 71 putative targets were analyzed through the STRING database
for protein interaction and the network was visualized using Cytoscape
([85]Figure 2D). Then, according to the degree value, the top 20 key
targets of the PPI network were identified ([86]Figure 2C). Among them,
EGFR, PTGS2, ESR1, MAPK3 and other targets are located in the center of
the network and have significant regulatory functions in the PPI
network. EGFR can activate the MAPK signaling pathway, causing a
downstream cascade reaction to regulate cell proliferation,
differentiation and migration. In the biological process analyzed by
GO, inflammation and immune response attracted our attention, and too
strong inflammation and immune response would delay the wound healing
process, suggesting that the BEO may promote wound healing by reducing
inflammation ([87]Figure 2E). Pathway enrichment analysis based on the
KEGG pathway revealed potential targets associated with the steroid
hormone synthesis, efferocytosis and adhesion junction signaling
pathways ([88]Figure 2F).
2.3. BEO Promoted Wound Healing In Vitro
When the skin is wounded, harmful bacteria such as Escherichia coli and
Staphylococcus aureus can easily invade the tissues, causing infection
and tissue damage [[89]28]. We revealed the essential oil inhibited
bacteria and fungi to varying degrees. [90]Table 2 shows the
bacteriostatic zone morphology and area of BEO against E. coli and S.
aureus. The results showed that the MIC of BEO against E. coli and S.
aureus was 16 mg/mL, and the MBC against E. coli and S. aureus was 32
mg/mL.
Table 2.
Sensitivity of strains to BEO evaluated using the disc diffusion method
and MIC and MBC of BEO.
Microorganisms Diameters of Inhibition Zone (mm) MIC MBC
EGF 10 mg/mL 30 mg/mL 50 mg/mL 70 mg/mL BEO (mg/mL)
S. aureus 6.0 6.0 9.6 ± 0.42 11.2 ± 0.28 14.79 ± 0.45 16 32
E. coli 6.0 7.34 ± 0.21 8.56 ± 0.53 10.16 ± 0.45 13.8 ± 0.38 16 32
[91]Open in a new tab
During wound healing, neighboring stromal cells are required to migrate
to the wound site and then proliferate. The effect of proliferation was
studied by the CCK8 activity assay. The results showed that BEO had a
positive concentration correlation for promoting the proliferation of
HaCaT cells when the concentration was 100–300 μg/mL. The proliferation
of HaCaT cells reached a maximum of 149% when the BEO concentration was
300 μg/mL, and the proliferation of L929 cells reached a maximum of
134% when the BEO concentration was 250 μg/ mL ([92]Figure 3A,B). In
vitro scratch wound assays on HaCaT and L929 monolayers were used to
evaluate the effect of the extracts on skin cell migration. The results
showed that BEO levels at 150, 200, 250 and 300 μg/mL could promote the
migration of HaCaT cells and L929 cells ([93]Figure 3C–F).
Figure 3.
[94]Figure 3
[95]Figure 3
[96]Open in a new tab
Effects of BEO on fibroblasts and epithelial cells in vitro. (A,B) The
proliferation effect of BEO on HaCaT and L929 cells was determined by
CCK8. Wound scratch assay of L929 cells and HaCaT cells, which were
incubated with PBS (Ctrl), 150 μg/mL, 200 μg/mL, 250 μg/mL and 300
μg/mL BEO for 48 h. Migration rate (C,D) and representative scratch
images (E,F) of each group are shown. Scale bar: 100 μm. n = 3. *, p <
0.05; **, p < 0.01; ****, p < 0.0001; ns, not significant.
2.4. BEO Attenuated Inflammatory Response In Vitro
Excessive inflammation can disrupt tissue homeostasis and hinder wound
healing. Macrophages and secreted cytokines play an important role in
the wound-healing process. To simulate the excessive inflammation
caused by macrophages cell line, RAW 264.7 cells were treated with LPS,
and the expression of inflammatory factors including IL-1β, IL-6 and
TNF-α was detected by q-PCR. The results showed that the mRNA
expression levels of IL-1β, IL-6 and TNF-α were significantly increased
after oil incubation ([97]Figure 4A). BEO had a more significant effect
on reducing the secretion of inflammatory cytokines in macrophages than
the positive drug epidermal growth factor (EGF). In addition, the
secretion of IL-6 and TNF-α was significantly decreased in a
dose-dependent manner ([98]Figure 4B).
Figure 4.
[99]Figure 4
[100]Figure 4
[101]Open in a new tab
BEO attenuated the inflammatory response in RAW 264.7 cells stimulated
by LPS. (A) qPCR of IL-1β, IL-6 and TNF-α levels in RAW 264.7 cells
that were stimulated by LPS at 24 h from different groups. (B) The
level of IL-6 and TNF-α secreted by RAW 264.7 cells treated with BEO
was determined by ELISA. (C) Effects of 150 μg/mL, 200 μg/mL, 250 μg/mL
and 300 μg/mL BEO on the expression of NF-κB/p-IκBα protein. (D) The
cell typing of RAW 264.7 was detected by flow cytometry. Polarization
rate (D) and sectional images (E,F) of each group are shown. n = 3. *,
p < 0.05; **, p < 0.01; ***, p < 0.001; **** p < 0.0001; ns, not
significant.
Macrophage polarization is involved in many signaling pathways, such as
the NF-κB, JAK2/STAT3, ROS/ERK and mTOR signaling pathways [[102]29].
Western blot analysis was performed to detect the expression of related
proteins in RAW 264.7 cells treated with LPS. The results demonstrated
that the essential oil significantly reduced the levels of NF-κB p65
and p-IκBα in a dose-dependent manner after LPS activation ([103]Figure
4C). Flow cytometry was utilized to analyze the effects of different
concentrations of BEO on the polarization of macrophages into M1 and M2
phenotypes. The findings indicated that at concentrations of 150 and
200 μg/mL, there was no significant difference observed in the
inhibition of M1 polarization or the promotion of M2 polarization in
macrophages ([104]Figure 4E,F). However, at concentrations of 250 and
300 μg/mL, BEO exhibited inhibitory effects on M1 polarization and
promoted M2 polarization in macrophages. In comparison to the
LPS-stimulated group, BEO concentrations of 250 and 300 μg/mL reduced
the polarization of M1 macrophages by 4.89% and 9.8%, respectively,
while increasing the polarization of M2 macrophages by 2.3% and 4.5%,
respectively ([105]Figure 4D).
2.5. BEO Promoted Wound Healing In Vivo
The effect was proved in vitro, but its mechanism of action in vivo
remained unclear. To investigate this further, experiments were
conducted on skin-cut mice. Medication was administered on the third
day after molding to assess the effect of BEO on incision wounds in
vivo. Different concentrations of BEO were applied to surgical wounds
in mice and compared with the control group (wound without any
treatment), positive control group (EGF) and negative control group
(PBS). The effect was verified by the change in wound area ([106]Figure
5A). Compared to the healing rate of the control group (62.39%), the
wound-healing rates of 10%BEO (74.37%), 20%BEO (79.51%) and 30%BEO
(81.72%) were all higher.
Figure 5.
[107]Figure 5
[108]Figure 5
[109]Open in a new tab
BEO accelerates skin wound healing in mice. (A) Representative images
of skin wounds of mice treated by PBS, EGF, 10% BEO, 20% BEO and 20%
BEO after 8 days. (B,C) PBS, EGF, 10% BEO, 20% BEO, and 20% BEO groups.
n = 3. (D) Representative images of the healed skin area on day 8 with
hematoxylin–eosin (HE), Masson trichromatic staining and
immunohistochemistry of α-SMA and CD3 antibodies; scale bar: 200 μm. *,
p < 0.05; **, p < 0.01; ns, not significant.
The HE staining results showed that the skin structure of the EGF group
and 30%BEO group was more complete, the epidermal layer was thinner,
keratinization was improved, and hair follicles and glands were formed
compared with the model group ([110]Figure 5D). The collagen fibers
(blue) in the EGF group and 30%BEO group were more abundant and more
orderly than those in other groups, as determined by Masson staining
([111]Figure 5D). The α-SMA immunohistochemistry results showed that
the expression of α-SMA (brown) was significantly up-regulated in the
model group and the negative control group compared with the EGF group
and the BEO group at different concentrations, as shown in [112]Figure
5D. BEO reduces the infiltration of CD3+ T cells in the local
microenvironment at the wound site, which is consistent with the
wound-healing process ([113]Figure 5D).
2.6. BEO Reduces the Levels of Inflammatory Factors in the Healing Skin
The mRNA levels of inflammatory factors TNF-α, IL-1β and IL-6 in the
local wound microenvironment were detected, and TNF-α and IL-1β were
significantly decreased, especially in the 30%BEO group ([114]Figure
6D). In addition, compared with the model group, the expression of CD80
in the BEO-treated group was reduced, while CD206 was increased
([115]Figure 6C), which was consistent with the trend of the
wound-healing rate. Above all, BEO played a role in resisting external
infection, reducing inflammation levels and promoting wound healing.
Flow staining typing of lymphocytes isolated from the spleen of mice
showed that there was no significant difference in the positive rates
of CD4+ T cells and CD8+ T cells among all groups ([116]Figure 6A,B),
indicating that the local application of BEO had no significant
toxicity.
Figure 6.
[117]Figure 6
[118]Figure 6
[119]Open in a new tab
BEO reduces inflammatory factor expression, as well as promoting CD206
mRNA expression. (A,B) The types of spleen T cells were detected by
flow cytometry. (C) q-PCR levels of CD-80 and CD-206 in each group on
day 8 of the wound surface. (D) q-PCR levels of IL-1β, IL-6, and TNF-α
in each group on day 8 of the wound surface. *, p < 0.05; **, p < 0.01;
***, p < 0.001; ****, p < 0.0001; ns, not significant.
3. Discussion
Currently available drugs for wound healing are often expensive and
difficult to prepare. BEO, which is enriched with dextrose and has
antimicrobial and anti-inflammatory properties, has the potential to be
a more cost-effective and easily accessible wound healing treatment. In
this study, we determined the main components of BEO by gas
chromatography–mass spectrometry. The results showed that there were 32
chemical components in BEO, and borneol was the main component, which
was consistent with the results of Liu Xiaomin et al. [[120]30]. In
addition, our essential oil contained lower levels of caryophyllene and
bornyl acetate and higher levels of linalyl propanoate, bornyl ester
and eucalyptol than theirs. Among these components contained in BEO, it
was predicted by the STITCH database that α-terpineol might promote
fibroblast proliferation, which was experimentally verified by
Smiljanić K et al. [[121]31]. Eucalyptol has antioxidant and
anti-inflammatory effects, and eucalyptol-loaded nanoemulgel can
accelerate wound healing [[122]32], while borneol has antibacterial and
anti-inflammatory effects, and BEO’s ability to promote wound healing
may be related to these components. In addition, we selected
phytochemicals in the essential oil of Cinnamomum burmaannii that may
be related to the promotion of wound healing, analyzed their
pharmacological effects and compared them with other cinnamon varieties
(Cinnamomum cassia, Cinnamomum verum and Cinnamomum loureiroi), and the
specific results are shown in [123]Table 3. Moreover, we also found
that BEO could inhibit Escherichia coli and Staphylococcus aureus.
Table 3.
The phytochemicals and pharmacological activity of various Cinnamomum
species.
Cinnamum Plant Phytochemicals Pharmacological Activity
C. burmaannii α-Terpineol
Eucalyptol
Borneol Increased fibroblast viability and/or proliferation [[124]33].
Antioxidant and anti-inflammatory [[125]31].
Antibacterial and anti-inflammatory [[126]32].
C. cassia Cinncassiol G and cinnacasol
Cinnamaldehyde Inhibitory effects against proliferation of T cells and
B cells [[127]34].
Stimulates angiogenesis, promotes blood circulation [[128]35].
Anti-inflammatory and analgesic [[129]36].
C. verum Cinnamaldehyde
benzyl benzoate Antifungal and antioxidant [[130]37].
Increasing cell proliferation, collagen synthesis, and
reepithelialization ratio [[131]38].
C. loureiroi Tannins and saponins Astringents, healing, antiexudative,
anti-irritative, anti-inflammatory, antiseptic, anesthetic and
antioxidant [[132]39].
[133]Open in a new tab
Our network pharmacology results suggested that BEO may promote wound
healing by stimulating cell proliferation and migration, as well as
modulating inflammatory and immune responses. We subsequently performed
experiments to test this hypothesis in vitro and in vivo. Besides
promoting skin stromal cell proliferation and migration, BEO
significantly reduced the mRNA expression levels of IL-1β, IL-6, and
TNF-α through the NF-κB pathway in RAW 264.7 cells. Additionally, the
flow results showed that BEO could inhibit macrophage M1 polarization
and promote M2 polarization. In animal experiments, the effect of BEO
on wound healing in mice was studied. BEO with a 30% concentration had
the best healing effect. Histological analysis of skin tissues revealed
that the skin structure was more complete and collagen fibers were more
regularly arranged in the treated group than in the model group.
Additionally, the expression levels of inflammatory factors TNF-α,
IL-1β and IL-6 in the local wound microenvironment of the treatment
group were reduced, which was consistent with the wound-healing
process. Excessive inflammatory factors during wound healing could lead
to scar formation and slow wound healing in later stages [[134]40], and
the results suggested BEO may also reduce scar formation during wound
healing. The possible mechanism by which BEO promotes wound healing is
shown in [135]Figure 7.
Figure 7.
[136]Figure 7
[137]Open in a new tab
Graphical abstract: mechanism by which Cinnamomum burmannii essential
oils promote wound healing.
Our study demonstrated that BEO promotes skin wound healing in mice and
explored some possible mechanisms, which provided some basis for the
future development of this essential oil for other applications.
However, this study had some limitations. We did not investigate the
individual essential oil ingredients to validate their specific roles,
and further research is needed.
4. Materials and Methods
4.1. Materials
Cinnamomum burmannii essential oil (BEO) was provided by huaqingyuan
Biotechnology Co., Ltd. (Meizhou, China). Other materials used were
Dulbecco’s modified Eagle medium (Thermo fisher, Waltham, MA, USA),
penicillin/streptomycin (Gibco, Waltham, MA, USA), and fetal bovine
serum (EallBio, Beijing, China). Monoclonal antibodies against β-actin,
and NF-κB p65 were purchased from MedChemExpress Inc. (MCE, Monmouth
Junction, NJ, USA). Epidermal growth factors (Sigma–Aldrich, St. Louis,
MO, USA), RNA isolater Total RNA Extraction (Vazyme, Nanjing, China),
lipopolysaccharide (LPS) (Escherichia coli, serotype 0111:B4) and all
other chemicals were obtained from Sigma Chemicals (St Louis, MO, USA).
4.2. Gas Chromatography–Mass Spectrometry (GC-MS) Characterization of BEO
The essential oil from Cinnamomum burmannii was characterized by gas
chromatography–mass spectrometry (GC-MS). The GC-MS system used was an
Agilent Technologies gas chromatograph (model 7890A) (Agilent, Santa
Clara, CA, USA) linked to a mass spectrometer (model 5975C) (Agilent,
Santa Clara, CA, USA) fitted with an HP-5MS column (30.0 m × 250 μm
i.d. and 0.25 μm film thickness). The sample was injected by split,
using 1 μL of BEO. The experiment began at a starting temperature of 50
°C and then increased to 145 °C at a rate of 3 °C/min. It then rose to
250 °C at a rate of 5 °C/min. The gasification chamber temperature was
maintained at 240 °C, while the transmission line temperature was kept
at 250 °C. The carrier gas used was helium with a flow rate of 1.0
mL/min. Qualitative analysis was performed using the MS database NIST11
and retention time to identify the detected components. The screening
results of the database should exclude the column loss peak.
Quantitative analysis: The area-normalized quantitative method
expresses the quantitative result as the ratio of the peak area of the
determined component to the sum of the areas of all determined
components. The following formula is used for this method.
[MATH: Ci=AiA1+A2+A3+…Ai+…An×100% :MATH]
where the following definitions hold: C[i]—the content of an identified
ingredient, %; Ai—the peak area of an identified component; n—the total
number of identified components.
4.3. Bacterial Strains
Escherichia coli ATCC 25922 (E. coli) and Staphylococcus aureus (S.
aureus) ATCC 25923 were both obtained from the Industrial Microbial
Culture Collection and Management Center of China and routinely
cultured on Luria-Bertani (LB) liquid medium.
4.4. Antimicrobial Activity of the BEO
The antibacterial activity of the essential oil was determined by the
disc diffusion method. The medium for microbial growth was LB solid
medium. The medium was sterilized at 110 kPa pressure in an autoclave
at 121 °C for 20 min. Then, 8 mL of LB solid medium was added into a 10
mL dish, and after the medium cooled completely, 0.1 mL bacteria was
inoculated with a McFarland ratio of 0.5. The sterile test strip
(diameter 6 mm) was placed on the surface of the inoculation medium and
impregnated with 60 μL essential oil solution at the concentrations of
10 mg/mL, 30 mg/mL, 50 mg/mL and 70 mg/mL (1:10 v/v, 10% ethanol). The
samples were incubated at 37 °C for 24 h. The diameter of the
inhibition zone was measured after incubation. The presence of a
bacteriostatic zone indicated that the essential oil had bacteriostatic
activity. The solvent 10% ethanol was used as the negative control.
4.5. MIC and MBC
The microdilution method was used to determine the minimum inhibitory
concentration (MIC) and minimum bactericidal concentration (MBC) of the
essential oil. The essential oil was dissolved in 10% ethanol and then
diluted in MHB medium with concentrations ranging from 2 μg/mL to 256
μg/mL. A 96-well microporous plate was used to carry out the
microdilution experiment, and 180 μL of each essential oil solution and
20 μL of each bacterium with a 0.5 McFarland ratio were taken. The
negative control was treated with MHB medium supplemented with 10%
ethanol. The 96-well plates were incubated under a bacterial incubator
for 24 h. The absorbance at 600 nm was then measured. The MIC is the
lowest essential oil concentration with 100% inhibition of bacterial
growth. To determine the MBC, 100 μL was removed from a hole without
bacterial growth and transferred to a Petri dish (100 mm diameter)
containing LB solid medium (15 g/L Agar) that was then stored in a
laboratory oven at 37 ± 2 °C for 24 h. Concentrations of essential oils
that did not show bacterial growth after 24 h of incubation were
considered fungicides.
4.6. Network Construction and Prediction of Genes Associated with Wound
Healing
The chemical composition of the input was determined through GC-MS
analysis via Pub Chem ([138]https://pubchem.ncbi.nlm.nih.gov/ (accessed
on 15 November 2023)), and then Swiss Target Prediction
([139]http://www.swisstargetprediction.ch (accessed on 15 November
2023)) was applied to predict targets based on the primer obtained.
Finally, wound-healing protein targets were retrieved from the OMIM
([140]https://www.omim.org/ (accessed on 15 November 2023)), Gene Cards
([141]https://www.genecards.org (accessed on 15 November 2023)) and CTD
([142]http://ctdbase.org/ (accessed on 15 November 2023)) databases.
After eliminating duplicate genes, we analyzed the two genes to
identify potential targets. Next, we input these targets into STRING
([143]https://string-db.org/ (accessed on 11 January 2024)) to obtain
relevant details on protein interactions. We then created a
protein–protein interaction (PPI) network using Cytoscape.
Subsequently, we enriched the candidate targets using Gene Ontology
(GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with
Metscape ([144]https://metascape.org/ (accessed on 11 January 2024)).
4.7. Cell Culture
RAW 264.7 cells, L929 cells (L929 mouse fibroblast cells) and HaCaT
cells (human keratinocyte cell line) were cultured in Dulbecco’s
modified eagle medium (DMEM, Gibco, Waltham, MA, USA) supplemented with
10% (v/v) fetal bovine serum and 1% (v/v) penicillin/streptomycin (P/S,
Gibco, Waltham, MA, USA). When the cells grew to 80~90% density, the
cells were washed with PBS and then digested with 0.25% pancreatic
enzyme for centrifugation, and the RAW 264.7 cells did not need
pancreatic enzyme for digestion.
4.8. In Vitro Cell Viability and Cytotoxicity Test
The cell viability and cytotoxicity of BEO were evaluated in different
skin cell lines (HaCaT and L929) by cell counting kit-8 (CCK8) assay.
Cell suspensions with a density of 5 × 10^5 cells /mL were uniformly
inoculated on 96-well plates with 100 μL per well and then placed in
incubators for overnight culture, and the old medium was removed. Then,
100 μL of fresh medium was added to the control group, and 100 μL of
medium mixed with the drug solution was added to the administration
hole, and the culture was continued for 24 h. The medium was removed,
100 μL of CCK-8 reagent was added to each well, and the wells were
incubated at 37 °C for 1~2 h away from light. Absorptivity (OD) at 450
nm was determined by enzyme labeling.
4.9. Scratch Assay
When L929 cells or HaCaT cells reached 90% confluence in 6-well plates,
we used a 200 μL pipette tip to vertically scratch the monolayer. Three
scratches were repeated in each well, and detached cells were gently
washed with PBS to form three clean and straight lines in one
direction.
Then, cells were replenished with 10% DMEM, and each well was
supplemented with 100 μL PBS (Ctrl), 150 μg/mL BEO, 200 μg/mL BEO, 250
μg/mL BEO or 300 μg/mL BEO. In addition, each well was supplemented
with 200 μL of culture medium with cultured peripheral blood
mononuclear cells to simulate the immune environment. After 24 h or 48
h, images were captured with a light microscope to record the cells’
migration. Image J 1.54d software was used for scratch area
measurement. The calculation formula for the migration rate was as
follows:
[MATH:
Migration Ra
te(%)=Scratch Areat=<
/mo>0−Sc<
mi>ratch A<
/mi>reat=
nScr<
/mi>atch A<
mi>reat=0×100% :MATH]
4.10. Quantitative Real-Time PCR
The total RNA of RAW 264.7 cells was extracted with TRIzol^® (Vazyme,
Nanjing, China) reagent and reverse transcribed into complementary DNA
(cDNA) with EasyScript^®All-in-One SuperMix (Trans Gen, Beijing,
China), and qPCR was performed with a thermal cycler, using
PerfectStart™SYBR Green I (Vazyme, Nanjing, China) as the fluorophore.
Next, mRNA levels of IL-1β, IL-6 and TNF-α were detected by qPCR. The
primers we used are listed in [145]Table 4.
Table 4.
The primer sequences of qPCR.
Gene Forward Primer
Sequence 5′–3′ Reverse Primer
Sequence 5′–3′
Mouse β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
Mouse IL-1β GAAATGCCACCTTT TGACAGTG TGGATGCTCTCAT CAGGACAG
Mouse IL-6 CTGCAAGAGACT TCCATCCAG AGTGGTATAGACAGG TCTGTTGG
Mouse TNF-α
CD80
CD206 CTGAACTTCGGGGTGATCGG
CCTCAAGTTTCCATGTCCAAGGC
AAACACAGACTGACCCTTCCC GGCTTGYCACTCGAA TTTTGAGA
GAGGAGAGTTGTAACGGCAAGG
GTTAGTGTACCGCACCCTCC
[146]Open in a new tab
4.11. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
After 24 h of cell administration, the cell supernatant was placed into
a new tube. Culture medium samples were stored at −80 °C until ELISA
detection. Using a mouse IL-6 and TNF-α specific ELISA kit, according
to the manufacturer’s instructions, concentrations of IL-6 and TNF-α
were measured three times in each independent experiment.
4.12. Flow Cytometry
After treatment, the cells were removed from the culture plates and
washed in a centrifuge tube. First, 100 μL of CD16/32 (1:1000 dilution)
was added to block the non-specific binding antibody. Then, 100 μL of
APC-coupled anti-CD80 antibody (1:1000 dilution) and Brilliant Violet
421-coupled anti-CD206 antibody (1:1000 dilution) were double-stained
at 37 °C in the dark for 20 min. After two steps of PBS washing, APC
and Brilliant Violet 421 fluorophores were detected by a flow cytometry
system (Beckman Coulter, Brea, CA, USA). For each sample, 3000 events
were recorded.
4.13. Western Blot
First, RAW 264.7 cells were cultured in 10% DMEM containing different
concentrations of BEO (150 μg/mL, 200 μg/mL, 250 μg/mL, 250 μg/mL and
300 μg/mL BEO) for 24 h. The cells were lysed with RIPA lysis buffer
supplemented with protease inhibitor cocktail tablets, iced for 30 min
and quantified at equal protein weight. Protein samples were separated
by 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis
(SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes.
Each PVDF membrane was blocked by 5% skim milk for 2 h, separated and
incubated with NF-κB p65, p-IKB α, IKB α, β-actin primary antibody and
corresponding secondary antibody at 4 °C overnight. Protein bands were
displayed using an ECL chemiluminescence kit. Image J software was used
to quantitatively analyze protein bands.
4.14. Animal Models and Drug Administration
BALB/c male mice, aged 6 weeks, were obtained from Shenzhen Maike
Biotechnology Co., LTD, Shenzhen, China. They were kept in a controlled
environment with a 12 h light/dark cycle, at a temperature of 20–24 °C
and a humidity of 45–55%. The animal experiment protocols were approved
by the Sun Yat-sen University Animal Ethics Committee in China
(SYSU-IACUC-2024-000237).
The animal experiment design was as follows: after one week of
acclimatization, mice were randomly divided into 6 groups (n = 3); the
model group; PBS group; EGF group; and 10%BEO, 20%BEO and 30%BEO (v/v)
treatment groups. An appropriate amount of 1% pentobarbital was
injected intraperitoneally for anesthesia, and then hair shaving and
hair removal were performed on the lower left side of the back spine.
The skin was perforated with an 8 mm skin punch to the depth of the
fascia layer to establish a uniform skin incision.
The wound site was treated once a day on the 3rd, 4th and 5th days
after modeling. The weight changes of the mice were recorded every day,
and the wounds of the mice were photographed every other day. The drug
was administered on the third day after modeling, every 24 h, and the
administration continued for three days. The weight changes of the mice
were recorded every day, and the wounds of the mice were photographed
every other day (with a circular control ring as a reference); then,
Image J was used. The software analyzed the wound healing. On the 9th
day, the mice were dissected, the wound-healing skin tissue was cut for
RNA extraction and pathological analysis and the spleens of the mice
were taken to analyze the typing of T cells.
4.15. Histology and Immunohistochemistry Analysis
Briefly, skin tissue samples were immersed in 4% paraformaldehyde
overnight, dehydrated with alcohol, cleared with xylene and then
embedded with paraffin wax and cut into 5 μm thick paraffin sections.
Paraffin sections were stained with hematoxylin (H&E) and Masson
trichrome staining, embedded in paraffin and cut into 5 μm thick
paraffin sections. Paraffin sections were degummed, rehydrated and
subjected to heat-induced epitope extraction for immunohistochemical
analysis. Then, they were incubated with primary antibodies of CD3 and
alpha smooth muscle (α-SMA) and corresponding secondary antibodies.
Slides were used for light microscopy with 100× magnification for
observation, and three random fields of view were captured.
4.16. Flow Cytometry Was Used to Detect the Activation of Spleen T Cells
The spleen was fully ground on a screen, the screen was rinsed with 1
mL PBS, the screen was rinsed repeatedly for more than 5 times, the
centrifuge tube containing cell suspension was centrifuged, the
single-cell precipitation of the spleen was supplemented with 2 mL red
cell lysate, and the spleen was lysed on ice for 5 min and then
centrifuged at 1500× g. Then, 100 μL cell stain buffer, 1 μL APC
anti-mouse CD4 antibody, 1 μL Brilliant Violet 421TM anti-mouse CD8a
antibody and 1 μL FITC anti-mouse CD3 antibody were added to the cell
precipitation. After blowing and mixing, the cell precipitation was
incubated in ice for 15 min under dark light and then centrifuged at
1500× g, 4 °C, for 5 min. The activation of CD4+ and CD8+ T cells in
splenic cell suspension was measured by flow cytometry.
4.17. Statistical Analysis
The mean ± standard error of the mean (SEM) was determined for all
treatment groups and analyzed by GraphPad Prism 7 (GraphPad Software
Inc., La Jolla, CA, USA). Each datum is the average of at least three
replicates for each group. Statistical analysis was conducted using a
t-test and one-way analysis of variance (ANOVA) by Tukey’s test. p <
0.05 indicates a significant difference (*, p < 0.05; **, p < 0.01;
***, p < 0.001; ns, not significant).
5. Conclusions
In this study, we investigated the anti-inflammatory, antibacterial and
other effects of BEO and confirmed its role in promoting wound healing
through in vivo and in vitro experiments. Furthermore, we found that
essential oil exhibits a certain antibacterial effect, which is
advantageous due to its complex composition that makes it less prone to
causing drug resistance. However, there are certain limitations in this
study, such as the identification of the specific component of
essential oil responsible for promoting cell proliferation and
migration, as well as the underlying mechanism. In future research, it
would be valuable to explore the potential application of this
essential oil in treating various skin diseases including cuts, burns,
diabetic feet, ulcers and infectious wounds. Overall, our findings
suggest that this essential oil holds promise as a therapeutic agent
for promoting tissue repair and regeneration.
Author Contributions
Conceptualization, X.Z., H.C., F.C., Y.P. and G.X.; methodology, J.C.;
software, X.L.; investigation, B.L.; resources, X.X.; writing—original
draft preparation, X.Y. All authors have read and agreed to the
published version of the manuscript.
Institutional Review Board Statement
The study was approved by the Sun Yat-sen University Animal Ethics
Committee in China (SYSU-IACUC-2024-000237).
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in the study are included in the
article, further inquiries can be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This work was supported by Yunfu 2021 Traditional Chinese Medicine
(Southern Medicine) Industry Talent Project—Southern Medicine Resource
Innovation Team; State Administration of Traditional Chinese Medicine
high-level key disciplines construction project (zyyzdxk-2023186);
Ministry of Science and Technology, Ministry of Finance, National
Science and Technology Resources Sharing Service Platform—National
Tropical Plant Germplasm Repository—Medicinal Plant Germplasm Resources
Sub-Repository (NTPGRC2021-020); Guizhou University of Traditional
Chinese Medicine Karst food and medicinal resources protection and
innovative use of scientific and technological innovation talent team
(Guizhou Chinese Medicine TD Hezi [2022] 001); Guangdong Pharmaceutical
University Rural Science and Technology Specialist Project: Research
and Demonstration on Selection and Breeding of Good Seeds and
High-Efficiency Cultivation Techniques of Ailanthus (Yuekehannongzi
[2020] No. 409).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data
contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI
and/or the editor(s) disclaim responsibility for any injury to people
or property resulting from any ideas, methods, instructions or products
referred to in the content.
References