Abstract
The viscoelasticity of mechanically sensitive tissues such as
periodontal ligaments (PDLs) is key in maintaining mechanical
homeostasis. Unfortunately, PDLs easily lose viscoelasticity (e.g.,
stress relaxation) during periodontitis or dental trauma, which disrupt
cell–extracellular matrix (ECM) interactions and accelerates tissue
damage. Here, Pluronic F127 diacrylate (F127DA) hydrogels with
PDL‐matched stress relaxation rates and high elastic moduli are
developed. The hydrogel viscoelasticity is modulated without chemical
cross‐linking by controlling precursor concentrations. Under
cytomechanical loading, F127DA hydrogels with fast relaxation rates
significantly improved the fibrogenic differentiation potential of PDL
stem cells (PDLSCs), while cells cultured on F127DA hydrogels with
various stress relaxation rates exhibited similar fibrogenic
differentiation potentials with limited cell spreading and traction
forces under static conditions. Mechanically, faster‐relaxing F127DA
hydrogels leveraged cytomechanical loading to activate PDLSC
mechanotransduction by upregulating integrin–focal adhesion kinase
pathway and thus cytoskeletal rearrangement, reinforcing cell–ECM
interactions. In vivo experiments confirm that faster‐relaxing F127DA
hydrogels significantly promoted PDL repair and reduced abnormal
healing (e.g., root resorption and ankyloses) in delayed replantation
of avulsed teeth. This study firstly investigated how matrix nonlinear
viscoelasticity influences the fibrogenesis of PDLSCs under mechanical
stimuli, and it reveals the underlying mechanobiology, which suggests
novel strategies for PDL regeneration.
Keywords: F127 hydrogels, mechanical regulation, periodontal ligaments,
viscoelastic hydrogels, viscoelasticity
__________________________________________________________________
Viscoelastic F127DA hydrogels with periodontal ligament (PDL)‐matched
stress relaxation rates significantly enhance the fibrogenic
differentiation of PDL stem cells under cytomechanical loading.
Mechanically, viscoelastic F127DA hydrogels harness mechanical stress
to reinforce cell–matrix interactions by activating integrin–focal
adhesion kinase–cytoskeleton linkages and exhibit potent therapeutic
effects on PDL injuries in the delayed replantation of avulsed teeth.
graphic file with name ADVS-11-2309562-g001.jpg
1. Introduction
Periodontal ligaments (PDLs) mechanically anchor teeth on the alveolar
bone and transfer mechanical loads to adjacent bone.^[ [46]^1 , [47]^2
^] Due to the hierarchical structure and gradients at soft–hard tissue
insertion sites, PDLs have a very high incidence of injury and are
susceptible to pathological stimuli, which is the leading cause of
tooth loss in adults.^[ [48]^3 ^] Globally, 1.1 billion cases of severe
periodontitis and 15–61% of cases of dental trauma are associated with
PDL injuries.^[ [49]^3 , [50]^4 , [51]^5 ^] Although many strategies
have been developed for reconstructing damaged PDLs, including but not
limited to cell sheets,^[ [52]^6 , [53]^7 ^] bioactive scaffolds
combined with growth factors or platelet‐rich fibrin,^[ [54]^7 , [55]^8
^] and enamel matrix derivatives,^[ [56]^9 ^] few advances have been
achieved due to the complex mechanical microenvironments and
hierarchical architectures of PDLs.^[ [57]^10 , [58]^11 , [59]^12 ^] In
the field of periodontal tissue engineering, significant progress has
been made in bone regeneration, and guided bone regeneration has been
proven to be effective in promoting the healing of both horizontal and
vertical bone defects.^[ [60]^13 , [61]^14 ^] However, the therapeutic
outcomes of guided tissue regeneration are far from achieving
satisfactory regeneration of the bone–PDL–cementum complex.^[ [62]^15
^] Hence, the repair of PDLs may be the main obstacle for the
regeneration of the bone–PDL–cementum complex, and finding effective
ways to revitalize PDLs can not only benefit the therapy of injured
PDLs in dental trauma but also promote the regeneration of the
bone–PDL–cementum complex.
PDLs are biomechanically active tissues whose primary function is to
bear cyclic mechanical loads and disperse mechanical loads from teeth
to the alveolar bone.^[ [63]^16 ^] In this mechanically stimulated
microenvironment, PDLs have mechanical adaptability and can reshape
themselves to maintain their intact structure.^[ [64]^17 ^] Under
abrupt mechanical loads, the collagen fibers in PDLs can stretch to
resist mechanical forces and show time‐dependent responses to
mechanical loading or deformation.^[ [65]^18 , [66]^19 ^] These unique
biomechanical properties of PDLs are termed viscoelasticity. The
viscoelastic properties of PDLs allow the relaxation of traction forces
exerted by resident cells on the surrounding extracellular matrix
(ECM), enabling the spreading, proliferation, and differentiation of
cells in 2D and 3D conditions.^[ [67]^20 , [68]^21 , [69]^22 ^]
Furthermore, the excellent viscoelasticity of PDLs enables them to
withstand large mechanical loads and dissipate the excess energy, which
can prevent the detrimental effects of excessive mechanical loads on
embedded cells.^[ [70]^23 , [71]^24 , [72]^25 ^] However, the
viscoelasticity of PDLs can be easily lost due to periodontitis or
dental trauma, compromising the biomechanical function of the
periodontium.^[ [73]^16 ^] Under such circumstances, the cell–ECM
interactions change, and even physiological mechanical loads can lead
to periodontal tissue damage. Therefore, recovering the mechanical
adaptability of the periodontium by restoring the biomechanical
properties of PDLs (e.g., viscoelasticity) is a novel and promising way
to promote periodontal regeneration.
Pluronic F127 diacrylate (F127DA) hydrogels are nanomicelle crosslinked
hydrogels with excellent viscoelasticity that can structurally and
biomechanically mimic PDLs.^[ [74]^26 ^] Moreover, F127DA hydrogels
have been widely used in drug delivery for periodontal regeneration.^[
[75]^27 , [76]^28 ^] Therefore, F127DA hydrogels were chosen for
fabricating viscoelastic biomaterials. By controlling the precursor
concentrations, F127DA hydrogels with tunable elastic modulus and
stress relaxation were successfully synthesized. Then, the effects of
viscoelastic F127DA hydrogels on the fibrogenic differentiation of PDL
stem cells (PDLSCs) were investigated under static conditions and under
cytomechanical loading. Given that mechanotransduction determines how
cells translate extracellular mechanical stimuli to intracellular
biochemical signals,^[ [77]^29 ^] the effects of F127DA hydrogels on
the activation of integrin–focal adhesion kinase (FAK) signaling and
cytoskeletal rearrangement were further evaluated under cytomechanical
loading. Finally, the repair‐promoting functions of viscoelastic F127DA
hydrogels were tested in the delayed replantation of avulsed teeth.
These findings, for the first time, have elucidated how hydrogels with
stress relaxation determine cellular behaviors under cytomechanical
loading and have suggested a new strategy to promote the regeneration
of PDLs.
2. Results and Discussion
2.1. The Mechanical and Rheological Characterization of F127DA Hydrogels
In the present study, we fabricated F127DA hydrogels to mimic the
viscoelastic properties of PDLs. The reason for this choice is that
F127DA hydrogels can self‐assemble into nanomicelles that closely
resemble the nanofibers of PDLs through photoinitiated free radical
copolymerization.^[ [78]^26 , [79]^30 ^] Moreover, the F127DA hydrogels
exhibit minimal degradation due to the main covalent intramicelle
bridging and adjacent intermicelle crosslinks in the networks, which
can offer durable and consistent physical and chemical characteristics
for investigating the effects of viscoelastic properties on cells.^[
[80]^26 ^] Furthermore, F127DA hydrogels are highly versatile, with
tunable viscoelasticity and other excellent physiochemical properties,
such as low swelling and high strength, which are also quite suitable
for PDL repair.^[ [81]^31 , [82]^32 ^] First, the successful synthesis
of F127DA was confirmed by Fourier transform infrared spectroscopy
(FT‐IR). As shown in Figure [83]1A, it was found that both F127 and
F127DA displayed the representative absorbance peaks of C─O stretching
at 1097 cm^−1, in‐plane O─H bending at 1342 cm^−1, and C─H aliphatic
stretching at 2879 cm^−1. However, the characteristic peak of C═O
stretching vibration at 1724 cm^−1 was only evident in the FT‐IR
spectrum of F127DA, indicating that F127DA was successfully synthesized
by grafting a vinyl group onto F127 through a condensation reaction.
Then the porosity, microstructure, elastic modulus, and viscoelasticity
of F127DA hydrogels with different concentrations were evaluated by the
liquid displacement method, scanning electron microscopy (SEM), cyclic
loading‒unloading compressive tests, and rheological tests. As shown in
Figure [84]1B, the porosity of F127DA hydrogels decreased with the
concentration; and the porosity of the F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels was 96.16 ± 0.43%, 92.91 ± 0.78%, and 85.23 ±
0.57%, respectively. Representative SEM images showed irregular porous
microstructures in all the tested hydrogels, and the wall thickness of
the F127DA hydrogels increased with the precursor concentration
(Figure [85]1C). The cyclic loading‒unloading compressive tests showed
that the stress–strain curves of the F127DA‐5, F127DA‐10, and F127DA‐20
hydrogels were nonlinear (Figure [86]1D). As the precursor
concentration of the F127DA hydrogels increased from 5% to 10% to 20%
(wt/vol), the elastic modulus of the F127DA hydrogels changed from
29.91 ± 0.73 KPa to 56.64 ± 3.65 KPa and then reached a maximum of
152.08 ± 7.65 KPa (Figure [87]1E). Notably, there were significant
differences in the hysteresis loops of each hydrogel during the
unloading period, indicating the different capacities of the F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels to dissipate energy.^[ [88]^4 ,
[89]^33 ^] Quantitative analysis showed that the F127DA‐5 hydrogels
exhibited the highest dissipation energy (1813 ± 135.37 J m^−3) among
all tested hydrogels (Figure [90]1F). Furthermore, the mechanical
stability of F127DA hydrogels was analyzed. As shown in Figure [91]S1,
Supporting Information, the loading–unloading curves from 5 cyclic
compressive tests were consistent across the tested groups, suggesting
that the mechanical characteristics of F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels remained stable. Subsequently, the viscoelastic
properties of hydrogels were analyzed in terms of rheological
properties. Frequency sweeps from 0.1 to 100 rad s^−1 were conducted at
37 °C to determine the viscoelasticity of the preprepared F127DA
hydrogels, and the strain was set to 1% to ensure that the entire
oscillatory deformation test was conducted within the linear elastic
regime of the hydrogels. The results showed that the storage modulus
(G′) was larger than the loss modulus (G″) and changed only slightly
over the entire frequency range in all the hydrogels, indicating the
gel‐like behavior of F127DA hydrogels, and both G′ and G″ increased
with the precursor concentration (Figure [92]1G). To investigate the
stress relaxation rate of the F127DA hydrogels, a constant 1% strain
was applied, and the stress in response to strain was measured over the
course of 100 s. The results indicated that, compared to the F127DA‐10
and F127DA‐20 hydrogels, the F127DA‐5 hydrogels exhibited the fastest
stress relaxation rate. Consistently, τ [1/2] (the time over which the
initial stress was relaxed to half its value) decreased from 24.69 ±
0.5 s to 10.77 ± 2.37 s and reached a minimum of 3.17 ± 0.1 s when the
concentrations decreased from 20% to 10% to 5% (wt/vol)
(Figure [93]1H).
Figure 1.
Figure 1
[94]Open in a new tab
Characterization of viscoelastic F127DA‐5, F127‐10 and F127‐20
hydrogels. A) FT‐IR spectra of F127 and F127DA. The left panel showing
the magnified images of characteristic peak of C═O stretching vibration
at 1724 cm^−1. B) The porosity of F127DA‐5, F127‐10, and F127‐20
hydrogels (n = 4). C) Representative SEM images showing the
microstructures of F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels. Scale
bar = 200 µm. D) Cyclic loading‒unloading compressive curves of
F127DA‐5, F127DA‐10 and F127DA‐20 hydrogels. E) Initial elastic modulus
of F127DA hydrogels as calculated from compression curves of
viscoelastic F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels (n = 3). F)
Energy dissipation of F127DA hydrogels determined by compression
testing of viscoelastic F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels (n
= 3). G) Frequency dependency of storage modulus G′ and loss modulus
(G″) for F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels. H) Normalized
stress relaxation tests on viscoelastic F127DA hydrogels at 1% strain
and quantification of the half stress‐relaxation time (τ [1/2])
determined by stress relaxation testing of F127DA hydrogels (n = 3).
The data are shown as the mean ± SD. Data shown in (B), (E), (F), and
(H) were analyzed by one‐way ANOVA; *p < 0.05, **p < 0.01 and ***p <
0.001 indicate significant differences between the indicated columns.
The hierarchical composites of ECM in PDLs containing self‐assembled
collagen fibers and noncovalently crosslinked macromolecules (e.g.,
glycoproteins or polysaccharides) allow the rearrangement of fibers and
the reformation of weak bonds, serving as the primary source of tissue
viscoelasticity.^[ [95]^34 , [96]^35 ^] Despite great progress in
biomaterials science,^[ [97]^36 , [98]^37 ^] it is still impossible to
recapitulate the viscoelastic properties of PDLs due to the complex
interconnected networks of ECM. Inspired by the self‐assembly and
dynamic crosslinking principles of native ECM, increased efforts have
been devoted to incorporating reversible crosslinks (e.g., reversible
supramolecular interactions or noncovalent chemical reactions) into
networks of synthetic biomaterials for engineering applications.^[
[99]^38 , [100]^39 ^] However, these modulations result in biomaterials
with slower stress relaxation,^[ [101]^40 ^] which still cannot mimic
the excellent viscoelasticity of PDLs. Moreover, the low elastic moduli
of viscoelastic materials, such as alginate hydrogels (≈10 KPa),^[
[102]^21 ^] borate ester bond‐modified gelatine methacryloyl hydrogels
(≈8 KPa),^[ [103]^41 ^] boronate‐based hydrogels (≈2 KPa),^[ [104]^42
^] collagen hydrogels (≈0.3 KPa)^[ [105]^43 ^] and protein‐engineered
hyalurona hydrogels (≈1 KPa),^[ [106]^44 ^] limits their use in the
regeneration of tissues under dynamic mechanical loading. In the
present study, we provided an easy and versatile way to fabricate
viscoelastic hydrogels with tailored stress relaxation and high elastic
moduli (Figure [107]1). By varying the concentration of F127DA, both
the stress relaxation and the elastic modulus could be precisely
controlled. The τ [1/2] of F127DA hydrogels can reach ≈3.17 ± 0.1–24.69
± 0.5 s, which is much better than that of frequently used alginate
hydrogels.^[ [108]^21 ^] The fast stress relaxation of F127DA hydrogels
also closely matched the stress relaxation of PDLs, whose τ [1/2]
varies from seconds to tens of seconds due to the heterogeneity of
PDLs.^[ [109]^12 , [110]^23 ^] The excellent energy dissipation or fast
stress relaxation of F127DA hydrogels is due to the deformation of
macromolecular micelles or the disentanglement of polymer chains with
increasing water content.^[ [111]^26 ^] Moreover, the elastic modulus
of the F127DA hydrogels ranged from 29.91 ± 0.73 KPa to 152.08 ± 7.65
KPa, which is significantly higher than the elastic modulus of most
viscoelastic hydrogels.^[ [112]^21 , [113]^41 , [114]^42 , [115]^43 ^]
Based on these aforementioned findings, we believe that the obtained
F127DA hydrogels might be suitable for PDL repair due to their
favorable mechanical properties.
2.2. The Cytocompatibility and Histocompatibility of F127DA‐5, F127DA‐10, and
F127DA‐20 Hydrogels
The cytocompatibility of F127DA hydrogels with PDLSCs was first
evaluated by examining the adhesion, morphology, and viability of
PDLSCs on F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels. Representative
optical microscopy images showed that PDLSCs could adhere to the
surface of arginine‐glycine‐aspartic (RGD)‐modified F127DA hydrogels.
Additionally, most cells cultured on the F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels had uniform round and compact cell shapes (Figure
[116]2A). The quantitative analysis revealed no significant differences
in the number of round cells cultured on the F127DA hydrogels
(Figure [117]2B). Consistently, the representative images of phalloidin
staining showed that PDLSCs cultured on the F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels had similar cellular morphology (Figure [118]2C).
Furthermore, the viability of PDLSCs cultured on F127DA‐5, F127DA‐10,
and F127DA‐20 hydrogels was assessed by live/dead cell staining and
cell counting kit‐8 (CCK‐8) assays (Figure [119]2D–F). On days 1, 3,
and 7 of incubation, representative images of live/dead cell staining
showed that most cells cultured on all the F127DA hydrogels were living
(labeled with green fluorescence) (Figure [120]2D). In line with the
live/dead staining, quantitative analysis showed that the percentages
of living cells (>90%) in different groups were similar on days 1, 3,
and 7 of incubation, suggesting that F127DA hydrogels support excellent
cell viability (Figure [121]2E). The CCK‐8 assay indicated that cells
cultured on F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels showed a trend
toward increasing proliferation, and the optical density (OD) value of
cells cultured on F127DA‐5 hydrogels was higher than that of cells
cultured on F127DA‐20 hydrogels on days 3 and 7 during incubation
(Figure [122]2F). Altogether, these data indicated good
cytocompatibility of the F127DA hydrogels. To further confirm the
biocompatibility of F127DA hydrogels, F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels were subcutaneously implanted into the dorsal
flanks of mice. During the whole experiment period, none of the
surgical sites showed any sign of infection and all animals survived in
the experiment. The representative images of hematoxylin and eosin
(H&E) staining showed the presence of immune cells surrounding the
implanted F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels, although no
fibrous tissues could be observed as 2 weeks post surgery. The enlarged
area showed many newly formed blood vessels (black arrows) in the
transplanted area (Figure [123]2G). In addition, no signs of any tissue
damage (e.g., inflammation, hemorrhage, necrosis) could be observed in
the major organs (e.g., heart, lung, liver, kidney, and spleen)
(Figure [124]2H). Combined with the in vitro data, these findings
indicated that F127DA hydrogels are non‐toxic.
Figure 2.
Figure 2
[125]Open in a new tab
The biocompatibility of F127DA‐5, F127DA‐10 and F127DA‐20 hydrogels. A)
Representative optical microscope images showing the morphology of
PDLSCs cultured on the surfaces of F127DA‐5, F127DA‐10, and F127DA‐20
hydrogels. Scale bar = 100 µm. B) Quantitative analysis of nonspread
round cells cultured on F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels (n
= 3). C) Representative images of phalloidin staining showing the
cytoskeletons of PDLSCs cultured on the F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels for 24 h. Scale bar = 50 µm. D) Representative
images of live/dead cell staining of PDLSCs cultured on F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels on days 1, 3, and 7. Scale bar =
500 µm. E) Quantitative analysis of cell viability determined by
live/dead cell staining (n = 3). F) CCK‐8 assays showing the
proliferation of PDLSCs cultured on F127DA‐5, F127DA‐10, and F127DA‐20
hydrogels on days 1, 3, and 7 (n = 3). G) The representative images of
H&E staining showing tissues surrounding the implanted hydrogels at 2
weeks post surgery. Left panels, the overview of the hydrogel‐implanted
area, scale bar = 250 µm; right panel, the magnified view focusing on
infiltrated immune cells and newly formed blood vessels, scale bar =
50 µm. H) Representative images of H&E staining for major organs of
rats receiving F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels, scale bar
= 100 µm. The data are shown as the mean ± SD. Data shown in (B) were
analyzed by one‐way ANOVA. Data shown in (E) and (F) were analyzed by
two‐way ANOVA; *p < 0.05 and ***p < 0.001 indicate significant
differences between the indicated columns.
Previously published studies have indicated that the spreading area of
cells increases with the substrate modulus or stress relaxation rates
of the matrix due to modification of their mechanical response.^[
[126]^45 , [127]^46 , [128]^47 ^] However, we found that differences in
the stress relaxation/elastic moduli of the F127DA hydrogels exerted
little effect on cell morphology (Figure [129]2), as cells cultured on
F127DA‐5, F127DA‐10 or F127DA‐20 hydrogels all displayed limited cell
spreading, indicating the uncoupling of the nucleus and the actin
cytoskeleton (Figure [130]2). The reason may be that F127DA hydrogels
with fast stress relaxation exhibited a decreased elastic modulus
(Figure [131]1). Therefore, the increased stress relaxation‐induced
cell spreading might compensate for the low elastic moduli of F127DA
hydrogels, which is consistent with previously published studies.^[
[132]^48 ^] Furthermore, the atomic force microscopy (AFM) analysis
indicated similar cell elastic moduli among cells cultured on F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels, implying that cells in different
groups exerted similar traction forces on the ECM (Figure [133]S2,
Supporting Information). Considering that cells sense the stiffness and
stress relaxation of ECM mainly by gauging resistance to the traction
forces they exert on the matrix,^[ [134]^21 ^] these data suggested
that F127DA hydrogels with different viscoelasticities/elastic moduli
exerted similar mechanical regulation on cells.
2.3. Viscoelastic F127DA Hydrogels Enhanced the Fibrogenic Differentiation
Potential of PDLSCs under Cytomechanical Loading
The viscoelasticity of PDLs allows time‐dependent energy dissipation,
which plays a key role in maintaining mechanical homeostasis in
periodontal tissues by decreasing internal stress over time in response
to step deformation (termed “stress relaxation”). Recently, the
importance of stress relaxation in cell–ECM interactions has gained
extensive attraction. Mooney et al. showed that hydrogels with fast
relaxation can significantly increase stem cell spreading and
osteogenic differentiation,^[ [135]^21 , [136]^34 , [137]^48 ^]
determine the dynamics of tissue growth,^[ [138]^22 ^] and even
regulate the immune response of immune cells.^[ [139]^49 , [140]^50 ^]
These milestone studies highlight hydrogel viscoelasticity as a key
design parameter for cell fate decisions. However, whether and how
viscoelasticity, especially stress relaxation, influences cell
behaviors under external stress loading is still unknown. Considering
that mechanical stress is inevitable in periodontal tissues and is
necessary for PDL repair,^[ [141]^51 ^] we further explored whether
viscoelastic F127DA hydrogels can increase the fibrogenic
differentiation potential of PDLSCs under cytomechanical loading. The
fibrogenic differentiation potentials of PDLSCs cultured on
viscoelastic F127DA hydrogels were first evaluated by Sirius red total
collagen detection, quantitative real‐time polymerase chain reaction
(qRT–PCR), and immunofluorescence staining, respectively. First, the
influences of the F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels on the
fibrogenic differentiation potential of PDLSCs under static conditions
were evaluated (Figure [142]3A). After 7 days of incubation, Sirius red
total collagen detection showed no significant differences in the
content of soluble collagen generated by PDLSCs cultured on different
hydrogels under static conditions (Figure [143]3B). Consistently,
representative images of immunofluorescence staining showed that PDLSCs
cultured on the F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels exhibited
comparable expression levels of fibrogenic differentiation‐related
markers (collagen type‐1 (COL‐1) and scleraxis (SCX)) (Figure [144]3C).
In line with these results, no significant difference could be observed
in the expression of fibrogenic differentiation‐related genes (COL‐1
and SCX) in PDLSCs among all tested groups (Figure [145]3D).
Collectively, these data suggest that under static conditions, the
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels with different stress
relaxations and elastic moduli exerted similar influences on the
fibrogenic differentiation potential of PDLSCs. To mimic the
hydrostatic pressure endured by cells encapsulated in interstitial
fluid‐filled ECM during mastication,^[ [146]^4 , [147]^52 , [148]^53 ^]
dynamic compressive stress (≈0–120 KPa, 1 Hz, 1 h day^−1) was applied
to PDLSCs cultured on F127DA‐5, F127DA‐10 and F127DA‐20 hydrogels
(Figure [149]3E). Notably, F127DA‐5 hydrogels significantly increased
the collagen production of PDLSCs under cytomechanical loading compared
with those grown on F127DA‐10 or F127DA‐20 hydrogels (Figure [150]3F).
Representative images of immunofluorescence staining also revealed that
fibrogenic differentiation‐related markers (COL‐1 and SCX) were more
abundant in PDLSCs cultured on the F127DA‐5 hydrogels than in PDLSCs
cultured on the F127DA‐10 or F127DA‐20 hydrogels under cytomechanical
loading (Figure [151]3G). Consistent with immunofluorescence staining,
qRT–PCR analysis revealed that PDLSCs cultured on viscoelastic F127DA‐5
hydrogels exhibited higher expression levels of fibrogenic
differentiation‐related genes (COL‐1 and SCX) than cells cultured on
F127DA‐10 and F127DA‐20 hydrogels when subjected to dynamic compressive
stress (Figure [152]3H). Taken together, our results indicate that
under external cytomechanical loading, F127DA‐5 hydrogels with faster
stress relaxation rates and lower elastic moduli can promote the
fibrogenic differentiation of PDLSCs.
Figure 3.
Figure 3
[153]Open in a new tab
The fibrogenic differentiation potentials of PDLSCs cultured on
viscoelastic F127DA hydrogels. A) Schematic diagrams of PDLSCs cultured
on viscoelastic F127DA hydrogels under static conditions. B) The
concentrations of total collagen produced by PDLSCs cultured on
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels under static conditions
for 7 days (n = 6) (Sirius red total collagen detection assays). C)
Representative images of immunofluorescence staining showing the
fibrogenic differentiation‐related markers (COL‐1 and SCX) of PDLSCs
cultured on F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels under static
conditions for 7 days. D) Expression of fibrogenic
differentiation‐related genes (COL‐1 and SCX) in PDLSCs cultured on
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels under static conditions
for 7 days (n = 6) (qRT–PCR assay). E) Schematic diagrams of PDLSCs
cultured on viscoelastic F127DA hydrogels under cytomechanical loading.
F) The concentrations of total collagen produced by PDLSCs cultured on
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels for 7 days under
cytomechanical loading (≈0–120 KPa, 1 Hz, 1 h day^−1) every other day
(n = 6) (Sirius red total collagen detection assays). G) Representative
images of immunofluorescence staining showing the fibrogenic
differentiation‐related markers (COL‐1 and SCX) of PDLSCs cultured on
the F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels under cytomechanical
loading. H) Expression of fibrogenic differentiation‐related genes
(COL‐1 and SCX) in PDLSCs cultured on the F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels under cytomechanical loading (n = 6) (qRT–PCR
assay). The data are shown as the mean ± SD; Data shown in (B), (D),
(F) and (H) were analyzed by one‐way ANOVA; ***p < 0.001 indicates
significant differences between the indicated columns.
Although the roles of nonlinear viscoelasticity in determining cell–ECM
interactions have been widely recognized, most of these studies focus
on how cells respond to the stress–relaxing matrix without external
mechanical stimuli, and the results of such studies are often assumed
to predict the mechanical environment experienced by cells in vivo.^[
[154]^21 , [155]^43 , [156]^54 ^] However, tissues and ECM are often
under dynamic external mechanical loading (e.g., PDL), which is an
important regulator in maintaining physiological function
maintenance.^[ [157]^55 , [158]^56 ^] For example, mechanical force has
been reported to promote type H angiogenesis and osterix+ (OSX+)
cell‐related osteogenesis in PDLs, contributing to the maintenance of
periodontal homeostasis.^[ [159]^57 ^] Therefore, it is important to
investigate whether viscoelastic hydrogels can benefit PDL healing in
vitro under external stress loads. Compared with viscoelastic alginate
hydrogels or collagen hydrogels,^[ [160]^21 , [161]^43 , [162]^54 ^]
the physiochemical properties of F127DA hydrogels remain stable during
investigation of the effects of viscoelastic properties on cell
behavior, as demonstrated by the fact that they undergo little
degradation in PBS or by cells.^[ [163]^58 ^] Interestingly, our data
showed that PDLSCs cultured on F127DA‐5 hydrogels showed maximal
fibrogenic differentiation potential under cytomechanical loading,
while no significant differences could be observed when cells were
cultured on F127DA hydrogels under static conditions (Figure [164]3).
Although both viscoelasticity and the elastic modulus could influence
the cellular behavior of PDLSCs, the forces that cells exert on the
elastic matrix remained constant over time.^[ [165]^46 ^] The
viscoelastic matrix can relax contraction forces gradually, leading to
increased cell spreading and ligand clustering.^[ [166]^21 , [167]^43
^] Considering that cells can bind to the ECM within seconds and form
stable adhesion within minutes^[ [168]^59 , [169]^60 ^] and that
external mechanical stress can reinforce such mechanotransduction,^[
[170]^46 , [171]^61 ^] the fast stress relaxation of the ECM is
critical for actin polymerization and stress fiber formation in cells,
which in turn contributes to robust cytoskeletal organization. The slow
stress relaxation of F127DA‐10 or F127DA‐20 hydrogels might inhibit
cell remodeling in ECMs, thereby inhibiting the related cellular
mechanotransduction and fibrogenic differentiation of PDLSCs. Together,
these data indicated that mechanical stress can change the bioactive
effects of materials, and the fast stress relaxation of F127DA
hydrogels, but not the elastic modulus, could harness mechanical loads
to promote the fibrogenic differentiation of PDLSCs.
2.4. The Viscoelastic F127DA Hydrogels Influence the Fibrogenic
Differentiation Potential of PDLSCs by Regulating Cell–ECM Interactions under
Cytomechanical Loading
To gain insight into the underlying mechanism of viscoelastic F127DA
hydrogels on fibrogenic differentiation of PDLSCs, the differently
expressed genes in PDLSCs cultured on F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels were analyzed by a bulk RNA sequencing (RNA‐seq).
Under static conditions, the principal component analysis (PCA) showed
the diffused distribution of duplicated plots, and no obvious clusters
could be observed, indicating similar gene expression profiles among
different groups (Figure [172]S3, Supporting Information).
Consistently, there were a few differentially expressed genes among
different groups as shown by the volcano plots and heat maps (Figures
[173]S4–S6, Supporting Information). Under cytomechanical loadings, the
PCA revealed clustered plots in PDLSCs cultured on F127DA‐5, F127DA‐10,
and F127DA‐20 hydrogels, with PC1 and PC2 values of 44.02% and 11.45%,
respectively, indicating the significant different gene expression
profiles among the cohorts (Figure [174]4A). As shown by the volcano
plots, there were 799 significantly upregulated genes and 614
significantly downregulated genes between F127DA‐5 and F127DA‐10
groups, 2102 significantly upregulated genes, and 2231 significantly
downregulated genes between F127DA‐5 and F127DA‐20 groups, and 1390
significantly upregulated genes and 1781 significantly downregulated
genes between F127DA‐10 and F127DA‐20 groups (Figure [175]4B). The
differently expressed genes were plotted as a heatmap in
Figure [176]4C, indicating the different influences elicited by
viscoelastic F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels,
respectively. The biological functions and process of differently
expressed genes were further predicted and analyzed by Gene ontology
(GO) cellular component enrichment analysis. The top 9 enriched
biological processes in PDLSCs cultured on F127DA‐5 and F127DA‐10
hydrogels were involved in the ECM remodeling, integrin complex, and
cytoskeleton rearrangement (Figure [177]4D). Consistently, the Kyoto
Encyclopedia of Genes and Genomes (KEGG) enrichment analysis also
indicated that most differently expressed genes were involved in
cell–ECM interactions, such as ECM‐receptor interaction, cell adhesion
molecules, and focal adhesion (Figure [178]4E). Gene set enrichment
analysis (GSEA) also showed that the differently expressed genes
between F127DA‐5 and F127DA‐10 groups are associated with the
cytoskeleton rearrangement of PDLSCs (gene ontology biological
processes (GOBP) Microtubule‐based movement and gene ontology cellular
component (GOCC) Microtubule organizing center) (Figure [179]4F). In
line with these results, further analysis via GO cellular component and
KEGG enrichment analysis showed that the differently expressed genes
between F127DA‐5 and F127DA‐20 groups, and F127DA‐10 and F127DA‐20
groups participated in the ECM remodel and cytoskeleton rearrangement,
and the enriched signaling pathways highlighted focal adhesion and
ECM‐receptor interaction (Figure [180]4G,H and Figure [181]S7,
Supporting Information). GSEA analysis also revealed that the
differently expressed genes were associated with the extracellular
organization and cell adhesion (Figure [182]4I). Overall, these
findings indicated that viscoelastic F127DA hydrogels could harness the
mechanical stress to enhance cell–ECM interactions, thereby influencing
the fibrogenic differentiation of PDLSCs.
Figure 4.
Figure 4
[183]Open in a new tab
RNA‐seq revealed that viscoelastic F127DA hydrogels influenced the
cell–ECM interaction under cytomechanical loading. A) PCA of genes from
PDLSCs cultured on F127DA‐5, F127DA‐10 hydrogels, and F127DA‐20
hydrogels. B) Volcano plots of the differentially expressed genes (fold
change >1.5 and adjusted p < 0.05) in PDLSCs cultured on
F127DA‐5 versus F127DA‐10 hydrogels, F127DA‐5 versus F127DA‐20
hydrogels, and F127DA‐10 versus F127DA‐20 hydrogels. C) Heat map of
RNA‐seq data showing differently expressed genes among PDLSCs cultured
on F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels after cluster analysis
(n = 3–4). D) GO enrichment analysis of differently expressed genes in
PDLSCs cultured on F127DA‐5 and F127DA‐10 hydrogels. E) Top KEGG
enrichment analysis of potential pathways targets for fibrogenic
differentiation of PDLSCs cultured on F127DA‐5 and F127DA‐10 hydrogels.
F) GSEA analysis of pathways (GOBP microtubule‐based movement and GOCC
microtubule organizing center) involved in cytoskeleton rearrangement
of PDLSCs cultured on F127DA‐5 and F127DA‐10 hydrogels. G) GO
enrichment analysis of differently expressed genes in PDLSCs cultured
on F127DA‐5 and F127DA‐20 hydrogels. H) Top KEGG enrichment analysis of
potential pathways targets for fibrogenic differentiation of PDLSCs
cultured on F127DA‐5 and F127DA‐20 hydrogels. I) GSEA analysis of
pathways (GOMF extracellular matrix structural constituent and KEGG
Cell adhesion molecules) involved in cell–ECM interactions of PDLSCs
cuktured on F127DA‐5 and F127DA‐20 hydrogels. Three to four samples
were measured per group.
2.5. Viscoelastic F127DA Hydrogels Enhanced Integrin–FAK Signaling and the
Cytoskeletal Rearrangement of PDLSCs under Cytomechanical Loading
The activation of integrin–FAK signaling plays a key role in regulating
cell–ECM interactions by linking the ECM to intracellular signaling.^[
[184]^62 , [185]^63 ^] Upon binding to the ECM, integrin clusters form
focal adhesion or multiprotein hubs that connect to the cytoskeleton.^[
[186]^64 , [187]^65 ^] The physical properties of the ECM, including
viscoelasticity and elastic modulus, can influence integrin clusters to
activate integrin–FAK signaling and cytoskeletal rearrangements,
including actin bundling and stress fiber formation, thereby
influencing cell spreading and intracellular signaling pathways.^[
[188]^54 , [189]^66 ^] Combined with the physical properties of the
ECM, external mechanical loads can also trigger integrin–FAK signaling
to generate tension and determine cell fates.^[ [190]^67 ^] Therefore,
we hypothesized that integrin–FAK signaling and cytoskeletal
rearrangement were involved in F127DA‐5 hydrogel‐mediated cell–ECM
interactions under cytomechanical loads. After 24 h of cytomechanical
loading, the spreading and morphology of PDLSCs were evaluated by
phalloidin staining, optical microscopy, and SEM. Representative images
of phalloidin‐stained cells showed that PDLSCs cultured on viscoelastic
F127DA‐5 hydrogels displayed a larger spreading morphology than those
cultured on F127DA‐10 and F127DA‐20 hydrogels (Figure [191]5A).
Consistent with phalloidin staining, representative optical microscopy,
and SEM images both showed that PDLSCs cultured on F127DA‐5 hydrogels
with faster stress relaxation rates were spindle‐shaped, and many more
filopodia or lamellipodia could be observed. In contrast, PDLSCs
cultured on F127DA‐20 hydrogels were round or oval, and only a few
filopodia or lamellipodia could be observed (Figure [192]5B).
Consistently, the quantification also showed that the number of
nonspreading round cells in the F127DA‐5 group was much lower than that
in the F127DA‐10 or F127DA‐20 group (Figure [193]5C). The
immunofluorescent staining revealed more vinclin and talin expression
in cells cultured on F127DA‐5 hydrogels, indicating more formation of
focal adhesions (Figure [194]5D). Furthermore, qRT–PCR analysis
revealed that PDLSCs cultured on viscoelastic F127DA‐5 hydrogels
exhibited higher expression levels of integrin–FAK pathway‐related
genes (Integrin Alpha (ITGA)5, Integrin Beta (ITGB1), FAK, and
Ras‐related C3 botulinum toxin substrate 1 (RAC1)) than cells cultured
on the F127DA‐10 and F127DA‐20 hydrogels under cytomechanical loading
(Figure [195]5E). ITGA‐5 and ITGB1 encode integrin α5β1 and integrin
β1, which are major components of integrins. FAK encodes FAK. Integrin
α5β1 and integrin β1 switch between relaxed and tensioned states, which
is necessary for external mechanical load‐induced FAK activation.^[
[196]^67 , [197]^68 , [198]^69 ^] The spatiotemporal RAC1 can influence
the stability of integrin adhesions.^[ [199]^62 ^] Under cytomechanical
loads, F127DA‐5 hydrogels with fast stress relaxation allowed the rapid
remodeling of ECM to promote the clustering of integrin α5β1 and
integrin β1, thereby activating integrin–FAK signaling. In contrast,
the low stress relaxation of F127DA‐10 or F127DA‐20 hydrogels
compromised the spreading and activation of integrins, which might be
why the spreading of PDLSCs was still inhibited under cytomechanical
loads, and these inhibitory influences cannot be reversed by the high
elastic modulus. Following the activation of integrin–FAK signaling,
the polymerization/depolymerization of the actin cytoskeleton mediates
the cytoplasmic‐to‐nuclear localization of various transcription
factors.^[ [200]^70 ^] qRT‒PCR analysis showed that cytomechanical
loads caused a greater increase in the expression of cytoskeletal
rearrangement‐related genes (Actin Beta (ACTB), Actin‐1 (ACTN1) and
Tropomyosin‐1 (TPM1)) in cells cultured on F127DA‐5 hydrogels than in
those cultured on F127DA‐10 and F127DA‐20 hydrogels(Figure [201]5F).
Meanwhile, Ras Homolog Family Member A (RhoA) also increased
significantly in F127DA‐5 groups, indicating the active actin
polymerization.^[ [202]^62 , [203]^70 ^] The activation of integrins
and polymerization of actins increased the force on the resistant
plasma membrane, consequently increasing the cellular traction force on
the ECM (Figure [204]5F). Together, these findings suggest that under
cytomechanical loading, F127DA‐5 hydrogels with faster stress
relaxation rates can promote integrin α[5]β[1] and FAK activation and
cytoskeletal rearrangement in PDLSCs (Figure [205]5G).
Figure 5.
Figure 5
[206]Open in a new tab
The mechanical responses of PDLSCs toward viscoelastic F127DA hydrogels
under cytomechanical loading (≈0–120 KPa, 1 Hz, 1 h day^−1) for 24 h.
A) Representative images of phalloidin staining showing the
cytoskeleton of PDLSCs cultured on F127DA‐5, sF127DA‐10, and F127DA‐20
hydrogels under cytomechanical loading. Scale bar = 100 µm. B)
Representative optical microscopy (left panels) and SEM (right panels)
images showing the morphology of PDLSCs cultured on F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels under cytomechanical loading. Scale
bar = 50 µm (left panels) or 4 µm (right panels). C) Quantitative
analysis of nonspread round cells cultured on F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels under cytomechanical loading (n = 3). D)
Representative images of immunofluorescence staining showing the focal
adhesion related markers (vinculin and talin) of PDLSCs cultured on
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels under cytomechanical
loading. Scale bar = 20 µm. E) The expression levels of integrin–FAK
pathway‐related genes (ITGA5, ITGB1, FAK and RAC1) and cytoskeletal
rearrangement‐related genes (ACTINB, ACTIN1, TPM1 and RhoA) in PDLSCs
cultured on F127DA‐5, F127DA‐10 and F127DA‐20 hydrogels under
cytomechanical loading (n = 3–6) (qRT–PCR assay). F) Representative
deflection–distance curves and calculated elastic modulus of PDLSCs
analyzed by AFM under cytomechanical loading (n = 15–22). G) Schematic
diagram showing the mechanical regulation of viscoelastic hydrogels on
integrin–FAK pathways and cytoskeletal rearrangement of PDLSCs under
cytomechanical loading. The data are shown as the mean ± SD; Data shown
in (C), (E), and (F) were analyzed by one‐way ANOVA; *p < 0.05, **p <
0.05, and ***p < 0.001 indicate significant differences between the
indicated columns.
To further study the effect of cytoskeletal rearrangement on the
fibrogenic differentiation potential of PDLSCs, cytochalasin B (CB) was
used to inhibit the actin cytoskeleton of PDLSCs cultured on F127DA‐5
hydrogels under cytomechanical loading. Representative phalloidin
staining images after treatment with 10 µM CB for 24 h showed that CB
treatment resulted in shortened actin fibers forming cytoplasmic puncta
under cytomechanical loading (Figure [207]6A,B). Consistent with the
phalloidin staining results, representative optical microscopy images
showed that cells cultured on F127DA‐5 hydrogels became round after CB
treatment (Figure [208]6C). To confirm the effects of cytoskeletal
inhibition on the ECM–integrin–cytoskeleton linkage of PDLSCs on
F127DA‐5 hydrogels, qRT–PCR analysis revealed that CB treatment
significantly decreased the expression levels of integrin–FAK
pathway‐related genes (ITGA5, ITGB1, FAK) and cytoskeletal
rearrangement‐related genes (ACTN1 and TPM1) (Figure [209]6D). The
effect of cytoskeletal inhibition on the fibrogenic differentiation
potential of PDLSCs under cytomechanical loading was further studied.
After treatment with 10 µM CB for 7 days under cytomechanical loading,
representative immunofluorescence staining images revealed that the
presence of fibrogenic differentiation‐related markers (COL‐1 and SCX)
in PDLSCs cultured on the F127DA‐5 hydrogels with CB treatment was less
than that in the control (Figure [210]6E). Consistent with the
immunofluorescence staining results, qRT–PCR analysis revealed that
PDLSCs cultured on viscoelastic F127DA‐5 hydrogels with CB treatment
exhibited lower expression levels of fibrogenic differentiation‐related
genes (COL‐1 and SCX) than control PDLSCs (Figure [211]6F). Taken
together, our results indicate that cytoskeletal rearrangement plays a
key role in the viscoelastic F127DA‐5‐enhanced fibrogenic
differentiation potential of PDLSCs under mechanical loading and that
inhibiting the formation of actin microfilaments by CB could abolish
the mechanical response of viscoelastic F127DA‐5 hydrogels.
Figure 6.
Figure 6
[212]Open in a new tab
The effects of CB on the mechanical responses and fibrogenic
differentiation of PDLSCs cultured on viscoelastic F127DA‐5 hydrogels
under cytomechanical loading (≈0–120 KPa, 1 Hz, 1 h day^−1). A)
Schematic diagrams showing that the actin polymerization of PDLSCs
cultured on viscoelastic F127DA‐5 hydrogels was inhibited by 10 µm CB
under cytomechanical loading. B) Representative images of phalloidin
staining showing the influence of CB treatment on the cytoskeletons of
PDLSCs grown on viscoelastic F127DA‐5 hydrogel under cytomechanical
loading. Scale bar = 50 µm. C) Representative optical microscopy images
showing the influence of CB treatment on the viscoelastic F127DA‐5
hydrogel‐mediated morphology of PDLSCs. Scale bar = 200 µm. D)
Decreased expression levels of integrin–FAK pathway‐related genes
(ITGA5, ITGB1, FAK) and cytoskeletal rearrangement‐related genes (ACTN1
and TPM1) in PDLSCs following CB incubation under cytomechanical
loading (n = 6) (qRT–PCR assay). E) Representative images of
immunofluorescence staining showing the effects of CB treatment on the
expression of fibrogenic differentiation‐related markers (COL‐1 and
SCX) in PDLSCs under cytomechanical loading. Scale bar = 100 µm. F)
Decreased expression levels of fibrogenic differentiation‐related genes
(COL‐1 and SCX) in PDLSCs following CB incubation under cytomechanical
loading (n = 3) (qRT–PCR assay). The data are shown as the mean ± SD.
Data shown in (D) and (F) were analyzed by unpaired t test; *p < 0.05
and **p < 0.001 indicate significant differences between the indicated
columns.
Notably, the elastic modulus and viscoelasticity of F127DA hydrogels
were both changed in the present study, making the data presentation
and elucidation chaotic. In the future, viscoelastic hydrogels with
tunable stress relaxation independent of a high elastic modulus should
be designed. Further studies can also focus on the involvement of
ECM–integrin–cytoskeleton linkages in viscoelastic hydrogel‐enhanced
fibrogenic differentiation under cytomechanical loading.
2.6. Viscoelastic F127DA Hydrogels Promoted the Repair and Regeneration of
PDLs in the Delayed Replantation of Avulsed Teeth
Due to the hierarchical structure and complex mechanical
microenvironments, restoring lost PDL attachments in mechanically
stimulated environments continues to be a crucial yet challenging task
in the field of periodontal tissue engineering.^[ [213]^11 , [214]^71
^] Considering that the viscoelasticity of PDLs can structurally
modulate the mechanical response of the tooth–PDL–bone complex and
facilitate the remodeling of the periodontium under mechanical
stimulation,^[ [215]^72 , [216]^73 , [217]^74 ^] we hypothesized that
viscoelastic hydrogels could promote PDL regeneration and healing under
occlusal stimulation. First, the biodegradation process of F127DA
hydrogels was monitored following subcutaneous implantation. The
representative images of in vivo fluorescence demonstrated that
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels could be degraded over
time, but they all remained in the implantation sites for 2 weeks
(Figure [218]S8A,B, Supporting Information). These results indicated
that F127DA hydrogels could retain in vivo and provide stable
mechanical supports for weeks to allow the regeneration and remodeling
of PDLs. As a proof of concept, the delayed replantation of an avulsed
incisor model in rats was established to evaluate the in vivo
therapeutic performance of viscoelastic F127DA hydrogels on PDLs. One
of the advantages of the delayed replantation of the avulsed tooth
model is that PDLs can be completely necrotized by air drying for 1 h,
while damage to alveolar bones can be minimized.^[ [219]^75 ^] The
other advantage is that the occlusal force can be controlled by
altering the food structure (feeding with jelly or solid feed).^[
[220]^76 ^] To establish the delayed replantation of the avulsed tooth
model, the maxillary left incisor was first extracted from the tooth
fossa, and then the extracted incisor was air‐dried in a fume hood for
60 min to ensure complete necrosis of the PDLs. Subsequently, F127DA‐5,
F127DA‐10, or F127DA‐20 hydrogel was coated on the surface of roots.
After photo‐crosslinking, the hydrogel‐coated tooth was replanted into
the corresponding extraction socket (Figure [221]7A). During the
experiment, all the animals exhibited good wound healing at the
replantation sites, and no severe adverse events occurred, so all
animals were used for the subsequent tests. At 8 weeks post surgery,
all the animals were euthanized, and the maxillaries were harvested to
investigate the therapeutic effects of viscoelastic F127DA hydrogels on
PDL injury by micron‐scale computed tomography (micro‐CT) and H&E,
Masson, and immunofluorescence staining. As shown in Figure [222]7B,
representative micro‐CT scanning images showed that tooth resorption
was present in all the tested groups. However, the resorption sites
were more easily visualized on the surface of replanted teeth coated
with F127DA‐10 hydrogels. The absence or enlargement of PDL space could
also be observed in the Control or F127DA‐10 groups. Consistently, the
three‐dimensionally reconstructed images showed large amounts of
resorption pits on the replanted root surfaces (green), and newly
formed PDLs (yellow) could be observed covering the root surface.
Compared with the F127DA‐10 and F127DA‐20 groups, more PDLs formed
alongside the root surface in the F127DA‐5 group (Figure [223]7B). As
demonstrated by quantitative analysis, the degree of root resorption in
the F127DA‐10 group was the highest among all tested groups. The area
and volume of newly formed PDLs in the F127DA‐5 group were the highest,
but there was no significant difference in PDL volume among the four
groups (Figure [224]7C).
Figure 7.
Figure 7
[225]Open in a new tab
The effects of viscoelastic F127DA hydrogels on tooth resorption and
PDL healing in the delayed replantation of avulsed teeth in rats. A)
Representative photographs showing the delayed replantation of avulsed
incisors in rat. i) Preoperative photographs of maxillary incisors in
rat. ii) Extraction of the maxillary left incisor in rat. iii) Removal
of the dental papilla and pulp tissues. iv) Filling of root canal with
calcium hydroxide. v) Extracted maxillary incisor after air‐dried in a
fume hood for 60 min. vi) Application of F127DA hydrogels on the root
surface. vii) Photo‐crosslinking of F127DA hydrogels. viii)
Replantation of the F127DA hydrogel‐coated maxillary incisor. B)
Representative images of micro‐CT scanning showing tooth resorption and
newly formed PDLs alongside the tooth root at 8 weeks after delayed
tooth replantation. Left panels: representative 2D micro‐CT images
showing the PDL space between the tooth root and lamina dura. Middle
panel: 3D reconstruction of micro‐CT images showing the morphology of
the tooth root surface (cyan). Right panel: 3D reconstruction of
micro‐CT images showing the newly formed PDLs surrounding the tooth
root (yellow). Scale bar = 3 mm. C) Quantitative analysis of root
resorption degree, PDL area, and PDL volume at 8 weeks post surgery
based on micro‐CT scanning (n = 5). The data are shown as the mean ±
SD. Data shown in (C) were analyzed by Kruskal‒Wallis test; *p < 0.05
and **p < 0.01 indicate significant differences between the indicated
columns.
To further evaluate the regenerative outcomes of PDLs, tooth sections
representing the whole length of replanted incisors were prepared and
then subjected to H&E and Masson staining. Representative images of H&E
and Masson staining showed that the interstitial space between alveolar
bone and the replanted root was filled with newly formed PDL‐like
connective tissue in all groups. Specifically, the PDL‐like tissues in
the F127DA‐5 groups consisted of dense collagen fibers, and the newly
formed collagen fibers were inserted perpendicularly into the cementum
on the root surface, similar to normal PDLs. However, in the F127DA‐10
and F127DA‐20 groups, inflammation, replacement tooth resorption, and
ankylosis were frequently observed (Figure [226]8A,B). Quantitative
histological analysis demonstrated that the PDL length in the F127DA‐5
group was the greatest among all tested groups. In contrast, the
lengths of tooth resorption and root ankylosis in the F127DA‐10 group
were the highest (Figure [227]8C). The potential cause for
F127DA‐10‐induced root resorption may be attributed to the fact that
medium stiffness (≈44.6 kPa) facilitated the greatest formation of
preosteoclasts, reinforcing the stiff matrix‐mediated osteoclastic
differentiation when the elastic modulus of matrix exceeds 29.4 Kpa.^[
[228]^77 ^] Consistent with the histological analysis, representative
immunofluorescence images showed that COL‐1 and SCX (fibrogenic
differentiation‐related markers) were highly expressed in newly formed
PDL‐like tissues (Figure [229]8D). These findings were in line with
previously published research in which viscoelastic alginate‐based
hydrogels also promoted PDL regeneration. However, both bone and PDL
were removed in that study,^[ [230]^12 ^] which disturbed the
mechanical pathways from tooth to alveolar bone. Therefore, the present
study provided more substantial evidence that viscoelastic biomaterials
could promote PDL regeneration under mechanical stimulation. However,
it is still unclear whether viscoelastic biomaterials matching the fast
stress relaxation of PDLs can restore the mechanical microenvironments
of PDLs due to the challenges in measuring the mechanical stress of
PDLs in vivo. Advances in biomechanical testing will help to identify
and select parameters for designing PDL‐mimicking biomaterials, which
can reshape the mechanical adaptability and promote the tissue
regeneration of PDLs. For clinical applications of F127DA hydrogels,
the therapeutic effects of F127DA hydrogels on PDL regeneration should
be further analyzed on large animals, such as nonhuman primates, dogs,
sheeps, or mini pigs. Moreover, further optimization is required for
the adhesion and binding of F127DA hydrogels to the adjacent cementum
and alveolar bones.
Figure 8.
Figure 8
[231]Open in a new tab
Therapeutic performance of viscoelastic F127DA hydrogels on PDL injury
in delayed replantation of avulsed teeth. Tooth roots that did not
receive any implants were used as Ctrl. Representative images of A) H&E
staining and B) Masson staining showing the newly formed PDLs, root
resorption, and ankylosis at 8 weeks after the delayed replantation of
avulsed incisors. Left panels: overview of the teeth replanted in the
alveolar sockets. Scale bar = 2000 µm); middle and right panels:
magnified view (marked region on the left) showing the PDLs
(asterisks), inflammatory or replacement tooth resorption (black
triangles), or ankylosis (white triangles). Scale bar = 100 µm (middle
panels) or 50 µm (right panels). C) Histometric analysis of root
ankylosis, PDL length, and root resorption in tissue slices from each
group (n = 6). Landmarks and parameters used for histometric analysis
are shown in the representative H&E staining image (left). D)
Representative images of immunofluorescence staining showing the
expression of COL‐1 and SCX across the newly formed PDL tissues (the
dotted lines indicate the bone–ligament or ligament–root interfaces).
The data are shown as the mean ± SD. Data shown in (C) were analyzed by
one‐way ANOVA; *p < 0.05, **p < 0.005, and ***p < 0.001 indicate
significant differences between the indicated columns.
3. Conclusions
Mechanical stress can act as a biological stressor that elicits a
homeostasis response to reshape mechanical adaptability and promote the
reconstruction of injured PDLs. However, mechanical homeostasis is
easily lost but difficult to restore. Inspired by the excellent
viscoelasticity of PDLs, which can withstand and disperse chewing or
biting forces, we first demonstrated an approach to modulate the
viscoelasticity and elastic modulus of F127DA hydrogels, which could
match the fast relaxation rates of PDLs and provide mechanical support
without chemical cross‐linking. Then, we found that the F127DA
hydrogels with the fastest stress relaxation harnessed cytomechanical
loads to improve the fibrogenic differentiation potential of PDLSCs.
Mechanically, the viscoelastic F127DA hydrogels could activate the
mechanotransduction of PDLSCs by upregulating integrin–FAK pathways and
related cytoskeletal rearrangement under cytomechanical loading,
leading to reinforced cell–ECM interactions. The in vivo experiments
also indicated that the F127DA hydrogels with the fastest stress
relaxation significantly promoted the repair of PDLs and reduced
abnormal healing (e.g., root resorption and ankyloses) in the delayed
replantation of avulsed teeth. These findings provide a novel strategy
to promote the regeneration of PDLs and elucidate the important roles
of mechanical stress in efforts to develop functional PDL regeneration.
4. Experimental Section
Synthesis of Pluronic F127DA Hydrogels
F127DA hydrogels were synthesized according to previously published
studies.^[ [232]^78 , [233]^79 ^] Briefly, 10 g of F127 (Sigma Aldrich,
St. Louis, MO, USA) was dissolved in 100 mL of anhydrous
dichloromethane (Aladdin, Shanghai, China) with constant stirring.
After complete dissolution, triethylamine (ACMEC biochemical, Shanghai,
China) and acryloyl chloride (Aladdin) were slowly added. The mixture
was reacted in an ice bath for 1 h and then kept at room temperature
for 24 h. Subsequently, the precipitated triethylamine was removed by
infiltration, and the residual filtrate was precipitated slowly by
adding supercooled anhydrous diethyl ether. Then, F127DA was obtained
by drying in vacuum at 30 °C for 24 h. For the generation of F127DA
hydrogels, F127DA was dissolved in 0.5% (wt/vol) lithium
acylphosphinate photoinitiator (LAP; EngineeringForLife, Suzhou,
Jiangsu, China) at various concentrations (wt/vol; 5%, 10% and 20%) at
4 °C. After incubation for 1 h, the hydrogel solutions containing
different concentrations of F127DA were simultaneously solidified
through exposure to 30 mW cm^−2 405 nm UV light for 30 s using a 405 nm
light‐curing portable source (EFL, EFL‐LS‐1601‐405, China). Final
gelatin containing 5%, 10%, or 20% F127DA in the synthesized hydrogels
was referred to as F127DA‐5, F127DA‐10, or F127DA‐20 hydrogels,
respectively.
FT‐IR Analysis of F127 and F127DA Hydrogels
The FT‐IR spectra of F127 and F127DA were recorded at resolutions of
400–4000 and 4 cm^−1 by an FT‐IR spectrometer (Thermo Scientific
Nicolet iS5, ThermoFisher Scientific, Waltham, MA, USA).
Microstructure of F127DA Hydrogels
The microstructure of the synthesized F127DA‐5, F127DA‐10, or F127DA‐20
hydrogels was first characterized by SEM (Hitachi S‐4800, EIKO
Engineering, Tokyo, Japan). The synthesized F127DA was dissolved in
0.5% (wt/vol) LAP and injected into a cylindrical mold. After UV
curing, the cylindrical F127DA hydrogels were precooled at −20 °C for
4–5 h and −80 °C for 18 h and then freeze‐dried using a vacuum‐freeze
drying device (GOLD‐SIM, LA, California, USA). To observe the inner
microstructure of the F127DA hydrogels, the lyophilized hydrogels were
cut into slices of 1 mm thickness. Then, the fracture morphologies were
observed and imaged by SEM (Hitachi S‐4800).
The Porous Properties of F127DA Hydrogels
The liquid displacement method was performed to determine the porosity
of F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels, respectively. 100 µL
of F127DA solutions were added into 1‐mL syringes to fabricate regular
cylindrical F127DA hydrogel samples. After freeze‐drying, the F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels were weighed for their dry weight (W
[d]). Subsequently, they were immersed in ethanol and evacuated under
vacuum until no air bubbles were present. After 1 h, the hydrogels were
suspended in the ethanol, and the weight of F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels immersed in the ethanol (W [e]) was determined. The
hydrogels were then taken out from the ethanol, the excessive ethanol
adsorbed on the hydrogel was gently removed, and the weight of
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels in air (W [a]) were
measured. The porosity (P (%)) is defined as,
[MATH: P%=VpVs=Wa−Wd/
ρethWa−We/
ρeth=Wa−WdWa−We :MATH]
(1)
where V [p] is the pore volume, V [s] is the total volume of pores and
solid matrix, ρ [eth] is the density of ethanol, W [e] is the wet
weight of the hydrogels immersed in ethanol, W [d] is the dry weight of
the hydrogels, and W[a] is the weight of the hydrogels in air after
ethanol immersion.
The Mechanical Properties of F127DA Hydrogels
The compression modulus of the F127DA hydrogel was measured by a
biomechanical tester (EFL‐MT‐5600, EngineeringForLife) according to
previously published methods.^[ [234]^80 ^] Briefly, hydrogel samples
were cast in a 2‐mL syringe (6.5 mm in height). Then, the compression
test was performed with a drop speed of 1 mm min^−1 until the pressure
reached a maximum of 20 N in the loading period. In the unloading
period, the plate rise speed was set to 1 mm min^−1 until the pressure
dropped to a minimum of 0.001 N. The elastic modulus of each sample was
calculated as the slope of the resulting loading curves in the linear
regions (first 0 to 10% of strain) generated by the corresponding
software (EFL‐MT‐5600, EngineeringForLife). The area enclosed by the
loading–unloading curve was defined as the energy dissipated by the
hydrogel network. The energy dissipation was calculated using the
formulas below.
[MATH: ΔU=∫εmax−loading0σdε−∫εmax−unloading0σdε :MATH]
(2)
where ΔU is the dissipation energy (J m^−3), σ denotes stress (Pa), ε
represents strain (%), ε(max‐loading) is the maximum strain during
loading period, and ε(max‐unloading) is the Maximum strain during
unloading period.
To assess the mechanical stability of F127DA‐5, F127DA‐10, and
F127DA‐20 hydrogels, the loading–unloading curves of F127DA‐5,
F127DA‐10, and F127DA‐20 hydrogels were recorded for 5 cycles of
compression tests using consistent methods.
Rheological Characterization of F127DA Hydrogels
Rheological tests were carried out with a rotational rheometer equipped
with a parallel plate geometry (plate diameter: 25 mm) (Anton Paar MCR
302, Anton Paar, Graz, Austria) according to the previously published
literature.^[ [235]^12 , [236]^43 ^] Briefly, the F127DA‐5, F127DA‐10,
and F127DA‐20 hydrogels were uniformly photo‐crosslinked in a 50‐mL
syringe (1 mm in thickness). Then, the disk‐shaped hydrogels were
immersed in phosphate buffer solution (PBS) to prevent dehydration.
Subsequently, the storage modulus (G′) and loss modulus (G″) of each
sample were recorded using a frequency sweep test under 1% strain
amplitude with a range of frequencies from 0.1 to 100 rad s^−1. For the
stress relaxation experiments, a constant strain of 1% was applied to
each hydrogel at 37 °C, and the resulting shear stress was recorded
over the course of 100 s. The half‐stress‐relaxation time (τ [1/2]) was
calculated as the time at which the initial stress of the hydrogel was
relaxed to half of its original value.
The Isolation and Culture of hPDLSCs
hPDLSCs were isolated from permanent teeth without any dental or
periodontal disease, provided by 6 systemically healthy donors (aged 18
to 30 years). All donors signed informed consent forms for the use of
their extracted teeth in the research project, which was approved by
the Ethics Committee of the School of Stomatology, Fourth Military
Medical University, Xi'an, Shaanxi, China (grant no. IRB‐REV‐2022120).
The isolation of PDLSCs was performed according to protocols reported
in the previously published studies.^[ [237]^30 , [238]^81 ^] Briefly,
PDL tissues were scraped from the middle third of the root surfaces.
Then, the obtained PDL tissues were cut into pieces and digested in
3 mg mL^−1 type I collagenase (DIYIBio, Shanghai, China) at 37 °C for
45 min. After digestion, the PDL tissues were incubated in α‐MEM (Gibco
BRL, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS;
Gibco BRL) and 1% penicillin and streptomycin (Zimu Biology, Xi'an,
Shaanxi, China), followed by transfer into 6‐well plates and culture in
a humidified atmosphere with 5% CO[2] at 37 °C. The medium was
exchanged every 3 days. When primary cells migrated from PDL tissues
and reached 80% confluence, the adherent cells were passaged with 0.25%
trypsin (Zimu Biology). The PDLSCs at passages 3–5 were used in the
subsequent experiments.
The Adhesion and Morphology of PDLSCs Cultured on F127DA Hydrogels
The adhesion and morphology of PDLSCs cultured on F127DA‐5, F127DA‐10,
and F127DA‐20 hydrogels were observed by optical microscopy, phalloidin
staining, and SEM, respectively. Prior to cell cultivation, different
concentrations of F127DA (wt/vol; 5%, 10%, and 20%) were dissolved in
0.5% (wt/vol) LAP at 4 °C. After complete dissolution, the F127DA
hydrogel solutions were filtered through precooled 0.22‐µm filters.
Subsequently, 120 µL of filtered hydrogel solutions with different
concentrations (wt/vol; 5%, 10%, and 20%) were added to 48‐well plates
per well and exposed to 30 mW cm^−2 405 nm UV light for 5 s to form
initial hydrogels, followed by coating with 5 mg mL^−1 RGDfK peptide
acryloyl (EngineeringForLife) with UV light exposure for 25 s. All
operations were carried out on ice to prevent automatic hydrogel
gelation at room temperature. When the hydrogels were solidified, cells
were seeded on the surfaces of F127DA‐5, F127DA‐10, or F127DA‐20
hydrogels in 48‐well plates at a density of 5 × 10^4 cells per well.
After 24 h of incubation, the number of nonspread round cells on the
F127DA‐5, F127DA‐10, and F127DA‐20 hydrogels was observed by optical
microscopy (Leica Microsystems, Heerbrugg, St. Gallen, Switzerland) and
quantified according to previously published literature.^[ [239]^82 ^]
For phalloidin staining, cells were rinsed three times with PBS and
fixed in 4% paraformaldehyde (PFA; Servicebio, Wuhan, Hubei, China) for
15 min. After washing three times with PBS, cells were permeabilized
with 0.1% Triton X‐100 (MP Biomedical, Irvine, California, USA) at room
temperature for 5 min. Subsequently, the cells were rinsed and
incubated in iFluor 488 phalloidin (1:500, 40736ES75, Yeasen, Shanghai,
China) plus DAPI (1:1000, 40728ES03, Yeasen) for 1 h at room
temperature in the dark. Representative images of phalloidin staining
were captured by confocal microscopy (Nikon, Tokyo, Japan). For SEM
examination, each sample was rinsed with PBS and fixed in 2.5%
glutaraldehyde (Sigma Aldrich, St. Louis, MO, USA) for 6 h at room
temperature. Then, the samples were dehydrated sequentially in an
ethanol gradient (30, 50, 70, 80, 90, 100%) for 5 min. Subsequently,
the hydrogels were placed in a fume hood to dry for 20 min. Finally,
all samples were sputter‐coated with Pb/Au and imaged using
field‐emission SEM (Hitachi S‐4800) according to the previous paper.^[
[240]^83 ^]
PDLSC Viability Cultured on F127DA Hydrogels
PDLSC viability cultured on F127DA hydrogels was characterized by
live/dead cell staining and Cell counting Kit‐8 (CCK‐8) assays. For
live/dead cell staining, 5 × 10^4 cells were seeded on the surfaces of
F127DA hydrogels as described before. After 1, 3, and 7 days of
culture, the cells were rinsed with PBS and then incubated in 5 mL of
PBS containing 5 µL of calcein‐AM (DIYIBio) plus 15 µL of propidium
iodide (PI) (DIYIBio) for 15 min at room temperature in the dark.
Representative images showing live/dead cells were then taken by
confocal microscopy under the same setup parameters (Nikon), and
randomly selected fields were used for image analysis using ImageJ
1.53k software. The cell viability was calculated as the number of
living cells/the number of total cells (100%). For CCK‐8 assays, 2 ×
10^3 cells were seeded on the surfaces of F127DA hydrogels in 96 cell
plates. After 1, 3, and 7 days of culture, each sample was rinsed with
PBS and then incubated in 200 µL of serum‐free α‐MEM containing 20 µL
of CCK‐8 reagent (DIYIBio) per well for 3 h at 37 °C in the dark. The
absorbance at 450 nm was measured by a microplate reader (Tecan
Infinite 200Pro, Tecan, Männedorf, Zurich, Switzerland).
In Vivo Biocompatibility of F127DA Hydrogels
The biocompatibility of F127DA hydrogels was further investigated
following subcutaneous implantation into the dorsal flanks of mice.
Nine male C57 mice aged 7–8 weeks (purchased from the Laboratory Animal
Center of FMMU) were used in the experiment. All surgical procedures
were also approved by the Animal Research Committee of FMMU (grant no.
IACUC‐20240113). The F127DA solutions were added into 2‐mL syringes to
fabricate cylindrical F127DA hydrogel samples (3 mm in height). F127DA
hydrogel samples were then subcutaneously transplanted into the
bilateral backs of mice. At 2 weeks post surgery, the mice were
euthanized. The full‐thickness skins covering the transplanted F127DA
hydrogels and major organs of mice (liver, spleen, lung, heart, and
kidney) were collected. The obtained samples were dehydrated, embedded
in paraffin, sectioned with a thickness of 4 µm, and then stained with
hematoxylin and eosin (H&E). The scanned slices were observed using
slide‐viewing software (CaseViewer ver. 2.1, 3DHISTECH, Budapest, Pest
megye, Hungary).
The Elastic Modulus of PDLSCs Cultured on F127DA Hydrogels
1 × 10^5 cells were seeded on the surfaces of F127DA‐5, F127DA‐10, or
F127DA‐20 hydrogels (volume: 100 µL) in 35 mm glass bottom cell culture
dishes. After 24 h of incubation, the cells were rinsed three times
with PBS, and then the elastic modulus of PDLSCs was detected by AFM
(Bruker, Billerica, Massachusetts, USA). The measurement was conducted
in contact mode in an aqueous environment by using an AFM probe
(PNP‐TR, Nanoworld, Neuchatel, Neuchâtel Canton, Switzerland) equipped
with a triangular tip and with a nominal spring constant of 0.08 N
m^−1. The AFM tip was controlled to indent the cells in the
approach–retract mode to measure the elastic properties of the cells,
and the approach–retract curves were recorded by the AFM manipulation
software. The elastic modulus of PDLSCs was calculated by the Sneddon
model by using the following equation.
[MATH: F=2πd2E1−ν2tanα :MATH]
(3)
where F is the loading force of the AFM probe, d is the indentation
depth, E is the Elastic modulus, υ is the Poisson ratio of cell (υ =
0.5), and α is the half‐opening angle of the conical tip.
Fibrogenic Induction of PDLSCs on F127DA Hydrogels under Resting Conditions
PDLSCs were seeded on the surfaces of F127DA‐5, F127DA‐10, or F127DA‐20
hydrogels at a density of 5 × 10^4 per well. When the cells reached
80–90% confluence, the culture medium was changed to fibrogenic
induction medium, which was complete medium supplemented with 25 µg
mL^−1 corbic acid and 100 ng mL^−1 connective tissue growth factor
(CTGF; MedChemExpress, Monmouth Junction, NJ, USA) according to
previously published literature.^[ [241]^16 , [242]^84 ^] The medium
was changed every 3 days. After 7 days of incubation, the cells and
supernatant were harvested for quantitative real‐time polymerase chain
reaction (qRT‒PCR), immunofluorescence staining, and total collagen
detection assays.
The Fibrogenic Induction of PDLSCs on F127DA Hydrogels under Cytomechanical
Loading
To mimic the hydrostatic pressure endured by cells encapsulated in the
interstitial fluid‐filled ECM during mastication, a custom‐designed
multifunctional in vitro cell compression system was used to exert
dynamic compressive stress on PDLSCs according to the previously
published studies.^[ [243]^52 , [244]^53 ^] The cells were first seeded
on the surfaces of F127DA‐5, F127DA‐10 or F127DA‐20 hydrogels. When the
cells reached 80–90% confluence, the culture medium was changed to
fibrogenic induction medium. At 1, 3, and 5 days after fibrogenic
induction, the cell–hydrogel constructs seeded in 48‐well plates were
placed in the cell compression device and stimulated with pressure
every other day. Based on previously published literature.^[ [245]^52 ,
[246]^85 ^] the pressure conditions were set to ≈0–120 kPa, 1 Hz, and 1
h day^−1. After an incubation period of 7 days, the effects of
viscoelastic F127DA hydrogels on the fibrogenic differentiation
potential of PDLSCs under dynamic compressive stress were analyzed
using qRT‒PCR, immunofluorescence staining and total collagen detection
assays.
qRT‒PCR
The expression levels of fibrogenic differentiation‐related genes (SCX
and COL‐1) in PDLSCs cultured on viscoelastic F127DA hydrogels were
analyzed by qRT‒PCR. Briefly, total cellular RNA was extracted and
transcribed into complementary DNAs (cDNAs) using TRIzol Reagent
(TIANGEN, Beijing, China) and a Hifair lll 1st Strand cDNA Synthesis
Kit (Yeasen) according to the manufacturer's protocol. Then, qRT‒PCR
was conducted using 2×qPCR SmArt Mix (SYBR Green) (No Rox) (DIYIBio).
The primer sequences used in this study are listed in Table [247]1 .
Table 1.
qRT–PCR primer sequences used in this study.
Gene Full name Gene ID Primers Sequences (5′‐3′)
18S rRNA 18S ribosomal RNA 106632259 Forward CAGCCACCCGAGATTGAGCA
Reverse TAGTAGCGACGGGCGGTGTG
COL‐1 Collagen type I alpha 1 chain 1277 Forward
CTGACCTTCCTGCGCCTGATGTCC
Reverse GTCTGGGGCACCAACGTCCAAGGG
SCX Scleraxis 642658 Forward CCTGGCCTCCAGCTACATCT
Reverse TCGCGGTCCTTGCTCAACTTT
ITGA5 Integrin subunit alpha 5 3678 Forward GAGGCAGTGCTATTCCCAGTAAG
Reverse GTCCCGTAACTCTGGTCACATAT
ITGB1 Integrin aubunit beta 1 3688 Forward ACAGTGAAGACATGGATGCTTACT
Reverse ACGACACTTGCAAACACCATTTC
FAK Focal adhesion kinase 5747 Forward CATCTATCCAGGTCAGGCATCTC
Reverse TTTCCTGTTGCTGTCGGATTAGA
TPM1 Tropomyosin 1 7168 Forward GTTTGCGGAGAGGTCAGTAACTA
Reverse TCAGGGCCAGCTTTAGTTCATTA
ACTB Actin beta 60 Forward ACAGAGCCTCGCCTTTGC
Reverse CCACCATCACGCCCTGG
ACTN1 Actinin alpha 1 87 Forward TCAACAAGGCCCTGGATTTCATA
Reverse TGTGGAAGTTCTGGATGTTGACA
RAC1 Rac family small GTPase 1 5879 Forward GGCTAAGGAGATTGGTGCTGT
Reverse GACAGGACCAAGAACGAGGG
RHOA Ras homolog family member A 387 Forward TTCGTTGCCTGAGCAATGG
Reverse TGTGTCCCACAAAGCCAACT
[248]Open in a new tab
Immunofluorescence Staining for Fibrogenic Differentiation Analysis
Fibrogenic differentiation‐related markers (SCX and COL‐1) were
detected by immunofluorescence staining. Cells were rinsed three times
with PBS and then fixed in 4% paraformaldehyde (Servicebio) for 15 min.
After washing three times with PBS, cells were permeabilized with 0.1%
Triton X‐100 (MP Biomedical) at room temperature for 5 min. Then, the
cells were rinsed and incubated at 4 °C overnight with the following
primary antibodies: rabbit anti‐SCXA (1:100, DF13293, Affinity
Biosciences, Cincinnati, OH, USA) and rabbit anti‐COL‐1 (1:200, 72026,
Cell Signaling Technology, Boston, MA, USA). Subsequently, the cells
were rinsed and incubated in Alexa Fluor 488 donkey anti‐rabbit IgG
(H+L) (1:500, 34206ES60, Yeasen) plus DAPI (1:1000, 40728ES03, Yeasen)
for 1 h at room temperature in the dark. Representative images were
captured by confocal microscopy (Nikon) at 20× magnification
with the same settings.
Sirius Red Total Collagen Detection
The content of total collagen in the supernatant was detected by a
Sirius red total collagen detection kit (cat. 9062, Chondrex,
Washington, WV, USA) following the manufacturer's instructions. In
brief, 1 mL of collected supernatant was mixed with 250 µL of
concentrating solution, and the mixture was vortexed overnight at 4 °C.
Subsequently, each sample was centrifuged at 10 000 rpm for 3 min, and
250 µL of 0.05 m acetic acid was added to each centrifuge tube to
dissolve the obtained pellet. After complete dissolution, 100 µL of
solution was mixed with 500 µL of Sirius Red in another 1.5‐mL
centrifuge tube. After vortexing for 20 min at room temperature, the
mixture was centrifuged, rinsed in 500 µL of Washing Solution, and
centrifuged at 10 000 rpm for 3 min. Then, 250 µL of Extraction Buffer
was added to dissolve the precipitate. After vortexing and complete
dissolution, 200 µL of solution from each tube was transferred to a
96‐well plate. The optical density (OD) value at 510 nm was measured
using a microplate reader (Tecan). The concentrations of collagen in
each sample were calculated from standard curves, which were defined by
the OD values and corresponding concentrations (125, 63, 31.5, 16, and
8 µg mL^−1).
The Mechanical Responses of PDLSCs to Viscoelastic F127DA Hydrogels under
Cytomechanical Loading
Given that integrin–FAK–cytoskeleton pathways play key roles in
cell–ECM interactions, which influence the spreading and
differentiation of stem cells by activating mechanoresponsive signaling
and mechanotransduction pathways,^[ [249]^49 , [250]^62 ^] the cell
spreading of PDLSCs and the related integrin–FAK–cytoskeleton pathways
were further analyzed. As described before, PDLSCs were seeded on the
surfaces of viscoelastic F127DA hydrogels and stimulated with
compressive pressure (≈0–120 kPa, 1 Hz, 1 h day^−1). After 24 h of
cytomechanical loading, the morphology of PDLSCs cultured on F127DA‐5,
F127DA‐10, or F127DA‐20 hydrogels was observed by optical microscope,
phalloidin staining, and SEM according to the methods described and
focal adhension‐related markers (Vinculin and Talin) were detected by
immunofluorescent staining, the following primary antibodies were used:
rabbit anti‐Talin (1:200, 14168‐1‐AP, Proteintech, Wuhan, China) and
mouse anti‐Vinculin (1:200, 66305‐1‐Ig, Proteintech). Subsequently, the
cells were rinsed and incubated in Alexa Fluor 488 Goat anti‐Mouse IgG
(H+L) (1:500, 33206ES60, Yeasen), Alexa Fluor 594 Goat anti‐Rabbit IgG
(H+L) (1:500, 33112ES60, Yeasen) plus DAPI (1:1000, 40728ES03, Yeasen)
for 1 h at room temperature in the dark. The elastic modulus of PDLSCs
cultured on F127DA‐5, F127DA‐10, or F127DA‐20 hydrogels was detected by
AFM single‐cell experiments according to the aforementioned methods.
The expression levels of integrin–FAK‐cytoskeleton pathway‐related
genes (ITGA5, ITGB1, FAK, ACTN1, ACTB, TPM1, RAC1, and RhoA) were
analyzed by qRT–PCR. The primer sequences used in this study are listed
in Table [251]1.
Influence of Cytochalasin B Treatment on the Mechanical Responses and
Fibrogenic Differentiation of PDLSCs under Cytomechanical Loading
To further examine the effect of the cytoskeleton on the fibrogenic
induction of PDLSCs, cells cultured on F127DA‐5 hydrogels were first
incubated in complete medium containing 10 µM cytochalasin B (CB;
Yeasen) for 24 h under cytomechanical loading. Then, the spreading of
PDLSCs was observed by optical microscopy and phalloidin staining. In
line with the cell spreading analysis, the expression levels of
integrin–FAK–cytoskeleton pathway‐related genes (ITGA5, ITGB1, FAK,
ACTN1, and TPM1) were analyzed by qRT‒PCR according to the
aforementioned methods. Similarly, the fibrogenic differentiation
potential of PDLSCs was determined using qRT‒PCR and immunofluorescence
staining after cells cultured on F127DA‐5 hydrogels were incubated in
fibrogenic inductive medium containing CB for 7 days.
RNA Sequencing Analysis
To further understand the underlying mechanics of Viscoelastic F127DA
hydrogels enhanced the fibrogenic differentiation potentials of PDLSCs
under cytomechanical loading. RNA sequencing analysis was performed to
obtain a global view of the affected biological processes and signaling
pathways within PDLSCs. The samples were divided into three groups,
including F127DA‐5 group, F127DA‐10 group, and F127DA‐20 group, with
3–4 parallel samples in each group. After an incubation period of 7
days, the PDLSCs cultured on F127DA‐5, F127DA‐10, or F127DA‐20
hydrogels were harvested for RNA sequencing analysis, the Trizol was
used to lysis cells and total RNA was extracted by a total RNA kit. All
samples were submitted to Biomarker Technologies Co., Ltd. (Beijing,
China). After extracting the total RNA, a library was constructed to
check and ensure the quality of RNA, and then Illumina sequencing was
carried out. After sequencing, all the genes were analyzed
statistically, and the differentially expressed genes (DEGs) in
different groups were compared. The screening criterion of differential
genes was log2 (fold change) ≥ 1.5, and p‐value ≤ 0.05. Then the Gene
Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway
enrichment analysis, and gene set enrichment analysis (GSEA) were
performed and visualized based on differentially expressed genes DEGs
using the BMKCloud ([252]www.biocloud.net).
In Vivo Biodegradability of F127DA Hydrogels
The biodegradation of F127DA hydrogels following dorsal subcutaneous
transplantation was analyzed using in vivo immunofluorescence images.
Nine male C57 mice aged 7–8 weeks (purchased from the Laboratory Animal
Center of FMMU) were used in the experiment. All surgical procedures
were approved by the Animal Research Committee of FMMU (grant no.
IACUC‐20240112). F127DA hydrogel solutions were first labeled with the
fluorescent dye (4 mg mL^−1; EFL‐DYE‐UF‐ENE‐R, EFL) following the
manufacturer's instructions. Then the F127DA solutions were added into
2‐mL syringes to fabricate cylindrical F127DA hydrogel samples (3 mm in
height). F127DA hydrogel samples were then subcutaneously transplanted
into the bilateral backs of mice. The fluorescent dye‐labeled F127DA
hydrogels were detected using the In Vivo Imaging System (IVIS)
(Xenogen, Alameda, CA, USA) at 0, 1, and 2 weeks post surgery. The
radiant efficiency was quantified using Living Image v.4.3.1 software
(Caliper Life Sciences, Hopkinton, MA, USA). The following formula was
used to calculate the in vivo retention (%) of F127DA hydrogels
according to a previously published study.
[MATH: RetentionofF127DA%=REt/REt0<
mo linebreak="goodbreak">×100%
:MATH]
(4)
where RE(t [0]) is the radiant efficiency at week 0 and RE(t) is the
radiant efficiency at time point t.
Therapeutic Performance of Viscoelastic F127DA Hydrogels on PDL Injury in
Delayed Replantation of Avulsed Teeth
A model of delayed replantation of an avulsed incisor was used as a
proof‐of‐concept test to evaluate the effects of viscoelastic F127DA
hydrogels on PDL regeneration. Twenty‐four male Sprague−Dawley rats
(7–8 weeks, 180–250 g; purchased from the Laboratory Animal Center of
FMMU) were used for delayed tooth replantation, in accordance with the
ethical guidelines. All surgical procedures were also approved by the
Animal Research Committee of FMMU (grant no. IACUC‐20221241). Based on
previously published methods,^[ [253]^75 , [254]^86 ^] animals were
anesthetized by the intraperitoneal injection of 0.1% pentobarbital
sodium (0.4 mL/100 g). After general anesthesia, the maxillary left
incisors of rats were submucosally anesthetized using primacaine
(Acteon Pharma, Bordeaux, Gironde, France), and then the maxillary left
incisor of each rat was completely extracted with minimum trauma using
a 1# Root Elevator (BONEWELL Medical, Suzhou, Jiangsu, China). Teeth
with either root or bone fracture were excluded from the present study.
Immediately after extraction, the dental papilla and pulp tissues were
carefully removed using a 00# barbed broach (MANI, Tokyo, Japan) to
prevent the continual growth of the rat incisors. The root canals were
then irrigated with sterile 0.9% physiological saline, and the residual
saline was dried by #40 absorbent paper points (HuaYou Medical
Instruments, Ziyang, Sichuan, China). To prevent potential infection,
the root canal was filled with calcium hydroxide root canal filling
agent (C‐Root, Beijing, China). Next, the dental crowns of extracted
teeth were inserted in an orthodontic wax, and then the tooth roots
were air‐dried in a fume hood for 60 min. Thereafter, each root surface
was packaged with 20 µL of F127DA‐5, F127DA‐10, or F127DA‐20 hydrogel.
Tooth roots without hydrogel coatings were used as a control. After
crosslinking under 405 nm UV‐light exposure for 30 s, each tooth was
replanted into the corresponding extraction socket with slow and
delicate movements using tweezers. Penicillin was intramuscularly
injected, and iodine tincture was locally applied for 3 consecutive
days to prevent potential postoperative infection. The rats were fed a
soft food diet for 7 days and then given a regular diet. At 8 weeks
post surgery, the animals were euthanized by CO[2], and the maxillaries
were harvested for further analysis.
Micro‐CT Analysis
The maxillaries were collected and fixed in 4% paraformaldehyde
(Servicebio) for 24 h. Then, root resorption and PDL regeneration were
analyzed using a micro‐CT scanner (AX2000, Always Imaging, Shanghai,
China) with a resolution of 12.5 µm, an energy of 90 kV, and a current
of 80 µA. After scanning, the obtained images were analyzed and
three‐dimensionally reconstructed using the software VG studio MAX
3.5.1 (Volume Graphics, Heidelberg, Baden‐Württemberg, Germany). After
the 3D reconstruction of rat maxillary incisors by software, the degree
of root resorption was calculated as the root resorption area/total
root area (100%) measured by the software. Since the PDL of rat
incisors exists only on the lingual side,^[ [255]^87 ^] the region of
interest (ROI) was defined as the lingual area between the root and
alveolar bone to reconstruct the PDL model. The ROI of each sample was
analyzed to determine the area (mm^2) and volume (mm^3) of
reconstructed PDL tissue.
Histology Analysis
The newly formed periodontal tissue and root resorption were analyzed
based on Masson and H&E staining according to the previously published
methods.^[ [256]^88 ^] Briefly, after micro‐CT scanning, the specimens
were decalcified in 10% EDTA decalcification solution (Coolaber,
Beijing, China) at 37 °C for at least 3 months. The decalcification
solution was exchanged every 3 days. Subsequently, the obtained samples
were dehydrated and embedded in paraffin and sectioned longitudinally
along the entire length of the tooth from crown to root at a thickness
of 4 µm. The slices were further stained with Masson and H&E. The
scanned slices were observed using slide‐viewing software (CaseViewer
ver. 2.1, 3DHISTECH). The histomorphometric analysis included the
following parameters: root resorption, replacement root resorption
(ankylosis), and the length of the newly formed PDLs.
Immunofluorescence Staining for Newly Regenerated PDL Evaluation
For immunofluorescence staining, sections were routinely dewaxed and
hydrated, and then the antigen in specimens was retrieved using sodium
citrate buffer (DIYIBio). Subsequently, sections were blocked and
incubated in the following primary antibodies at 4 °C overnight: rabbit
anti‐COL‐1 (1:100, 14695‐1‐AP, Proteintech) and rabbit anti‐SCX (1:300,
bs‐12364R, Bioss, Beijing, China). Subsequently, the slices were rinsed
with PBS and incubated with the following two secondary antibodies:
Alexa Fluor 488 donkey anti‐rabbit IgG (1:500; 34206ES60, Yeasen) or
Alexa Fluor 594 donkey anti‐rabbit IgG (1:500, 34212ES60, Yeasen) plus
DAPI (1:1000, 40728ES03, Yeasen). After rinsing with PBS three times,
the images were scanned by slide‐viewing software (CaseViewer ver. 2.1,
3DHISTECH).
Statistical Analysis
Data from at least three independent experiments are presented as the
means ± standard deviations. When normality was confirmed, one‐ or
two‐way ANOVA with Tukey's post hoc test was performed to evaluate the
group differences when dealing with more than 2 groups. The statistical
significance of the difference between two groups was determined by
unpaired t‐test. When the data were nonnormally distributed, the
Kruskal‒Wallis test was used to calculate statistical significance. In
all cases, significance was defined as follows: *p < 0.05, **p < 0.01,
***p < 0.001. The n values in each figure legend represent the number
of the sample size or repetitions. Detailed P values, n values, and
statistical methods were listed in the corresponding figure legends.
Conflict of Interest
The authors declare no conflict of interest.
Author Contributions
J.‐J.Z., X.L., and Y.T. contributed equally to this work. R.‐X.W.,
F.‐M.C., and X.‐T.H. conceptualized the study and designed the
experiments. J.‐J.Z., X.L., and X.‐T.H. supervised the study. J.‐J.Z.
and Y.T. synthesized the materials. J.‐J.Z., X.L., and Y.T.
characterized the samples. J.‐J.Z., X.L., J.‐K.Z., and D.‐K.D.
performed the in vitro experiments. J.‐J.Z., Y.T., and C.J. performed
the in vivo experiments. X.L., Y.Y., B.‐M.T., and X.‐T.H. analyzed the
data. J.‐J.Z., X.L., Y.T., and X.‐T.H. wrote and drafted the
manuscript.
Supporting information
Supporting Information
[257]ADVS-11-2309562-s001.pdf^ (634.4KB, pdf)
Acknowledgements