Abstract
Proteolysis‐targeting chimeras (PROTACs) have emerged as a promising
strategy for targeted protein degradation and drug discovery. To
overcome the inherent limitations of conventional PROTACs, an
innovative drugtamer‐PROTAC conjugation approach is developed to
enhance tumor targeting and antitumor potency. Specifically, a smart
prodrug is designed by conjugating “drugtamer” to a nicotinamide
phosphoribosyltransferase (NAMPT) PROTAC using a tumor microenvironment
responsible linker. The “drugtamer” consists of fluorouridine
nucleotide and DNA‐like oligomer. Compared to NAMPT PROTAC and the
combination of PROTAC + fluorouracil, the designed prodrug AS‐2F‐NP
demonstrates superior tumor targeting, efficient cellular uptake,
improved in vivo potency and reduced side effects. This study provides
a promising strategy for the precise delivery of PROTAC and synergistic
antitumor agents.
Keywords: drug combination, drugtamer, fluorouracil, NAMPT, PROTAC
__________________________________________________________________
The first drugtamer‐PROTAC conjugate, which enhances tumor targeting
and efficacy in vivo while reducing side effects, is developed by
linking a nucleolin‐specific aptamer with nicotinamide
phosphoribosyltransferase (NAMPT) PROTAC and fluorouridine nucleotides
through a drug‐constituted DNA‐like oligomer (drugtamer) and a tumor
microenvironment‐responsive linker. This approach may revolutionize the
precise delivery of PROTAC and synergistic cancer treatments.
graphic file with name ADVS-11-2401623-g005.jpg
1. Introduction
Proteolysis‐targeting chimeras (PROTACs) are gaining popularity as a
promising technology for drug discovery and development.^[ [34]^1 ^]
These bifunctional molecules consist of a target protein‐ligand,
linker, and E3 ligase ligand. By recruiting an E3 ligase in proximity
to the target protein, PROTACs facilitate the formation of ternary
complexes, inducing the ubiquitination of the target protein and its
subsequent degradation by the proteasome. Compared with conventional
small‐molecule inhibitors, PROTACs exhibit remarkable advantages in
catalytic degradation at low dosages and selectively eliminate
obstinate proteins.^[ [35]^1 , [36]^2 ^] Nevertheless, drug development
for PROTACs faces several major challenges, including non‐specific
tumor targeting, limited in vivo potency, and significant toxicity.^[
[37]^3 , [38]^4 ^]
To improve the therapeutic efficacy of PROTACs, combinations of PROTAC
and small‐molecule antitumor agents are currently being evaluated in
clinical trials. For example, the estrogen receptor (ER) PROTAC
ARV‐471, in combination with everolimus (ClinicalTrials.gov identifier:
[39]NCT05501769) or palbociclib (ClinicalTrials.gov identifier:
[40]NCT04072952), has been investigated for the treatment of breast
cancer.^[ [41]^5 , [42]^6 , [43]^7 , [44]^8 ^] The clinical efficacy of
the androgen receptor (AR) PROTAC ARV‐110 and abiraterone in prostate
cancer is currently in progress (ClinicalTrials.gov Identifier:
[45]NCT05177042).^[ [46]^9 , [47]^10 ^] However, owing to the unique
pharmacokinetic properties of individual drugs, traditional “cocktail”
combination therapies face challenges in achieving balanced drug
delivery to tumor sites, thereby escalating the risk of potential
toxicity.^[ [48]^11 , [49]^12 , [50]^13 , [51]^14 , [52]^15 ^]
Therefore, there is an imperative need to develop novel strategies to
improve the efficiency of PROTAC‐based combination therapies,
particularly those capable of precisely modulating drug accumulation in
tumors to enhance synergistic therapeutic efficacy.
Aptamers, also known as chemical antibodies, possess great potential as
targeting moieties because of their low immunogenicity, facile
synthesis, potent tissue penetration, and high binding affinity for
specific receptors.^[ [53]^16 , [54]^17 ^] Previously, we developed an
aptamer‐PROTAC conjugation strategy by combining the aptamer AS1411
(AS) with a bromodomain and extra‐terminal domain (BET) PROTAC through
a glutathione‐responsive linker.^[ [55]^18 ^] The resulting conjugate
showed improved targeting ability in breast cancer cells. However, such
aptamer‐drug conjugates typically face limitations in their
drug‐loading capacity, making it challenging to sequentially conjugate
multiple drug molecules onto aptamers.^[ [56]^19 ^] To address this
bottleneck, we designed a novel multifunctional smart prodrug system,
named drug tamer‐PROTAC conjugate, to simultaneously realize precise
tumor targeting, efficient delivery, and synergistic combination
therapy. Specifically, taking advantage of the structural similarity of
fluorouridine nucleotides (Fdu) with thymidine (T) nucleotides, Fdu was
directly integrated into nucleic acids during the solid‐phase synthesis
of the aptamer, which was further attached to a synergistic PROTAC
through a tumor microenvironment‐responsive linker. Therefore, improved
tumor targeting, antitumor efficacy, and reduced side effects can be
achieved. As a conceptual validation study, we designed a smart prodrug
by conjugating aptamer AS, cytotoxic Fdu, and nicotinamide
phosphoribosyltransferase (NAMPT) PROTAC. The PROTAC conjugate showed
improved aqueous solubility and was selectively recognized and
efficiently delivered into tumor cells to release synergistic Fdu and
PROTAC, leading to excellent in vivo antitumor potency and low
toxicity.
2. Results
2.1. Rational Design of AS‐2Fdu‐NAMPT PROTAC Conjugates
Fluoropyrimidines such as 5‐fluorouracil (FU) are intracellularly
converted into active Fdu, thereby impeding DNA and RNA synthesis
(Figure [57]S1, Supporting Information).^[ [58]^20 ^] As a frontline
chemotherapeutic agent, FU is used in various treatment regimens for
breast cancer when co‐administered with other anticancer drugs.^[
[59]^21 , [60]^22 ^] NAMPT is the rate‐limiting enzyme in nicotinamide
adenine dinucleotide (NAD^+) biosynthesis and is a promising antitumor
target.^[ [61]^23 ^] FU has been reported to exert synergistic effects
with the NAMPT inhibitor FK866, which increases the chemosensitivity of
cancer cells to FU by inhibiting cell proliferation and inducing
apoptosis.^[ [62]^24 , [63]^25 ^]
We previously designed a series of NAMPT PROTACs (herein referred to as
NP).^[ [64]^26 , [65]^27 , [66]^28 ^] However, such NAMPT degraders are
limited by their poor solubility and tumor tissue selectivity. Inspired
by the synergism between FU and NAMPT inhibitors, we envisioned that
the targeted co‐delivery of FU and NP would achieve enhanced antitumor
activity and reduced side effects (Figure [67]1 ).
Figure 1.
Figure 1
[68]Open in a new tab
Design of drugtamer‐PROTAC conjugate AS‐2F‐NP. A) The chemical
structures and design rationale of AS‐2F‐NP. The imaging molecules were
designed by adding fluorophore in the aptamer. B) Schematic of the
design strategy of drugtamer‐PROTAC conjugate AS‐2F‐NP. The aptamer
segment selectively identifies the cell membrane receptor and is
specifically internalized into tumor cells. The cleavable linker is
susceptible to be attacked by GSH, leading to the release of the
original NP. AS‐2F‐NP was activated by GSH and DNase II successively,
then the FdUMP is released to block DNA synthesis and exerts
synergistic antitumor effect with NP.
Next, we validated the synergistic effects of FU and NP using
Chou‐Talalay assays to determine the drug combination index (CI).^[
[69]^29 ^] Experiments were conducted at FU:NP ratios of 1:2, 1:1, and
2:1, respectively. The most pronounced synergism occurred at a ratio of
2:1 (Table [70]S1, Supporting Information). When the cells were treated
with different doses, the group with an FU:NP ratio of 2:1 exhibited
synergism at all concentrations, indicating a stronger synergistic
effect. In contrast, groups treated with FU: NP ratios of 1:1 or 1:2
showed synergistic effects (CI<1) at concentrations <0.5 µm. When the
concentration increased, the antitumor efficacy improved accordingly,
but the drug combinations tended to be antagonistic (CI >1) or additive
(CI = 1) (Figure [71]2A). The dose–response curves demonstrated that
the differences were more significant in the 2:1 ratio than in the
other combinations (Figure [72]2B). The cytotoxic effects of FU, NP,
and their combination on breast cancer cells were evaluated using a
cell counting Kit‐8 (CCK8) assay. The results showed that the
combination treatment was more effective than the single drugs (Figure
[73]S2, Supporting Information), with the best inhibitory activity in
cell viability observed at the FU:NP ratio of 2:1 (Figure [74]2C,D).
Therefore, the ratio 2:1 was selected for the subsequent conjugate
design. AS is widely recognized as a nucleolin receptor‐targeting
aptamer with a specificity for breast cancer cells.^[ [75]^18 ^]
Inspired by this synergism, a smart AS‐based prodrug for the targeted
co‐delivery of 2Fdu (the active form of FU) and NP was rationally
designed. Considering the possibility that conjugated drugs may disrupt
the targeting specificity of AS aptamer, we incorporated six thymine
nucleotides at the AS terminus. Leveraging the structural similarity
between Fdu and natural thymine nucleotides, we integrated two Fdu
molecules into thymine nucleotides (AS‐2Fdu‐NH[2] ) to accurately
transport the drug payloads. AS‐2Fdu‐NH[2] can be conveniently prepared
via solid‐phase synthesis. The Fdu integrated aptamer was further
conjugated with NP through a tumor microenvironment‐responsive linker.
Specifically, the hydroxyl group in the VHL ligand of NP was used as a
suitable attachment point for linker extension. Although introducing a
linker could potentially disrupt the VHL‐mediated recruitment of the E3
ubiquitin ligase and thereby reduce degradation activity, we designed a
GSH‐sensitive carbonate disulfide cleavable linker to ensure the
effective release of NP. Finally, the conjugate AS1411‐2Fdu‐NAMPT
PROTAC (AS‐2F‐NP, 1) was rationally designed (Figure [76]1A).
Figure 2.
Figure 2
[77]Open in a new tab
The synergistic effect of FU and NP. A) The combination index (CI) of
FU with NP at different ratios. The best synergism was observed at a
FU:NP ratio of 2:1. Fa represents fraction affected, which denotes the
inhibition rate of cells. B) The dose–response curve for the
combination therapy in the FU:NP ratio of 2:1. C,D) Comparative
evaluation of cytotoxicity of FU, NP, and their 2:1 combination against
MDA‐MB‐231 cells through the CCK‐8 assay.
To further assess the tumor‐targeting capability and advantages of
AS‐2F‐NP, we designed various control molecules (Scheme [78]1 ),
including non‐targeted CRO‐2Fdu‐NP (CRO‐2F‐NP, 2) and AS‐2F‐NP variants
tagged with different fluorescent groups (AS‐2F‐NP‐Fluorescein (Fam), 3
and AS‐2F‐NP‐Cyanine 3 (Cy3), 4), for in vitro and in vivo evaluations.
Scheme 1.
Scheme 1
[79]Open in a new tab
Reagents and conditions: a) 4‐nitrophenylchloroformate, DMAP, DCM, rt,
12 h, 47%; b) 2,2′‐disulfanediylbis(ethan‐1‐ol), DMAP, DCM, TFA, DCM,
rt, 10 h, 44%; c)
2,2‐dimethyl‐4‐oxo‐3,8,11,14,17‐pentaoxa‐5‐azanonadecan‐19‐oic acid,
HOBT, EDCI, DMF, rt, 5 h, 65%; d) TFA, DCM, rt, 2 h, 79%; e) compound
1S, HOBT, EDCI, DMF, rt, 10 h, 56%; f) succinic anhydride, DMAP, DCM,
rt, 3 h, 72%; g) aptamers, Sulfo‐NHS, EDCI, dd‐H[2]O, DMF, 0.5 m
Na[2]CO[3]/NaHCO[3], 12 h, 5–20%.
2.2. Synthesis of Drugtamer‐PROTAC Conjugates
The synthesis of drugtamer‐PROTAC conjugates is outlined in
Scheme [80]1. First, the hydroxyl group in the VHL ligand 5 was reacted
with 4‐nitrophenyl carbonochloridate in the presence of DMAP to afford
intermediate 6. Key intermediate 7 was synthesized by reacting compound
6 with 2,2′‐disulfanediylbis(ethan‐1‐ol) under the catalytic reaction
by DMAP. Compound 7 was condensed with
dimethyl‐4‐oxo‐3,8,11,14‐tetraoxa‐5‐azahexadecan‐16‐oic acid in the
presence of HOBT and EDCI to afford the intermediate 8. Subsequently,
the Boc protecting group was removed using TFA to yield compound 9,
which was further condensed with intermediate 1S (Scheme [81]S1,
Supporting Information) in the presence of HATU and DIPEA to obtain
compound 10. Further esterification of 10 with succinic anhydride
afforded the intermediate 11. Finally, 11 was conjugated with
AS‐2Fdu‐NH[2] in the presence of sulfo‐NHS and EDCI, resulting in the
synthesis of the target compound AS‐2F‐NP. As controls, the CRO‐PROTAC
conjugate (herein denoted as CRO‐2F‐NP) and Fam‐ or Cy3‐modified
conjugates (hereafter denoted as AS‐2F‐NP‐Fam, AS‐2F‐NP‐Cy3, and
AS‐2F‐NP‐Cy3) were synthesized using a protocol similar to that
described for AS‐2F‐NP. The structures of the crucial intermediates
were verified using ^1H‐NMR, ^13C‐NMR, and high‐resolution mass
spectrometry (HRMS). The aptamer‐modified conjugates were purified
using reversed‐phase high‐performance liquid chromatography (RP‐HPLC)
and validated using mass spectrometry.
2.3. GSH‐Responsive Conjugate AS‐2F‐NP Demonstrated Favorable In Vitro
Stability and Efficiently Released the Prototype PROTAC
The stability of AS‐2F‐NP was assessed using 10% polyacrylamide gel
electrophoresis (PAGE) (Figure [82]3A; Figure [83]S3, Supporting
Information). AS‐Cy3 and AS‐2F‐NP‐Cy3 were incubated in a medium
containing 10% fetal bovine serum (FBS) at 37 °C for different
durations. Similar to AS‐Cy3, AS‐2F‐NP‐Cy3 demonstrated good stability
after 48 h of incubation in a serum‐containing medium. AS‐2F‐NP‐Cy3
mostly retained its intact form.
Figure 3.
Figure 3
[84]Open in a new tab
The stability, release, targeting, cellular uptake, and internalization
of conjugate AS‐2F‐NP. A) The 10 µM concentrations of AS‐Cy3 and
AS‐2F‐NP‐Cy3 were incubated for 48 h in a medium containing serum. B)
HPLC of drug‐release of AS‐2F‐NP in the reducing conditions for 24 h,
the Y axis represents relative amount of NP. C) MDA‐MB‐231 and MCF‐10A
cells were individually subjected to flow cytometry after incubation
with 500 nm Fam‐modified AS, AS‐2F‐NP, and CRO for 0.5 h at 45 °C. D)
Confocal laser scanning micrographs of MDA‐MB‐231 cells were captured
following a 2 h treatment with 500 nm Cy3‐modified AS‐2F‐NP, AS, and
CRO in DMEM at 37 °C. The scale bar represents 20 µm. E) Illustrative
confocal micrographs of MDA‐MB‐231 cells post‐pretreatment with
inhibitors targeting endocytic pathways (CA, caveolae; CL, clathrin; M,
macropinocytosis) and subsequent incubation with 500 nM Cy3‐modified
AS‐2F‐NP. The scale bar denotes 10 µm. F–I) Chemical inhibition was
employed to impede the cellular internalization of Cy3‐modified
conjugates in MDA‐MB‐231 cells. Compared to the control experiment (no
inhibitor, F), the relative fluorescence of Cy3 was assessed via flow
cytometry after treatment with inhibitors targeting three endocytic
pathways: EIPA (macropinocytosis, G), filipin (caveolae‐mediated
endocytosis pathway, H), or chlorpromazine (clathrin pathway, I). The
error bars represent the mean ± sd values; n = 3. The p values were
calculated using ANOVA with Tukey's test. *p <0.1, **p <0.01,
***p <0.05.
This suggests that the terminal modification of AS with Fdu and the
PROTAC molecule did not compromise the degradation of AS. Thus, the
conjugate AS‐2F‐NP‐Cy3 possessed good in vitro stability. Additionally,
to confirm effective NP release from AS‐2F‐NP, a 50 µM solution of
AS‐2F‐NP was supplemented with an equivalent concentration of GSH to
mimic the elevated glutathione environment in tumor tissues. As
illustrated in Figure [85]3B, the NP concentration increased in a
time‐dependent manner, and effective release from AS‐2F‐NP occurred
within 2 h with a release rate of 63.7%. These findings validate the
effective release of prototype NP from conjugate AS‐2F‐NP under
reducing conditions.
2.4. Effects of Conjugate AS‐2F‐NP on Cellular Uptake and Internalization
To assess the uptake and internalization of AS‐2F‐NP by MDA‐MB‐231
cells, Fam‐ and Cy3‐modified conjugates were analyzed using flow
cytometry and confocal laser scanning microscopy. AS specifically
targets cell membrane‐localized nucleolin that is overexpressed in
MDA‐MB‐231 breast cancer cells. Thus, MDA‐MB‐231 and MCF‐10A (normal
human mammary epithelial) cells were selected as nucleolin‐positive and
nucleolin‐negative cells, respectively. Flow cytometry demonstrated a
notably elevated cellular uptake efficiency for both AS‐Fam and
AS‐2F‐NP‐Fam compared to that of the non‐selective CRO‐Fam conjugates
following incubation with MDA‐MB‐231 cells (Figure [86]3C). Conversely,
no noticeable differences in the fluorescence intensities between
Fam‐modified targeting and non‐targeting aptamers were observed during
incubation with MCF‐10A control cells. These findings confirm the
specific recognition of AS‐2F‐NP‐Fam by MDA‐MB‐231 cells. The uptake
and specificity of AS‐2F‐NP were explored using confocal laser scanning
microscopy. After treatment for 1 h with AS‐2F‐NP‐Cy3, AS‐Cy3, and
CRO‐Cy3, MDA‐MB‐231 cells were stained with DAPI, and Fam‐modified
samples were examined. As shown in Figure [87]3D, cells incubated with
AS‐2F‐NP‐Cy3 or AS‐Cy3 exhibited stronger red fluorescence than those
incubated with CRO‐Cy3, confirming the excellent and specific
nucleolin‐mediated internalization of AS‐2F‐NP. Moreover, pretreatment
of MDA‐MB‐231 cells with EIPA (a macropinocytosis inhibitor) resulted
in a dose‐dependent decrease in the red fluorescence of AS‐2F‐NP‐Cy3
(Figure [88]3E–G) compared with vehicle‐treated control cells.
Conversely, Cy3 fluorescence signals were observed in the cytoplasm of
MDA‐MB‐231 cells (Figure [89]3H,I) pretreated with various
concentrations of chlorpromazine (a clathrin pathway inhibitor) or
filipin (a caveolae‐mediated endocytosis pathway inhibitor). This
difference indicated that AS‐2F‐NP‐Cy3 primarily entered MDA‐MB‐231
cells through macropinocytosis. This intriguing rapid internalization
mechanism may offer a novel strategy for enhancing the cell membrane
permeability of synergistic drugs.
2.5. AS‐2F‐NP Specifically Degraded NAMPT in MDA‐MB‐231 Cells
To further investigate the NAMPT degradation activity of AS‐2F‐NP,
western blotting was performed on MDA‐MB‐231 cells stimulated with
various concentrations of AS‐2F‐NP and CRO‐2F‐NP using NP as a control
(Figure [90]4A; Figure [91]S4, Supporting Information). AS‐2F‐NP and NP
caused concentration‐dependent degradation of NAMPT (AS‐2F‐NP: DC[50] =
18 nm, D [max] >90%; NP: DC[50] = 70 nm, D [max] >90%), whereas NAMPT
degradation was significantly diminished in cells treated with
CRO‐2F‐NP (DC[50] = 133 nm). These results demonstrate the enhanced
efficacy of AS‐2F‐NP in degrading NAMPT in nucleolin‐overexpressing
MDA‐MB‐231 cells, indicating that AS addition improved the degradation
activity compared to the original NP. In addition, the time‐dependent
degradation activity of AS‐2F‐NP was examined (Figure [92]4B). In
MDA‐MB‐231 cells, AS‐2F‐NP and NP showed degradation activity at 12 and
16 h, respectively, whereas CRO‐2F‐NP exhibited no significant
degradation activity at 24 h. The earlier onset of degradation observed
with AS‐2F‐NP may be attributed to their enhanced cellular uptake,
suggesting a more efficient internalization process. In MCF‐10A cells,
NP maintained robust NAMPT degradation activity at 33.3 nm (Figure
[93]S5, Supporting Information). Conversely, AS‐2F‐NP and CRO‐2F‐NP
only displayed weak degradation activity at 300 nm, possibly because of
the lack of specificity and larger molecular size impeding cellular
entry into MCF‐10A cells (Figure [94]S5, Supporting Information). These
findings highlighted the selective tumor cell‐targeting efficacy of
AS‐2F‐NP.
Figure 4.
Figure 4
[95]Open in a new tab
Degradation of NAMPT and cytotoxicity induced by the conjugates. A)
Analysis using western blotting assessing the effects of AS‐2F‐NP,
CRO‐2F‐NP, and NP compounds on NAMPT degradation in MDA‐MB‐231 cells
after 24 h of treatment. The results of grayscale statistics are shown
in Figure [96]S4 (Supporting Information). B) Evaluation of the impact
of AS‐2F‐NP, CRO‐2F‐NP, and NP on NAMPT degradation in MDA‐MB‐231 cells
at different time points, with GAPDH serving as the loading control.
The results of grayscale statistics are shown in Figure [97]S4
(Supporting Information). C) Cytotoxicity of AS‐2F‐NP, CRO‐2F‐NP, Fdu,
and NP in MDA‐MB‐231 nucleolin‐positive cells and MCF‐10A
nucleolin‐negative cells. IC[50] values are the mean of at least three
independent assays, presented as the mean ± sd. D) Apoptosis of
MDA‐MB‐231 cells in different treatment groups. E) Clone formation of
target MDA‐MB‐231 cells treated with different formulations.
2.6. AS‐2F‐NP Possessed Higher Cytotoxicity in MDA‐MB‐231 Cells than FU, NP,
and Their Combination
The antiproliferative activity of AS‐2F‐NP was assessed using the CCK8
assay (Figure [98]4C; Figure [99]S6, Supporting Information) using NP
as a positive control, and all compounds were treated for 72 h. In
MDA‐MB‐231 cells, AS‐2F‐NP (IC[50] = 46 nm) demonstrated superior in
vitro antiproliferative activity compared to FU (IC[50] = 1016 nm) and
NP (IC[50] = 116 nm). At the same concentration gradient, the
inhibitory rate of AS‐2F‐NP was similar to that of the combination of
2FU and NP (Figure [100]S7, Supporting Information). In contrast,
CRO‐2F‐NP (IC[50] = 593 nm) and AS (IC[50] = 2.01 µm) exhibited
significantly lower antiproliferative activity than AS‐2F‐NP. In
MCF‐10A cells, the cytotoxicity of AS‐2F‐NP was substantially reduced
(IC[50] = 652 nM), which was markedly lower than NP (IC[50] = 98.6 nm)
and comparable to that of CRO‐2F‐NP (IC[50] = 678 nm). In addition, AS
exhibited weak cytotoxicity against MCF‐10A cells within the tested
concentration range (IC[50] = 3.8 µm). These findings are consistent
with the reported results that AS‐based conjugates exhibit
significantly lower toxicity toward normal cells than toward breast
cancer cells.^[ [101]^30 , [102]^31 ^] These results suggested that the
designed AS‐2F‐NP exhibited excellent targeting capabilities toward
nucleolin‐positive MDA‐MB‐231 cells. The apoptotic effects of AS‐2F‐NP
on MDA‐MB‐231 cells were assessed (Figure [103]4D). After 48 h of
treatment with 100 nM AS‐2F‐NP, NP, FU, or 2FU+NP, the apoptosis rates
in MDA‐MB‐231 cells were 68.4%, 32.6%, 27%, and 43.6%, respectively.
Under the same conditions, the apoptotic rate of AS‐treated cells was
12.6%, which was significantly lower than that of cells treated with
AS‐2F‐NP. The effects on apoptosis were consistent with the
antiproliferative activity in MDA‐MB‐231 cells. A colony formation
assay was conducted to investigate the antiproliferative effects on
MDA‐MB‐231 cells (Figure [104]4E). AS‐2F‐NP, NP, FU, and 2FU+NP
effectively inhibit the growth of MDA‐MB‐231 cells. Among them,
AS‐2F‐NP exhibited the most pronounced inhibitory effect, indicating
enhanced selectivity toward nucleolin‐overexpressing MDA‐MB‐231 cells.
These results highlighted the potential of AS‐2F‐NP as targeted
therapeutic agents for cancer treatment, especially in cells with
elevated nucleolin expression. AS‐2F‐NP exhibited enhanced NAMPT
degradation activity and cytotoxicity compared with NP, FU, or their
combination.
2.7. Proteome Level Analysis
To further clarify the synergistic antitumor mechanism of AS‐2F‐NP,
whole‐cell proteomic experiments were conducted using MDA‐MB‐231 cells
(Figure [105]5A). The results showed that AS‐2F‐NP interfered with the
expression of 1006 genes, significantly larger than that of the 477
genes in the combined group of FU and NP. Notably, 420 genes in the
AS‐2F‐NP intervention group were identical to those in the FU and NP
combination groups (Figure [106]5B). To elucidate the impact of
AS‐2F‐NP on cellular signaling pathways, we analyzed the relevant
pathways and protein expression. Volcano plot and heatmap analyses
revealed the differential expression of 635 downregulated and 371
upregulated proteins following AS‐2F‐NP treatment, among which NAMPT
was significantly downregulated (Figure [107]5C,D; Figure [108]S8A,
Supporting Information). KEGG pathway enrichment analysis revealed the
involvement of these affected proteins in several key biological
pathways (Figure [109]5E; Figure [110]S8B, Supporting Information).
Notably, within the NAMPT‐involved pathway, a downregulation trend was
observed for nicotinamide (Figure [111]S9, Supporting Information). In
the drug metabolism pathway, the metabolism of FU led to the
downregulation of thymidine phosphorylase (TYMP) and five other genes
(Figure [112]S10, Supporting Information). Additionally, significant
gene expression differences were observed between AS‐2F‐NP and
PBS‐treated cells in the MAPK signaling pathway, with five genes
markedly downregulated and four genes upregulated (Figure [113]S11,
Supporting Information). The representative genes p65 and ErK were
selected as candidate genes, and their regulation was confirmed through
RT‐qPCR and aligned using KEGG analysis. This consistency suggested
that the expression trends of p65 (Figure [114]5F) and ErK
(Figure [115]5G) were in agreement with the pathway‐level outcomes.
These findings suggested that AS‐2F‐NP could serve as a pivotal
regulatory agent with promising therapeutic potential for breast cancer
treatment. Considering its NAMPT degradation and antiproliferative
activities, AS‐2F‐NP was further subjected to in vivo assessment of its
antitumor mechanisms and activities.
Figure 5.
Figure 5
[116]Open in a new tab
Proteome‐level analysis of AS‐2F‐NP treatment in MDA‐MB‐231 cells. A)
MDA‐MB‐231 cells were incubated with AS‐2F‐NP and 2FU+NP for 24 h,
followed by processing cell lysates according to standard procedures
for proteomic analysis. B) Venn diagram comparing differentially
expressed proteins in the cell lysate of MDA‐MB‐231 cells treated with
AS‐2F‐NP and PBS‐treated control. C) Volcano plot illustrating changes
in differentially expressed proteins in the cell lysate of MDA‐MB‐231
cells treated with AS‐2F‐NP compared to the PBS‐treated control (n = 3;
fold change >1.5; p <0.05). Colored points represent proteins that are
significantly decreased (blue), increased (red), and unchanged (gray),
respectively. D) Heatmap analysis of representative differentially
expressed proteins in the cell lysate of MDA‐MB‐231 cells treated with
AS‐2F‐NP compared to the PBS‐treated control (n = 3; p <0.05). E) KEGG
analysis revealing different signaling pathways influenced by 1 µM
AS‐2F‐NP in MDA‐MB‐231 cells. Quantitative analysis of p65 F) and ErK
G) mRNA expression in MDA‐MB‐231 cells treated with AS‐2F‐NP, as
determined using RT‐qPCR. The error bars represent the mean ± sd; n =
3. The p values were calculated by ANOVA with Tukey's test. *p <0.1,
**p <0.01, ***p <0.05.
2.8. Conjugate AS‐2F‐NP Showed Excellent In Vivo Tumor‐Targeting Capability
To assess the tumor‐targeting characteristics of AS‐2F‐NP, imaging
assays were employed to examine the tissue distribution of AS‐2F‐NP‐Cy3
in MDA‐MB‐231 xenograft mice, with AS‐Cy3 and CRO‐Cy3 serving as
controls. Following intravenous administration, the distribution of
AS‐Cy3, AS‐2F‐NP‐Cy3, and CRO‐Cy3 in the major organs (heart, liver,
spleen, lung, and kidney) and tumors was examined (Figure [117]6A).
Following 2 h post‐administration, the fluorescence intensity of Cy3 in
the tumor tissues of mice treated with AS‐2F‐NP‐Cy3 was markedly higher
than that observed in mice treated with AS‐Cy3. Conversely, minimal Cy3
fluorescence was detected in tumor tissues of mice treated with
CRO‐Cy3. Additionally, all three compounds were slightly distributed in
the liver and kidneys. After 8 h, the fluorescence intensity of Cy3 in
the tumor tissues of mice treated with AS‐2F‐NP‐Cy3 remained higher
than that in AS‐Cy3‐treated mice, with no observable Cy3 fluorescence
in the tumor tissues of mice treated with CRO‐Cy3. Furthermore,
virtually no fluorescence signal was detected in the heart, spleen, or
lungs in all three groups of mice. To further confirm the
tumor‐targeting capability of the AS‐2F‐NP conjugate in MDA‐MB‐231
xenografts, we assessed the in vivo distribution and aggregation of
AS‐2F‐NP‐Cy3 in mice (Figure [118]6B). Remarkably, AS‐2F‐NP‐Cy3
demonstrated the ability to recognize MDA‐MB‐231 tumor cells and
aggregate in tumors because of the prolonged fluorescence retention
time of AS‐2F‐NP‐Cy3 in tumor tissues compared to CRO‐Cy3 and AS‐Cy3.
Furthermore, robust fluorescence signals were still observable in
tumors at 12 h post‐injection, whereas no fluorescence signal was
detected in the tumors of mice treated with CRO‐Cy3. AS‐Cy3 group
presented little accumulation in the tumor 2 h after iv administration.
However, strong Cy3 fluorescence was observed even after 8 h
(Figure [119]6A). These disparities may arise from variations in the
pharmacokinetics of AS‐Cy3 across experiments and time points. These
findings confirmed the outstanding tumor‐targeting capability of
AS‐2F‐NP in the MDA‐MB‐231 xenograft model.
Figure 6.
Figure 6
[120]Open in a new tab
Distribution and antitumor efficacy of conjugates in MDA‐MB‐231
xenografts mice in vivo. A,B) Distribution results of AS‐Cy3,
AS‐2F‐NP‐Cy3, and CRO‐Cy3 in major organs (H, heart; Li, liver; S,
spleen; L, lung; and K, kidney) and the tumor (T) at 2 h and 8 h after
intravenous injection (a: AS‐Cy3, b: AS‐2F‐NP‐Cy3, c: CRO‐Cy3). C)
Schematic of the procedure for in vivo experimental studies. D) Changes
in tumor volume were recorded every other day during the 19‐day period
of intravenous injection therapy, with red patches indicating the
injection time points. Six groups were treated with intravenous
injections of PBS, AS (10 µm kg^−1), FU (1.3 mg kg^−1), NP
(11.8 mg kg^−1), 2FU+NP (2.6 mg kg^−1+11.8 mg kg^−1), and AS‐2F‐NP (10
µm kg^−1), with each mice receiving 100 µL per injection. The doses of
FU and NP were equivalent to 10 µm kg^−1. Data are expressed as the
mean ± sd. *p <0.05 and ***p <0.001, determined with one‐way ANOVA test
for significance. E) Representative images depicting the size effects
of xenograft tumors in each group after 19 days of treatment. F)
Changes in body weight of mice were recorded every day during the
19‐day treatment period. G) On the last day of the animal experiment,
mice from all groups were euthanized, major organs were harvested and
weighed, and the weights of tumors and organs were recorded and
analyzed.
2.9. Conjugate AS‐2F‐NP Showed Improved In Vivo Antitumor Potency by
Diffusion of PROTAC within Tumor Tissues
Considering the promising targeted antitumor activity of the AS‐2F‐NP,
we evaluated their in vivo efficacy in a mouse MDA‐MB‐231 xenograft
model. (Figure [121]6C). Upon reaching an average tumor volume of 150
mm^3, the mice were randomly assigned to six groups. Each mouse
received intravenous injections every other day, with a volume of
100 µL per injection. The injected substances included PBS, AS
(10 µm kg^−1), FU (1.3 mg kg^−1), NP (11.8 mg kg^−1), 2FU+NP
(2.6 mg kg^−1+11.8 mg kg^−1), and AS‐2F‐NP (10 µm kg^−1). The combined
administration of 2FU and NP achieved a tumor growth inhibition (TGI)
rate of 78.8% after 19 days, which was superior to that of NP (TGI =
60.1%) and FU (TGI = 44.2%) (Figure [122]6D,E). In contrast, AS
exhibited negligible antitumor activity in vivo (TGI = 30.7%). Notably,
AS‐2F‐NP demonstrated the best in vivo antitumor efficacy with a TGI
>92%, highlighting the therapeutic advantages of the AS‐2F‐NP
conjugation strategy. Throughout the treatment duration, the body
weights of the treated mice were measured every 3 days to evaluate
potential toxicity. The AS, FU, and AS‐2F‐NP groups exhibited favorable
tolerability without significant weight loss or adverse reactions,
whereas the NP and 2FU+NP groups exhibited toxicity, as evidenced by
obvious weight loss (Figure [123]6F). Additionally, the weights of the
vital organs of the treated mice were assessed. (Figure [124]6G), only
the 2FU+NP group exhibited weight loss in the liver and lungs, whereas
no significant differences were observed in the other groups compared
to the control group. Toxicity was further evaluated using H&E
staining, and lung damage was detected in mice treated with NP and
2FU+NP, consistent with our previous findings^[ [125]^18 , [126]^32 ^]
(Figure [127]S12, Supporting Information). In contrast, mice treated
with AS‐2F‐NP did not exhibit any signs of organ damage. These findings
indicated that AS modification significantly reduced the toxicity of NP
and FU. Furthermore, the in vivo antitumor mechanisms of AS‐2F‐NP were
investigated using immunohistochemistry. These results indicate that
AS‐2F‐NP was more active in inducing apoptosis than Fdu, NP, or the
2FU+NP combination (Figure [128]7A).
Figure 7.
Figure 7
[129]Open in a new tab
Immunohistochemistry and immunofluorescence of tumor tissues from
different experimental groups. A) Immunohistochemistry results of
tunnel staining on tumor tissue sections from the five treatment groups
and the control group. Brown color is the result of tunnel staining. B)
Micrographs of tumor tissue sections with Ki67 staining from the five
treatment groups and the control group. Brown color is the result of
Ki67 staining. C) Immunofluorescence results of NAMPT staining on tumor
tissue sections from the five treatment groups and the control group.
D) Micrographs of tumor tissue sections with ErK staining
immunohistochemistry from the five treatment groups and the control
group. E) Immunohistochemistry results of p65 staining on tumor tissue
sections from the five treatment groups and the control group. Scale
bar, 200 µm.
In the AS‐2F‐NP group, the number of TUNEL‐positive cells was
significantly higher than those in the control, AS, FU, NP, and 2FU+NP
treatment groups, indicating the superior apoptotic efficacy of
AS‐2F‐NP. Immunohistochemistry revealed a significant decrease in the
number of Ki67‐stained cells in the AS‐2F‐NP group compared to that in
the control, AS, FU, NP, and 2FU+NP treatment groups, indicating that
AS‐2F‐NP had a better inhibitory effect on cell proliferation
(Figure [130]7B). To further explore in vivo NAMPT degradation
efficiency, immunofluorescence, and immunohistochemical staining were
performed using anti‐NAMPT antibodies. In contrast to the control
group, the AS and FU groups showed no change in green fluorescence, the
NP and 2FU+NP groups exhibited a slight reduction, while green
fluorescence was nearly undetectable in the AS‐2F‐NP treatment group,
indicating lower NAMPT expression levels (Figure [131]7C).
Immunohistochemistry results also suggested that AS‐2F‐NP was more
effective in degrading NAMPT than NP and 2FU+NP, leading to better in
vivo antitumor efficacy (Figure [132]S13, Supporting Information).
These findings demonstrated that AS modification enhanced the
degradation efficiency of NAMPT PROTAC in mice. Additionally, to
further verify whether the combination of NP and FU synergistically
decreased p65 (Figure [133]7D) and ErK (Figure [134]7E) expression,
protein expression, and immunohistochemistry were conducted on tumor
sections from all groups. Compared to the control group, there was no
significant change in p65 and ErK proteins in the AS and FU groups,
whereas the 2FU+NP group showed a notable enhancement and AS‐2F‐NP
induced the strongest downregulation of p65 and ErK proteins. These
findings indicate that AS modification further enhances the synergistic
efficacy of the combined treatment with NP and FU in mice.
3. Discussion
The drugtamer‐PROTAC conjugation strategy represents a significant
advancement in addressing the limitations of conventional PROTACs. By
conjugating a nucleolin‐specific aptamer with NAMPT PROTAC and a
fluorouridine nucleotide, the smart prodrug AS‐2F‐NP demonstrated
superior tumor targeting, efficient cellular uptake, improved in vivo
potency, and reduced toxicity, thereby providing a promising strategy
for the precise delivery of PROTAC and synergistic antitumor agents.
Recently, several types of PROTAC prodrugs have been developed.^[
[135]^33 , [136]^34 , [137]^35 , [138]^36 , [139]^37 , [140]^38 ^] For
instance, Tate et al. reported an antibody‐based PROTAC that
demonstrated tumor cell targeting.^[ [141]^39 ^] However, the
transmembrane efficacy of such antibody‐PROTACs is impeded by the
intrinsic limitations of antibody‐drug conjugates (ADCs) in cellular
transport. Furthermore, ADCs carry the risk of eliciting immune
responses, thereby causing in vivo immunogenic hazards. Aptamers are
emerging as superior alternatives owing to their high affinity and
specificity, low immunogenic potential, and reduced molecular size. By
leveraging macropinocytosis, this drugtamer‐PROTAC conjugation approach
facilitates swift penetration through tumor cell membranes,
substantially improving the potency and selectivity of protein
degradation, and attenuating potential immunogenic risks. Wei et al.
recently reported folate‐coupled PROTAC prodrugs for targeted delivery
of PROTACs.^[ [142]^40 ^]However, the advantages of these prodrugs have
not been evaluated in animal models. The tumor‐targeting efficiency, in
vivo potency, and toxicity of the designed drugtamer‐PROTAC prodrugs
were validated in MDA‐MB‐231 xenograft mouse models.
To augment the therapeutic efficacy of PROTAC, the co‐administration of
small‐molecule anticancer inhibitors has been widely evaluated in
clinical trials.^[ [143]^5 , [144]^6 , [145]^9 , [146]^10 ^] Such
combined therapeutic strategies have demonstrated notable synergistic
benefits in clinical settings. Despite the advantages, traditional
“cocktail” treatments encounter difficulties in ensuring balanced drug
delivery to tumor sites, primarily due to the unique pharmacokinetic
profiles of each drug and the complexity of controlling drug ratios.
The limitations of PROTAC‐based drug combinations underscore the
importance of developing innovative methods for precise co‐delivery of
PROTAC and synergistic drugs. In this context, this study determined
the optimal dosing ratio of FU and NP (2:1) and embedded two Fdu
molecules into the AS1411 aptamer to achieve precise co‐delivery at the
desired ratio. The best synergistic antitumor effects were observed.
Traditional aptamer‐PROTAC conjugates usually encounter limitations in
their drug‐loading capacity, particularly when multiple drug molecules
are sequentially conjugated to aptamers.^[ [147]^41 , [148]^42 ^] Our
design effectively circumvents these constraints by leveraging the
structural resemblance between Fdu and thymidine nucleosides. Fdu was
directly incorporated into the nucleic acid structure during
solid‐phase synthesis of the aptamer. Subsequently, it was conjugated
to NAMPT PROTAC to facilitate sequential loading of multiple drugs.
The drugtamer‐PROTAC conjugation approach exhibited remarkable effects
in mitigating the toxicity associated with PROTACs. By modulating the
in vivo distribution of PROTAC, FU and NP were preferentially
concentrated in tumor tissues, thereby diminishing their toxicity to
non‐target tissues. After in vivo analysis of AS‐2F‐NP, a pronounced
decrease in NP levels was observed in non‐target organs, such as the
liver, kidneys, and lungs, leading to attenuated toxic side effects in
these tissues. Compared to drug combinations, conjugate AS‐2F‐NP
ensured precise control over drug ratios and their uniform distribution
in mouse models, effectively maximizing antitumor efficacy and
minimizing the toxicity commonly associated with drug combinations.
Therefore, AS‐2F‐NP were safer and more effective than the PROTAC‐based
drug combination.
Despite these promising profiles, this study has several limitations.
First, only breast cancer models were used in this study; therefore,
expanding these findings to a broader range of cancer types is
essential for a comprehensive assessment of the drugtamer‐PROTAC
conjugation strategy. Second, further research is required to
understand the long‐term effects and potential immune responses induced
by drugtamer‐PROTAC conjugates. Given the “precise targeting and potent
killing” attributes of the conjugates, optimizing the linker may be the
key to enhancing the tumoricidal effects and broadening the therapeutic
window. New linkers with better tumor‐responsive abilities and high
drug release efficacies would further enhance the precision and safety
of conjugates.
4. Conclusion
In summary, we developed a novel drugtamer‐PROTAC conjugation strategy
to enhance the tumor‐targeting ability and antitumor potency of
conventional PROTACs. Inspired by the synergism between NAMPT PROTAC
and 5‐fluorouracil, a multifunctional smart prodrug conjugate. For
aptamer‐drug conjugates, it remains challenging to sequentially
incorporate various drugs into aptamers. In this study, based on the
optimal drug combination ratio, two molecules of Fdu replaced natural
thymine nucleotides to ensure synthetic inconvenience and precise drug
release. Conjugate AS‐2F‐NP showed improved aqueous solubility and
cellular uptake, resulting in the degradation of NAMPT in
nucleolin‐overexpressing MDA‐MB‐231 cells. In animal models, AS‐2F‐NP
is activated by GSH in the TME and achieves precise co‐delivery of
synergistic Fdu and NP, leading to enhanced antitumor potency
(TGI >92%) and reduced side effects. Thus, the drugtamer‐PROTAC
conjugation strategy provides an effective approach for the precise
co‐delivery of PROTAC and its synergistic drugs, which may have broad
applications in PROTAC‐based drug development.
5. Experimental Section
Experimental Subheading Synthesis and Structural Characterization of
Intermediates and Target Compounds
In general, NMR spectra (^1H and ^13C) were obtained using Bruker
AVANCE300 and AVANCE600 spectrometers with TMS as the internal standard
and DMSO‐d [6] as the solvent, with chemical shifts in ppm (δ). The
mass spectra were recorded on an Esquire 3000 LC‐MS. TLC was performed
on GF254 silica gel plates from Qingdao Haiyang Chemical, China, and
silica gel column chromatography utilized their Silica gel 60 G. All
materials, unless specified, were sourced commercial and used as
received without additional purification. The details of the synthesis
and characterization of intermediates and target compounds employed in
this manuscript were described in the Supplementary Information.
Chou‐Talalay Assays
Dose‐response curves were obtained for FU and NP as single agents, as
well as at a constant ratio of their IC[50] values, to determine the
extent of synergy between these drugs. The Combination Index (CI)
scores were calculated using CompuSyn software (ComboSyn, Inc),
employing the Chou‐Talalay combination index method based on the
principles of the median‐effect equation. Synergy between the two drugs
was defined as CI <1, additivity as CI ≈1, and antagonism as CI > 1.
Additionally, isobolograms were generated using CompuSyn to visualize
the synergy. In essence, the quantities of each individual drug needed
to achieve effects at nine different efficacy levels were calculated,
and these were used as intercepts to generate an isobole connecting
those points. Dose pairs for the combination therapy were then plotted,
with points below the isobole considered synergistic, on the isobole
indicating additivity, and above the isobole suggesting antagonism.^[
[149]^29 ^]
Confocal Microscopy
Cellular fluorescence images were acquired on a Leica TCS SP5 confocal
microscope equipped with an Argon‐Helium‐Neon laser (Leica Microsystems
Inc., Exton, PA). MDA‐MB‐231 cells (10×10^4) were seeded in
glass‐bottom confocal dishes and incubated overnight at 37 °C.
Subsequently, MDA‐MB‐231 cells were treated with 500 nM of
AS‐2F‐NP‐Cy3, AS‐Cy3, and CRO‐Cy3, respectively, in serum‐free cell
culture medium. After incubating for 1 h at 37 °C, the cells were
washed three times with PBS solution. Following that, the cells were
treated with 4% formaldehyde for 15 min at room temperature and washed
with PBS solution three times. After a 15 min treatment with DAPI, the
cells were rinsed with PBS three times and visualized using a confocal
microscope.
For confocal imaging of endocytosis pathways, MDA‐MB‐231 cells (2×10^4)
were seeded in glass‐bottom confocal dishes and incubated overnight at
37°C. MDA‐MB‐231 cells in glass‐bottom confocal dishes should be
pre‐incubated with the macropinocytosis inhibitor (EIPA), clathrin
pathway inhibitor (Chlorpromazine), or caveolae pathway inhibitor
(Filipin) at various concentrations for 30 min before the addition of
AS‐2F‐NP. Other experimental steps were the same as described above.
Colony Formation Assay
MDA‐MB‐231 cells were meticulously harvested, resuspended in growth
medium, and precisely seeded into six‐well plates using a single‐cell
suspension technique. After seeding, an exact cell count adjusted the
density to 1000 cells per well, followed by the addition of DMEM medium
to each well, reaching a precise volume of 1000 µL. Following a closely
monitored 7‐day incubation, AS‐2F‐NP, AS, NP, FU, and 2FU+NP were
individually added to the respective plates. Another 7‐day period of
cultured cell growth ensued, culminating in the removal of the culture
medium. Adherent cells underwent a dual PBS rinse and meticulous
fixation with 4% paraformaldehyde. Each well received 200 µL of a 1%
crystal violet dye solution from the esteemed Beyotime Institute of
Biotechnology, ensuring complete coverage. After a precisely timed
15‐minute ambient incubation, the plate underwent a thorough tap water
wash and subsequent air‐drying for assay detection preparation.
Study of Specificity and Binding Ability
The specificity and binding ability of AS‐2F‐NP‐Fam, AS‐Fam, or CRO‐Fam
(final DNA concentrations: 250 nM) were explored by flow cytometry.
MDA‐MB‐231 cells (1×10^5) were incubated in the corresponding binding
buffer at 4 °C for 40 min, followed by washing with washing buffer for
3 times. Then, precipitated cells were suspended in 400 µL binding
buffer at 4 °C for flow cytometric analysis on a flow cytometer (BD
Accuri C6). Data were analyzed using FlowJo software. CRO‐Fam was used
as negative control, and AS‐Fam was used as a positive control.
Binding Buffer
4.5 g L^−1 glucose, 5 mM MgCl[2], 0.1 mg mL^−1 yeast tRNA (Sigma
Aldrich), and 1 mg mL^−1 BSA (Fisher Scientific) in Dulbecco's PBS
(Sigma). Washing buffer: 4.5 g L^−1 glucose and 5 mM MgCl[2] in
Dulbecco's PBS (Sigma).
The Release of AS‐2F‐NP Conjugate In Vitro
AS‐2F‐NP at a concentration of 100 µM in water was first transferred
into centrifuge tube, and then incubated with 5 mM DTT in 5 mL PBS
(containing 0.5% Tween 80). The control group was conducted by
immersing the AS‐2F‐NP in the PBS solution without DTT. The treatment
groups were incubated at 37 °C under continuous shaking at a rate of
100 rpm min^−1. Compounds concentrations at different time intervals
were determined by HPLC using RP‐C18 column (5 µm, 4.6 × 150 mm) with
0.8 mL mi^−1n. Mobile phase: A:100 mM TEAA pH = 7.0, B: CAN; Column
temperature:40 °C; detection, UV, 260 nm.
Proteome Assay
MDA‐MB‐231 cells in good condition were digested and 9 × 10^7 cells
were seeded in nine cell‐culture dishes for 24 h. Then, AS‐2F‐NP,
2FU+NP, and PBS in the medium were incubated with cells, respectively.
Repeat 3 groups for each compound. After incubation, cells were washed
with PBS and then lysed by RIPA lysis buffer on the ice for 30 min.
Total cell protein was obtained from the supernatant collected by
centrifuging the cell lysate (12 000 g, 4 °C). Subsequently, the cell
lysate (100‐200 µg) was sent to OEBiotech company for proteomic assay.
Briefly, cellular samples were processed to extract total proteins, a
portion of which was utilized for protein concentration determination
and SDS‐PAGE analysis. Another portion was subjected to trypsin
digestion and labeling, followed by equal mixing of the labeled samples
for chromatographic separation. Subsequently, the samples were
subjected to LC‐MS/MS analysis, and the acquired data were subjected to
comprehensive data analysis.
Bioinformatical Analysis
Following protein identification and quantification using Proteome
Discovery v1.4 software, the expression profiles of proteins were
obtained in each sample. The first and foremost step involved checking
data quality through Pearson correlation analysis. In this study, each
experimental group was replicated three times, and data were processed
by filtering out outliers using Mean Absolute Differences (MAD) and
imputing missing values through a random forest‐based algorithm. After
consolidating the data, linear models (limma v3.52.4 R package) were
employed to analyze significantly differentially expressed proteins
between the two groups (The above experimental procedures were
conducted by OEBiotech company). Volcano plots, expression pattern
clustering heatmaps, Venn analysis, and other methods were employed for
differential comparison group data. To gain a deeper understanding of
differentially expressed proteins in the target KEGG pathway, this stud
was focused on the MAPK signaling pathway and integrated it with
proteins of interest. Lastly, enrichment analysis was conducted for the
proteins of interest using R packages cluster Profiler v4.4.4 and
org.Hs.eg.db v3.15.0.
RNA Extraction and Real‐Time Quantitative PCR (qPCR)
The p65 and ErK gene expression effect of conjugates on MDA‐MB‐231
cells at different concentrations (0.5 µM and 1 µM) was assessed by the
qPCR assay. Briefly, cells in good condition were digested and seeded
with 3 × 10^5 cells in each well of the 6‐well plates for 24 h. Then,
500 µL AS‐2F‐NP in the medium were incubated with cells for 24 h. After
incubation, cells were washed with 1 × PBS, and total RNA was S44
extracted using RNAiso PLUS (TaKaRa Bio Inc, Shiga, Japan) according to
the manufacturer's protocol. Complementary DNAs (cDNAs) were
synthesized from 1 µg of purified total RNAs using Prime Script RT
Master Mix (TaKaRa Bio Inc). Real‐time qPCR was executed on qTOWER3
Real‐time PCR Thermal Cycler (Analytik Jena, Jena, Germany) in reaction
mixtures containing TB Green Premix Ex Taq (TaKaRa Bio Inc), cDNA, and
forward and reverse primers, and cycling conditions of: 95 °C for 3
mins; followed by 40 cycles of 94 °C for 10 secs, 60 °C for 20 secs,
and 72 °C for 20 secs; and final extension at 72 °C for 10 mins. The
primer sets used were based on the following genes: ErK forward:
5′‐TCAACACCACCTGCGACCT‐3′, ErK reverse: 5′‐CGTAGCCACCTGCGACCT‐3′; GAPDH
forward: 5′‐AACATCATCCCTGCTTCCAC‐3′, GAPDH reverse:
5′‐GACCACCTGGTCCTCAGTGT‐3′; p65 forward: 5′‐AAGATCTGCCGAGTGAACCG‐3′,
p65 reverse:5′‐GCCTGGTCCCGTGAAATACA‐3′. Target gene expressions were
normalized to the internal loading control gene GAPDH using 2‐ΔΔCT
method. The mean CT value of target genes in the experimental group was
normalized to the CT value of GAPDH to give a ΔCT value. The ΔCT value
was then further normalized to control samples to obtain ΔΔCT value.
In Vitro Antiproliferative Assay
Cells were seeded in 96‐well transparent plates at a density of ≈5 ×
10^3 cells well^−1 and incubated in a humidified atmosphere with 5%
CO[2] at 37 °C for 24 h. Solutions of 10 µM AS‐2F‐NP, CRO‐2F‐NP, and AS
were prepared in PBS (NP and FU were dissolved in DMSO with a
concentration of 10 mm and diluted to achieve a concentration of 10 µM
with PBS). Serial three‐fold dilutions of the solutions were performed
with serum‐containing medium to create a concentration range from 13.7
to 10 000 nm. The cell culture medium was removed, and the solutions
were added to triplicate wells with different concentrations. The
medium containing 0.1% DMSO served as the control. After incubating for
72 h, 10 µL of cell counting kit‐8 (CCK8) solution was added to each
well, and the plate was further incubated for 0.5‐1 h. The absorbance
(OD) was measured using a Biotek Synergy H2 (Lab systems) at 405 nm.
The concentration causing 50% inhibition of cell growth (IC[50]) was
determined using the Logit method. Each experiment was conducted three
times.
Western Blotting
MDA‐MB‐231 cell lines were seeded at a density of 4.0 × 10^5
cells well^−1 in 6‐well transparent plates (Corning). The test
compounds were added 24 h after seeding, and the cells were incubated
for an additional 24 h. Subsequently, the cells were washed twice with
cold PBS and lysed with 60 µL of ice‐cold lysis buffer containing 1%
protease and phosphatase inhibitors (Roche). After 30 min on ice, the
cells were scraped off and centrifuged at 12 000 rpm for 15 min at 4 °C
to obtain the protein lysate. The protein extract was denatured in a
100 °C water bath and analyzed on 10% SDS‐PAGE gels. The gels were
transferred onto a PVDF membrane (Merck Millipore), and blocking was
performed with 5% BSA Buffer (5% Bovine Serum Albumin in TBST) for 2 h
at room temperature. Subsequently, the membranes were probed with
infrared secondary antibodies. After three washes with TBST, the blots
were scanned using a LI‐COR Odyssey imaging system. Protein levels were
quantified based on the gray values of the bands in the resulting
images, with the control group serving as the standard.
Image J software was used to statistically analyze the grayscale values
of the target protein blots and internal reference protein blots.
According to the formula SF1, the remaining percentage of the target
protein under different concentrations of target compound was
calculated separately.
[MATH: Rp=At/AiBt/Bi<
/mfrac>×100%SF1 :MATH]
(1)
R[p] represents the remaining percentage of the target protein; A[t]
represents the grayscale value of the target protein blot in the
treated group; A[i] represents the grayscale value of the internal
reference protein blot in the treated group; B[t] represents the
grayscale value of the target protein blot in the blank group; B[i]
represents the grayscale value of the internal reference protein blot
in the blank group.
The curve was plotted between the concentration of the compound and the
remaining percentage of the target protein by using GraphPad Prism 8
software, and the DC[50] of the target compound was calculated
accordingly.
The remaining percentage of the target protein corresponding to the
optimal degradation activity was selected. According to the formula
SF2, the D [max] was calculated
[MATH: Dmax=1−RpSF2 :MATH]
(2)
In Vivo Imaging
All the animal protocols were assessed and approved by the Committee on
Ethics of Medicine, Navy Medical University (SMMU82030105). BALB/C nude
female mice (certificate SCXK‐2021‐0013, weighing 18−20 g) were
obtained from Changzhou Cavens Experimental Animal Co., Ltd. 100 µL of
AS‐2F‐NP‐Cy3, AS‐Cy3 and CRO‐Cy3 at a single dose of 5 µm were given to
two groups of the MDA‐MB‐231 xenografts bearing BALB/C nude mice,
respectively, by intravenous route (iv) via the tail vein. The nude
mice were anesthetized and in vivo fluorescent imaging was carried out
4 and 8 h postinjection using Lumina XR imaging system. All the mice
were sacrificed right after the last imaging. Tumors and major organs
(hearts, lungs, livers, spleens, and kidneys) were collected and imaged
with the in vivo imaging system (Lumina XR).
In Vivo Therapy
The efficacy experiment in vivo was evaluated using the MDA‐MB‐231
tumor xenograft in mice. MDA‐MB‐231 cells (6 × 10^6 cells/animal) were
subcutaneously into the flank area of the female nude mice (5−6 weeks
old). When tumors reached an average volume of 150 mm^3 after
implantation. nude mice were randomly divided into six groups. Five
groups of nude mice were given intravenously with AS (10 µm kg^−1) and
AS‐2F‐NP (10 µm kg^−1) in PBS and FU (1.3 mg kg^−1), NP
(11.8 mg kg^−1), 2FU+NP (2.6 mg kg^−1+11.8 mg kg^−1) in solution with
formula (0.5% DMSO+5% ethanol + 0.5% Tween 80 + ddH[2]O) every other
day with a volume of 100 µL per injection. The doses of FU and NP were
equivalent to 10 µm kg^−1. The control group was given an equal volume
of PBS. During the treatment, tumor size was measured using vernier
caliper, and monitored body weight every four days. After 19 days
treatment, the mice were killed. The major organs (hearts, lungs,
livers, spleens, and kidneys) were dissected, collected and weighed.
The tumors were taken out of the mice and pictured. The tumor volume
was calculated by this formula, volume = AB^2/2. A and B are the length
and width dimension of the tumor, respectively. Data were analyzed by
1‐way ANOVA test. P level <0.05 was considered statistically
significant.
Histology
After 30 days post‐treatment, the heart, liver, spleen, lung, kidney,
and tumors of all treatment groups were dissected and fixed with 4%
paraformaldehyde. The tissue of organs was sliced and stained by Bios
Biological Company.
Statistical Analysis
All the data were presented as mean ± sd. Student's t‐test or 1‐way
analyses of variance (ANOVA) were performed in the evaluation of
statistical. P level <0.05 was considered statistically significant.
Conflict of Interest
The authors declare no conflict of interest.
Supporting information
Supporting Information
[150]ADVS-11-2401623-s001.pdf^ (3MB, pdf)
Acknowledgements