Abstract

   There are numerous mechanisms by which glioblastoma cells evade
   immunological detection, underscoring the need for strategic
   combinatorial treatments to achieve appreciable therapeutic effects.
   However, developing combination therapies is difficult due to
   dose-limiting toxicities, blood-brain-barrier, and suppressive tumor
   microenvironment. Glioblastoma is notoriously devoid of lymphocytes
   driven in part by a paucity of lymphocyte trafficking factors necessary
   to prompt their recruitment and activation. Herein, we develop a
   recombinant adeno-associated virus (AAV) gene therapy that enables
   focal and stable reconstitution of the tumor microenvironment with
   C-X-C motif ligand 9 (CXCL9), a powerful call-and-receive chemokine for
   lymphocytes. By manipulating local chemokine directional guidance,
   AAV-CXCL9 increases tumor infiltration by cytotoxic lymphocytes,
   sensitizing glioblastoma to anti-PD-1 immune checkpoint blockade in
   female preclinical tumor models. These effects are accompanied by
   immunologic signatures evocative of an inflamed tumor microenvironment.
   These findings support AAV gene therapy as an adjuvant for
   reconditioning glioblastoma immunogenicity given its safety profile,
   tropism, modularity, and off-the-shelf capability.

   Subject terms: CNS cancer, Tumour immunology, Cancer immunotherapy
     __________________________________________________________________

   The limited infiltration and migration of T cells in the brain can
   hinder the success of immune checkpoint blockade in glioblastoma (GBM).
   Here the authors show that an adeno-associated virus-based gene therapy
   for the intratumor delivery of CXCL9 promotes T cell infiltration and
   enhances response to anti-PD1 in GBM preclinical models.

Introduction

   Breakthroughs in immunotherapy including immune checkpoint blockade
   (ICB), monoclonal and bispecific antibodies, and CAR T cell therapy,
   have ignited the hope of achieving durable remission in even the most
   recalcitrant tumors. Although these strategies are capable of producing
   remarkable responses, therapeutic benefit is seen in only a small
   proportion of patients with many proposed reasons for lack of
   response^[59]1. Presently, T cell infiltration and abundance within the
   tumor microenvironment is one of the most predictive biomarkers for
   response to immunotherapy^[60]2–[61]4. Unfortunately, diseases like
   glioblastoma (GBM) and many other solid tumors demonstrate low baseline
   infiltration of lymphocytes that is only marginally improved by
   treatment^[62]5,[63]6. For GBM patients in particular, generalized
   lymphopenia as a result of impaired lymphocyte egress^[64]7 alongside
   the lymphodepleting nature of conventional treatment further detracts
   from successful adaptive immune recognition of these tumors^[65]8.
   Preclinical studies on cellular therapy imaging and trafficking show
   that a comparably lower fraction of T cells can be found in these brain
   tumors as compared to lung, liver, and spleen tissues in comparative
   mouse models^[66]9,[67]10. Similar hurdles with respect to CAR T cell
   penetration into brain tumors in the clinical setting have necessitated
   alternative locoregional delivery strategies^[68]11. Together these
   observations indicate that ineffective T cell migration and
   infiltration into GBM tumors may represent a principal barrier to
   immunotherapy. Solving this problem requires both an improved
   understanding of the chemical signals that govern T cell chemotaxis
   into tumors and identifying a method to amplify those signals.

   Lymphocytes are recruited via long-range signaling mediated by the
   diffusion of chemokines present in inflammatory environments. During
   glioma formation, tumors manufacture immune-suppressive chemokines and
   cytokines that co-opt resident cells, resulting in the preferential
   recruitment of immune suppressor cells from the periphery^[69]12.
   Additionally, we have found that primary patient glioma samples are
   deficient in lymphocyte-specific chemokines. To overcome this problem,
   we propose the use of in situ recombinant AAV expressing a lymphocyte
   trafficking chemokine payload to restore expression of lymphocyte
   chemotaxis. AAV vectors are the leading platform for gene delivery due
   to their efficacy, ease of use, and safety profile^[70]13.
   Additionally, multiple AAV gene therapies have reached FDA approval for
   a variety of diseases^[71]13,[72]14. There are multiple strategies for
   AAV therapy for GBM that have been previously described, including
   vector capsid protein modification, brain tropic (microglia, astrocyte,
   or neuronal) AAV serotypes, and direct parenchymal delivery of
   AAV^[73]15–[74]19. Thus, AAV vectors are an ideal platform for
   transforming targeted cell populations while minimizing potential
   patient risk.

   In this work we identify CXCL9 as a candidate lymphocyte
   call-and-receive signal absent in GBM following a comprehensive
   chemokine screen of clinical tumor specimens. We examine AAV delivered
   CXCL9 transgene tropism, durability, and impact on lymphocyte tumor
   migration. Using syngeneic preclinical model systems of GBM, we further
   evaluate the therapeutic benefit of our AAV gene therapy alongside
   anti-PD-1 ICB. Single-cell RNA sequencing (scRNAseq) of immune cells
   isolated from tumors during treatment reveals widespread immunological
   reconditioning of tumors, with improved effector lymphocyte recruitment
   that yields long-term survival outcomes in aggressive preclinical GBM
   models. This work suggests direct conditioning of the tumor
   microenvironment by AAV-CXCL9 constructs could potentially overcome a
   key resistance factor in GBM, sensitizing tumors to immune-mediated
   therapies.

Results

Chemokine analysis of Human GBM favors MDSC recruitment over lymphocyte
infiltration

   Upon examination of human glioma tumors for CD3 protein expression
   provided through the Human Protein Atlas, we found that > 80% of tumor
   specimens evaluated are negative for lymphocyte infiltrates
   (Supplementary Fig. [75]S1a), corroborating prior literature describing
   the lymphocyte-replete nature of these tumors^[76]20. To identify if a
   paucity of lymphocyte chemotactic factors is a contributing aspect,
   human glioma samples were screened via chemokine proteome array. Of
   these, CXCL4, CXCL7, CXCL8 (IL-8), CXCL16, LCF (IL-16), TIG-2, and
   midkine (MDK) emerged as the most abundant secreted chemokines detected
   (Fig. [77]1a, b), where these ligands play a significant role in
   recruiting myeloid-derived suppressor cells in the context of
   gliomagenesis^[78]21. Notably, chemotactic factors that favor
   lymphocyte recruitment were poorly expressed, including CXCL9 (MIG) and
   MIP-1α/β (CCL3/CCL4) (Fig. [79]1a, b). CXCL9 is a powerful attractant
   known to induce the migration, differentiation, and activation of
   cytotoxic T lymphocytes^[80]22. Expression of CXCL9 has been shown to
   correlate with anti-tumor immune activity and is predictive of response
   to ICB in several solid tumors^[81]23. We hypothesized that AAV
   delivery and restoration of CXCL9 as a “call-and-receive” signal for T
   lymphocytes within the tumor microenvironment (TME) would enhance their
   recruitment and infiltration in the tumor.

Fig. 1. Chemokine signature of glioblastoma tumors.

   [82]Fig. 1
   [83]Open in a new tab

   a Immunoblots of GBM samples showing signal intensity of 31 chemokines
   (n = 8). CXCL9 (undetected) is outlined in red. b Box-whisker plots of
   cumulative relative protein expression of immunoblots shown in panel
   (a). c Recombinant AAV6 vector design encoding CXCL9 and the
   fluorescent reporter gene RFP. d 3D IHC of RFP-labeled GL261 tumor
   tissue collected 1 week following AAV6-EGFP injection. The top row
   depicts 3D rendering at 10 x magnification, scale bar 200 µm. AAV6
   transduced cells are shown in green, GFAP in red, RFP+ tumor cells in
   gray, and DAPI nuclear stain in dark blue. 2nd and 3rd rows depict 2D
   digital zoom as outlined by the yellow dashed line in the top row to
   enhance cellular resolution. Voxel-based co-localization between AAV6
   and GFAP (2nd row) and AAV6 and tumor cells (3rd row) is shown as a
   separate channel (yellow or pink). Representative images selected from
   n = 5. e 3D IHC of AAV6-EGFP transduction in age-matched naïve control
   mice. The top row depicts 3D rendering at 10x magnification, scale bar
   200 µm. AAV6 transduced cells are shown in green, GFAP in red, and DAPI
   nuclear stain in dark blue. 2nd row depicts 2D digital zoom as outlined
   by the yellow dashed line in the top row to enhance cellular
   resolution. Voxel-based co-localization between AAV6 and GFAP is shown
   as a separate channel (yellow). Representative images selected from
   n = 3. f Box-whisker quantitative summary of voxel-based AAV6
   co-localization with either tumor (GL261, n = 5) or astrocytes in each
   tumor-bearing (n = 3) and naïve mice (n = 3). g Box-whisker plot of
   flow cytometry quantitation of AAV6 (EGFP + ) co-localization with
   either tumor cells (GL261, RFP + ) or astrocytes (GFAP + , RFP-) at 3-,
   5-, and 7 days post AAV6 transduction as illustrated in the schematic.
   Two-way ordinary ANOVA statistical analysis performed comparing percent
   transduction between tumor and astrocytes across matched time points,
   n = 6 per time point. P-values ≤ 0.05 are considered statistically
   significant. Box-whisker plots display the box ranging from the first
   to the third quartile, the center median value, and the whiskers extend
   from each quartile to the minimum and maximum values. Source data are
   provided as a Source Data File.

   Historically, targeted transduction of cancer with AAV has proven
   challenging despite elegant efforts in capsid evolution studies and
   capsid engineering. To achieve sufficient transgene expression,
   transduction of either tumor cells or tumor-associated stroma is likely
   necessary, where intra-tumoral delivery would minimize the potential
   for systemic toxicities and decrease off target homing of T cells. To
   identify an appropriate AAV capsid for targeting glioma tumors, we
   performed an in vitro capsid screen. Enhanced green fluorescent protein
   (EGFP) was encoded into an AAV2 single stranded vector, utilizing the
   non-cell-autonomous, constitutively active CBA promoter to drive
   transgene expression (AAVn-EGFP). These constructs were pseudotyped
   into 29 unique capsids as previously described^[84]24. Transduction in
   15 unique glioma models, including primary human^[85]25 and murine
   xenografts, was assessed via EGFP relative fluorescence expression
   (Supplementary Fig. [86]S1b). AAV6 was selected for further examination
   as it demonstrates moderate to high transduction in nearly all models
   tested and is further substantiated by excellent CNS transduction in
   other studies^[87]24,[88]26. AAV6 capsids encoding each CXCL9, EGFP,
   blue fluorescent protein (BFP), and empty vector control (Fig. [89]1c,
   Supplementary Fig. [90]S1c–e) were designed for further testing.
   Quantitative flow cytometric evaluation of EGFP expression in three
   distinct syngeneic murine GBM models 72 h following AAV6-EGFP
   transduction shows moderate transduction of GL261 and KR158, with > 25%
   of cells positive for the transgene at this time point, with lower
   transduction observed in CT-2A cells (<20%) (Supplementary
   Fig. [91]S1f).

AAV6 transduces tumor-reactive astrocytes in vivo in preclinical models of
GBM

   While we demonstrate good targeting of glioma cells in an in vitro
   setting, AAV6 has also been reported capable of targeting other cell
   populations in the CNS^[92]24,[93]26. These studies have largely been
   performed in the context of naïve mice or in models of
   neurodegenerative disease, which may or may not be directly applicable
   to CNS malignancy. To define AAV6 tropism in murine GBM in vivo,
   AAV6-EGFP (Supplementary Fig. [94]S1c) was intratumorally injected into
   established intracranial KR158 and GL261 tumors. EGFP expression was
   detected 1 week following tumor transduction in both models
   (Supplementary Fig. [95]S2a, b), however the morphological appearance
   and contiguous distribution of transduced cells suggest that AAV6
   targeted cells are likely tumor-associated, and not cancer cells
   directly. Microglia and tumor-associated macrophages are reported to
   comprise a significant cellular proportion of glioma tumors^[96]27, and
   so we sought to identify if AAV6 was targeting either population. KR158
   and GL261 were implanted into CCR2^RFPCX3CR1^GFP
   (B6.129(Cg)-Cx3cr1^tm1Litt Ccr2^tm2.1lfc/JernJ) dual reporter mice,
   where microglia can be identified via GFP expression, and bone
   marrow-derived inflammatory cells via RFP expression^[97]28,[98]29.
   Tumors were evaluated by 3D IHC for viral transduction 1 week following
   intratumor injection with AAV6 encoding a BFP reporter (Supplementary
   Fig. [99]S1d). In both tumor model systems, we found no co-localization
   between BFP and either RFP or GFP, indicating that neither microglia
   nor tumor-associated macrophages are the principal target of AAV6
   transduction (Supplementary Fig. [100]S3a, b). To assess the degree of
   AAV6 transduction specifically in tumor cells we implanted mice with
   RFP-labeled KR158 or GL261 cells. Tumors were evaluated by 3D IHC for
   viral transduction 1 week following intratumor injection with
   AAV6-EGFP. Resected tumors were immuno-labeled against glial fibrillary
   acidic protein (GFAP) to detect astrocytes, another candidate
   tumor-associated cell population. Both tumor models reveal a high
   degree of overlap between GFAP (red) and EGFP (green), with minimal
   overlap between tumor cells (gray) and EGFP (Fig. [101]1d,
   Supplementary Fig. [102]S3c), indicating that EGFP-positive cells are
   likely astrocytes. Voxel-based co-localization algorithms to quantitate
   EGFP co-localization with each tumor or astrocytes confirm astrocytes
   as the principal cell target of AAV6 transduction, accounting
   for ~ 60–70% of EGFP-positive cells in both GL261 (Fig. [103]1f) and
   KR158 (Supplementary Fig. [104]S3d) intracranial tumors. Because tumor
   presence can stimulate different activation states in astrocytes that
   may cause them to be more or less susceptible to viral
   transduction^[105]30,[106]31, we also evaluated CNS tropism of AAV6 in
   age-matched naïve mice. AAV6 was equally efficient at transducing
   astrocytes in naïve animals as shown by co-localization between GFAP
   immunostaining and EGFP transgene expression (Fig. [107]1e, f).

   One of the unique features of AAV gene transduction is that it rarely
   integrates into the host genome. Following uncoating in the host
   nucleus, single-stranded genomes are converted to double-stranded
   multimeric circular concatemeric episomes^[108]32. As such, AAV
   transgene expression can persist long-term in post-mitotic cells.
   Because tumor cells undergo rapid cell division, it may be possible
   that transgene expression is lost over time through sequential dilution
   of episomes passed down to daughter cells. To explore this, we
   evaluated AAV6-EGFP transgene expression longitudinally across early
   time points in mice harboring RFP labeled GL261 cells, which
   demonstrate the highest transduction efficiency in vitro (Supplementary
   Fig. [109]S1f). Tumors were resected 3, 5, and 7 days following
   AAV6-EGFP intra-tumor injection as outlined in Fig. [110]1g, and EGFP
   transgene expression in tumors and astrocytes was measured by flow
   cytometry. Even at early time points, AAV6 predominantly transduces
   astrocytes identified as GFAP + RFP- (70–80% EGFP+ cells), with limited
   EGFP expression observed in RFP+ tumor cells (<15%) (Fig. [111]1g,
   Supplementary Fig. [112]S4a). By 7 days post intratumor viral
   injection, less than 5% of EGFP+ cells on average were RFP+ tumor
   cells, where astrocytes consistently comprised 70–80% of EGFP+ cells at
   each time point. These data indicate that AAV6 more selectively
   transduces astrocytes in vivo, with limited and transient expression in
   tumor cells.

AAV6 transgene signal distribution and durability in GBM

   Next, we examined the distribution of transgene signal in both the
   GL261 and KR158 tumor models via 3D IHC to better understand the
   avidity of AAV6 for tumor-associated versus distal astrocytes following
   direct intra-tumor injection. BFP transgene expression was observed in
   a peritumoral pattern in and around the tumor body in both model
   systems (Fig. [113]2a, b), redolent of glial scar formation found in
   human brain malignancies^[114]33. As CXCL9 is a small, secreted
   chemokine, we wanted to determine if signal expression was still focal
   to the tumor or could be detected in contralateral brain and/or
   systemically. The whole brain was collected at 1 and 2 weeks following
   AAV6-CXCL9 or AAV6-EGFP intratumor injection as outlined in
   Fig. [115]2c. Cerebellar tissue was removed, and remaining tissue was
   dissected into the tumor containing and contralateral hemispheres.
   Serum was collected following peripheral blood draws taken from the
   posterior vena cava. Brain tissue and serum were also collected from
   non-transduced (sham) tumor controls, and naïve (non-tumor bearing)
   controls to establish CXCL9 baseline values. Serum levels of CXCL9
   following intratumor delivery of AAV6-CXCL9 measured using high
   sensitivity ELISA assay did not exceed those observed in naïve controls
   (Fig. [116]2d, e). In the brain, elevated CXCL9 expression was
   selectively detected in the tumor bearing hemisphere transduced with
   AAV-CXCL9, with minimal signal observed in the contralateral hemisphere
   in both GL261 and KR158 model systems (Fig. [117]2f, g). Transgene
   CXCL9 expression appears to be stable, as signal intensity was
   consistent in AAV6-CXCL9 transduced tumors at both the 1- and 2-week
   time points in each tumor model (Fig. [118]2f, g). Of note, a small
   increase in CXCL9 expression was observed in AAV6-EGFP control
   transduced GL261 tumors and could be indicative of a mild inflammatory
   response to AAV6, however these values were not found to be
   statistically significant. Together these data demonstrate that AAV6
   intratumor delivery of CXCL9 results in focal and durable expression of
   encoded transgene, where tumor-reactive astrocytes are the target of
   AAV6 transduction.

Fig. 2. AAV6 tumor tropism.

   [119]Fig. 2
   [120]Open in a new tab

   3D IHC displaying geospatial distribution of AAV6 encoded transgene
   (BFP) in (a) GL621 and (b) KR158 tumors collected 1 week following in
   vivo transduction (green), n = 2 per model, scale bar 150 µm. DRAQ5
   nuclear dye (pink) is used to identify tumor borders, as outlined by
   the white dashed line. c Intra-tumor AAV6 treatment schematic for
   protein detection of AAV6 encoded CXCL9. ELISA detection of CXCL9
   protein in serum at one and 2 weeks following AAV6-CXCL9 or AAV6-EGFP
   control intracranial injection in (d) GL261 and (e) KR158 models, n = 3
   per time point, per group. Age-matched naïve controls used to establish
   baseline CXCL9 levels indicated by dashed black line. ELISA detection
   of CXCL9 protein in brain tissues isolated at 1 and 2 weeks following
   AAV6-CXCL9 or AAV6-EGFP control intracranial injection in (f) GL261 and
   (g) KR158 models. Left and right hemispheres lysed separately to
   reflect tumor-bearing and contralateral (focal and distal) signal
   detection. Statistical analyses performed using two-way ANOVA analysis
   with Tukey’s multiple comparisons test. Age-matched naïve brain, and
   sham (saline) injected tumors included as negative control and tumor
   baseline control, with the latter represented by the dashed black line,
   n values shown. P-values ≤ 0.05 are considered statistically
   significant. Bar graphs depict group mean with error bars representing
   standard error of the mean. Source data are provided as a Source Data
   File.

AAV6-CXCL9 enhances lymphocyte chemotaxis

   To evaluate the biologic activity of AAV6-CXCL9 on lymphocyte
   recruitment, we performed competitive in vitro chemotaxis assays.
   Briefly, CTV-labeled splenic-derived T lymphocytes were flanked by
   target cells transduced with AAV6 encoding either EGFP or CXCL9, and
   migration was monitored via fluorescence microscopy at 1- and 24 h
   following co-culture as described in the methods (Fig. [121]3a). Using
   GL261 tumor cells as the target population for AAV6 transduction,
   significantly more T lymphocytes co-localized in the CXCL9 transduced
   tumor field as compared to EGFP at 24 h (Fig. [122]3b). Given that
   astrocytes are the principal target of AAV6 transduction in vivo,
   chemotaxis was reassessed via competitive co-culture using astrocytes
   (C8-D1A) in lieu of GL261 glioma cells. Astrocytes transduced with
   AAV6-CXCL9 similarly showed enhanced recruitment of T lymphocytes
   (Fig. [123]3c), confirming that transgene encoding CXCL9 produces a
   biologically functional chemokine. We also compared lymphocyte
   chemotaxis in the context of AAV6-CXCL9 transduced tumor cells versus
   AAV6-CXCL9 transduced astrocytes, and found that lymphocytes were
   evenly distributed in both the astrocyte field and tumor field
   (Supplementary Fig. [124]S5a), even though increased levels of CXCL9
   secretion were detected in the tumor field (Supplementary
   Fig. [125]S5b). This we attribute in part towards the higher
   proliferative capacity of tumor cells as compared to C8-D1A astrocytes
   (Supplementary Fig. [126]S5c). Altogether, these data indicate that
   CXCL9 functions in an autonomous manner, effectively promoting
   lymphocyte chemotaxis independent of the cellular source. It also
   suggests that there is a minimum biological threshold of CXCL9 signal
   needed for lymphocyte chemotaxis, beyond which increasing levels of
   this chemokine may not impart a competitive advantage.

Fig. 3. AAV6-CXCL9 directed lymphocyte chemotaxis.

   [127]Fig. 3
   [128]Open in a new tab

   a Diagrammatic overview of in vitro competitive T lymphocyte chemotaxis
   assay. b Lymphocyte (CTV + , blue) chemotaxis in AAV6-EGFP (control,
   green) transduced or AAV6-CXCL9 (RFP + , red) transduced GL261 field at
   1- and 24 h following co-culture. Statistical analyses performed by
   two-way ANOVA with Sidak’s multiple comparisons test, n = 3 per time
   point, per group. Representative images shown. Dashed white line
   represents the lymphocyte-tumor border at assay start. c Competitive
   chemotaxis measured as described in (b) in C8-D1A astrocytes field at
   1- and 24 h following co-culture. d Schematic outlining combination
   AAV6 and PD-1 ICB treatment and tissue collection and survival
   analysis. Flow cytometric detection of tumor-infiltrating CD8+
   lymphocytes in control, single or combination AAV6-CXCL9 plus anti-PD-1
   ICB treatment in (e) GL261 and (f) KR158 models. Fold-change
   normalization based on sham values (dashed black line). Statistical
   analysis performed using ordinary one-way ANOVA with Fisher’s least
   significant difference (LSD) test for multiple comparisons, n = 3–6 per
   treatment group, individual values shown. Flow cytometric detection of
   tumor-infiltrating CD4+ lymphocytes in control, single or combination
   AAV6-CXCL9 plus anti-PD-1 ICB in (g) GL261 and (h) KR158 models.
   Fold-change normalization based on sham values (dashed black line).
   Statistical analysis performed using ordinary one-way ANOVA with
   Fisher’s LSD test for multiple comparisons, n = 3–6 per treatment
   group, individual values shown. i 3D IHC of lymphocytes (EGFP + ,
   green) in sham tumor control (scale bar 100 µm) and combination
   AAV6-CXCL9 plus anti-PD-1 ICB treated GL261 tumors (scale bar 70 µm)
   isolated day 15. Tissues counterstained with DAPI (blue) and GFAP
   (astrocytes, red). Images representative of n = 3 per treatment group.
   j Representative 3D IHC of a region of lymphocyte infiltration
   (EGFP + , green) in combination treated GL261 tumors, n = 3, scale bar
   30 µm. Tissues were counterstained with DAPI nuclear dye (blue) and
   GFAP (astrocytes, red). Voxel-based co-localization between EGFP and
   GFAP indicate areas of convergence, ‘cell junctions’, between
   astrocytes and T cells, shown as a separate channel (white). 3D surface
   renderings of astrocytes and lymphocytes to visualize cell junctions in
   greater detail. P-values ≤ 0.05 are considered statistically
   significant. Bar graphs depict group mean with error bars representing
   standard deviation. Box-whisker plots display the box ranging from the
   first to the third quartile, the center median value, and the whiskers
   extend from each quartile to the minimum and maximum values. Source
   data are provided as a Source Data File.

   To determine the effect of AAV6-CXCL9 on T lymphocyte recruitment in
   vivo, multiparametric flow cytometry was performed to quantitate the
   number of T cells present in dissociated tumors following intratumor
   delivery. These studies were done in combination with anti-PD-1 ICB,
   where tissue was collected 1 day following the final dose of ICB to
   capture events within the therapeutic response window as outlined in
   Fig. [129]3d. In both GL261 and KR158 tumor models AAV6-CXCL9 alone had
   minimal impact on enhancing T cell recruitment to the tumor, however
   significant increases in T lymphocyte infiltration were observed in the
   context of combination treatment. AAV6-CXCL9 plus ICB increased CD8 T
   lymphocytes > 2.5-fold in the GL261 model and >4.5-fold in the KR158
   model (Fig. [130]3e, f and Supplementary Fig. [131]S4b). While no
   significant changes in CD4 T lymphocyte recruitment in response to
   treatment was observed in the GL261 model (Fig. [132]3g), a >3-fold
   increase was detected in the KR158 model (Fig. [133]3h). Anti-PD-1 ICB
   treatment in combination with control AAV6 (EGFP) modestly increased
   CD8 T lymphocyte recruitment in GL261 by 1.4-fold and in KR158 by
   2.7-fold, indicating that CXCL9 markedly improves tumor infiltration by
   these cells. These data highlight a potential role for anti-PD-1 ICB in
   mobilizing T lymphocytes systemically, where sequestration of T
   lymphocytes was recently proposed as a mechanism of immune suppression
   in brain tumors^[134]7. To evaluate the geospatial distribution of T
   lymphocyte infiltration into treated tumors, we resected tumor tissue
   on day 15 following treatment with either sham control or combination
   AAV6-CXCL9 with anti-PD-1 ICB, where lymphocytes are identifiable
   through endogenous EGFP expression. Few, if any, lymphocytes could be
   visualized in control treated tumors (Fig. [135]3i). A heterogenous
   distribution of lymphocytes could be readily detected in both peritumor
   and intratumor regions in combination treated tissue (Fig. [136]3i),
   confirming that treatment increases both lymphocyte tumor recruitment
   and penetration. In combination treated tumors, T lymphocytes were also
   observed in regions of astrocytosis, where they formed direct cell-cell
   contact points, or ‘cell junctions (white),’ as detected by voxel
   co-localization between GFAP (astrocytes, red) and EGFP (lymphocytes,
   green) (Fig. [137]3j). While cellular communication between these two
   cell populations can be inferred given the physical proximity and
   direct contact, the exact nature or respective influence imparted by
   these interactions remain an area of ongoing research.

AAV6-CXCL9 sensitizes preclinical GBM to anti-PD-1 ICB

   To assess if enhanced lymphocyte recruitment and immunological
   reprogramming through combination treatment could produce anti-tumor
   responses against GBM, we performed survival analyses in both the GL261
   and KR158 syngeneic model systems. Five days following tumor
   implantation, AAV6 encoding CXCL9 or EGFP control transgene was
   injected intratumorally, with anti-PD-1 ICB (10 mg/kg) administered
   intraperitoneally for a total of 4 doses given every 72 h
   (Fig. [138]3d). In the GL261 model we found that anti-PD-1 ICB produced
   a small, but non-significant increase in overall survival as compared
   to sham treated control animals (p = 0.060), where AAV6-CXCL9 treatment
   yielded no survival benefit as a monotherapy (Fig. [139]4a).
   Combination treatment significantly improved overall survival, with 50%
   of animals exhibiting durable outcomes (Fig. [140]4a). We observed
   similar results in the KR158 model, which carries a low mutational
   burden and is recalcitrant to immunotherapy, with combination treatment
   significantly improving median survival, and long-term survival
   observed in 25% of this cohort (Fig. [141]4b). As an additional metric
   to validate the ability of combination AAV6-CXCL9 plus anti-PD-1 ICB to
   immunologically transform GBM tumors, GL261 tumors were implanted in
   GREAT transgenic mice to evaluate tumor-wide IFNγ expression following
   treatment as described in Fig. [142]3d. IFNγ was readily detected in
   combination treated tumors as compared to sham control treated tumors,
   evidenced by EYFP signal detection via 3D IHC (Fig. [143]4c).
   Immunolabeling of tissues for CD45 confirms that EYFP (IFNγ)+ cells are
   immune cells (Fig. [144]4d), indicative of pro-inflammatory immune
   activation.

Fig. 4. AAV6-CXCL9 sensitizes GBM tumors to anti-PD-1 immunotherapy.

   [145]Fig. 4
   [146]Open in a new tab

   Survival analysis in (a) GL261 and (b) KR158 tumor-bearing mice treated
   with control, AAV6-CXCL9, and anti-PD-1 ICB alone and in combination.
   Median survival for each treatment group shown, n = 8 per group.
   Statistical analysis was performed using Log-rank (Mantel-Cox) test
   comparing individual treatment groups. c Tile-stitch 10x 3D IHC imaging
   of GL261 tumors resected from sham control and combination AAV6-CXCL9
   plus anti-PD-1 ICB treated GREAT mice, n = 3 per group, scale bar
   300 µm. DAPI nuclear dye (blue) used to identify tumor area outlined by
   the dashed white line. Digital magnification of regions outlined in the
   far-left panel to show higher image resolution for each treatment,
   scale bar 50 µm. EYFP (green) correlates with IFNγ expression. d 3D IF
   of tissue from GL261 tumor tissue as shown in (c) immunolabeled for
   CD45 expression (red), scale bar 20 µm. Digital zoom of region outlined
   in the far-right panel shows co-localization between CD45 and IFNγ,
   indicating these are immune cells, n = 3, scale bar 5 µm. e
   Diagrammatic summary of combination treatment strategy with concomitant
   CD4 or CD8α antibody depletion. f Survival analysis in GL261
   tumor-bearing mice treated with combination AAV6-CXCL9 plus anti-PD-1
   monoclonal antibody, with or without anti-CD8α depletion. Statistical
   analysis performed using Log-rank (Mantel-Cox) test comparing
   individual treatment groups, n = 8 per group. g Survival analysis in
   GL261 tumor-bearing mice treated with combination AAV6-CXCL9 plus
   anti-PD-1 monoclonal antibody, with or without anti-CD4 depletion.
   Statistical analysis performed using Log-rank (Mantel-Cox) test
   comparing individual treatment groups, n = 7–8 per group. h Survival
   analysis in long-term survivors from combination treated animals
   re-challenged with tumor at day 55 of study (n = 5). Age-matched naïve
   control mice were orthotopically implanted with GL261 as survival
   control arm. Statistical analysis was performed using Log-rank
   (Mantel-Cox) test comparing individual treatment groups.
   P-values ≤ 0.05 are considered statistically significant. Source data
   are provided as a Source Data File.

   To determine if CD8 lymphocytes contribute to the therapeutic survival
   effect, we repeated combinatorial treatment with concomitant CD8
   depletion (Fig. [147]4e) in the GL261 model. We found that on study day
   18 all animals treated with CD8 depleting antibodies had no detectable
   levels of circulating CD8 T lymphocytes, and no changes in the quantity
   of circulating CD4 T lymphocytes (Fig. [148]4f, Supplementary
   Fig. [149]S5d). CD8 depletion reversed the survival benefit observed
   with combination AAV6-CXCL9 plus anti-PD-1 ICB, and this cohort
   progressed as quickly as control treated subjects (Fig. [150]4f). We
   similarly evaluated the impact of CD4 lymphocyte depletion
   (Fig. [151]4e, Supplementary Fig. [152]S5e), and found that while there
   was a trend for reduced survival in animals treated with combination
   therapy plus concomitant CD4 depletion, these results were not
   considered to be statistically significant, and many animals in the
   cohort demonstrated extended survival as compared to control
   (Fig. [153]4g). Interestingly, sham control animals with concomitant
   CD4 depletion demonstrated more rapid disease progression as compared
   to non-depleted controls, indicating an important role for these
   lymphocytes in host tumor response (Fig. [154]4g). To determine if
   combination treatment could confer long-term immune memory formation,
   we performed a GL261 tumor rechallenge in long-term survivors
   (>55 days) that had received AAV6-CXCL9 plus anti-PD-1 ICB. No
   observable residual tumor was present from the initial tumor
   implantation during the second implantation. A second cohort of
   age-matched naïve animals was intracranially injected with GL261 as a
   control. Control animals all succumbed to tumor burden within 30 days
   of tumor implantation, whereas 100% of rechallenge animals remained
   disease free (Fig. [155]4h). These data confirm that therapeutic
   response to combination therapy is dependent on tumor infiltration by
   CD8 T lymphocytes as part of the adaptive immune cascade, and
   combination therapy can convey long-term immune memory protection
   against recurrence.

   To assess if intratumor delivery of AAV6-CXCL9 is vital for therapeutic
   efficacy we compared overall survival in GL261 tumor bearing mice where
   AAV6-CXCL9 (1e10 VGS) was intratumorally (IT) injected, or injected
   into the contralateral (CL) hemisphere at coordinates symmetrical to
   intratumor delivery. We found that intratumor delivery of AAV6-CXCL9
   produced a more robust survival response as compared to contralateral
   delivery (Supplementary Fig. [156]S5f), although a subset of these
   animals did demonstrate extended survival as compared to control. We
   also tested therapeutic efficacy in more established tumors, comparing
   AAV6-CXCL9 intratumor delivery plus combination anti-PD-1 ICB given on
   day 5 or day 12 (delayed treatment, DT). While delayed treatment
   yielded some survival benefit as compared to control treated animals,
   is was significantly reduced as compared to animals receiving
   combination treatment beginning on day 5 (Supplementary Fig. [157]S5g).
   Whole brain imaging of GL261 tumors excised 1 week following intratumor
   delivery at day 12 with AAV6 encoding an mCherry fluorescent reporter
   transgene revealed extensive local and distant disease progression,
   including ventricular dissemination (Supplementary Fig. [158]S5h). AAV6
   transduction in these larger tumors was confined largely to the site of
   intratumor injection (Supplementary Fig. [159]S5h), indicating that in
   larger tumors a multifocal delivery method may be required for optimal
   anti-tumor efficacy.

scRNAseq identifies treatment-related immune response to AAV6-CXCL9 and
anti-PD-1 ICB

   In an effort to define the immunological landscape of AAV6-CXCL9
   treated tumors with or without concurrent anti-PD-1 ICB, we performed
   single cell RNA sequencing (scRNAseq) on CD45-positive cells isolated
   from GL261 tumors collected on day 15 of treatment as outlined in
   Fig. [160]3d. Top differentially expressed genes from each pooled
   population were identified, and cluster cell types were defined using
   the expression of known marker genes resulting in the identification of
   13 unique cell clusters^[161]34,[162]35 (Fig. [163]5a, Supplementary
   Table [164]1). Dimensionality reduction using uniform manifold
   approximation and projection (UMAP) was performed on 52,344 cells
   collected across five treatment groups: sham (saline), AAV6-ctrl + IgG,
   AAV6-ctrl + aPD-1, AAV6-CXCL9 + IgG, and combination
   AAV6-CXCL9 + aPD-1, 3 mice per group (Fig. [165]5b, c, Supplementary
   Fig. [166]S7a–d). Analyses of lymphocyte tumor recruitment across
   treatment groups recapitulate our earlier observation, with combination
   therapy yielding a significant increase in total infiltrating CD8 T
   lymphocytes (Fig. [167]5d), identified using the gene expression
   markers Cd3d, Cd8a, Cd8b1 as previously described^[168]36. T regulatory
   lymphocytes (Treg), defined by Cd4, Foxp3, and Il2ra gene
   expression^[169]36, were also increased in response to combination
   therapy, although collectively these represent <1% of the total
   tumor-associated immune population (Fig. [170]5e). Increased tumor
   infiltration by monocytes, classified by high Ly6c1 expression, was
   observed across all treatment groups as compared to sham control mice
   (Fig. [171]5f), with an enrichment of non-classical monocytes
   characterized by Spn, Cx3cr1, and Tnfrsf1b expression^[172]37 in groups
   receiving anti-PD-1 treatment (Fig. [173]5g). Graphical summaries for
   all remaining cells clusters in response to each treatment are shown in
   Supplementary Fig. [174]S6a–h. Given that CXCR3 is the concomitant
   receptor for CXCL9, we leveraged our scRNAseq data to assess which
   tumor-associated immune cells could interact with our AAV encoded
   transgene. We found that Cxcr3 was principally expressed by
   lymphocytes, as shown on the UMAP in Fig. [175]5h. Further
   classification of lymphocyte subsets was done to determine if specific
   populations would be more or less responsive to AAV-CXCL9 therapy by
   means of differential CXCR3 expression. We identified 11 unique
   lymphocyte clusters (Fig. [176]5i, Supplementary Fig. [177]S7e), with
   equal distribution of Cxcr3 transcript expression detected across all
   clusters, with cluster 9 and 10 exhibiting slightly reduced overall
   Cxcr3 transcript expression (Fig. [178]5i, Supplementary
   Fig. [179]S7e). These findings suggest that CXCL9 broadly interacts
   with all lymphocyte subsets through CXCR3 expression.

Fig. 5. Immunological landscape of GBM tumors treated with AAV6-CXCL9 and
anti-PD-1 immunotherapy.

   [180]Fig. 5
   [181]Open in a new tab

   a Summary of UMAP cell clusters. UMAP of cell types clustered by scRNA
   transcriptional analysis of 52,344 CD45+ cells isolated from GL261
   tumor bearing mice treated with (b) sham (saline) or (c) combination
   AAV6-CXCL9 + aPD-1 treated GL261 tumors, n = 3 mice per group. Summary
   circle chart depicting cell cluster population frequency detected for
   each treatment included alongside each UMAP. Quantitative change in
   population frequency of (d) CD8 + T cells, (e) Treg cells, (f)
   monocytes, and (g) non-classical (n–c) monocytes across treatment
   groups. Statistical analyses performed using ordinary one-way ANOVA
   with Fisher’s LSD test for multiple comparisons, n = 3 per group,
   individual values shown. h UMAP projection of Cxcr3 transcript
   expression (TPM) detected across all cell clusters. i UMAP of T cell
   clusters. j Summary of Cxcr3 transcript expression across defined T
   cell clusters. Box-whisker plots display the box ranging from the first
   to the third quartile, the center median value, and the whiskers extend
   from each quartile to the minimum and maximum values. Source data are
   provided as a Source Data File.

Combination AAV6-CXCL9 and anti-PD-1 ICB treatment increases cellular
crosstalk in lymphocytes

   As shown in Fig. [182]6a, we identified 2,260 differentially expressed
   genes (DEGs) associated with AAV6-CXCL9 treatment, 2,607 DEGs
   associated with anti-PD-1 treatment, and 2,649 DEGs associated with
   these treatments combined. Of these, 70, 194, and 151 DEGs appear to be
   unique to each given treatment strategy, respectively, and may provide
   unique insight toward treatment impact on immune cell functional
   states. Through transcriptional expression of distinct ligands and
   receptors, cell-type-specific interactions were inferred, providing
   additional insight towards the inflammatory profile of tumors and how
   they change in response to treatment^[183]38. Using our predefined cell
   clusters, a simplified DEG set was established for each. DEGs were then
   queried against public ligand-receptor databases (see Methods). Summary
   results are shown in Chord Plots, where line thickness represents the
   number of predicted interactions between two defined cell clusters
   (Supplementary Fig. [184]S8a–e). Next, we performed direct comparisons
   of interactome activity between treatment groups to elucidate
   heightened or decreased connectivity associated with AAV6-CXCL9 and
   anti-PD-1 ICB, where heatmap relative values in red indicate increases
   and blue decreases in prospective ligand-receptor interactions. In
   evaluating AAV6-CXCL9 in combination with either anti-PD-1 ICB or IgG2
   control to resolve the contributions of ICB, notable increases in
   signals emanating from each macrophages (Mac), border-associated
   macrophages (BAM), microglia (Mg), and NK cells signaling to CD8+ and
   regulatory T cells were observed (Fig. [185]6b). Decreased incoming
   signals were noted in BAMs, CD4 + T cells, and dendritic cells (DCs)
   stemming from nearly all cell clusters (Fig. [186]6b). Cell-cell
   interactions associated with AAV6-CXCL9 shown in Fig. [187]6c reveal
   heightened communication directed toward both CD4+ and CD8 + T cell
   subsets, and NK cells prompted by all clusters excluding B cells and
   DCs. Signaling originating from all lymphocyte populations, and most
   innate immune cells including Macs, Mgs, Monocytes, and NK cells was
   increased, suggesting that AAV6-CXCL9 treatment broadly stimulates
   immune activity.

Fig. 6. AAV6-CXCL9 and anti-PD-1 immunotherapy stimulates CD8 lymphocyte
activation.

   [188]Fig. 6
   [189]Open in a new tab

   a Venn Diagram representing differentially expressed genes affiliated
   with each treatment. b Heatmap depicting scRNA-seq-derived cell-cell
   communication networks enriched or decreased in response to combination
   AAV6-CXCL9 + aPD-1 as compared to AAV6-CXCL9 + IgG2 treatment across
   identified cell clusters. c Heatmap depicting scRNA-seq-derived
   cell-cell communication networks enriched or decreased in response to
   combination AAV6-CXCL9 + aPD-1 as compared to AAV6-EGFP + aPD-1
   treatment across identified cell clusters. d Waterfall summary plot of
   scRNA-seq-derived signaling pathways enriched in CD8 + T cells
   following combination AAV6-CXCL9 + aPD-1 as compared to
   AAV6-CXCL9 + IgG2 treatment. e Waterfall summary plot of
   scRNA-seq-derived signaling pathways enriched in CD8 + T cells
   following combination AAV6-CXCL9 + aPD-1 as compared to
   AAV6-EGFP + aPD-1 treatment. f Heatmap representation of gene
   expression analysis derived from all cell clusters using the nCounter®
   Immune Exhaustion Panel (nanoString) following AAV6-CXCL9 gene therapy
   with or without PD-1 ICB. CD8 + T cell populations outlined in black
   for each treatment group. g–l Quantification of common pathways found
   to be differentially regulated in CD8 + T cells in response to
   treatment, derived from n = 669, 674, 1099, 912, and 1656 single cells
   pooled from n = 3 individual samples per treatment group, graphically
   presented from left to right. Statistical analyses performed using
   Kruskal–Wallis test followed by Dunn’s multiple comparisons, with
   individual values shown. P-values ≤ 0.05 are considered statistically
   significant. Box-whisker plots display the box ranging from the first
   to the third quartile, the center median value, and the whiskers extend
   from each quartile to the minimum and maximum values. Source data are
   provided as a Source Data File.

   Given that combination treatment promotes CD8 T cell tumor
   infiltration, which is required for anti-tumor efficacy, we sought to
   resolve how treatment might impact CD8 T cell effector function via
   pathway analysis of DEGs specifically within these cells. Comparative
   pathway analysis between CD8 T cell DEGs shows selective enrichment of
   thrombospondin (Thbs1), poliovirus receptor (Pvr, Cd155), Cd137
   (Tnfrsf9, 4-1BB), fibronectin-1 (Fn1), laminin (Lamc1), and several
   genes associated with major histocompatibility complex class I
   signaling, among others, as uniquely affiliated with combination
   therapy when compared to AAV6-CXCL9 plus IgG2 control (Fig. [190]6d).
   These data suggest that anti-PD-1 treatment prompts T cell activation
   via CD137^[191]39, but also reciprocal immune suppression via CD155
   given its inhibitory function as a ligand for T cell immunoreceptor
   with immunoglobulin and ITIM domain (TIGIT)^[192]40. FN1, laminin, and
   THBS are major constituents of the extracellular matrix, and when
   produced by lymphocytes have been described to support cell-cell
   engagement, transendothelial migration, and
   lymphoproliferation^[193]41–[194]43. DEG comparisons between
   combination therapy and AAV6-EGFP control plus anti-PD-1 ICB treatment
   reveals selective pathway enrichment of macrophage migration inhibitory
   factor (Mif), growth arrest specific (Gas6), galectin-9 (Lgals9),
   inducible T cell co-stimulator (Icos1), tumor necrosis factor (Tnf),
   and pleiotrophin (Ptn) as a result of AAV6-CXCL9 treatment
   (Fig. [195]6e). These data infer that AAV6-CXCL9 directly promotes CD8
   T cell activation through increased ICOS and TNF
   expression^[196]44,[197]45, T cell migration via PTN^[198]46, and
   reciprocally enhances innate immune stimulation of NK cells and myeloid
   cells via GAS6 and MIF secretion, respectively^[199]47,[200]48. It also
   reveals galectin-9 as a possible mechanism for CD8 T cell acquired
   exhaustion^[201]49,[202]50. Both anti-PD-1 ICB and AAV6-CXCL9
   treatments stimulate NOTCH, TGFβ, IL-10, SEMA4, CXCL, Complement, and
   CCL pathway activation (Fig. [203]6d, e), each with varying impact on T
   cell maturation, effector function, homeostasis, survival, and
   migration^[204]51–[205]57. Comparative pathway analysis was also
   performed for CD4 T cells across treatment groups (Supplementary
   Fig. [206]S8f, g).

   We next leveraged the NanoString nCounter® Immune Exhaustion Panel to
   further characterize immune status and inflammatory signatures
   associated with each respective treatment. A summary of pathway
   activation across all cell subsets in response to individual treatments
   is shown in Fig. [207]6f and Supplementary Fig. [208]S8h, with CD8 T
   cell clusters outlined in black for each treatment group. From the
   NanoString analysis, CD8 T cell specific differential pathway
   activation is graphically presented in Fig. [209]6g–l, where we
   identify treatment-associated changes in each antigen presentation
   (Fig. [210]6g), chemokine signaling (Fig. [211]6h), cytotoxicity
   (Fig. [212]6i), T cell exhaustion (Fig. [213]6j), TCR signaling
   (Fig. [214]6k), and PD-1 signaling (Fig. [215]6l). In particular,
   combination AAV6-CXCL9 plus anti-PD-1 ICB was associated with the
   highest increase in cytotoxicity, TCR signaling, and PD-1 signaling.
   Increased T cell exhaustion appears to be associated with AAV6-CXCL9
   treatment. Given that monocyte tumor infiltration was additionally
   increased in response to treatment (Fig. [216]5f, g), we evaluated
   pathway activation in these cells to better understand their functional
   status. We found enhanced activation across 12 pathways, including
   antigen presentation, chemokine signaling, cytotoxicity, IL-10
   signaling, JAK/STAT signaling, other interleukin signaling, T cell
   checkpoint, TGFβ signaling, TNF signaling, Type I interferon signaling,
   and Type II interferon signaling (Supplementary Fig. [217]S9). Of
   these, AAV6-CXCL9 treatment appears to be associated with increased
   antigen presentation, cytotoxicity, JAK/STAT signaling, and Type I
   interferon signaling, where anti-PD-1 ICB induces IL-10 signaling, TLR
   signaling, and TNF signaling. Together these data are suggestive that
   treatment may augment the pro-inflammatory function of these cells.

Cytokine profiling of combination AAV6-CXCL9 plus anti-PD-1 ICB

   As combination therapy increases DEGs of both the CCL and CXC
   superfamily of secreted chemokines and cytokines, we sought to parse
   out transcriptional changes within CD8 T cells as an additional means
   to evaluate the activation state of these cells given the central role
   of these ligands in directing migration and activation of immune cells
   during inflammation^[218]58. A summary of all CCL and CXC family ligand
   and receptor transcripts expressed by CD8 T cells is presented in the
   heatmap in Fig. [219]7a. CD8 T cell mediated stimulation of
   monocytes/macrophages is evidenced by increased transcription of Ccl2,
   Ccl3, and Ccl12 across all treatment groups as compared to sham control
   (Fig. [220]7b–d). Ccl4 transcription was also increased (Fig. [221]7e),
   indicative of NK stimulation by CD8 T cells. Ccl5 was found to be the
   most differentially upregulated soluble ligand in combination treated
   CD8 T cells as compared to all other treatment groups (Fig. [222]7f),
   and is indicative of CD8 T cell effector function^[223]59,[224]60.
   While we show that AAV6 delivered CXCL9 transgene expression
   predominantly emanates from tumor-reactive astrocytes, our scRNAseq
   data shows that each anti-PD-1 and AAV gene therapy induces CXCL9
   transcription within CD8 T cells (Fig. [225]7g), additionally
   demonstrating immune activation as a result of
   treatment^[226]22,[227]23,[228]61. Cxcl10 was also found to be
   transcriptionally upregulated in response to anti-PD-1 and AAV gene
   therapy (Fig. [229]7h), which prompts further CD4, CD8, and NKT
   lymphocyte recruitment^[230]61. Altogether, these data support that
   combination AAV6-CXCL9 and anti-PD-1 ICB both increases lymphocyte
   trafficking to intracranial GBM tumors and potently stimulates effector
   lymphocyte cellular communication and activation.

Fig. 7. Inflammatory signature of preclinical GBM treated with AAV6-CXCL9 and
anti-PD-1 ICB.

   [231]Fig. 7
   [232]Open in a new tab

   a Heatmap summary of scRNA-seq-derived CCL-CXC expression in CD8 + T
   cells isolated from GL261 tumors in response to AAV6-CXCL9 and
   anti-PD-1 ICB treatment created using GraphPad Prism. b–i
   Quantification of CCL-CXC genes found to be differentially expressed in
   CD8 + T cells in response to treatment derived from n = 669, 674, 1099,
   912, and 1656 single cells pooled from n = 3 individual samples per
   treatment group, graphically presented from left to right. Statistical
   analyses performed using Kruskal–Wallis test followed by Dunn’s
   multiple comparisons, with individual values shown. j Representative
   immunoblots depicting chemokine and cytokine protein expression
   detected in GL261 tumors resected following treatment with AAV6-CXCL9
   with and without PD-1 ICB (n = 3 for sham, rAAV6-EGFP + IgG2a, and
   rAAV6-EGFP + aPD-1; n = 4 for rAAV6-CXCL9 + IgG2a and
   rAAV6-CXCL9 + aPD-1). -4 per group. k Heatmap summary of CCL-CXC
   relative protein expression found to be differentially expressed in
   response to AAV6-CXCL9 with and without PD-1 ICB, created using
   GraphPad Prism. l Circos interactome analysis of detected
   differentially expressed proteins and predicted receptors.
   P-values ≤ 0.05 are considered statistically significant. Box-whisker
   plots display the box ranging from the first to the third quartile, the
   center median value, and the whiskers extend from each quartile to the
   minimum and maximum values. Source data are provided as a Source Data
   File.

   As described above, secreted cytokines can influence the trajectory of
   tumors in a multitude of ways- reprogramming tumor-associated cells and
   suppressing infiltrating inflammatory subsets which allows for tumor
   tolerance, progression, metastasis, and even therapeutic resistance or,
   alternatively, creating an environment favorable for innate and
   adaptive immune activation to facilitate tumor rejection^[233]62.
   Moreover, the cytokine profile of a tumor may serve as predictive
   and/or therapeutic biomarkers allowing for the detection of tumor
   presence, forecasting therapeutic response, and can also be used to
   guide therapeutic choices^[234]62. We performed a large-scale cytokine
   proteomic assessment of single agent and combination treated tumors to
   identify candidate biomarkers of response to therapy. Tumors were
   resected 10 days after the onset of treatment as shown in Fig. [235]3d.
   Of the 111 soluble murine proteins on the array, relative expression of
   65 was detected in treated and/or control GL261 tumor samples as
   summarized Supplementary Fig. [236]S10a, with representative cytokine
   immunoblots shown in Fig. [237]7j. 10 secreted factors were identified
   as differentially expressed as compared to sham control tumors
   following either single or combination treatment with AAV6-CXCL9 and
   anti-PD-1 ICB: ADIPOQ, C1QR1 (CD93), CCL5, CCL12, CD40, CXCL9, CXCL10,
   CXCL16, LCN2, and MPO (Fig. [238]7k, Supplementary Fig. [239]S10b–k).
   Of these, CCL5, CD40, and CXCL16 were most potently induced by
   combination treatment. These markers are indicative of lymphocyte
   presence and activation, where CCL5 is a potent pro-inflammatory ligand
   manufactured principally by CD8 T lymphocytes, and CD40 is a
   co-stimulatory ligand that triggers lymphocyte proliferation and
   cytokine production^[240]59,[241]60. Of note, elevated CCL5 ligand
   expression demonstrates concordance with scRNAseq data (Fig. [242]7f).
   In addition, CXCL9, CXCL10 and CXCL16 are strong chemotactic signals
   for lymphocyte recruitment. Both CXCL10 and CXCL16 are induced by
   interferon gamma (IFNγ) and tumor necrosis alpha (TNFα), powerful
   catalysts of innate and adaptive inflammation^[243]63,[244]64. A
   summary of treatment-induced secreted ligands and known receptor
   interactions are depicted via circular interactome analysis performed
   using Circos® visualization software^[245]65, revealing insight towards
   immune reprogramming that occurs in response to each respective
   treatment (Fig. [246]7l). These data combined validate that AAV6
   delivery of CXCL9 to the tumor microenvironment in tandem with
   anti-PD-1 ICB not only facilitate lymphocyte recruitment to GBM tumors,
   but also reprograms the immunological landscape towards a
   pro-inflammatory phenotype.

   In summation (Fig. [247]8), intra-tumor delivery of AAV6 encoded CXCL9
   results in the production of a pro-lymphocyte chemotactic gradient by
   transduced tumor-reactive astrocytes. This, in concert with anti-PD-1
   ICB, significantly increases tumor infiltration by lymphocytes likely
   through CXCL9 engagement with its cognate receptor expressed by these
   cells- CXC motif chemokine receptor 3 (CXCR3). In particular, CD8 T
   lymphocytes are the premier arbiters of anti-tumor response, where
   depletion of this lymphocyte subset negates therapeutic efficacy.
   Moreover, CD8 T cell effector activation and function is evidenced by
   heightened expression of co-stimulatory molecules, such as 4-1BB and
   ICOS, and production of pro-inflammatory chemokines and cytokines.
   Beyond CD8 T lymphocyte activation, AAV6-CXCL9 and anti-PD-1 ICB appear
   to contribute widespread immunological activation, demonstrated by
   heightened cellular cross-talk across numerous immune clusters, and
   protein detection of pro-inflammatory molecules. Notably, CCL5, CXCL9,
   CXCL10, and CD40 are detected in response to combination therapy within
   resected tumors, and may serve as biomarkers of therapeutic response.

Fig. 8. Diagrammatic summary of findings.

   [248]Fig. 8
   [249]Open in a new tab

   Intra-tumor delivery of AAV6 encoding CXCL9 results in robust
   transduction of tumor-reactive astrocytes, creating a chemotactic
   gradient of secreted CXCL9. This improves lymphocyte trafficking in
   combination with anti-PD-1 ICB through chemokine-receptor engagement
   between CXCL9 in the TME and CXCR3 expression on lymphocytes. CD8 + T
   cells are required for durable survival response to treatment,
   indicating that tumor cell killing is mediated by the adaptive arm of
   immunity. Combination treatment also transforms the inflammatory milieu
   of tumors, creating a pro-inflammatory environment evidenced by the
   presence of cytokines and chemokines that further promote innate and
   adaptive immune activation.

Discussion

   Perhaps one of the most consequential advantages of AAV gene therapy
   for the treatment of GBM, and possibly other solid tumors, is that
   fundamentally AAV is a modality for distributing encoded transgene into
   the tumor microenvironment. Still further work has been done on
   modification and design of vectors carrying unique biotherapeutic
   transgenes capable of targeting particular cells. These can be pooled,
   offering a straightforward method for delivering personalized
   anti-cancer combination treatment targeting one or multiple aspects of
   tumorigenicity. Examples include transgenes encoding anti-angiogenics,
   anti-migrastics, direct cytotoxic agents (e.g. suicide genes), immune
   stimulating elements, immune checkpoint inhibitor decoys, and even
   gene-editing elements such as CRISPR/Cas9 or shRNA. Herein, we
   demonstrate that AAV encoding for the lymphotactic chemokine CXCL9 can
   be leveraged to engage the immune system to recognize and attack tumor
   cells by modulating anti-PD-1 immunotherapy in the combinatorial
   setting.

   We found that GBM tumors possess a chemokine signature that favors the
   recruitment of myeloid and other ‘suppressive’ immune cells, notably
   lacking lymphocyte call-and-receive signals. This is unsurprising given
   that the immune contexture of human GBM is largely comprised of myeloid
   cells^[250]66. To test if GBM reconstitution with a lymphocyte
   selective chemokine could improve trafficking we leveraged AAV gene
   therapy to generate durable production of CXCL9. With the initial
   intent of transducing glioma cells to generate tumor-tropic transgene
   expression, we found that in vivo transduction was not redolent of in
   vitro screening methods, instead revealing potent transduction of
   tumor-reactive astrocytes with our lead serotype, AAV6. These findings
   advise caution in extrapolating AAV transduction efficacy from in vitro
   or even ex vivo screening methods to anticipated cell/tissue tropism in
   the in vivo setting. Despite this discrepancy, we found that
   AAV6-transduced astrocytes confer a high degree of tumor tropism, where
   transgene expression was limited to the immediate tumor area. Whether
   this is due to localization of AAV delivery at the injection site,
   which is an advantage of direct inoculation over systemic
   administration, or through changes to the reactive astrocytes
   surrounding the tumor that lead to increased transfection
   susceptibility is an area of active investigation. Our study
   additionally shows that AAV6 inoculation in vivo in non-tumor bearing
   mice preferentially transfects astrocytes, potentially indicating the
   inoculation itself is an injury/inflammatory event that sequesters the
   therapy at the site of delivery. Altogether our findings suggest that
   astrocytes may be selectively susceptible to AAV6 transduction as
   compared to the other cells constituting the tumor microenvironment
   that reside within the treatment field of the viral administration.
   Heparin sulfate proteoglycan (HSPG), one of the principal host cell
   receptors for AAV6 transduction^[251]67 is reported to be upregulated
   by astrocytes in response to brain injury^[252]30,[253]31, offering a
   possible explanation for the tumor-tropic nature of astrocyte
   transduction by AAV6.

   AAV targeting of tumor-associated cells may carry several distinct
   advantages over directly targeting cancer cells. Given the genetic
   diversity of cancer cells, identifying a serotype that can reliably and
   consistently transduce tumor cells poses a challenge. Tumor-associated
   cells such as astrocytes, as demonstrated herein, or alternatively
   endothelial cells, microglia, etc. are more likely to have a homogenous
   genotype across patient tumors allowing for targeted off-the-shelf
   therapeutic development, drastically accelerating treatment timelines
   and reducing cost as compared to personalized medicine approaches
   necessary to guide serotype selection for cancer cell targeting. Our
   data also indicates that targeting of tumor-associated astrocytes is
   likely to produce a more durable response as these cells are less
   susceptible to genetic alterations. Direct tumor transduction, on the
   other hand, is short-lived, likely as a result of vector genome
   dilution due to the high proliferative capacity of these cells^[254]68
   and may require repeat treatments to sustain transgene expression. This
   is supported by other studies, including one conducted by Maguire et
   al. where they found that intraparenchymal delivery of human interferon
   beta by AAV prevented human GBM development and led to tumor regression
   in xenograft models of disease^[255]17. In their study, they stress the
   capacity of transfecting non-tumor cells in the TME as an effective
   strategy in longer lasting production of transfected viral payload.

   Although AAV6 produced CXCL9 clearly improves lymphocyte chemotaxis in
   vitro, we found that AAV6-CXCL9 monotherapy did not induce robust
   lymphotaxis into intracranial GBM tumors. The addition of anti-PD-1 ICB
   dramatically improved lymphocyte trafficking in the combinatorial
   setting with AAV6-CXCL9, in particular CD8 T cells. These findings
   speak toward the prospect of T cell sequestration as an auxiliary
   barrier to trafficking that jointly contributes to lymphopenia in GBM
   as first reported by Chongsathidkiet and colleagues^[256]7. Therefore,
   treatment strategies to boost peripheral lymphocyte counts may be
   necessary to realize the potential of AAV-based chemotactic therapy.
   Anti-PD-1 ICB offers one such modality, as peripheral expansion of T
   cells has been validated as a clinical correlate of response to this
   immune checkpoint inhibitor in certain cancers^[257]69,[258]70. GBM is
   largely refractory to anti-PD-1 ICB including in somatically
   hypermutated GBM,^[259]8,[260]71 reciprocally underscoring the need for
   multimodal treatment strategies. Our findings echo this sentiment, with
   anti-PD-1 ICB showing minimal improvements in overall survival in the
   preclinical setting. Previous work done by Pascual-Garcia et al.
   identified the IL-6 class cytokine Leukemia Inhibitor Factor (LIF) as a
   potential direct regulator of CXCL9 expression in human GBM preventing
   recruitment of CD8 + T cells and impairing anti-PD-1 therapy^[261]72.
   In their work, there was an inverse relationship between LIF
   upregulation and CXCL9 expression in human GBM samples, and inhibition
   of LIF through RNAi or monoclonal antibody therapy could induce
   upregulation in CXCL9 resulting in improved T cell recruitment. Similar
   to our data presented here, as a monotherapy, this strategy cannot
   overcome tumor proliferation. However, when added to anti-PD-1 ICB they
   observed similar increases in survival and induction of immunologic
   memory^[262]72. These data suggest that deficiencies in lymphocyte
   trafficking and tumor infiltration likely contribute to the problem of
   immunotherapy resistance, where strategies that upregulate CXCL9 may
   overcome this barrier. Both strategies have benefits and drawbacks.
   Peripheral monoclonal antibody administration poses little logistical
   considerations in terms of safety and feasibility; however, it is
   unknown if a LIF-targeting monoclonal antibody can sufficiently cross
   the BBB. As we anticipate heterogeneity among human GBM patients, LIF
   may not be a constitutively expressed target across all patients.
   Therefore, inhibition of LIF may not necessarily correlate with
   upregulation in CXCL9. This is highlighted by Garcia’s work, which
   emphasized that LIF inhibition in the GL261 parent line had no effect
   but was effective in the GL261N subline with elevated LIF expression
   levels. Therefore, AAV directed production of CXCL9 at the tumor site,
   independent of LIF expression, may be applicable to a broader range of
   GBM patients. Moreover, intratumoral delivery has the capacity to
   localize the recruitment and migration of T cells to the tumor site as
   compared to systemic delivery which may redirect or dilute the response
   of CD8 + T cells.

   Another consideration is to combine AAV6-CXCL9 gene therapy alongside
   adoptive cellular transfer of ex vivo modified T cells, such as CAR T
   cell therapy. This strategy would bypass host lymphocyte sequestration
   altogether by direct intravenous delivery of antigen-specific T cells,
   where tumor-tropic CXCL9 expression would facilitate directed
   trafficking. Likewise, tumor-specific homing of CAR T remains an
   unresolved issue for solid tumors^[263]9–[264]11 and may benefit from
   this particular combinatorial strategy. Both AAV6-CXCL9 and anti-PD-1
   ICB also confer secondary mechanisms of action that protect against
   immune tolerance. CXCL9 is reported to promote lymphocyte
   differentiation and maturation towards an effector phenotype^[265]73
   and anti-PD-1 ICB protects against TME PD-L1 induced lymphocyte
   exhaustion, thus contributing toward adaptive immune activation and
   prolongation of cytotoxicity in these cells^[266]74. Our findings
   corroborate this, confirming enhanced CD8 T cell cytotoxicity and TCR
   signaling pathway activation alongside detection of pro-inflammatory
   chemokines and cytokines associated with adaptive immunity,
   particularly in the context of combination treatment. Total abrogation
   of therapeutic efficacy with CD8 lymphocyte depletion validates
   adaptive immune activation as the principal mechanism of anti-tumor
   response. Combination virotherapy with pooled AAV vectors targeting
   different aspects of immunogenicity should also be explored further as
   a viable multimodal strategy for overcoming GBM immune evasion.

   We found that direct intratumor delivery of AAV6 was sufficient to
   establish tumor-selective production of CXCL9. While intratumor
   delivery is considered an invasive method of treatment, generating
   focal expression of chemokine is critical for efficacy as the mechanism
   by which these secreted molecules work to facilitate immune cell
   trafficking is by establishing concentration gradients that immune
   cells expressing the cognate receptor follow, prompting selective
   infiltration into inflamed tissues^[267]58. While brain tropic,
   BBB-crossing serotypes have received significant attention for their
   ability to transduce CNS tissue following intravenous
   delivery^[268]15,[269]16, higher doses are required to maintain
   sufficient transduction efficiency, and off-target transduction of
   peripheral tissues remains a consequence of this delivery
   method^[270]75–[271]78. Peripheral expression of CXCL9 or other
   lymphotactic chemokines could counterproductively deter homing to the
   CNS, reducing the efficacy of this treatment strategy. Furthermore,
   systemically delivered AAV could also encourage immunological responses
   resulting in host complement activation and antibody-mediated
   neutralization, or could prompt adverse toxicity such cytopenias,
   hepatoxicity, and even neurotoxicity^[272]77–[273]79. To generate focal
   AAV transgene expression, virus could be delivered via stereotactic
   injection into unresectable gliomas, for example in tumors that arise
   in vital structures of the brain or in the event of recurrence, or into
   the resection cavity following surgery.

   In summary, the use of AAV gene therapy has the potential to disrupt
   the existing treatment paradigm for GBM which relies on radiation,
   surgery, and cytotoxic chemotherapy. Systemic administration of
   immunotherapeutics and single-target chemotherapy agents have shown
   limited clinical efficacy due to dose-limiting toxicities, the
   constraints of the blood brain barrier (BBB), and the suppressive
   nature of the TME. This study combines the excellent safety profile of
   AAV^[274]13 with focal delivery directly to the TME, bypassing the
   restrictions and limitations of systemic delivery. AAV biotherapy is
   minimally invasive, tunable, and enables simultaneous delivery of
   multiple anti-cancer agents that can be customized to targets unique to
   each brain tumor. This platform has further application across multiple
   metastatic tumors where the TME limits the efficacy of immunotherapy.

Methods

   The results presented here comply with all relevant ethical
   regulations. Ethical approval for the use of human tissue specimens
   were obtained through the Florida Center for Brain Tumor Research
   (FCBTR) under the University of Florida Institutional Review Board
   protocol 201300482. The patient tissues used in this study have an
   ‘Exempt Non-Human Status’ approval from the IRB as it is considered
   non-human in nature, with no identifiers.

   All animal experiments complied with local and federal animal welfare
   standards, and all protocols were independently reviewed and approved
   by the University of Florida Institutional Animal Care and Use
   Committee (IACUC).

Cell culture

   KR158B-luc (Kluc) glioma line (provided by Dr. Karlyne M. Reilly, NCI
   Rare Tumor Initiative, NIH) and GL261 cells have been verified
   histologically as high-grade glioma, and gene expression analysis
   confirmed appropriate haplotype background and expression of
   astrocytoma-associated genes^[275]80. CT-2A were purchased from
   Millipore Sigma (cat# SCC194). Primary human glioma cells including L0,
   L1, L2, CA1, CA2, CA4, CA6, CA7, L23, L26, L31, L34, L38, L47, and HA2
   were a kind gift from Dr. Brent A. Reynolds^[276]25. C8-D1A primary
   astrocytes were purchased from ATCC (cat# CRL-2541). All cells were
   cultured in DMEM (Fisher-Scientific) supplemented with 10% FBS (VWR)
   and 1% Penn-Strep (Life Technologies), and maintained at 37^oC in
   humidified conditions with 5% CO[2]. At the beginning of the study,
   cells were expanded, stocks made, and thawed vials were maintained in
   culture for no more than 3 weeks.

In vivo studies

   Female C57BL/6 J (Strain# 000664), CCR2^RFPCX3CR1^GFP (Strain# 032127),
   GREAT (Strain# 017581), and UBC-GFP (Strain# 004353) mice were
   purchased from Jackson Laboratory. Animals were maintained at the
   animal facility of the University of Florida in ventilated cages in a
   pathogen-free facility in a standard environmentally controlled room,
   with 50% humidity and 22 C temperature under a 14–10 h light-dark
   cycle. Standard water and diet were given to the mice. On day 0,
   5 x 10^4 tumor cells suspended in 50% methylcellulose and 50% saline
   (Fisher-Scientific) were stereotaxically injected into murine brain at
   a depth of 3 mm, 2 mm lateral to bregma, at a volume of 2 µl in
   8–12 week-old animals. On day 5, AAV6 vectors were intratumorally
   injected in the same coordinates as tumor implantation. For
   contralateral AAV delivery, AAV6 vectors were injected at a depth of
   3 mm, -2mm lateral to bregma. Where indicated, monoclonal antibody
   treatment (PD-1 ICB, IgG control, CD4 or CD8a depletion) was
   administered beginning Day 5 via intraperitoneal injection and given
   every 72 h. Endpoint criteria used in survival analyses are defined by
   the presentation of neurological symptoms (e.g. decreased grip
   strength, ataxia, circling, paralysis, and seizure activity),
   appearance, cranial deformity, and/or decline in body condition score
   as a result of advanced disease burden, as tumor size is not readily
   apparent in the orthotopic models utilized in this study. Defined
   limits were not exceeded. Protocols (201910827, 201907966,
   202100000029, and 202300000171) were reviewed and approved by the
   University of Florida Institutional Animal Care and Use Committee.

Clinical specimens

   De-identified patient tissues were procured by the Florida Center for
   Brain Tumor Research (FCBTR) under the University of Florida
   Institutional Review Board protocols 201300482.

Drug

   InVivoMAb anti-mouse PD-1 (cat# BE0146) and InVivoMAb rat IgG2a isotype
   control (cat# BE0089) monoclonal antibodies were purchased from
   BioXcell, diluted in Sterile Saline 0.9% solution (Patterson Veterinary
   Supply, Inc.), and administered via intraperitoneal injection at a dose
   of 10 mg/kg given every 72 h for a total of 4 doses. InVivoMAb
   anti-mouse CD8α (cat# BE0061), InVivoMAb anti-mouse CD4 (cat#
   BE0003-3), InVivoMAb rat IgG2b isotype control (cat# BE0090), InVivoMAb
   rat IgG2a isotype control (cat# BE0089) monoclonal antibodies were
   purchased from BioXcell, diluted in Sterile Saline 0.9% solution
   (Patterson Veterinary Supply, Inc.), and administered via
   intraperitoneal injection at a dose of 300 µg/mouse given every 72 h
   for a total of 6 doses.

AAV protocol

   HEK 293 T cells (ATCC cat# CRL3216) were cultured to ~ 70% confluency
   in two Cellstacks (Corning cat# 3269) per construct and transfected
   using PEI 25 k MW (Polysciences cat# 23966-1) for 3 days. The cells
   were then harvested via shaking and centrifugation until cell pellet
   was formed. The pellet was then digested with a final concentration of
   50 U/mL of Benzonase (Sigma cat# E8263) and 0.5% sodium deoxycholate in
   a lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH 8.4) for 30 min at
   37 °C. Following incubation, the supernatant was supplemented with 5 M
   NaCl until a 1 M final concentration was achieved. Afterwards, the
   supernatant was lysed via 3 freeze thaw cycles of -80 °C and 50 °C. The
   lysate was spun down and supernatant transferred to an ultracentrifuge
   tube (Beckman cat# 342414), where it is layered with discontinuous
   layers of iodixanol (Accurate Chemical cat# AN1114542) to separate out
   viral particles from the supernatant. This was spun for 1 h at 18 °C at
   350,000xg. The viral particles were isolated and removed, then washed
   four times in a dialysis column (Millipore cat# UFC910024) with PBS
   before being finally purified in a sterile filtration column (Millipore
   cat# UFC30DV00).

AAV quantification

   The viruses were titrated by quantitative PCR (Bio-Rad CFX384) using
   custom probes designed to target the ITR sequences. First, 1 uL of the
   virus was treated with DNAseI (Thermo Fisher cat# 18068015) for 15 min
   at room temperature, inactivated by heat and EDTA, protein coat of
   virus digested with Proteinase K (Thermo Fisher cat# 25530049) and
   finished with a second heat-inactivation step. Following incubations,
   the sample was diluted and mixed with a Taqman PCR Master Mix (Thermo
   Fisher cat# 4352042) and the custom designed probes (Thermo Fisher cat#
   4332078). The probe sequences were as follows: Forward
   –GGAACCCCTAGTGATGGAGTT, Reverse –CGGCCTCAGTGAGCGA, Probe
   –CACTCCCTCTCTGCGCGCTCG. The samples were then compared to a standard
   curve consisting of a linearized plasmid with ITRs from a range of
   1e4–1e8 genomic copies per mL. The samples were then run on a standard
   program of 10 min denature at 95^oC, then cycled 39 times at 95 °C at
   1 min and 60 °C at 30 s.

Lentiviral transduction of tumor cells

   RFP labeled GL261 and KR158 tumor cells were transduced with a
   LentiBrite RFP Control Lentiviral Biosensor (Millipore-Sigma, cat#
   17-10409), MOI 50. Following cell expansion, RFP-positive cells were
   FACS sorted using a BD FACSAria-II cell sorter, yielding RFP-stable
   tumor cells. GFP labeled GL261 tumor cells were produced in the same
   manner using LentiBrite GFP Control Biosensor (Millipore-Sigma, cat #
   17-10387).

Proteome arrays

   Following resection, the right hemisphere (cerebellum removed) of
   murine brain (tumor-containing) were transferred to 1.5 mL microtubes,
   snap frozen in LN2, and stored at -80^oC until lysis. De-identified
   flash frozen patient GBM tissue was procured from the FCBTR. Tissue
   shavings were collected on dry ice and transferred to 1.5 mL
   microtubes. 300–500 µl PBS containing 1 x Halt^TM Protease/Phosphatase
   inhibitor (Thermo Fisher) and 1% Triton X-100 (Sigma) was added to
   samples and transferred to wet ice. Tissue was lysed manually using a
   20-gauge needle attached to a 1 mL syringe followed by vortexing every
   5 min for 30–60 min. Supernatant was collected following centrifugation
   at 10,000 x g at 4 °C, and assayed for protein concentration using a
   NanoDrop Spectrophotometer. 0.75 mg of each human sample was used for
   the Human Chemokine Array Profiler (R&D Systems, ARY017), and 1 mg of
   each murine sample was used for the Mouse XL Cytokine Array (R&D
   Systems, ARY028) following manufacturer’s instruction. Images were
   captured using BioRad ChemiDoc MP Imaging System with ImageLab 6.1
   software over a series of exposure times. Mean voxel intensity per
   capture antibody was calculated using Imaris x64 v9.7.0, and protein
   signal was normalized against internal reference controls. Detected
   protein and predicted receptor interactions were analyzed and
   visualized using Circos®^[277]65.

ELISA

   Tissue specimens were collected at 1 and 2 weeks post-AAV6 injection.
   Peripheral blood was taken from the anterior vena cava, centrifuged at
   10,000 x g x 10 min @ RT, and serum collected and stored at -80C. Whole
   brain was resected, cerebellum removed, and divided into the
   tumor-bearing (AAV6 injected) and contralateral hemispheres. Naive
   brain and serum were collected and used to set the baseline for both
   week 1 and week 2 datasets. Tissue was snap frozen and stored at -80 °C
   until lysis. Tissue was lysed using RIPA buffer containing 2x Halt
   protease/phosphatase inhibitor cocktail (Thermo Fisher) with manual
   dissociation performed using a 20-gauge needle attached to a 1 mL
   syringe followed by vortexing every 5 min for 30–60 min, and maintained
   on ice. Following lysis, tissue samples were centrifuged at 12,000xg @
   4 °C x 10 min. Supernatant was collected, and assayed for protein
   concentration using a NanoDrop. Protein concentrations were adjusted
   using RIPA buffer. MIG/CXCL9 ELISA (Thermo Fisher) performed according
   to manufacturer protocol. Serum diluted 1:2 using Assay Diluent B.
   Tissue sample concentration: 2 mg. All samples run in duplicate. ELISA
   detection of CXCL9 in competitive co-culture assays were performed on
   undiluted media collected from respective cell chambers prior to
   co-culture.

Cell proliferation assay

   Cells were seeded at 2 x 10^4 cells per well in 24 well plates in
   complete media (day 0). On days 1, 3, and 5 cells were detached from
   the plate using 0.25% trypsin (Gibco), and counted using a ViCELL
   Analyzer (Beckman Coulter).

3D tissue clearing and immunolabeling

   Brain tissue was collected after cardiac perfusion with cold saline
   followed by PBS supplemented with 4% acrylamide (Sigma-Aldrich), 0.05%
   N,N’-methylenebisacrylamide (Sigma-Aldrich), 4% paraformaldehyde and
   0.25% VA-044 (TCI America). Tissues were stored at 4 °C for 3 days to
   allow hydrogel permeation of tissues. Following hydrogel polymerization
   at 37^oC x 3 h, whole brain was sectioned to 2 mm and passively cleared
   over 3–7 days with PBS containing 200 mM boric acid (Sigma-Aldrich) and
   4% sodium-dodecyl-sulfate (Fisher-Scientific), pH 8.5 at 50^oC. After
   clearing, samples were washed in PBS with 0.1% Triton X-100 for 2 days,
   and immunostained at 4 °C for 2 days with the following antibodies and
   stains: GFAP (Thermo Fisher, cat# PA1-10004, 1:50 dilution), CD45
   (Thermo Fisher, cat# 14-0451-82, 1:50 dilution), anti-chicken Alexa
   Fluor^TM 647 antibody (Thermo Fisher, cat# A-21449, 1:200 dilution),
   anti-rat Alexa Fluor^TM 568 (Thermo Fisher, cat# A-11077, 1:200
   dilution), and either DAPI (Sigma-Aldrich) or DRAQ5 (Thermo Fisher)
   nuclear dye. Samples were whole-mounted onto slides using 62%
   2,2’-Thiodiethanol (Sigma-Aldrich). Images were acquired using a Nikon
   A1RMP confocal microscope and analyzed using Imaris x64 v9.7.0
   software. Detection of lymphocyte infiltration was performed as
   follows: CD3+ lymphocytes were isolated from naïve donor UBC-GFP
   spleens using the MojoSort^TM mouse CD3 T cell Isolation Kit
   (Biolegend, cat# 480024). These were adoptively transferred
   (1 x 10^6/mouse) into sham control or combination AAV6-CXCL9 plus
   anti-PD-1 ICB treated mice harboring GL261 tumors on study day 11 via
   intravenous tail vein injection. Brain tissue was resected on study day
   15, and prepared using the method described above. Whole brain 3D
   tissue clearing, immunolabeling, and light-sheet imaging was performed
   by LifeCanvas Technologies.

Tissue dissociation and flow cytometry

   Brain tissue was digested using the Multi-tissue Dissociation Kit
   (Miltenyi Biotec) on a gentleMACS^TM Octo Dissociator with heat,
   followed by sample clean-up using Debris Removal Solution (Miltenyi
   Biotec) according to manufacturer’s protocol. Tumor-infiltrating
   leukocytes were isolated using CD45 microbeads (Miltenyi Biotec)
   filtered through LS columns (Miltenyi Biotec) on a QuadroMACS Separator
   (Miltenyi Biotec) according to manufacturer’s protocol. Blood samples
   were collected from the anterior vena cava, and RBC lysis performed
   using Pharm Lyse solution (BD Biosciences) per manufacturer’s protocol.
   Samples were washed 2x with cold PBS. Unstained cells were reserved for
   unlabeled and FC controls, and dead cells were labeled with Zombie
   NIR^TM Fixable Viability Kit (Biolegend) according to manufacturer’s
   protocol. Cells were washed 2x in PBS containing 0.5% BSA (Sigma) and
   2 mM EDTA (Thermo Fisher) FC buffer and blocked for 10 min on ice using
   TruStain FcX (Biolegend) prior to cell surface antigen labeling with
   the following antibodies: CD45-APC (Biolegend, cat# 103112, 0.20 µg per
   10 ^ 6 cells), CD3-FITC (Biolegend, cat# 100204, 1.0 µg per 10 ^ 6
   cells), CD4-PE (Biolegend, cat# 100408, 0.20 µg per 10 ^ 6 cells),
   CD8-BV421 (Biolegend, cat# 100738, 0.50 µg per 10 ^ 6 cells) for 45 min
   on ice. For astrocyte detection, cells were fixed and permeabilized
   using True-Nuclear^TM Transcription Factor Buffer Set (Biolegend)
   following manufacturer’s protocol following debris removal step, with
   no CD45 microbead isolation. Samples were labeled with Zombie NIR^TM
   Fixable Viability Kit (Biolegend), blocked with TruStain FcX
   (Biolegend), and immunolabeled with GFAP-APC (Thermo Fisher, cat#
   51-9792-82, 0.50 µg per 10 ^ 6 cells). Following immunolabeling, all
   samples were washed 2x with FC buffer and analyzed using a BD
   FACSymphony A3 flow cytometer.

In vitro chemotaxis

   GL261 or C8-D1A cells were plated in 24-well dishes at 1 x 10^5/well in
   pre-warmed complete media. AAV6-EGFP or AAV6-CXCL9 (RFP + ) was added
   at a final concentration of 10^5 VGS. Twenty-four hours following
   transduction, cells were transferred into the outer chambers of
   µ-Dishes with 3-well culture inserts (Ibidi), 10^4, suspended in 15 µl
   of growth-factor reduced Matrigel® (Corning). 40 µl of complete media
   was added following polymerization for 10 min at 37°C in humidified
   conditions with 5% CO[2]. CD3 + T cells were isolated from naïve
   C57BL/6 mouse spleen (8–12 weeks) using MojoSort CD3 T cell isolation
   kit (Biolegend) per manufacturer’s protocol. T cells were labeled with
   Cell Trace Violet dye (CTV) (Thermo Fisher) per manufacturer protocol.
   1 x 10^4 labeled T cells were suspended in 15 µl cold growth-factor
   reduced Matrigel® (Corning), and added to the µ-Dish center well.
   Following polymerization as described above, media was removed from all
   wells, and 3-well insert was carefully removed. The gap between wells
   was filled with additional Matrigel to form a continuous substrate, and
   allowed to polymerize for 20 min. Complete media was added to cover
   cells, and incubated at 37^oC in humidified conditions with 5% CO[2].
   IF images were acquired using a Nikon A1RMP confocal microscope at
   indicated time points (1- and 24 h) following co-culture, and T cell
   chemotaxis was quantified as the number of migratory cells (CTV + )
   visible in either the EGFP or CXCL9 (RFP + ) transduced tumor/astrocyte
   field.

Single cell RNA sequencing, quality control, NanoString and data analysis

   Following whole brain resection, cerebellar tissue was removed and the
   right hemisphere collected for processing. Tissue dissociation and CD45
   TIL isolation was performed as described under Tissue Dissociation
   above. The cells directly after isolation were washed with PBS and
   0.04% bovine serum albumin two times and filtered with 40-µm cell
   strainer. Cells were collected by centrifugation at 500xg for 5 min and
   subsequently counted with hemocytometer. Cells were diluted in ice-cold
   PBS containing 0.04% BSA at a density of 1000 cells/µL. The final cell
   suspension volume equivalent to 8000 target cells was used for further
   processing. Cells were loaded into a Chromium NextGEM Chip G (10x
   Genomics, Pleasanton, California) and processed in Chromium X following
   the manufacturer’s instructions. Preparation of gel beads in emulsion
   and libraries were performed with Chromium Next GEM Single Cell 3’ Kit
   v.3.1 (Dual Index) according to User Guide provided by the
   manufacturer. Libraries quality and quantity were verified with 2200
   TapeStation (Agilent technologies, USA). Libraries were pooled based on
   their molar concentrations. Pooled library was sequencing on the
   NovaSeq 6000 instrument (Illumina, San Diego, California). For
   sequencing 3’ gene expression libraries we used following read length:
   Read 1–28 cycles; i7Index-10 cycles; i5Index-10 cycles; Read 2–90
   cycles. Raw base call (BCL) files generated by NovaSeq 6000 sequencer
   were processed using Cell Ranger software (10X Genomics, version 7) for
   demultiplexing, barcode processing, and single-cell 3’-gene counting.
   Mouse genome reference GRCm38 was used for sequence alignment using
   STAR aligner. A read was considered exonic, if at least 50% of it
   mapped to an exon, intronic (if it was non-exonic and intersected an
   intron), or intergenic otherwise. For reads that aligned to a single
   exonic locus but also aligned to 1 or more non-exonic loci, the exonic
   locus was prioritized and the read was considered to be confidently
   mapped to the exonic locus. Cell Ranger also aligned exonic reads to
   annotated transcripts. An annotated transcript that aligned to the same
   strand was considered to be confidently mapped to the transcriptome.
   These confidently mapped reads were used for unique molecular
   identifier (UMI) counting and subsequent analysis to generate h5 files.
   The h5 file of each sample was then processed with Partek Flow analysis
   software (version 10). Cells meeting the following quality control (QC)
   parameters were included in the analysis: total reads between
   1000–33,649; expressed genes between 187–5464; mitochondrial reads
   percentage < 20%. Following this selection, we obtained 48159 cells
   that passed QC filters. Next, features were filtered in order to
   include only genes expressed in >0.01% of cells and 20,785 genes were
   retained. UMI counts were then normalized following Partek® Flow®
   recommendations: for each UMI in each sample the number of raw reads
   was divided by the number of total mapped reads in that sample and
   multiplied by 1,000,000, obtaining a count per million value (CPM), the
   normalized expression value was log-transformed. Starting from the
   normalized data node, we performed clustering analysis for each sample
   separately by means of graph-based clustering task in Partek® Flow®
   software which employs the Louvain algorithm. Clustering analysis was
   done based on the first 100 principal components. To visualize single
   cells in a two-dimensional space, we applied Uniform Manifold
   Approximation and Projection (UMAP) plot using the first 50 principal
   components for each sample separately and for the entire data set. Cell
   types were determined by the expression of marker genes that define
   specific cell types (Supplemental table [278]1). Pathway enrichment
   analysis for tumor cells and immune cells was performed with AUCell
   algorithm using the NanoString nCounter Immune Exhaustion panel.
   Interactions between immune populations were analyzed and visualized
   using the CellChat algorithm^[279]38. The pheatmap package was used for
   unsupervised hierarchical clustering to create heatmaps^[280]81.
   Clustering of T cell sub-populations was performed by taking predefined
   “CD8 T cells,” “CD4 T cells,” and “Treg cells” and assembling them into
   a Seurat object. Principal Component Analysis (PCA) and the UMAP
   algorithm were then employed. Cell types were determined based on
   previously defined differentially expressed genes within each
   cluster^[281]82. The Seurat feature plot function was utilized to
   examine the expression of the Cxcr3 gene. The scRNAseq data files
   generated in this study have been deposited in the open-access Genome
   Sequence Archive database under the accession code PRJCA022912.

Statistical analysis

   Statistical analyses performed using GraphPad Prism 9 as described in
   figure legends. Significance determined as p < 0.05. Voxel-based
   co-localization was established using Imaris x64 v9.7.0 using the Coloc
   module with automatic threshold selection. For survival studies,
   animals were randomized prior to treatment.

Reporting summary

   Further information on research design is available in the [282]Nature
   Portfolio Reporting Summary linked to this article.

Supplementary information

   [283]Supplementary Information^ (2.1MB, pdf)
   [284]Peer Review File^ (600.9KB, pdf)
   [285]Reporting Summary^ (1.2MB, pdf)

Source data

   [286]Source Data^ (2MB, xlsx)

Acknowledgements