Abstract

   To investigate the different mechanisms of Penaeus monodon in response
   to acute and chronic hypotonic stress, RNA sequencing technology was
   employed to profile the gene expression patterns in the gill,
   hepatopancreas, and hemocyte at 0, 6, 48, and 72 h post acute hypotonic
   stress treatment (with salinity immediately decreased from 20 psu to
   4 psu) and at 0, 2, 10, 15 days during chronic hypotonic stress
   treatment (with salinity gradually decreased from 20 psu to 4 psu). The
   control group (SC) was maintained at a constant salinity of 20 psu.
   Differentially expressed genes (DEGs) were identified, followed by
   further validation using real-time quantitative reverse transcription
   PCR (RT-qPCR). A total of 34,217 genes were expressed through
   sequencing. Compared with the control group, 8,503 DEGs were identified
   in the acute hypotonic stress group, comprising 3,266 up-regulated and
   5,237 down-regulated genes. In the chronic hypotonic stress group,
   8,900 DEGs were detected, including 3,019 up-regulated and 5,881
   down-regulated genes. Gene Ontology (GO) functional annotation analysis
   indicated that DEGs were primarily enriched in biological processes
   such as cellular and metabolic processes, cellular components like
   membrane and other cellular components, and molecular functions
   including structural binding and catalytic activity. Kyoto Encyclopedia
   of Genes and Genomes (KEGG) pathway enrichment analysis indicated that
   DEGs were predominantly concentrated in five major pathways:
   metabolism, genetic information processing, environmental information
   processing, cellular processes, and biological systems. These pathways
   encompassed antigen processing and presentation, the NOD-like receptor
   signaling pathway, the Toll-like receptor signaling and cell apoptosis.
   The RT-qPCR validation of 11 DEGs (hsp70, hsp90, nlrp3, mincle, nlrp12,
   tlr4, myd88, imd, casp7, casp9 and toll) demonstrated that the trends
   observed in the quantitative results were consistent with those from
   the transcriptome analysis, thereby validating the reliability of
   transcriptome sequencing data. This study identified that hypotonic
   stress triggers physiological responses in P. monodon to both acute and
   chronic hypotonic conditions, offering valuable insights into the
   expression patterns of functional genes in the gills, hepatopancreas,
   and hemocytes of P. monodon under such stress. These findings provide
   foundational data and a theoretical basis for further research into the
   regulatory mechanism of P. monodon in response to hypotonic stress.

   Keywords: Penaeus monodon, hypotonic stress, transcriptome sequencing,
   bioinformatics analysis, differential gene expression

Introduction

   Penaeus monodon offers numerous advantages, such as economic benefits,
   growth characteristics, and nutritional value, making it an
   increasingly important species in aquaculture. Salinity is a crucial
   environmental factor affecting the cultivation of economically
   significant aquatic species. It can impact various aspects of marine
   crustaceans, including growth and survival ([43]1), physiological
   activities and nutritional requirements ([44]2), energy metabolism
   ([45]3), and immunity ([46]4). As a euryhaline species, P. monodon can
   survive across a wide salinity range, from 5 psu to 33 psu. Recent
   studies have demonstrated that under acute salinity stress, Litopenaeus
   vannamei can regulate osmotic ions through hyperglycemia ([47]5).
   Furthermore, salinity stress has been shown to increase mortality in L.
   vannamei infected with white spot syndrome virus (WSSV), with the risk
   of infection escalating as salinity decreases from 35 psu to 10 psu
   ([48]6). Similar findings have also been observed in Fenneropenaeus
   indicus ([49]7). Liu et al. ([50]8) revealed that under acute salinity
   stress, dopamine and 5-hydroxytryptamine can regulate free amino acids
   production, Na^+/K^+ pump activity, and the osmotic pressure regulation
   by glutamate dehydrogenase. Moreover, glutamate dehydrogenase can
   enhance the metabolism of free amino acids, particularly in the
   synthesis of arginine, proline and alanine. Studies on the immune
   activity and pathogenicity of Vibrio harveyi in P. monodon under acute
   hypotonic stress have shown that salinity affects the immune capacity
   and metabolic performance of P. monodon, increasing its susceptibility
   to viruses and enhancing the pathogenicity of viruses towards P.
   monodon ([51]9). The immune capacity of P. monodon is reduced under
   both hypotonic and hypertonic conditions ([52]9). Shekhar et al.
   ([53]10, [54]11) studied the differential gene expression under chronic
   salinity stress in hypotonic and hypertonic conditions, concluding that
   these genes are involved in the regulatory mechanisms of adaptation to
   hypotonic stress.

   Transcriptome sequencing technology is a molecular biology technique
   used to examine gene expression profiles in biological specimens. In
   recent years, transcriptome analysis has become a key tool for
   identifying differences in gene expression levels in various shrimp
   species under environmental stress. Notable examples include L.
   vannamei ([55]12), Palaemon gravieri ([56]13), and Fenneropenaeus
   chinensis ([57]14). Qiao et al. ([58]4) demonstrated that the addition
   of β-glucan can improve total antioxidant capacity (T-AOC), superoxide
   dismutase (SOD), and catalase (CAT) activities, thereby enhancing the
   antioxidant capacity of L. vannamei and reducing the damage caused by
   hypotonic stress. Farhadi et al. ([59]15) reported the significant
   expression of various DEGs in L. vannamei under multiple stressors,
   including low salinity, nitrite exposure, low pH, and high pH. These
   DEGs include C-type lectin 2, anti-lipopolysaccharide factor 1 (alf1),
   acyl-coenzyme A oxidase 1-like (acx1), liver lectin-like, and hemolymph
   coagulation protein-like (cp).

   Currently, research on the effects of salinity on P. monodon is
   primarily focused on salinity-related genes ([60]16, [61]17) and acute
   immune responses ([62]18). However, the specific effects of acute and
   chronic hypotonic stress on the physiological changes and gene
   expression in P. monodon remain largely unexplored. Therefore, this
   study aims to perform a transcriptome analysis of acute and chronic
   hypotonic stress in P. monodon. Such research is of great significance
   for disease prevention and the advancement of aquaculture technology.

Materials and methods

Experimental animals

   The shrimps used in this experiment were provided by an aquaculture
   seedling farm in Zhangzhou, Fujian Province, with an average body
   length of 6.16 ± 1.12 cm and an average body weight of 4.56 ± 0.57 g,
   all healthy. Before the experiment, they were temporarily housed in a
   breeding barrel with a water temperature of 28.50 ± 2.0°C and salinity
   at 20 ± 1.0 psu. They were fed daily, with a water exchange of
   one-third of the volume with seawater every 3 days, and this
   acclimation feeding lasted for 5 days.

Preliminary experiment

   The shrimps were initially acclimated at a salinity of 20 psu for
   5 days, followed by a gradual reduction of salinity to 15 psu, 10 psu,
   7 psu, 5 psu, and 4 psu every 2 days. Samples were collected, and the
   mortality rates were recorded. As reported in the literature
   ([63]19–21), glut, nka, and ca were identified as genes related to
   osmoregulation, and gapdh was employed as an internal control to
   evaluate the expression changes of these osmoregulation-related genes
   under hypotonic stress. The primers used for the tests are listed in
   [64]Table 1.

Table 1.

   Primer sequences.
   Gene name Sequence (5′ to 3′)
   ca        F: TCCCAGGAACAACTGGATGC
             R: AGAGAGGACATGGTGGCCTA
   glut      F: CAAGGTGCCAGAGACCAAGAA
             R: ATCTGGCCCTACTTCCGTGT
   nka       F: CCTGCCATTTCCCTTGCCTA
             R: AGCTTGTCGGTGAATGGGTT
   gapdh     F: CGAGATGAAGCCCGAGAACA
             R: GCCTTCTCGATGGTGGTGAA
   [65]Open in a new tab

Hypotonic stress experiments

   The hypotonic stress experiment was conducted in two phases: acute and
   chronic hypotonic conditions. For the acute hypotonic experiment
   (Experiment J), seawater at 4 psu salinity was prepared, and 30 shrimps
   that had been pre-fed for 5 days were placed in each of the three
   buckets. The control group received an adequate amount of seawater at
   20 psu salinity, with 30 shrimps (acclimated for 5 days) in each
   bucket. Samples were taken from three shrimps in each group at 6 h,
   48 h, and 72 h, with gill, hepatopancreas, and hemocyte samples
   collected, using 20 psu salinity and the 0-h time point as control
   references throughout the experiment. In the chronic hypotonic