Abstract

   Bladder cancer (BC) ranks as the sixth cancer in males and the ninth
   most common cancer worldwide. Conventional treatment modalities,
   including surgery, radiation, chemotherapy, and immunotherapy, have
   limited efficacy in certain advanced instances. The involvement of
   GALNT6-mediated aberrant O-glycosylation modification in several
   malignancies and immune evasion is a subject of speculation. However,
   its significance in BC has not been investigated. Through the
   integration of bioinformatics analysis and laboratory experimentation,
   we have successfully clarified the role of GALNT6 in BC. Our
   investigation revealed that GALNT6 has significant expression in BC,
   and its high expression level correlates with advanced stage and high
   grade, leading to poor overall survival. Moreover, both in vitro and in
   vivo experiments demonstrate a strong correlation between elevated
   levels of GALNT6 and tumor growth, migration, and invasion.
   Furthermore, there is a negative correlation between elevated GALNT6
   levels, the extent of CD8^+ T cell infiltration in the tumor
   microenvironment, and the prognosis of patients. Functional experiments
   have shown that the increased expression of GALNT6 could enhance the
   malignant characteristics of cancer cells by activating the
   epithelial-mesenchymal transition (EMT) pathway. In brief, this study
   examined the impact of GALNT6-mediated abnormal O-glycosylation on the
   occurrence and progression of bladder cancer and its influence on
   immune evasion. It also explored the possible molecular mechanism
   underlying the interaction between tumor cells and immune cells, as
   well as the bidirectional signaling involved. These findings offer a
   novel theoretical foundation rooted in glycobiology for the clinical
   application of immunotherapy in BC.

Supplementary Information

   The online version contains supplementary material available at
   10.1186/s12935-024-03492-1.

   Keywords: GALNT6, O-glycosylation, Epithelial-mesenchymal transition,
   Tumor immune escape, Bladder cancer

Introduction

   Bladder cancer (BC) is a malignant tumor that develops in the
   epithelial tissue of the bladder mucosa. According to the latest global
   cancer statistics, BC has the sixth highest incidence rate among male
   malignancies [[46]1], and it ranks as the ninth most common disease
   worldwide. Men have a greater incidence rate and fatality rate compared
   to women globally. BC is one of the most deadly types of cancer around
   the world, and bladder urothelial carcinoma (BLCA) makes up 90% of all
   occurrences of BC [[47]2, [48]3]. Transurethral resection of BC and
   radical total cystectomy have emerged as significant surgical
   techniques for managing BC [[49]4]. However, despite these
   advancements, many individuals remain susceptible to post-surgical
   recurrence and distant metastases. Therefore, understanding the causes
   and mechanisms that lead to the malignant advancement of BLCA is
   extremely important in developing more effective treatment strategies.

   Glycosylation represents the most prevalent post-translational
   modification in proteins, which enhances their structural and
   functional diversity [[50]5, [51]6]. This process can be classified
   into four main types based on the core regions where glycans bind to
   proteins: N-glycans, O-glycans, glycosaminoglycans, and
   glycosphingolipids [[52]7, [53]8]. Among these, O-glycosylation is
   notably prevalent in animals, involving the attachment of glycans
   through O-linked N-acetylgalactosamine (GalNAc) to serine and threonine
   residues [[54]9]. In oncology, abnormal expressions of Tn
   (GalNAcα1-Ser/Thr), T (Galβ1-3GalNAcα1-Ser/Thr), and s-Tn
   (Neu5Acα2,6GalNAcα1-Ser/Thr) antigens, commonly observed in various
   cancers, are utilized as biomarkers for cancer detection [[55]10].
   Additionally, aberrant O-GlcNAcylation is linked with a spectrum of
   diseases, including neurodegenerative disorders, diabetes, and cancer
   [[56]11]. Specifically, the sTn antigen, which often correlates with
   the early stages of tumorigenesis, is highly expressed in several
   cancers, including bladder, ovarian, colon, lung, gastric, and prostate
   [[57]12, [58]13]. The process of O-Glycosylation, which is regulated by
   a large family of enzymes known as UDP-GalNAc: polypeptide
   GalNAc-transferase (GALNT), has different roles in tumors [[59]9].
   Research has demonstrated that members of the GALNT family are
   implicated in the onset and progression of various cancers, with their
   roles potentially tied to the modifications they induce in protein
   structures through O-glycosylation [[60]14]. For instance, elevated
   expression of GALNT1 in hepatocellular carcinoma (HCC) has been linked
   to enhanced tumor migration and invasion, facilitated by increased
   O-glycan modifications on the epidermal growth factor receptor (EGFR)
   [[61]15]. Conversely, reduced levels of GALNT2 have been associated
   with increased proliferation, migration, invasion, and metastasis in
   gastric adenocarcinoma [[62]16]. Additionally, GALNT3 has been
   identified as an independent prognostic marker for high-grade tumors
   and adverse outcomes in renal cell carcinoma (RCC) [[63]17]. GALNT6,
   encoded by the GALNT6 gene and predominantly located in the Golgi
   apparatus, has been identified as a pro-tumorigenic factor in various
   human cancers [[64]17–[65]20]. However, in the context of
   gastrointestinal cancer, some studies suggest that GALNT6 may function
   as a tumor suppressor [[66]21–[67]23]. Despite these findings, the
   precise molecular mechanisms underlying the role of GALNT6 in the
   pathogenesis and progression of bladder cancer remain elusive.

   Epithelial-mesenchymal transition (EMT) is a critical cellular process
   where epithelial cells transform into mesenchymal phenotype. This
   process plays a pivotal role in developmental biology and wound healing
   [[68]24, [69]25]. Initially identified during embryonic development,
   EMT has since been recognized in various pathological states [[70]26].
   Recent research has demonstrated that GALNT6, a specific enzyme within
   the UDP-GalNAc: polypeptide GalNAc-transferase family, facilitates the
   progression of EMT in several cancers, including breast, prostate, and
   lung adenocarcinoma [[71]18, [72]27, [73]28]. Furthermore, in
   pancreatic cancer, GALNT6 has been shown to promote EMT by the
   glycosylation and stabilization of the mucin MUC4 [[74]29]. Similarly,
   EMT is enhanced in lung adenocarcinoma through the O-glycosylation and
   stabilization of the protein GPR78 [[75]18]. The present study extends
   these findings by demonstrating that GALNT6 also augments tumor
   migration and invasion capabilities in bladder cancer, thereby
   enhancing the EMT process. This suggests a broader, possibly conserved
   role of GALNT6 in promoting EMT across different tumor types,
   highlighting its potential as a target for therapeutic intervention in
   oncology.

   Tumor immune escape is a critical survival strategy employed by tumors,
   involving the development of multiple immunosuppressive mechanisms to
   counteract the host’s immune response [[76]30]. Glycosylation,
   particularly of tumor antigens, plays a significant role in
   facilitating tumor immune escape. Studies have shown that various
   glycoforms, such as Tn antigens, Lewis antigens, and lectins binding
   sialic acids or galactoses, are prevalent in the tumor
   microenvironment. For example, enhanced sialylation of tumor cells
   leads to the increased expression of ligands for lectin receptors, many
   of which perform immunosuppressive functions. Specifically, the
   sialylated Tn antigen (sTn) is widely expressed in various cancers and
   is associated with the induction of immune tolerance [[77]31]. Thus,
   tumor antigens’ glycosylation patterns critically influence
   tumor-infiltrating immune cells’ behavior, contributing to the
   establishment and maintenance of immunosuppressive circuits within
   tumors. This underscores the complex interplay between tumor
   glycosylation and immune evasion, highlighting potential targets for
   therapeutic intervention to enhance anti-tumor immunity.

   In this study, we investigated the association of GALNT6 with clinical
   outcomes in BC patients. Our findings indicate a positive correlation
   between GALNT6 expression and both the pathological grade and stage of
   BC, suggesting that GALNT6 expression is linked to poor prognosis.
   Experimentally, we demonstrated that overexpression of GALNT6
   significantly enhanced migration and invasion in J82 human BC cells.
   Conversely, silencing GALNT6 markedly inhibited proliferation,
   migration, and invasion in 5637 and T24 BC cell lines. Further analysis
   revealed that GALNT6 influences the development and progression of BC
   through the EMT signaling pathway. Additionally, using bioinformatics
   analysis and immunohistochemical experiments, we found that the level
   of GALNT6 expression in BC tissues was inversely correlated with CD8^+
   T cell infiltration. It also showed a correlation with the expression
   of multiple immune checkpoint molecules. Therefore, GALNT6 could
   potentially function as an innovative therapeutic target, contribute
   significantly to developing immunotherapeutic strategies, and serve as
   a prognostic biomarker for BC.

Materials and methods

Online database analysis

   The GALNT6 mRNA expression profile in pan-carcinoma was investigated
   using the online TIMER database ([78]http://timer.cistrome.org/)
   [[79]32]. Prognostic and clinical features analysis used UALCAN online
   databases ([80]https://ualcan.path.uab.edu/). The RNAseq data was
   obtained from The Cancer Genome Atlas (TCGA:
   [81]https://cancergenome.nih.gov/) with a total of 433 samples,
   including 19 normal and 414 bladder urothelial carcinoma samples. TCGA
   combined with GTEx analysis of differentially expressed genes used Gene
   Expression Profiling Interactive Analysis database (GEPIA:
   [82]http://gepia.cancer-pku.cn/). To explore the correlation between
   GALNT6 and immune cell infiltration, we used the integrated repository
   portal for tumor-immune system interactions online analysis database
   TISIDB ([83]http://cis.hku.hk/TISIDB/). The Cancer Immunome Atlas
   (TCIA: [84]https://tcia.at/home) was used to analyze the correlation of
   GALNT6 expression and IPS of CTLA4 and PD-1. The “edgeR” package in R
   software was utilized to identify the differentially expressed mRNAs of
   glycosyltransferases in bladder cancer compared to normal bladder
   tissues. The significative threshold parameters were set as follows:
   FDR < 0.05 and |log[2]Fold Change|>1. A total of 214
   glycosyltransferase genes were obtained from HGNC
   ([85]https://www.genenames.org/).

Enrichment analysis of genes co-expressed with GALNT6

   Zhengcun Wu et al. [[86]33] previously described the process of
   enrichment analysis for these genes, so we downloaded the [87]GSE3167
   data set including 51 cases of tumor samples from the Gene Expression
   Omnibus database (GEO: [88]http://www.ncbi.nlm.nih.gov/geo/) and
   divided it into two groups based on the GALNT6 expression level (median
   value) for subsequent functional and pathway enrichment analysis. GSEA
   and KEGG were used to analyze the differentially expressed gene
   enrichment signaling. Ingenuity Pathway Analysis (IPA) was used to
   generate a gene-co-expressed network.

Clinical patient tissue samples and cell culture

   Human BC tissue and paracancerous tissue were collected from 40
   patients who underwent surgical resection in the First Affiliated
   Hospital of Dalian Medical University (Dalian, China) from January 2016
   to December 2018. Two urology professional pathologists confirmed the
   tumor grading of these tissues. This study was conducted with the
   informed consent of all patients and approval from the Medical Ethics
   Committee of the First Affiliated Hospital of Dalian Medical University
   (LCKY2015-08).

   SV-HUC-1 normal bladder epithelial cell, RT4, SCaBER, 5637, T24, J82,
   and UMUC3 BC cell lines were obtained from The Cell Bank of Type
   Culture Collection of the Chinese Academy of Sciences. All cell culture
   media contain 10% fetal bovine serum and 1% penicillin/streptomycin and
   are incubated at a CO[2] concentration of 5% at 37℃. All cell lines
   used in this study were identified by STR.

Generation of GALNT6-overexpression cell line and ShGALNT6-mediated genome
editing

   To establish a GALNT6-overexpressing J82 cell line, a vector containing
   a sequence targeting the human GALNT6 gene,
   pLenti-GII-CMVCBH-GFP-2 A-Puro (Amp), was constructed. Following
   confirmation of the insert sequences via DNA sequencing, lentiviral
   particles were used to transfect J82 cells. Forty-eight hours
   post-transfection, cells expressing the transgene were selected with
   puromycin (5 µg/ml) for seven days. Subsequently, single cells were
   isolated using a limited dilution method in a 96-well plate.

   Conversely, GALNT6 expression was knocked out in T24 and 5637 cell
   lines using short hairpin RNA (shRNA) mediated gene editing. For this
   purpose, a vector pCDH-U6-shRNA-EF1-Puro containing a GALNT6-specific
   shRNA sequence was introduced into these cells via nucleofection.
   Following transfection, cells successfully incorporating the shRNA were
   selected with puromycin (2 µg/ml) for seven days. Single-cell isolation
   was again performed using the limited dilution technique in 96-well
   plates. The resultant cell clones were expanded, and their knockdown
   efficiency was assessed using RT-qPCR and Western blotting analysis.

Immunohistochemistry

   Immunohistochemistry (IHC) was performed as described by Xiaorong Ding
   et al. [[89]34]. The primary antibodies used in IHC are described as
   follows: GALNT6 (1:250, abcam, ab151329), CD8 (MXB Biotechnologies,
   RMA-0514), CD83 (1:200, ABclonal, A2040), CD68 (1:100, ABclonal,
   A13286), CD56 (1:10000, Proteintech, 14255-1-AP), CD4 (1:100, ABclonal,
   A19018), PD-L1(1:10000, Proteintech, 66248-1). Tissue samples were
   fixed overnight in 4% paraformaldehyde to obtain paraffin-embedded
   sections. The sections were deparaffinized using xylene and rehydrated
   using gradient alcohol. Antigen retrieval was performed using citrate
   buffer, followed by the application of a 3% endogenous catalase blocker
   to eliminate endogenous peroxidase activity. The next day, it was
   incubated with the biotinylated secondary antibody at 37℃, washed with
   PBS, incubated with HRP conjugated streptavidin, and finally treated
   with DAB, stained with hematoxylin and dehydrated with gradient alcohol
   and observed under the microscope. Three pathologists evaluated GALNT6
   staining in paraffin sections by integrating cell percentage, staining
   intensity, and immunoreactivity score (IRS) according to the TMAs IHC
   assessment technique.

Immunocytochemistry

   Immunocytochemistry (ICC) was performed on the coverslips obtained from
   each of the experimental groups. The primary antibodies used in ICC is
   PD-L1 (1:10000, Proteintech, 66248-1) according to the manufacturer’s
   instruction. Briefly, the coverslips were washed with
   phosphate-buffered solution (PBS, pH 7.4), incubated for 10 min in 3%
   H[2]O[2] and then with the appropriately diluted first antibody at
   37 °C for 60 min in a humid chamber, followed by the treatments with
   reagent A containing polymer enhancer for 20 min and with reagent B
   containing polymerized horseradish peroxidase (HRP) anti-mouse/rabbit
   IgG for 30 min (Zymed Lab, Inc, San Francisco, CA). Color reaction was
   developed using 3,3′-diaminobenzidine tetrahydrochloride.

Xenograft tumor model

   At the end of the experiment, following euthanasia, the tumors were
   excised and photographed. All animal experiments were approved by the
   Animal Care&Welfare Committee of Dalian Medical University (Number:
   [90]AEE22047).Animals were maintained under constant temperature
   (23–25℃) and humidity (45–65%) with controlled light/dark cycles
   (12 h/12 h). Nude mice aged 5 weeks with thymus removed were obtained
   from the Animal Experimental Center of Dalian Medical University and
   randomly divided into T24 and sh1-GALNT6-T24 groups, with 4 mice per
   group. After mixing 1 × 10^7 cells with 100 µl PBS, they were injected
   subcutaneously into the right back of the mice. Tumor diameter was
   measured with a Vernier calliper every 7 days beginning on the 7th day
   until the 28th day. Tumor volumes were calculated using the formula 1/2
   (length×width^2).

Western blotting analysis

   Cells and tissues were lysed using a lysis buffer to obtain proteins
   and quantified with BCA protein quantitative kit (Beyotime, China).
   Proteins were separated by SDS-PAGE and blotted onto the polyvinylidene
   fluoride (PVDF) membranes. The membranes were blocked with 5% DifcoTM
   Skim milk (BD, USA), incubated overnight at 4℃ with specific primary
   antibodies, and then incubated with HRP-conjugated secondary
   antibodies. The following antibodies were used: GALNT6 (1:1000, abcam,
   ab151329), N-Cadherin (1:1000, cell signaling technology, #13116),
   E-Cadherin (1:1000, cell signaling technology, #3195), Vimentin
   (1:5000, proteintech, 10366-1-AP). β-Catenin (1:1000, cell signaling
   technology, #8480), Phospho-β-Catenin (1:1000, cell signaling
   technology, #4176), Phospho-GSK-3β (1:1000, cell signaling technology,
   #5558), GSK-3β (1:1000, cell signaling technology, #12456), and GAPDH
   (1:10000, Proteintech, 10494-1-AP).

Real-time quantitative PCR (RT-qPCR)

   Total RNA from tissues and cells was extracted with RNAiso Plus (TAKARA
   BIOINC), followed by cDNA synthesis with TransScript^® One-Step gDNA
   Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China).
   Real-time quantitative PCR was conducted with SYBR Select Master Mix
   (Applied Biosystems). Expression was normalized to the expression of
   the human housekeeping gene GAPDH. Primers used were:
     * GALNT6: F1: CCTTGGCGCTTACGAGATGA, R1: ATGATTGGCCCTGGATGCAA.
     * GAPDH: F1: AATGGGCAGCCGTTAGGAAA, R1: GCGCCCAATACGACCAAATC.

Cell counting Kit-8 (CCK-8) and colony formation assay

   Cells were plated in 96-well plates at a density of 2.5 × 10^3 cells
   (T24 cell line) or 2 × 10^3 cells (5637 cell line) per well in
   triplicate, and 10 µl of CCK-8 reagent was added into each well, then
   incubated at 37℃ with 5% CO[2] for two hours. The microplate reader
   (Thermo Fisher Scientific, United States) was used to measure the
   absorbance at 450 nm. In addition, 0.5 × 10^3 cells (T24 cell line) or
   0.2 × 10^3 cells (5637 cell line) per well were added in 6-well plates
   and incubated for 14 days or 10 days separately. Cells were fixed with
   4% paraformaldehyde and stained with 1% crystal violet. The cell
   colonies were more than 50 cells.

Cell scratch assay

   Four lines were evenly marked on the back of each well of each six-well
   plate to ensure that the same areas were photographed at every time
   point. Then, approximately 3 × 10^5 cells were plated to each well.
   After these cells reached confluence, a 200 µl sterile pipette tip made
   a gap in the monolayer. Then, the cells were washed with PBS and
   photographed immediately with a microscope at 100× magnification. The
   same areas were photographed again after the cells were cultured for
   12–24 h in medium without FBS.

Transwell assay

   About 3 × 10^4 cells (T24 cell lines) or 2 × 10^4 (5637 cell lines)
   cells in 200 µl of medium without FBS were added to the upper
   compartment of a 24-well transwell chamber (8 μm pore size
   polycarbonate membrane, BIOFIL, China), and 550 µl medium with 10% FBS
   was added to the lower compartment. After incubating 24–48 h at 37℃
   with 5% CO[2], the upper compartment was washed with PBS, fixed in 4%
   paraformaldehyde, and then stained with 1% crystal violet.
   Subsequently, the chambers were washed with PBS and photographed with a
   microscope at 100× magnification. For invasion assay, the upper
   compartment was added 40 µl Matrigel and incubated for 2 h at 37℃, and
   about 3 × 10^4 cells in 200 µl of medium without FBS were added to the
   upper compartment of a 24-well transwell chamber. Other procedures were
   the same as migration.

Immunofluorescence

   After the preparation of J82 and T24 cells with knockdown of the GALNT6
   gene, the primary antibody (GALNT6, 1:200, Abcam, ab151329),
   Biotinylated-(B-1235-2)) was incubated overnight at 4 °C. Finally,
   secondary fluorescent antibodies were purchased from zsbio to capture
   images using a fluorescence microscope (Leica, TCS SP8).

Statistical analysis

   All statistical analyses were done with GraphPad Prism 8.0.1, SPSS 26.0
   and R 4.2.2 software. For sample size choice, the majority of the
   assays performed used either ≥ 3 donors to overcome donor variability.
   In all figures with histograms, data are represented using the
   mean ± SD. The unpaired or paired two-tailed Student’s t test was used
   for comparison between two groups. The one-way ANOVA test and two-way
   ANOVA test were used for three or more groups. The log-rank test was
   used for survival analysis. p < 0.05 was considered a significant
   value.

Results

Identification of GALNT6 as a key biomarker in bladder cancer

   To examine the expression of GALNT6, the R programming language was
   employed to analyze expression profile data from the TCGA database.
   This analysis included 19 samples of normal adjacent tissues and 414
   bladder cancer tissue samples, focusing on differentially expressed
   glycosyltransferase genes. The initial results indicated that six
   members of the GALNT family exhibited differential expression in
   bladder cancer tissues (Fig. [91]1A). Further analysis, incorporating
   data from the GTEx database, narrowed the findings to four
   glycosyltransferases—GALNT6, GALNT14, GALNT15, and GALNT16—showing
   significant differential expression (Fig. [92]1B). Prognostic relevance
   was assessed using clinical data from the TCGA database, where only
   GALNT6 showed significant prognostic implications (Fig. [93]1C).
   Additionally, comparative analysis of GALNT6 expression between normal
   adjacent tissues and a pan-cancer cohort revealed elevated expression
   of GALNT6 across various tumor types, including BC (Fig. [94]1D). This
   expression was also associated with multiple clinical features
   (Fig. [95]1E). Consequently, this analysis supports the potential role
   of GALNT6 as a significant biological marker in patients with BLCA.

Fig. 1.

   [96]Fig. 1
   [97]Open in a new tab

   GALNT6 is a potential prognostic marker of bladder cancer. A. The
   expression of glycosyltransferase in bladder cancer was analyzed based
   on TCGA expression profile data; B. TCGA combined with the GTEx
   database to analyze the mRNA expression of differentially expressed
   genes in the GALNT family; C. The prognosis of GALNT family
   differential genes in bladder cancer was analyzed based on the TCGA
   database; D. Analyzing the expression profile data of GALNT6 in
   pan-cancer based on the TCGA database; E. Analysis of the correlation
   between GALNT6 and various clinical features based on clinical data
   from TCGA database. Data are presented as mean ± SD of three
   independent experiments. *p < 0.05, ***p < 0.001

High expression of GALNT6 in bladder cancer and its correlation with
pathological grading and staging

   Previous research has suggested that the abnormal expression of GALNT6
   may be implicated in the formation, progression, metastasis, and
   prognosis of cancer. To investigate the expression levels of GALNT6 in
   bladder cancer, we assessed both mRNA and protein expressions in
   various bladder cancer cell lines. Relative to the SV-HUC-1 cell line,
   a normal bladder urothelial cell line, we observed that GALNT6
   expression was significantly upregulated in the 5637 and T24 cell
   lines, and downregulated in the J82 and UMUC3 cell lines
   (Fig. [98]2A-C). To further explore the expression of GALNT6 in bladder
   cancer at the tissue level and its correlation with clinical
   characteristics, we combined 6 cases of paracancerous tissues, 5 cases
   of paracancerous microarray tissues, 40 cases of bladder cancer
   tissues, and 88 cases of bladder cancer microarray tissues for
   immunohistochemical analysis, and found that GALNT6 expressed highly in
   bladder cancer tissues (Fig. [99]2D, G).

Fig. 2.

   [100]Fig. 2
   [101]Open in a new tab

   GALNT6 expression in bladder cancer and its correlation with clinical
   characteristics. A. The mRNA expression of GALNT6 in the bladder cancer
   cell line was detected by qPCR; B-C. Western blotting was used to
   detect the protein expression of GALNT6 in bladder cancer cell lines;
   D. Immunohistochemistry was used to detect the expression of GALNT6 in
   bladder cancer tissues and paired paracancerous tissues; E. The
   expression of GALNT6 in bladder cancer tissue was detected by
   immunohistochemistry and correlated with clinical grading; F. The
   expression of GALNT6 in bladder cancer tissue was detected by
   immunohistochemistry and correlated with T stage. G.
   Immunohistochemical analysis of the difference of GALNT6 expression
   between normal adjacent tissues and bladder cancer. Data are presented
   as mean ± SD of three independent experiments. *p < 0.05, **p < 0.01,
   ****p < 0.0001

   Additionally, a detailed analysis of the correlation between GALNT6
   expression and clinical features revealed associations with grade,
   tumor stage (T stage), and nodal involvement (N stage) (Fig. [102]2E-F
   and Table [103]1). Collectively, these findings indicate that GALNT6 is
   not only highly expressed in bladder cancer cells and tissues but also
   exhibits a positive correlation with clinical grade and tumor stage,
   reinforcing its potential role in the pathophysiology of bladder
   cancer.

Table 1.

   Correlation between GALNT6 expression and clinical characteristics of
   bladder cancer
   Clinicopathologic characteristics Group No. of cases GALNT6 expression
   p-value
   High Low
   Age (years) <60 41 22 19 0.0534
   ≥60 87 31 56
   Gender Male 109 45 64 0.9466
   Female 19 8 11
   Grade Low 58 49 9 <0.0001
   High 70 4 66
   T Stage Ta/T1 35 26 9 <0.0001
   T2/T3/T4 93 27 66
   N Stage NX/N0 113 53 60 0.0005
   N1/N2/N3 15 0 15
   [104]Open in a new tab

Down-regulation of GALNT6 inhibits bladder cancer’s growth, proliferation,
migration, and invasion

   To investigate the influence of GALNT6 on the biological behavior of
   bladder cancer cells, we utilized molecular cloning techniques to
   develop a lentiviral transfection vector aimed at downregulating
   GALNT6. This vector was employed to establish a stable GALNT6-knockdown
   in 5637 bladder cancer cells. The expression efficiency of GALNT6 in
   cells transfected with three different vectors was assessed via qPCR
   and Western blotting, revealing that sh1-GALNT6 exhibited the lowest
   expression and was subsequently selected for further experiments
   (Supplementary Fig. 1A-C). A stable 5637 cell line with reduced GALNT6
   expression was successfully established, and the vector map of
   sh1-GALNT6 was analyzed (Supplementary Fig. 1D). The sh1-GALNT6 vector
   was also transfected into T24 cells, with transfection efficiency
   confirmed through qPCR, Western blotting and immunofluorescence
   (Supplementary Fig. 1E-H).

   Functional assays conducted on 5637 and T24 cells demonstrated that
   GALNT6 downregulation significantly inhibited cell growth,
   proliferation, migration, and invasion compared to control and negative
   control (NC) groups (Fig. [105]3A-E and Supplementary Fig. 3). This
   suggests that GALNT6 downregulation can effectively suppress these
   tumorigenic capabilities in vitro.

Fig. 3.

   [106]Fig. 3
   [107]Open in a new tab

   Down-regulation of GALNT6 inhibits bladder cancer’s growth,
   proliferation, migration, and invasion on T24 cellsin vivoandintro. A.
   CCK-8 experiment was used to detect the downregulation of GALNT6 and
   its ability to inhibit the growth and proliferation of T24 cells; B-C.
   Plate cloning experiment was used to detect the ability of GALNT6
   downregulation to inhibit the clone formation of T24 cells; D. Scratch
   assay was used to detect the ability of GALNT6 downregulation to
   inhibit the migration of T24 cells; E. Transwell assay was used to
   detect the ability of GALNT6 downregulation to inhibit the migration
   and invasion of T24 cells; F. Representative images of solid tumors
   isolated from nude mice. G-H. Average tumor weights and volumes were
   measured in shGALNT6 and scrambled groups. Data are presented as
   mean ± SD of three independent experiments. *p < 0.05, **p < 0.01,
   ***p < 0.001, ****p < 0.0001

   To assess the effects of GALNT6 downregulation in vivo, a tumorigenesis
   experiment was conducted using nude mice injected with sh1-GALNT6
   transfected T24 cells. The results showed a substantial reduction in
   tumor volume and mass in the mice (Fig. [108]3F-H), indicating that
   GALNT6 downregulation not only impacts bladder cancer cell behavior in
   vitro but also reduces tumor growth and aggressiveness in vivo.
   Overall, these findings support the potential therapeutic value of
   targeting GALNT6 in the treatment of bladder cancer.

Overexpression of GALNT6 enhances migration and invasion of bladder cancer
cells

   In an effort to further elucidate the role of GALNT6 in modulating the
   biological behavior of bladder cancer cells, we employed molecular
   cloning techniques to generate a lentiviral vector for GALNT6
   overexpression (Supplementary Fig. 2A). This vector was utilized to
   create a stable cell line (OE-GALNT6-J82) that overexpresses GALNT6.
   J82 bladder cancer cells were infected with this lentivirus, and
   following drug selection, a stable cell line exhibiting GALNT6
   overexpression was established. The transfection efficiency was
   confirmed via quantitative PCR (qPCR) and Western blotting analyses,
   which demonstrated a significant upregulation of GALNT6 in the
   OE-GALNT6-J82 cells, confirming the successful establishment of the
   overexpressing cell line (Supplementary Fig. 2B-D). Additionally, the
   incorporation of the GFP tag from the lentiviral vector into the cells
   was visually confirmed using fluorescence microscopy (Supplementary
   Fig. 2E).

   Furthermore, we investigated the influence of GALNT6 overexprssion on
   the biological behavior of bladder cancer cells. In the functional
   experiments of J82 cells, we found that the growth and proliferation
   characteristics of J82 cells with different expression levels of GALNT6
   were not statistically significant (Fig. [109]4A-C). However, the
   impact of GALNT6 overexpression on the migratory and invasive
   capabilities of J82 cells showed a significant difference. We conducted
   wound healing (scratch) assays and transwell migration and invasion
   assays. The results indicated that, compared to the control and
   mock-transfected groups, the OE-GALNT6 group displayed a significantly
   enhanced rate of cell migration at 24 h (Fig. [110]4D).
   Correspondingly, the transwell assays demonstrated a notable increase
   in the number of cells migrating and invading through the membrane in
   the OE-GALNT6 group after 24 h (Fig. [111]4E). These findings suggest
   that the overexpression of GALNT6 significantly enhances the migration
   and invasion of bladder cancer cells, thereby promoting a more
   aggressive and malignant cellular phenotype.

Fig. 4.

   [112]Fig. 4
   [113]Open in a new tab

   Overexpression of GALNT6 promoted the migration and invasion ability of
   bladder cancer cells. A. CCK-8 experiment was used to detect the effect
   of GALNT6 upregulation on the growth and proliferation ability of J82
   cells; B-C. Plate cloning experiment was used to detect the clone
   formation of GALNT6 upregulation J82 cells; D. The wound healing test
   revealed that overexpression of GALNT6 exhibited a higher wound closure
   rate than that in the control group; E. The transwell assay
   demonstrated that overexpression of GALNT6 showed higher migration and
   invasion ability than the control group. Data are presented as
   mean ± SD of three independent experiments. **p < 0.01, ***p < 0.001

GALNT6 mediated O-glycosylation promotes the malignant phenotype of bladder
cancer

   To delve deeper into the internal molecular mechanisms by which
   GALNT6-mediated abnormal O-glycosylation affects the malignant
   phenotype of bladder cancer, we conducted a differential gene
   expression analysis between the high and low GALNT6 expression groups
   in bladder cancer. mRNA data from 414 bladder cancer cases were
   categorized into high and low expression groups based on GALNT6 levels,
   with each group comprising 50% of the sample size (Fig. [114]5A). GSEA
   and KEGG pathway enrichment analysis revealed that genes differentially
   expressed between the high and low GALNT6 expression groups were
   significantly enriched in multiple immune-related pathways
   (Fig. [115]5B). Further analysis using the GEO database confirmed that
   the differentially expressed genes associated with GALNT6 were enriched
   in various immune-related pathways (Fig. [116]5C-D).

Fig. 5.

   [117]Fig. 5
   [118]Open in a new tab

   Screening differential gene enrichment pathway of GALNT6 high and low
   expression groups in bladder cancer. A. Based on the mRNA expression
   profile data of the TCGA database, the differential genes between high
   and low expression groups of GALNT6 in bladder cancer were analyzed by
   R language; B. KEGG and GSEA methods were used to analyze the
   differential gene enrichment pathway of GALNT6 high and low expression
   groups based on the TCGA database bladder cancer expression profile
   data; C. Based on the expression profile data of bladder cancer in GEO
   database, the differential genes of GALNT6 high and low expression
   groups were analyzed; D. GSEA analyzed the differential gene enrichment
   pathway of bladder cancer expression profile in GEO database; E. IPA
   analysis of GALNT6 co-expressed gene network; F. The correlation
   between high and low expression of GALNT6 and EMT score was analyzed
   based on the expression profile data of bladder cancer in TCGA
   database; G. Based on the expression profile data of bladder cancer in
   TCGA database, the correlation between high and low expression of
   GALNT6 and immune characteristic score was analyzed

   Additionally, using the IPA molecular docking software to analyze the
   GALNT6 co-expression network indicated enrichment in pathways
   associated with EMT, PI3K/AKT, Wnt/β-catenin, and multiple
   immune-related pathways (Fig. [119]5E). Expanding on these findings, we
   computed EMT scores for the 408 bladder cancer samples from the TCGA
   database according to A. Gordon Robertson et al [[120]35] using the R
   language, and analyzed differences of these scores between the high and
   low GALNT6 expression groups. Additionally, the “estimate” Package in R
   language was runned for analyzing the immune microenvironment of 414
   cases bladder cancer mRNA profile data downloaded by TCGA, and
   generated the corresponding immune scores of 414 cases of bladder
   cancer samples. The immune scores were used to assess the immune
   microenvironment. We also analyzed the differences in immune scores
   between high and low expression groups of GALNT6. The analysis revealed
   significant disparities in both EMT and immune scores between these
   groups (Fig. [121]5F-G). These results suggest that the abnormal
   O-glycosylation mediated by GALNT6 may promote the malignant phenotype
   through the cancer cells’ own EMT signaling pathway and facilitate
   immune escape by activating immunosuppressive signals. This dual
   mechanism likely influences the biological function of cancer cells and
   contributes to a pro-cancer effect.

GALNT6 upregulation mediates the malignant phenotype of bladder cancer
through EMT signaling pathway

   To validate the findings from our bioinformatics analysis, we examined
   the impact of GALNT6 upregulation on the expression of key molecules
   within the EMT and Wnt/β-catenin signaling pathways in bladder cancer
   cells via Western blotting. The results indicated that, in J82 cells
   overexpressing GALNT6 (OE-GALNT6-J82), there was a complete absence of
   E-Cadherin expression compared to the mock and control groups.
   Conversely, the protein expression levels of N-cadherin and Vimentin
   were elevated (Fig. [122]6A-B). However, within the Wnt/β-catenin
   pathway, no significant changes in protein expression were observed
   (Fig. [123]6C-D). These findings suggest that the abnormal
   O-glycosylation modifications mediated by GALNT6 may primarily promote
   the malignant behavior of bladder cancer cells through alterations in
   the EMT signaling pathway.

Fig. 6.

   [124]Fig. 6
   [125]Open in a new tab

   EMT pathway mediates GALNT6 expression in bladder cancer. A-B. Western
   blotting analysis of the expression of EMT signaling pathway-related
   proteins in J82 cells; C-D. Western blotting analysis of the expression
   of Wnt/β-Catenin signaling pathway-related proteins in J82 cells. Data
   are presented as mean ± SD of three independent experiments.
   ****p < 0.0001

GALNT6 and immune microenvironment dynamic in bladder cancer

   Multiple bioinformatics techniques were employed to elucidate the
   relationship between GALNT6 expression and immune cell infiltration
   within the bladder cancer tumor microenvironment. The CIBERSORT
   algorithm was utilized to calculate the infiltration scores of 22
   immune cell types based on mRNA expression profiles from 414 bladder
   cancer cases. Scores with a significance level of p < 0.05 were
   selected for further analysis, yielding 186 cases with valid CIBERSORT
   scores. A differential analysis between these scores, stratified by
   high and low GALNT6 expression groups, revealed significant variations
   in the infiltration levels of several immune cells, including naive B
   cells, regulatory T cells (Tregs), activated NK cells, macrophages
   (M0/M1), and neutrophils (Fig. [126]7A). Subsequent analyses using the
   Timer and TISIDB databases investigated the correlations between GALNT6
   expression and immune cell infiltration, identifying significant
   associations with multiple key immune cells in bladder cancer
   (Fig. [127]7B-C). Specifically, our findings indicate correlations
   between GALNT6 expression and the infiltration of CD8^+ T cells,
   macrophages, dendritic cells, CD4^+ T cells, and natural killer cells
   based on multiple analysis methods (Fig. [128]7F).

Fig. 7.

   [129]Fig. 7
   [130]Open in a new tab

   GALNT6 and immune microenvironment dynamic in bladder cancer. A.
   CIBERSORT score analysis showed the infiltration of 22 immune cells in
   the high and low expression groups of GALNT6; B. Timer database
   analysis shows the correlation between GALNT6 expression and immune
   cell infiltration; C. TISIDB database analysis of the correlation
   between GALNT6 expression and immune cell infiltration; D-E.
   Immunohistochemical analysis was performed on 40 consecutive
   pathological sections from bladder cancer patients, detecting the
   correlation between GALNT6 and major immune cell markers; F. Wenn
   diagram shows the correlation between GALNT6 and immune cell
   infiltration in bladder cancer based on multiple analysis methods; G.
   Analysis of the correlation between GALNT6 and the expression of major
   immune checkpoints in bladder cancer based on the GEPIA database; H-I.
   Immunohistochemical analysis was performed on 40 consecutive
   pathological sections from bladder cancer patients, detecting the
   correlation between GALNT6 and PD-L1; J. Immunocytochemistry analysis
   for the expression of PD-L1 was conducted on T24 and sh1-GALNT6-T24
   (Sh1) cells; K. Immunocytochemistry analysis for the expression of
   PD-L1 was conducted on J82 and OE-GALNT6-J82 (OE) cells. xy axis
   refered to the scores of IHC for each marker in E and I. Data are
   presented as mean ± SD of three independent experiments

   To further validate these correlations, immunohistochemical analysis
   was performed on 40 consecutive pathological sections from bladder
   cancer patients, focusing on the infiltration of key immune cells
   predicted by bioinformatics methods (Fig. [131]7D). The results
   demonstrated a negative correlation between GALNT6 expression and CD8^+
   T cell infiltration (Fig. [132]7E), highlighting GALNT6 as a
   potentially crucial immune-related biomarker.

   Additionally, to explore the implications of GALNT6 expression for
   immunotherapy, the GEPIA database was used to analyze its correlation
   with major immune checkpoint molecules, including CTLA-4, PD-1 (PDCD1),
   LAG3, and PD-L1 (CD274). The analysis showed that GALNT6 expression was
   positively correlated with the expression of these immune checkpoint
   molecules in bladder cancer (Fig. [133]7G). In summary, these results
   indicate that GALNT6 expression in bladder cancer is negatively
   correlated with CD8^+ T cell infiltration and is associated with the
   expression of various immune checkpoint molecules, suggesting its
   involvement in modulating immune escape mechanisms in the tumor
   microenvironment.

   Furthermore, to explore the potential role of GALNT6 in clinical
   immunotherapy, we predicted the correlation between GALNT6 and immune
   responses such as CTLA-4 and PD-1. There is a significant correlation
   between the ctla4_pos_pd1_pos group (CTLA-4 positive & PD-1 positive)
   and GALNT6, and the ips_ctla4_neg_pd1_pos guoup (CTLA-4 negative & PD-1
   positive) correlation is higher than other two groups (Table [134]2).
   Therefore, we speculate that GALNT6 may serve as a potential target for
   clinical immunotherapy.

Table 2.

   Correlation between GALNT6 expression and CTLA4 and PD-1
   immunophenoscore (IPS) based on TCIA database
   Correlations
   GALNT6 ips_ctla4_neg_pd1_pos ips_ctla4_neg_pd1_neg
   ips_ctla4_pos_pd1_neg ips_ctla4_pos_pd1_pos
   Spearman’s rho GALNT6 Correlation Coefficient 1 0.144^** -0.107-^*
   -0.05 0.164^**
   (N = 408) Sig. (2-tailed) 0.004 0.031 0.316 0.001
   ips_ctla4_neg_pd1_pos Correlation Coefficient 0.144^** 1 0.665^**
   0.781^** 0.923^**
   Sig. (2-tailed) 0.004 0 0 0
   ips_ctla4_neg_pd1_neg Correlation Coefficient -0.107-^* 0.665^** 1
   0.871^** 0.586^**
   Sig. (2-tailed) 0.031 0 0 0
   ips_ctla4_pos_pd1_neg Correlation Coefficient -0.05 0.781^** 0.871^** 1
   0.742^**
   Sig. (2-tailed) 0.316 0 0 0
   ips_ctla4_pos_pd1_pos Correlation Coefficient 0.164^** 0.923^**
   0.586^** 0.742^** 1
   Sig. (2-tailed) 0.001 0 0 0
   [135]Open in a new tab

   ^*Correlation is significant at the 0.05 level (2-tailed).

   ^**Correlation is significant at the 0.01 level (2-tailed).

   In view of the relevance between GALNT6 promoting the malignant
   phenotype of bladder cancer and immune cells and immune response, we
   further explored the correlation between GALNT6 and PD-L1 expression in
   consecutive pathological sections from bladder cancer patients, and
   found a positive correlation between GALNT6 and PD-L1 expression in
   bladder cancer (Fig. [136]7H-I). Additionally, the expression of PD-L1
   was evaluated on T24 cell line under the GALNT6 knocked down condition
   by immunocytochemistry (Fig. [137]7J). Similarly, PD-L1 expression was
   lower in J82 than that in OE-GALNT6-J82 (OE) cells (Fig. [138]7K).
   Based on these results, we speculate that GALNT6 may affect the
   function of CD8^+ T cells through its interaction with PD-L1, thereby
   evading immune surveillance and promoting tumor development.

Discussion

   Bladder cancer is the most prevalent malignant tumor within the urinary
   system, exhibiting rising incidence and mortality rates in recent years
   [[139]36]. Approximately one-fourth of patients present with
   muscle-invasive bladder cancer (MIBC) or metastatic disease at their
   initial diagnosis. Moreover, bladder cancer is characterized by a high
   recurrence rate, with about half of the patient’s experiencing
   recurrence or metastasis post-radical surgery [[140]37]. Currently, the
   management of bladder cancer primarily involves surgery supplemented by
   postoperative treatments [[141]4]. Due to the heterogeneity among
   bladder cancer patients, outcomes following treatment can vary
   significantly. In an effort to enhance patient prognosis and alleviate
   the economic burden on patients, there is a critical need for
   researchers to develop novel biomarkers. These biomarkers could
   facilitate early diagnosis and treatment, thereby improving outcomes
   and enabling the early prediction of adverse reactions. However, a
   comprehensive understanding of the pathogenesis and progression of
   bladder cancer remains elusive, and there is a significant shortage of
   sensitive diagnostic and prognostic biomarkers. This gap in knowledge
   underscores the urgent need for intensified research efforts aimed at
   uncovering the underlying mechanisms of bladder cancer and identifying
   reliable biomarkers that can guide more effective clinical
   interventions.

   GALNT6 is abnormally expressed in various tumors and affects the
   occurrence and development of tumors. In pancreatic ductal
   adenocarcinoma (PDAC), GALNT6 is highly expressed in pancreatic cancer
   and plays a carcinogenic role [[142]38]. In addition, the high
   expression level of GALNT6 was significantly associated with the low
   expression levels of E-cadherin and β-catenin and the high expression
   levels of MMP9, these findings indicated that GALNT6 could provide a
   insight into the characterization of gastric cancer (GC) as well as
   contribute to the development of an efficient prognostic indicator for
   GC [[143]39]. Additionally, studies have shown that loss of GALNT6
   enzyme in early-stage colorectal cancer predicts poor clinical outcomes
   in colorectal cancer [[144]40]. In lung cancer, GALNT6 promotes the
   invasion and metastasis of by enhancing the MEK1/2/ERK1/2 pathway
   through the glycosylated chaperone protein GRP78 [[145]18]. However,
   GALNT6 also affects the EMT process in endometrial cancer (EOC) by
   regulating adhesion molecules, thereby inhibiting the progression of
   EOC [[146]41]. In summary, it can be seen that GALNT6 plays an
   important role in various tumors, directly or indirectly affecting the
   occurrence and development of tumors.

   We have demonstrated that GALNT6 is highly expressed across various
   tumor tissues, including bladder cancer, where its expression
   correlates with clinical parameters such as grade, T stage, and N
   stage. Confirmatory IHC staining aligned with bioinformatics analyses,
   indicating that higher malignancy levels in bladder cancer are
   associated with elevated GALNT6 expression. To further investigate, we
   employed RT-qPCR and Western blotting techniques to assess GALNT6
   levels in bladder cancer cell lines. Notably, J82 cells exhibited low
   GALNT6 expression, whereas T24 and 5637 cells showed high expression,
   making them suitable for the construction of recombinant lentiviral
   vectors to modulate GALNT6 expression. Subsequent experiments,
   including CCK-8, plate cloning, scratch tests, and transwell assays,
   were conducted to evaluate the impact of GALNT6 modulation on bladder
   cancer cell growth, proliferation, metastasis, and invasion. Our
   findings revealed that GALNT6 overexpression enhances these cells’
   migratory and invasive capabilities, whereas its suppression inhibits
   these oncogenic traits. To determine the in vivo relevance of these
   findings, BALB/c-nude mice with immunodeficiency were utilized for
   experimental validation. In vivo, results showed that a T24 cell line
   engineered to under express GALNT6 resulted in reduced tumor volume and
   mass. These observations suggest that GALNT6 promotes the malignant
   phenotype of bladder cancer both in vitro and in vivo, underscoring its
   potential as a therapeutic target.

   Abnormal O-glycosylation, often induced by the GALNT family of enzymes,
   has been implicated in numerous cancers [[147]42]. GALNT6, a critical
   enzyme within this family, has been identified as a key promoter of
   tumor invasion and metastasis. To investigate the role of GALNT6 in
   bladder cancer more deeply, we utilized bioinformatics tools, including
   GSEA, R language, and IPA software, combined with expression profile
   data from TCGA and GEO databases. Our analysis aimed to elucidate how
   variations in GALNT6 expression impact the pathogenesis of bladder
   cancer. Our findings suggest that GALNT6-mediated abnormal
   O-glycosylation may enhance the malignant phenotype of bladder cancer
   cells through several mechanisms. Primarily, it appears to activate the
   EMT and Wnt/β-catenin signaling pathways, crucial for the aggressive
   behavior of cancer cells. Additionally, GALNT6 may facilitate immune
   escape by triggering immunosuppressive signals, thereby further
   influencing the biological functions of cancer cells and exerting a
   pro-cancerous effect. These insights highlight the complex role of
   GALNT6 in the modulation of cellular mechanisms contributing to cancer
   progression.

   EMT has been a focal point in cancer research for over two decades.
   Numerous studies across various human cancer cell lines, mouse tumor
   models, and human tumor samples have demonstrated that EMT induction
   enables cancer cells to disrupt cell-to-cell adhesion and degrade local
   basement membranes by upregulating enzymes that break down the
   extracellular matrix. Research has identified that
   epithelial-mesenchymal transformation, a critical mechanism in tumor
   metastasis, can be influenced by glycosyltransferases [[148]43]. In the
   context of mucin O-glycosylation, GALNT6 plays a pivotal role in
   initiating this process, which is vital for the post-translational
   modification and stability of glycoproteins [[149]44]. Western blotting
   results corroborate this function of GALNT6. Typically, EMT is
   biochemically characterized by a reduction in the epithelial marker
   E-cadherin and an increase in mesenchymal markers such as Vimentin and
   N-cadherin [[150]45]. Our study reveals that GALNT6 facilitates EMT in
   bladder cancer cells. Mechanistically, overexpression of GALNT6
   upregulates N-Cadherin and Vimentin, thus promoting the EMT process.
   However, there was a complete absence of E-Cadherin in J82 cells with
   different GALNT6 expression groups. The absence of E-Cadherin
   expression in J82 bladder cancer cell also appeared in the results from
   Yang et al. [[151]46], which revealed that no expression of E-Cadherin
   was found in J82 and T24 cells. Due to the poor differentiation and
   high malignancy of J82 and T24 cells [[152]47, [153]48], loss of
   E-cadherin expression might correlate with loss of intercellular
   adhesion, tight junction formation and enhanced paracellular transport.
   Absent expression of E-cadherin in J82 bladder cancer cells with high
   malignangy reduced the endothelial properties of the cells, thereby
   weakening intercellular adhesion and making the cells more aggressive.
   By influencing the expression of matrix metalloproteinases (MMPs) and
   the transition from E-cadherin to N-cadherin, GALNT6 likely enhances
   the migratory and invasive capabilities of bladder cancer cells,
   further endorsing its role in cancer progression.

   Glycosylation plays a pivotal role in tumor immune evasion. Studies
   have identified various glyco-antigens such as Tn and Lewis antigens,
   and lectins like sialic acid or galactose in the tumor
   microenvironment. For instance, increased sialylation of tumor cells
   enhances the expression of ligands for lectin receptors, which
   predominantly exert immunosuppressive effects. The sialylated Tn
   antigen (sTn) is commonly expressed in cancers and is linked to immune
   tolerance [[154]31]. Therefore, glycosylation of tumor antigens
   significantly influences tumor-infiltrating immune cells and fosters
   immunosuppressive pathways. In colon cancer, O-GlcNAc glycosylation
   enhances cell proliferation and metastasis, helping the cells evade
   immune detection [[155]49].

   Glycan-binding receptors such as sialic acid binding
   immunoglobulin-like lectins (SIGLECs), macrophage galactose-specific
   lectins (MGLs), and dendritic cell-specific ICAM-3 grabbing
   non-integrins (DC-SIGN) are expressed on immune cells. These receptors
   mediate immune suppression by interacting with tumor-associated glycan
   motifs. Enrichment of Lewis structures, for instance, is known to
   promote innate immune suppression within the tumor microenvironment
   [[156]50, [157]51]. Additionally, molecules like MUC1, CD43, CD45,
   which are rich in Tn, GM2 or GD2, which carry N-acetylgalactosamine,
   interact with MGLs on macrophages, driving effector T cells to produce
   immunosuppressive programs characterized by IL-10 elevation and
   induction of apoptosis [[158]52, [159]53]. Thus, glycosylation plays an
   important role in immune escape in tumors.

   To explore the relationship between glycosylation and immune evasion in
   bladder cancer, we utilized bioinformatics tools such as CIBERSORT,
   Timer, TISIDB, and R language to analyze the correlation between GALNT6
   expression and immune cell infiltration. Immunohistochemical analyses
   confirmed a negative correlation between GALNT6 expression and CD8^+ T
   cell infiltration in bladder cancer, along with an association with
   several immune checkpoint molecules. These findings suggest that
   GALNT6-mediated O-glycosylation might facilitate immune escape in
   bladder cancer by impairing CD8^+ T cell functionality. However,
   further investigation is necessary to elucidate the specific molecular
   mechanisms through which GALNT6-mediated glycosylation promotes immune
   evasion in bladder cancer.

   Our results of IHC detection revealed the positive correlation between
   GALNT6 and PD-L1 in pathology specimens. Besides, it was found that
   PD-L1 expression was higher in T24 than that in GALNT6 downregulation
   T24 cells. Similarly, PD-L1 expression was lower in J82 than that in
   OE-GALNT6-J82 (OE) cells. The high expression of PD-L1 might promote
   the activation of PD-1/PD-L1 axis to suppress the CD8^+ T cell effect
   and facilitate the immune escape of cancer cells. As we know, the tumor
   microenvironment plays a crucial role in EMT. Inflammatory cytokines
   and immune suppressive cells are considered key factors in EMT and
   distant metastasis [[160]54]. In this context, tumor cells have
   developed several strategies to evade the host immune system, including
   overexpression of programmed death ligand 1 (PD-L1), which induces
   immune cell apoptosis by binding to PD-1 [[161]55]. Therefore, we
   analyzed that GALNT6 promotes the malignant phenotypes of bladder
   cancer, on the one hand, through EMT pathway activation, on the other
   hand, EMT activation probably upregulated the expression of PD-L1 on
   the tumor surface and promoted the activation of PD-1/PD-L1 axis. Thus,
   this process inhibited the immune function of CD8^+ T cells and
   promoted immune escape. Meanwhile, we attributed the elevated
   expression of immune checkpoint molecules in GALNT6-high expressing
   tumors to CD8^+ T cells present in the TME. The checkpoint molecules
   such as PD-1, LAG3 and CTLA-4 all expressed on the surface of activated
   CD8^+ T cells, impairing immune cells function and antitumor immune
   response, and their activation might inhibit CD8^+ T cell immune
   function and promote tumor immune escape. Taken together, the high
   GALNT6 expression promoted the activation of EMT and PD-1/PD-L1 axis,
   and enhanced the expression of inhibitory immune checkpoints, thereby
   inhibiting the CD8^+ T cells function and escaping of immune
   surveillance.

   While our study has elucidated the role of GALNT6 in bladder cancer
   progression, metastasis, and immune evasion through EMT transition, it
   also presents several limitations. Firstly, the detailed molecular
   mechanisms by which GALNT6 affects CD8^+ T cells via O-glycosylation
   require further exploration. Additionally, the impact of downstream
   substrates influenced by this regulation remains unclear. Identifying
   new substrates of GALNT6 is expected to be pivotal in fully
   understanding its contributions to bladder cancer’s metastasis and
   progression. Secondly, there is a critical need for additional in vivo
   experiments to evaluate the effects of GALNT6 in immunogenic mouse
   models, which we plan to address in our future research endeavors.

Conclusion

   Overall, this study demonstrated that GALNT6-mediated abnormal
   O-glycosylation might enhance the occurrence and development of bladder
   cancer and immune escape, which was related to the activation of the
   EMT signal of tumor cells and the failure or low function of CD8^+ T
   cells infiltrated in the tumor microenvironment. Besides, bladder
   cancer cells could regulate the infiltration of CD8^+ T cells through
   GALNT6 mediated O-glycosylation, enhance the inhibitory signals of
   immune cells such as PD-1, CTLA4, LAG3, inhibit immune-related
   signaling pathways, reduce the function and number of CD8^+ T cells,
   and promote the secretion of immunosuppressive molecules. All of this
   is to form an immunosuppressive tumor microenvironment as well as
   promote tumor immune escape and development. It is suggested that
   GALNT6 might be a potential therapeutic target for clinical bladder
   cancer.

Electronic supplementary material

   Below is the link to the electronic supplementary material.
   [162]Supplementary Material 1^ (9.9MB, docx)

Author contributions

   XS and SW conducted laboratory tests and participated in the writing of
   the manuscript. XS, HW, QC, DY and SW designed the study. YJ, LG, CL,
   LT and GZ provided analysis and interpretation of data. XY provided
   help for immunohistochemistry experiments and improved the experimental
   protocol. AA polished the language of the article. XS and LT revised
   the writing of the manuscript. All authors were involved in the
   conception, preparation of the manuscript, and the final version of the
   manuscript has been read and approved by all the authors before its
   submission.

Funding

   This work was supported by Dalian Medical University Interdisciplinary
   Research Cooperation Project Team Funding (JCHZ2023021).

Data availability

   No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

   This study was conducted with the informed consent of all patients and
   the approval of the Medical Ethics Committee of the First Affiliated
   Hospital of Dalian Medical University (LCKY2015-08). All animal
   experiments were approved by the Animal Care&Welfare Committee of
   Dalian Medical University ([163]AEE22047).

Consent for publication

   Not applicable.

Competing interests

   The authors declare no competing interests.

Footnotes

   Publisher’s note

   Springer Nature remains neutral with regard to jurisdictional claims in
   published maps and institutional affiliations.

   Xiaoxin Sun, Haotian Wu and Ling Tang contributed equally to this work.

Contributor Information

   Qiwei Chen, Email: chenqiwei@dmu.edu.cn.

   Deyong Yang, Email: yangdeyong@dmu.edu.cn.

   Shujing Wang, Email: wangshujing@dmu.edu.cn.

References