Abstract

   Parkinson's disease (PD) is characterized by dopamine (DA) neuron loss
   and neuroinflammation. This study develops carrier‐free nanocapsules
   (NCs) for targeted delivery of DA and catalase (CAT) to the PD brain,
   addressing both DA depletion and neuroinflammation simultaneously. The
   NCs are engineered by DA and 4‐formylphenylboronic acid co‐loading with
   cRGD‐modified CAT (CAT‐cRGD) and surface‐modifying with Angiopep‐2
   (Ang). Ang targets the blood‐brain barrier (BBB), enhancing brain
   delivery, while cRGD targets upregulated integrin receptors in the
   PD‐affected BBB. The NCs showed a 1.4‐fold increase in parkinsonian
   brain targeting efficiency compared to normal mice. In PD mice models,
   NCs demonstrated a stable increase in learning and memory, enhanced
   locomotor activity, and improved motor coordination. DA supplementation
   significantly enhanced dopaminergic signaling, increasing DA levels
   1.8‐ and 3.5‐fold in the striatum and substantia nigra, respectively.
   Additionally, delivered CAT effectively reduced neuroinflammation by
   mitigating endoplasmic reticulum stress, slowing disease progression,
   and protecting DA from oxidation. This innovative approach using
   PD‐targeted NCs represents a synergistic strategy for PD treatment,
   combining symptomatic relief with disease progression intervention.

   Keywords: carrier‐free delivery system, macromolecule delivery,
   neurotransmitter delivery, Parkinson disease, synergistic therapy
     __________________________________________________________________

   This study presents Parkinson's Disease (PD)‐targeted carrier‐free
   nanocapsules (NCs) for the simultaneous delivery of dopamine and
   catalase to the PD brain, addressing both dopamine depletion and
   neuroinflammation. By integrating symptomatic and etiological
   treatments, these NCs offer a comprehensive and innovative approach to
   PD therapy, providing a potential breakthrough in disease management.

   graphic file with name ADVS-11-2404717-g004.jpg

1. Introduction

   Parkinson disease (PD) is the second most common neurodegenerative
   disorder, characterized by motor symptoms such as rigidity,
   bradykinesia, and non‐motor symptoms including cognitive decline and
   mood disorders. The global burden of PD is rapidly increasing, with an
   estimated 13 million cases expected by 2040.^[ [36]^1 ^] The pathology
   of PD is primarily caused by the irreversible loss of dopaminergic
   neurons in the substantia nigra and the accumulation of misfolded
   α‐synuclein (α‐syn).^[ [37]^2 ^] The prion‐like behavior of misfolded
   α‐syn allows them to spread from one neuron to others and across brain
   regions. The aggregation of misfolded α‐syn in the endoplasmic
   reticulum (ER) and mitochondria leads to increased ER stress,
   mitochondrial dysfunction, and oxidative stress.^[ [38]^3 ^] These
   alterations trigger neuroinflammation, which is a key factor in the
   pathogenesis of PD. The loss of dopaminergic neurons and aggregation of
   misfolded α‐syn induce neuroinflammation, which in turn can further
   oxidize dopamine (DA) and promote α‐syn misfolding, creating a
   self‐perpetuating cycle.^[ [39]^4 ^]

   Current treatments for PD primarily focus on alleviating symptoms by
   either directly or indirectly increasing brain dopamine levels.^[
   [40]^5 ^] While dopaminergic medications provide symptomatic relief and
   improve quality of life, they are unable to halt or slow down disease
   progression. Additionally, the blood‐brain barrier (BBB) presents a
   significant hurdle for drug delivery, as it effectively blocks 98% of
   small molecules and nearly all macromolecules from entering the brain
   parenchyma.^[ [41]^6 ^] This insufficient delivery of therapeutic
   agents requires higher doses or more frequent administration over time.
   Therefore, efficient delivery of therapies to the brain is a critical
   aspect of PD treatment. Nanotechnology offers promising solutions to
   overcome the BBB and improve therapeutic delivery with minimal side
   effects. Surface‐modified nanoparticles can specifically penetrate the
   BBB through various mechanisms, such as adsorptive‐mediated,
   carrier‐mediated, and receptor‐mediated transcytosis.^[ [42]^7 ^]
   Several nanodrugs have been developed for the treatment of PD. However,
   these nanodrugs still have limitations, as most of them primarily focus
   on reducing neuroinflammation.^[ [43]^8 , [44]^9 , [45]^10 , [46]^11 ^]
   The single‐target strategies, failing to address the complex,
   network‐based nature of PD pathogenesis. Additionally, the use of
   external nanocarriers, such as inorganic nanoparticles, raises safety
   concerns due to potential accumulation in neuron microenvironment and
   interference with microglial clearance.^[ [47]^12 ^] These limitations
   highlight the urgent need for developing biocompatible carrier‐free
   nanodrugs that offer a synergistic, multi‐target approach to PD
   therapy.

   Herein, we aimed to develop a biocompatible carrier‐free nanodrug for
   synergistic therapy for PD treatment. As shown in Scheme [48] 1 , our
   innovative parkinsonian brain‐targeting nanocapsules (NCs) efficiently
   deliver DA to the brain parenchyma while simultaneously reducing
   neuroinflammation, offering a synergistic approach to PD therapy. The
   carrier‐free NCs are synthesized from DA and 4‐formylphenylboronic acid
   (FBA), ensuring biocompatibility and minimizing safety concerns
   associated with external carrier. The co‐loading catalase (CAT)
   modified with cyclo(CRGDfK) (cRGD) aims to decrease neuroinflammation.
   Furthermore, the modified cRGD binds to the increased expression of
   integrin receptors in the vascular endothelial cells of parkinsonian
   brains, creating PD‐targeted NCs.^[ [49]^13 , [50]^14 , [51]^15 ^] To
   improve brain targeting, Angiopep‐2 (Ang), which has a high affinity
   for low‐density lipoprotein (LDL)‐related protein‐1(LRP‐1) in the BBB,
   is adsorbed onto the surface of NCs, facilitating their penetration
   into the brain.^[ [52]^16 , [53]^17 ^] Our therapeutic NCs provide a
   dual‐target approach: 1) NCs efficiently transport DA into the brain,
   significantly alleviating disease symptoms; 2) encapsulated CAT
   intervenes in the progression of PD by reducing neuroinflammation.
   Additionally, CAT protects DA from oxidation, enhancing its therapeutic
   efficacy during delivery and within the lesion site. In summary, our
   study introduces a carrier‐free nanoformulation that addresses the
   limitations of current PD treatments. By exploiting the specific
   characteristics of the parkinsonian brain and incorporating a
   multi‐target approach, our NCs have the potential to revolutionize PD
   therapy, providing a more effective and comprehensive treatment option.

Scheme 1.

   Scheme 1
   [54]Open in a new tab

   Schematic Illustration of PD‐Brain Targeting Nanocapsules for
   Synergistic Therapy. A) The carrier‐free NCs were fabricated FBA and
   DA, followed by the loading of CAT‐cRGD and surface modification with
   Ang. B) Upon intravenous (i.v.) administration, the dual‐targeting NCs
   traverse the BBB by exploiting the interaction between Ang and theLRP‐1
   expressed on the BBB. Moreover, cRGD specifically targets to the
   upregulated integrin receptors on the BBB under PD conditions, further
   enhancing the BBB penetration of the NCs. Once in the brain, the NCs
   augment DA signaling and elevate DA levels in the striatum and
   substantia nigra. Concurrently, the NCs attenuate the expression of
   α‐synuclein (α‐syn) and activating transcription factor 6 (ATF6),
   resulting in a reduction of reactive oxygen species (ROS) and
   neuroinflammation. TH: tyrosine hydroxylase, DAT: dopamine transporter,
   DRD2: dopamine D2 receptor, BDNF: brain‐derived neurotrophic factor.

2. Results and Discussion

2.1. Preparation and Characterizations of Carrier‐Free Nanocapsules

   The BBB presents a significant challenge in delivering therapeutic
   agents to the brain. However, the progression of PD leads to
   disease‐specific alterations in the BBB, such as increased angiogenesis
   and integrin expression, which can be exploited for targeted drug
   delivery. To enhance the delivery efficiency of our NCs, we modified
   CAT with cRGD (CAT‐cRGD), which specifically targets integrins
   overexpressed in the BBB during PD. Although there are no definitive
   studies identifying the specific type of integrin overexpressed in the
   BBB during PD, we utilized cRGD to broadly target various integrins.^[
   [55]^18 , [56]^19 , [57]^20 , [58]^21 ^] This conjugation of cRGD to
   CAT was achieved using a previously described method,^[ [59]^22 ^] and
   the modification was confirmed by sodium dodecyl sulfate‐polyacrylamide
   gel electrophoresis, which showed an increase in molecular weight for
   the CAT‐cRGD compared to unmodified CAT (Figure [60]S1, Supporting
   Information). The enzyme activity of CAT‐cRGD was demonstrated through
   the oxidation of 3,3′,5,5′‐tetramethylbenzidine (TMB) in the presence
   of hydrogen peroxide, indicating that the enzyme's activity was
   preserved post‐modification (Figure [61]S1, Supporting Information).

   The carrier‐free‐ NCs was fabricated through the reaction FBA with
   DA at pH 7.8, simultaneously incorporating CAT‐cRGD (Figure [62] 1A).
   To further enhance brain delivery efficiency, Ang was adsorbed on the
   surface of NCs, known for its affinity to the LRP‐1 on the BBB. The
   changes in zeta potential verified the successful modification of Ang
   on the surface of NCs (Figure [63]S2, Supporting Information). We
   designed three groups of NCs to comprehensively evaluate the impact of
   cRGD modification and CAT payload: Ang‐modified, CAT‐cRGD‐loaded DA NCs
   (CRDA), Ang modified, CAT‐loaded DA NCs (CDA), and Ang‐modified, HSA‐
   cRGD ‐loaded DA NCs (HRDA). The hydrodynamic diameters of these NCs
   were 92.1 ± 7.8 nm (CRDA), 115.3 ± 11.5 nm (CDA), and 69.8 ± 5.9 nm
   (HRDA), all exhibiting a surface negative charge of≈−22 mV
   (Figure [64]1B,C). Transmission electron microscopy (TEM) confirmed
   their uniform and spherical structure (Figure [65]1D; Figure [66]S3,
   Supporting Information).

Figure 1.

   Figure 1
   [67]Open in a new tab

   Construction and Characterization of Therapeutic Nanocapsules (NCs). A)
   Illustration of the synthetic process for creating Ang modified, CRDA.
   B) Size distribution N(d[h]) of CRDA, CDA, and HRDA at a concentration
   of C[NCs] = 1 mg mL^−1. C) Zeta potential measurements ζ for CRDA, CDA,
   and HRDA at the same concentration. D) Transmission electron microscopy
   (TEM) image showcasing the morphology of CRDA. E) Hydrodynamic sizes
   d[h(N)] of NCs loaded with various proteins and built using different
   molecules (C[NCs] = 1 mg mL^−1). F) Stability analysis of the
   hydrodynamic size d[h(N)] for three NCs in PBS over 96 h. G) CAT
   viability of CRDA, CDA, and free CAT at a concentration of C[CAT] = 50
   µg/mL over 96 h at room temperature, with data normalized to 100%
   viability at t = 0 h (n = 3). H) HPLC profiles of samples separated
   using an ultracentrifuge filter after 72 h incubation with CRDA under
   various conditions at a concentration of C[DA] = 30 µg mL^−1, alongside
   DA monomers at a concentration of 7.81 µg mL^−1. I) Eluents collected
   at retention times between 2 and 2.5 min were further analyzed using
   electrospray ionisation mass spectrometry (ESI‐MS). J) Release profiles
   of DA from CRDA and HRDA under different conditions at a concentration
   of C[DA] = 50 µg mL^−1 (n = 3).

   To demonstrate the applicability of our nanoformulation method, we
   encapsulated proteins with varying molecular weights (25–64 kDa) and
   isoelectric points (2.7–8.9) within the NCs (Figure [68]S4, Supporting
   Information). The successful formation of NCs with diverse sizes and
   surface potentials (Figure [69]1E) and the efficient loading of these
   proteins (Table [70]S1, Supporting Information) highlight the broad
   applicability of our synthetic strategy. To further investigate the
   versatility of the synthesis strategy, we explored the construction of
   different small molecules that share structural similarities with DA,
   possessing catechol and primary amine groups (Figure [71]1E; Figure
   [72]S5, Supporting Information). Dynamic light scattering (DLS)
   analysis confirmed the nano‐structural integrity of these formulations.
   Consequently, this study provides a novel approach for the co‐delivery
   of small molecules with catechol and primary amine groups alongside
   macromolecules.

   The stability of the NCs is crucial for their potential therapeutic
   application. We evaluated the stability of the NCs by monitoring
   changes in their hydrodynamic diameter over time in phosphate‐buffered
   saline (PBS). The NCs maintained stability in a neutral environment for
   up to 96 h, with no significant alterations in their size
   (Figure [73]1F). However, the NCs can only keep their stability for up
   to 48 h in cell medium and 24 h in FBS‐supplemented cell medium.
   (Figure [74]S6, Supporting Information). Furthermore, the encapsulated
   CAT exhibited superior enzyme preservation compared to free CAT over
   the same duration at room temperature in PBS (Figure [75]1G),
   highlighting the protective role of the nanoformulation. To gain
   insights into the composition of the NCs, the concentrations of various
   components within the NCs were comprehensively quantified using a range
   of analytical techniques: DA levels were determined via
   high‐performance liquid chromatography (HPLC), protein content was
   assessed with the Bradford assay, boron (B) concentration was measured
   by inductively coupled plasma mass spectrometry (ICP‐MS), and the
   presence of cRGD was detected through its reaction with
   phenanthrenequinone (Figure [76]S7, Supporting Information).^[ [77]^23
   ^] The results demonstrated that the NCs maintained similar
   concentrations of DA and B, but exhibited varying levels of protein
   encapsulation (Table [78] 1 ). The DA/Protein ratio was 1.0 ± 0.2 for
   CRDA, 1.6 ± 0.4 for CDA, and 0.3 ± 0.02 for HRDA, with the lower ratio
   in HRDA attributed to the higher loading efficiency of HSA. The
   protein/cRGD ratio was 0.3 ± 0.09 for CRDA and 0.8 ± 0.04 for HRDA,
   confirming the successful incorporation of cRGD in the NCs.

Table 1.

   The concentration of different components within Nanocapsules.
                      CRDA       CDA        HRDA
   DA [µg/mg]      16.0 ± 3.3 19.5 ± 1.8 16.29 ± 2.5
   Protein [µg/mg] 14.3 ± 2.9 14.0 ± 3.4 50.8 ± 4.3
   B [µg/mg]       24.7 ± 4.0 22.5 ± 2.9 23.6 ± 5.5
   cRGD [µg/mg]    42.7 ± 3.9     /      67.3 ± 7.2
   DA/Protein      1.0 ± 0.2  1.6 ± 0.4  0.3 ± 0.02
   Protein/cRGD    0.3 ± 0.09     /      0.8 ± 0.04
   [79]Open in a new tab

   Previous research suggests that the pH of PD brain ranges from 6.4 to
   6.6, accompanied by an elevated reactive oxygen species (ROS) level in
   the neuronal microenvironment.^[ [80]^24 , [81]^25 , [82]^26 ^] To
   investigate the controlled release of DA from the NCs under conditions
   mimicking the PD brain environment, we incubated the NCs in media with
   different pH values (7.4 and 6.4) and in the presence of elevated ROS
   (ROSUP) at pH 6.4. The released DA was verified using HPLC and mass
   spectrometry (Figure [83]1H,I). At pH 7.4, the release rate of DA from
   both CRDA and HRDA NCs was ≈10% over 72 h (Figures [84]S9 and [85]S10,
   Supporting Information). This release rate increased to 37.3% ± 5.7%
   for CRDA and 36.2% ± 3.8% for HRDA at a pH of 6.4 (Figures [86]S11 and
   [87]S12, Supporting Information). However, under the pH 6.4 + ROSUP
   condition, DA release from CRDA and HRDA decreased to 22.5% ± 2.3% and
   12.9% ± 0.7%, respectively (Figures [88]S13 and [89]S14, Supporting
   Information). These results demonstrate that the mildly acidic
   conditions prompt DA release, whereas the presence of ROSUP leads to
   partial oxidation of DA (Figure [90]1J; Table [91]S2, Supporting
   Information). The release rate of DA from CRDA was higher under the pH
   6.4 + ROSUP condition compared to HRDA, indicating that CAT played a
   crucial role in reducing ROS levels and protecting DA from oxidation.
   The presence of CAT within the CRDA nanocomposite provided a protective
   effect against DA oxidation, as evidenced by a ≈15% reduction in
   release compared to the pH 6.4 condition without ROSUP. This finding
   suggests that the CRDA nanocomposite offers a significant degree of
   protection against DA oxidation, even under challenging oxidative
   stress conditions. Some studies indicated that the oxygen released from
   the reaction between CAT and ROSUP could promote DA oxidation;^[
   [92]^27 ^] however, our findings indicate that this phenomenon is
   unable to occur at pH 6.4 (Figure [93]S15, Supporting Information).
   This protective role of CAT highlights its potential significance in
   preserving the efficacy of DA in the oxidative environment of the PD
   brain.

2.2. Biocompatibility and BBB Penetration of Nanocapsules with In Vitro Model
of PD

   The biocompatibility of the NCs is a fundamental aspect of our study,
   as it establishes their suitability for further therapeutic evaluation.
   Initially, our investigation demonstrated the in vitro biocompatibility
   of NCs with mouse brain endothelial bEnd.3 cells and rat adrenal
   medullary carcinoma PC12 cells. This biocompatibility is a foundational
   aspect of our study, as it establishes the NCs' suitability for further
   therapeutic evaluation (Figure [94]S16, Supporting
   Information).1‐Methyl‐4‐phenylpyridinium (MPP^+), a neurotoxin used to
   simulate PD at the cellular level, was shown to increase oxidative
   stress, lead to mitochondrial dysfunction, and result in cell death.^[
   [95]^28 ^] Remarkably, the NCs (C[DA] = 50 µg mL^−1) enhanced the
   viability of PC12 cells exposed to MPP^+ across various concentrations
   (Figure [96] 2A). This treatment response was observed to be
   concentration‐dependent, with cell viability improvements being more
   pronounced at higher concentrations of MPP^+.

Figure 2.

   Figure 2
   [97]Open in a new tab

   In Vitro PD Model and Penetration Efficiency of NCs. A) Cell viability
   (V) of PC‐12 cells after 24 h of treatment with various concentrations
   of MPP^+ and NCs (C[DA] = 50 µg mL^−1, n = 3). B) Construction of an in
   vitro PD model using MPP^+ incubation and a transwell system. PC‐12
   cells were treated with MPP^+ (3  mM) for 24 h, while bEnd.3 cells in
   the transwell filter were exposed to NCs for 5 h (t[exp] = 5 h).
   Following this, the medium was refreshed after washing with PBS, and
   bEnd.3 cells were co‐incubated with the PC‐12 cells for an additional
   24 h (t[inc] = 24 h), totaling a combined incubation period of 29 h
   (t[exp] + t[inc] = 5 h + 24 h). C) Penetration efficiency [%] of NCs
   (C[DA] = 50 µg mL^−1) was evaluated by comparing the ratio of cellular
   Cy5.5 fluorescence (I[Cy5.5]) in bEnd.3 cells and PC‐12 cells at t[exp]
   + t[inc] = 5 h + 24 h relative to bEnd.3 cells at t[exp] = 5 h, using
   flow cytometry (n = 3). D) Confocal microscopy images of NCs (C[DA] =
   50 µg mL^−1) within the cells at t[exp] + t[inc] = 5 h + 24 h. The
   scale bar is 5 µm.

   Subsequently, LRP‐1 overexpressing bEnd.3 cells were utilized to assess
   the cellular uptake of Cy5.5‐labeled NCs. Flow cytometry analysis
   revealed that the uptake of NCs nearly reached saturation at 5 h
   post‐incubation (Figure [98]S17, Supporting Information). Importantly,
   the presence of cRGD within CRDA and HRDA significantly improved the
   efficiency of cellular uptake compared to CDA, demonstrating that cRGD
   facilitates cell adhesion of NCs. To closely mimic the neuronal
   microenvironment of PD, we employed a transwell system in conjunction
   with MPP^+ incubation to establish an in vitro PD model
   (Figure [99]2B). First, we incubated PC‐12 cells with MPP^+ to
   replicate the neuronal toxicity observed in PD. PC‐12 cells were
   utilized as an in vitro model to assess the therapeutic effects of the
   nanodrugs due to their ability to synthesize DA and their
   susceptibility to neurotoxins. MPP^+ exerts its toxicity by
   accumulating in mitochondria, where it blocks the activity of
   NADH‐ubiquinone oxidoreductase (complex I) of the mitochondrial
   electron transport system, leading to ATP depletion and leakage of
   DA into the cytosol from synaptic vesicles, which leads to ROS
   production.^[ [100]^29 , [101]^30 ^] Second, we employed a transwell
   system to mimic the BBB, where bEnd.3 cells were seeded on the apical
   side of the insert. The NCs were added to the apical compartment,
   allowing them to penetrate the bEnd.3 cell layer and reach the
   basolateral compartment containing the MPP^+‐treated PC‐12 cells.

   Therefore, the in vitro biofunction of NCs within PC‐12 cells incubated
   with MPP^+ was analyzed after penetrating bEnd.3 cells. First, PC‐12
   cells were incubated with 3 mM MPP^+ for 24 h. bEnd.3 cells were
   exposed to Cy5.5‐labeled NCs for a duration of 5 h (t[exp] = 5 h).
   Subsequently, the culture medium was refreshed for both bEnd.3 and
   PC‐12 cells. The bEnd.3 cells, now containing Cy5.5‐labeled NCs, were
   then co‐incubated with PC‐12 cells for an additional 24 h
   (t[inc] = 24 h). The penetration efficiency of NCs into PC‐12 cells was
   quantitatively assessed through the analysis of cellular fluorescence
   both at t[exp] = 5 h and the cumulative duration of t[exp] + t[inc] =
   5 h + 24 h. Given that flow cytometry quantifies fluorescence at the
   single‐cell level, it is essential to adjust for cell growth to
   accurately determine penetration efficiency (Figure [102]S18,
   Supporting Information). After normalization for growth factors, the
   penetration efficiency of CRDA and HRDA into PC‐12 cells was found to
   be 52.0% ± 4.6% and 61.3% ± 2.6%, respectively. In contrast, only
   19.2% ± 2.9% of CDA‐modified NCs were able to traverse bEnd.3 cells and
   enter PC‐12 cells (Figure [103]2C). The confocal images visualized the
   difference in penetration efficiency between three NCs
   (Figure [104]2D). These findings demonstrate that incorporating the
   cRGD motif into NCs significantly enhances their ability to be
   internalized by cells and improves their penetration efficiency.

2.3. In Vitro Therapeutic Effects of Nanocapsules in PD model

   The NCs were engineered to reduce neuroinflammation and enhance
   dopaminergic signaling following their penetration of the BBB.
   Subsequent in vitro analyses focused on the behavior of NCs after
   traversing bEnd.3 cell models. ROS levels and mitochondrial dysfunction
   are significant indicators of neuroinflammation. At t[exp] + t[inc] =
   5 h + 24 h, fluorescence microscopy revealed a significant reduction in
   DCFH, a marker used to quantify ROS levels (Figure [105] 3A; Figure
   [106]S19, Supporting Information). This reduction was markedly more
   pronounced in cells treated with L‐DOPA, CRDA, CDA and HRDA compared to
   those only treated with MPP^+, indicating a superior capability of the
   former in mitigating oxidative stress. Mitochondrial dysfunction is a
   characteristic phenomenon associated with neuroinflammation.
   Furthermore, we assessed mitochondrial integrity through JC‐1 staining
   at t[exp] + t[inc] = 5 h + 24 h. JC‐1 produces the red fluorescence
   from aggregates in the healthy mitochondria but green fluorescence in
   monomeric form in the cells with damaged mitochondria. Therefore, the
   fluorescent intensity ratio of JC‐1 red/green can be used to quantify
   the maintenance of mitochondrial membrane potential. A decrease in the
   red/green ratio with MPP^+ incubation of JC‐1 aggregates to monomers
   typically signifies the onset of cell death. Notably, our treatments
   counteracted this trend, as evidenced by an increased ratio, suggesting
   the protection of mitochondrial from ROS‐induced dysfunction
   (Figure [107]3B,C; Figure [108]S20, Supporting Information). Next, we
   explored the controlled release of DA from NCs at the cellular level.
   The results indicated that a mildly acidic environment (pH 6.4)
   facilitated the degradation of NCs, subsequently releasing DA
   (Figure [109]3D). This controlled release of DA from NCs under
   conditions mimicking the PD brain environment highlights their
   potential to restore dopaminergic signaling and alleviate PD symptoms.
   Misfolded α‐syn is a hallmark of PD, while tyrosine hydroxylase (TH)
   plays a crucial role in DA biosynthesis.^[ [110]^31 ^] Therefore, their
   expression levels serve as significant indicators of dopaminergic
   signaling. At t[exp] + t[inc] = 5 h + 24 h, the expression of α‐syn and
   TH in PC‐12 cells was analyzed via Western blot. The treatments notably
   upregulated TH and downregulated α‐syn expression, suggesting a
   therapeutic effect against PD pathology (Figure [111]3E; Figure
   [112]S21, Supporting Information). In summary, our findings demonstrate
   that the NCs, upon crossing the bEnd.3 cells, effectively reduce
   oxidative stress, mitigate mitochondrial dysfunction, and modulate the
   expression of critical enzymes associated with DA metabolism. Moreover,
   the capability of NCs to release DA under mildly acidic conditions
   further underscores their potential as a targeted therapeutic strategy
   for PD.

Figure 3.

   Figure 3
   [113]Open in a new tab

   Therapeutic Effects of NCs with In Vitro PD Model. A) Measurement of
   DCFH fluorescence (I[DCFH]) within PC‐12 cells after various treatments
   at t[exp] + t[inc] = 5 h + 24 h. The scale bar is 100 µm. B) Confocal
   microscopy images and C) quantification of the ratios of JC‐1
   aggregates to monomers in PC‐12 cells at t[exp] + t[inc] = 5 h + 24 h
   (n = 3). The scale bar is 5 µm. D) Release of DA from NCs
   (C[DA] = 50 µg mL^−1) into PC‐12 cells was measured after 5 h of
   incubation in complete cell media, pH 6.4 media, and pH 6.4 + ROSUP
   media (n = 3). E) Western blot images of TH and α‐syn in PC‐12 cells
   under various conditions at t[exp] + t[inc] = 5 h + 24 h. Statistical
   significance across different groups was determined using the one‐way
   ANOVA method, with significance levels denoted as *p < 0.05,
   **p < 0.01, ***p < 0.001.

2.4. In Vivo Brain Targeting Ability of Nanocapsules

   PD results in the upregulation of integrins within the BBB, which can
   be targeted by the cRGD peptide sequence. We hypothesized that NCs
   modified with cRGD could specifically target the PD‐altered BBB,
   enhancing the delivery of therapeutic agents to the affected brain
   regions. To validate our approach, we employed
   1‐Methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) to establish a PD
   model.^[ [114]^32 ^] MPTP serves as a classical neurotoxin that, upon
   crossing the BBB, is metabolized into its active form MPP^+, within the
   brain. MPP^+ selectively induces the loss of dopaminergic neurons in
   the substantia nigra, effectively replicating the neuropathological
   landscape of PD. To assess the brain‐targeting capabilities of our NCs,
   we initially administered Cy5.5‐labeled NCs to MPTP‐induced PD model
   mice and monitored the in vivo fluorescence using an in vivo imaging
   system (IVIS) (Figure [115]S22, Supporting Information). The peak
   accumulation of Cy5.5‐labeled NCs in the brain was observed at 5 h
   post‐administration. To further investigate the brain‐targeting
   efficacy between sham and MPTP‐treated mice, we incorporated Gadolinium
   (Gd) into the NCs through interactions with the cRGD peptide to
   construct Gd labeled NCs (NCs‐Gd), enabling visualization by magnetic
   resonance imaging (MRI) (Figure [116] 4A; Figure [117]S23, Supporting
   Information). MRI analysis confirmed that the accumulation of NCs‐Gd in
   the brain was discernible at 5 h post‐injection, with notably higher
   concentrations in MPTP mice compared to the sham group (Figure [118]4B;
   Figure [119]S24, Supporting Information). Subsequent quantitative
   analysis was performed by collecting and digesting brain tissues at 5 h
   post‐injection for Inductively Coupled Plasma (ICP) measurement of Gd
   content. The findings revealed that Gd levels in the MPTP group were
   ≈1.4 times higher than those in the sham group, indicating a
   significant enhancement in brain accumulation within the disease model
   (Figure [120]4C; Figure [121]S25, Supporting Information). Further
   investigations into the distribution of NCs within specific brain
   regions were conducted using frozen brain sections from mice
   administered with Cy5.5‐labeled NCs. Fluorescence imaging revealed that
   in MPTP mice, NCs were distributed across multiple brain areas,
   including the hippocampus, midbrain, and cerebellum, whereas in sham
   mice, NC distribution was primarily confined to the midbrain
   (Figure [122]4D). Although the incorporation of Gd into NCs altered
   their size distribution, zeta potential, and water solubility—which are
   factors known to influence in vivo distribution—these modifications did
   not preclude their utility as a comparative tool for assessing brain
   targeting efficacy between MPTP and sham groups. These findings
   collectively underscore the enhanced brain‐targeting capacity of the
   NCs, facilitated by the cRGD modification, which not only improved
   overall brain accumulation but also enabled penetration into a broader
   spectrum of brain regions.

Figure 4.

   Figure 4
   [123]Open in a new tab

   In Vivo Targeting Capability of NCs. A) Illustration of the synthesis
   process for Gd‐labeled NCs, outlining the step‐by‐step procedures
   involved in the preparation. B) MRI scans showcasing the brain of
   MPTP‐treated and sham mice following intravenous (i.v.) injection of
   CRDA and HRDA (C[DA] = 600 µg kg^−1) across various time intervals
   (n = 3). C) Quantification of Gd levels within the brain tissues of
   MPTP‐treated and sham mice post‐i.v. administration of CRDA and HRDA
   (C[DA] = 600 µg kg^−1) for 5 h. D) Confocal microscopy images of brain
   tissue sections from MPTP‐treated and sham mice after i.v. injection of
   CRDA and HRDA (C[DA] = 600 µg kg^−1) for 5 h. Statistical significance
   across different groups was determined using the one‐way ANOVA method,
   with significance levels denoted as *p < 0.05. The scale bar is 100 µm.

2.5. Behavioral Evaluation of In Vivo Treatment with Nanocapsules

   To establish a PD model, MPTP was administered intraperitoneally at a
   dose of 22.5 mg kg^−1 daily for 13 days to mice, as MPTP is known to
   selectively destroy dopaminergic neurons in the substantia nigra.
   Concurrently, NCs were administered to these mice via tail vein
   injection every three days to evaluate their therapeutic potential
   against PD (Figure [124] 5A). The mice were organized into six groups
   for behavioral assessment: 1) MPTP‐treated mice receiving saline (MPTP
   + saline), 2) MPTP‐treated mice receiving L‐DOPA (MPTP + L‐DOPA), 3)
   MPTP‐treated mice receiving CRDA (MPTP + CRDA), 4) MPTP‐treated mice
   receiving CDA (MPTP + CDA), 5) MPTP‐treated mice receiving HRDA (MPTP +
   HRDA), and 6) sham group. Given that PD symptoms encompass both
   non‐motor symptoms, such as cognitive impairment, and motor symptoms,
   our evaluations began with spatial learning and memory assessments
   using the Morris water maze—a benchmark test for rodent behavior
   (Figure [125]5B). The escape latency for the sham group diminished
   progressively across 4 days of trials, indicative of learning.
   Conversely, the MPTP + saline group showed no significant change in
   escape latency, underscoring locomotor impairment and delayed platform
   finding. Unlike the MPTP+ L‐DOPA and CRDA group, which demonstrated a
   decrease in escape latency over the 4‐day training session, the MPTP +
   CDA and MPTP + HRDA groups did not show a reduction in escape latency.
   After treatment, all groups showed improvements in locomotion and
   navigational efficiency during the maze testing session, although the
   extent of these improvements varied. Notably, the MPTP + CDA and MPTP +
   HRDA treatment groups had significantly longer distances traveled and
   greater platform latency compared to the MPTP + L‐DOPA and MPTP + CRDA
   groups (Figure [126]5C). Interestingly, the mice in the CDA and HRDA
   treatment groups exhibited inconsistent performance throughout the
   learning process. Motor coordination and balance were further assessed
   using the rotarod test (Figure [127]5D). After two days of training,
   the sham group completed the test within 300 s, while the MPTP + saline
   group exhibited a significant reduction in fall latency. CRDA treatment
   notably improved fall latency, indicating enhanced balance and motor
   coordination in MPTP‐treated mice. The pole test, used to evaluate
   movement disorders resulting from striatal DA loss, showed that the
   MPTP + saline group took longer to descend, reflecting movement
   slowness. All treatments ameliorated movement speed and reduced descent
   time (Figure [128]5E). Lastly, the open field test assessed spontaneous
   locomotor activity and anxiety levels. The MPTP treatment significantly
   diminished overall distance moved, center distance (indicated by green
   box), and center time, indicating reduced locomotor activity,
   exploratory behavior, and increased anxiety in the MPTP + saline group
   (Figure [129]5F,G; Figure [130]S26, Supporting Information). Treatment
   with the three NCs improved general locomotion and exploratory
   behavior. Body weight changes in mice can serve as an additional metric
   for assessing therapeutic efficacy. Treatment with MPTP significantly
   reduced body weight, whereas subsequent administration of CRDA was
   associated with an increase in body weight in MPTP‐treated mice (Figure
   [131]S27, Supporting Information). Although the various behavioral
   tests assessed different aspects of therapeutic outcomes, CRDA
   demonstrated superior efficacy through a stable increase in learning
   and memory, enhanced locomotor activity, and improved motor
   coordination. In summary, CRDA showed the most promising therapeutic
   outcomes based on behavioral tests, highlighting its potential as a
   synergistic therapy for PD.

Figure 5.

   Figure 5
   [132]Open in a new tab

   Therapeutic NCs Enhance Locomotor Activity, Spatial Learning, and Motor
   Coordination in PD Model Mice. A) Timeline depicting the schedule of
   behavioral tests conducted to assess the efficacy of therapeutic NCs on
   PD model mice. B) Learning curve of MPTP‐treated mice under various
   treatments over a 4‐day training period. Morris water maze test
   includes analyses of traveled distance to the target zone and latency
   to reach the platform on the testing day for all treatment groups
   (n = 7). C) Representative swimming paths in the Morris water maze test
   on the testing day. D) Latency to fall from the rotating rod in the
   rotarod test (n = 6). E) Climbing time (in seconds) recorded in the
   pole test (n = 5). F) Total distance traveled in the open field test
   (n = 7). G) Representative paths taken during the open field test for
   each treatment group. Statistical significance across different groups
   was determined using the one‐way ANOVA method, with significance levels
   denoted as *p < 0.05, **p < 0.01, ***p < 0.001.

2.6. Therapeutic Nanocapsules Enhance the Dopaminergic Signaling

   To elucidate the therapeutic effects of NCs, we employed mRNA
   sequencing to analyze gene expression changes within the substantia
   nigra. Differential expression analysis, visualized through a volcano
   plot with a cutoff of P ≤ 0.05 and a fold change (FC) ≥ 1.5, revealed
   315 genes significantly downregulated and 305 genes significantly
   upregulated between Sham and MPTP + Saline groups (Figure [133] 6A).
   Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment
   analysis of these genes highlighted the neuroactive ligand‐receptor
   interaction pathway as the most enriched (Figure [134]6B). Applying the
   same methodology to compare MPTP + CRDA and MPTP + Saline groups, we
   identified 55 genes with significant downregulation and 72 genes with
   significant upregulation within the neuroactive ligand‐receptor
   interaction pathway (Figure [135]6C,D). This pathway is integral to
   neurotransmitter signaling, neural activity, learning, and memory,
   underscoring the potential of NCs to regulate dopaminergic
   neurotransmission.^[ [136]^33 , [137]^34 ^]

Figure 6.

   Figure 6
   [138]Open in a new tab

   mRNA Sequencing Unveils Gene‐Level Mechanisms. A) Volcano plot
   illustrating gene expression differences between Sham and MPTP + Saline
   cases, with 315 upregulated genes in red and 305 downregulated genes in
   green. B) The top 20 KEGG pathways associated with differentially
   expressed genes (DEGs) in the Sham vs MPTP + Saline comparison. C)
   Volcano plot for the comparison between MPTP + CRDA and MPTP + Saline
   cases, showing 72 upregulated genes in red and 55 downregulated genes
   in green. D) The top 20 KEGG pathways for DEGs in the MPTP + CRDA vs
   MPTP + Saline comparison. These results are from three independent
   samples (n = 3).

   Our NCs are specifically designed to enhance DA delivery to the brain
   parenchyma and amplify DA‐related signaling. To further investigate
   NCs' impact on dopaminergic signaling, we systematically measured
   related proteins. TH, the rate‐limiting enzyme in DA synthesis,
   catalyzes the conversion of tyrosine to L‐DOPA and subsequently to
   DA.^[ [139]^35 ^] The dopamine transporter (DAT) plays a pivotal role
   in DA reuptake into presynaptic terminals, essential for maintaining DA
   concentration and availability.^[ [140]^36 ^] DA operates through
   various receptors, with the dopamine D2 receptor (DRD2) located in key
   areas such as the striatum, substantia nigra, and hippocampus,
   regulating DA synthesis and TH activity.^[ [141]^37 ^] DRD2 also
   influences neuronal excitability and signal transduction, affecting
   behavior and cognitive functions. Additionally, brain‐derived
   neurotrophic factor (BDNF) promotes the survival and differentiation of
   dopaminergic neurons, playing a significant role in DA synthesis and
   release.^[ [142]^38 ^] These proteins are closely related to
   dopaminergic signaling from synthesis to function was systematically
   studied.^[ [143]^39 ^]

   Immunohistochemistry (IHC) images of TH demonstrated a significant loss
   in the striatum and substantia nigra of MPTP‐treated mice, which was
   ameliorated following treatment, with NCs showing superior therapeutic
   outcomes compared to L‐DOPA (Figure [144] 7A; Figure [145]S28,
   Supporting Information). Reverse transcription‐quantitative polymerase
   chain reaction PCR (RT‐qPCR) and western blot analyses systematically
   evaluated TH, DAT, DRD2, and BDNF across all groups in the striatum and
   substantia nigra, showing a reduction in these proteins at both mRNA
   and protein levels following MPTP administration. All treatments
   notably upregulated these four proteins in MPTP‐treated mice, with CRDA
   exhibiting the most significant therapeutic effects (Figure [146]7B–E;
   Figures [147]S29–S31, Supporting Information). Additionally, the
   enhancement of dopaminergic signaling‐related proteins is more
   pronounced in the substantia nigra as compared to striatum
   (Figure [148]7; Figure [149]S31, Supporting Information). Furthermore,
   direct measurement of DA levels in the striatum and substantia nigra
   via ELISA indicated that MPTP administration substantially reduced
   dopamine levels. CRDA and HRDA treatments elevated DA levels in the
   striatum and substantia nigra of MPTP‐treated mice by ≈1.8‐ and
   3.5‐fold, respectively. These increases in DA levels were more
   pronounced compared to those observed with L‐DOPA and CDA treatments.
   Furthermore, the results indicated that the increase in DA levels was
   more significant in the substantia nigra than in the striatum
   (Figure [150]7F).

Figure 7.

   Figure 7
   [151]Open in a new tab

   Enhancement of Dopaminergic Signaling by Therapeutic NCs at Gene and
   Protein Levels. A) IHC for TH in brain sections of the striatum and
   substantia nigra across all experimental groups. The scale bar is
   800 µm. B) Analysis of relative mRNA expression levels for TH, DAT,
   DRD2, and BDNF in the striatum of mice from each group (n = 6),
   conducted via RT‐qPCR. C) Western blot analysis revealing protein
   expression of TH, DAT, DRD2, and BDNF in the striatum of MPTP‐treated
   mice receiving various NC treatments. D) RT‐qPCR analysis of relative
   mRNA levels for TH, DAT, DRD2, and BDNF in the substantia nigra of mice
   across all groups (n = 6). E) Protein expression of TH, DAT, DRD2, and
   BDNF in the substantia nigra of MPTP‐treated mice under different
   treatment conditions, as shown by western blot analysis. Other two
   replicates were shown in Figures [152]S29 and [153]S30 (Supporting
   Information). F) Measurement of DA levels in the striatum and
   substantia nigra of MPTP mice subjected to various treatments (n = 4).
   G) A summary statement that therapeutic NCs significantly boost
   DA‐related proteins from synthesis to functionality, affirming their
   effect at both mRNA and protein levels. Statistical significance across
   different groups was determined using the one‐way ANOVA method, with
   significance levels denoted as *p < 0.05, **p < 0.01, ***p < 0.001.

   In summary, mRNA sequencing suggested that NCs modulate the
   neurotransmitter pathway. A comprehensive analysis of DA‐related
   proteins, from synthesis to function, at both mRNA and protein levels,
   revealed that NCs not only increase DA levels but also upregulate
   associated proteins, highlighting their potential in therapeutic
   applications (Figure [154]7G). Treatments with CRDA and HRDA
   demonstrated more pronounced improvements in the expression of
   dopaminergic signaling‐related proteins and DA levels compared to
   L‐DOPA and CDA. These findings highlight the advantages of
   nanoformulation and cRGD modification in enhancing the therapeutic
   efficacy of the nanodrugs. Furthermore, the improvements observed in
   the substantia nigra were more significant than those in the striatum.

2.7. Decrease in Neuroinflammation through the Reduction of Endoplasmic
Reticulum Stress

   ER stress has been implicated in the pathogenesis of PD, contributing
   to neuroinflammation. The results of Gene Set Enrichment Analysis
   (GSEA) from mRNA sequencing demonstrated that CRDA significantly
   downregulated the protein processing pathway in the ER, as evidenced by
   a Normalized Enrichment Score (NES) of ‐1.95, a P‐value of 0.00, and a
   False Discovery Rate (FDR) q‐value of 0.036 (Figure [155] 8A). The ER
   plays a crucial role in protein synthesis, and misfolded or unfolded
   α‐syn has been shown to contribute to sustained ER stress, triggering
   the activation of the unfolded protein response (UPR).^[ [156]^4 ^] The
   UPR is mediated by complex stress sensors located at the ER membrane,
   among which ATF6 is a critical sensor associated with UPR activation
   and directly related to inflammatory responses, including an increase
   in ROS and activated glial cells (Figure [157]8B).^[ [158]^40 ^]

Figure 8.

   Figure 8
   [159]Open in a new tab

   Impact of Therapeutic NCs on Neuroinflammation via ER Stress
   Modulation. A) GSEA of KEGG terms comparing MPTP + CRDA to MPTP +
   Saline groups. B) The mechanism of reduction in neuroinflammation of
   NCs by decreasing α‐syn, ATF6, and ROS. C) IHC for α‐syn in brain
   sections of the striatum and substantia nigra for all experimental
   groups. The scale bar is 800 µm. D,F) RT‐qPCR analysis of relative mRNA
   levels for α‐syn and ATF6 in the striatum D) and substantia nigra F) of
   mice, quantifying gene expression across groups (n = 6). E,G) Western
   blot analysis for protein expression of α‐syn and ATF6 in the striatum
   E) and substantia nigra G) of mice. Other two replicates were shown in
   Figures [160]S29 and [161]S30 (Supporting Information). H) ROS staining
   in brain sections of the striatum and substantia nigra across all
   groups. The scale bar is 1000 and 200 µm. Statistical significance
   across different groups was determined using the one‐way ANOVA method,
   with significance levels denoted as *p < 0.05, **p < 0.01,
   ***p < 0.001.

   To systematically investigate the effects of NCs on ER stress, we
   measured the expression levels of α‐syn, ATF6, ROS, and
   neuroinflammation markers. IHC staining of α‐syn revealed that the MPTP
   + saline group exhibited high intensity in both the striatum and
   substantia nigra, whereas all treatments significantly reduced α‐syn
   concentration in these areas (Figure [162]8C; [163]S29–S32 only with
   Figure [164]S32, Supporting Information). Subsequent RT‐qPCR and
   Western blot analyses confirmed that MPTP administration upregulated
   α‐syn and ATF6 at both mRNA and protein levels in striatum and
   substantia nigra, while all treatments downregulated these markers
   (Figure [165]8D–G; Figure [166]S29–S31, Supporting Information). Among
   the experimental results, the reduction of α‐syn and ATF6 in the groups
   treated with CRDA is more pronounced than in the group treated with
   other treatments. This result aligns with dopaminergic signaling and
   the reduction is particularly noticeable in the substantia nigra.
   Additionally, ROS staining indicated a decrease in ROS intensity in the
   striatum and substantia nigra of MPTP‐treated mice following
   therapeutic interventions (Figure [167]8H; Figure [168]S33, Supporting
   Information). These findings suggest that NCs effectively reduce ER
   stress by downregulating α‐syn and ATF6 expression, consequently
   decreasing neuroinflammation, as evidenced by the reduction in ROS. The
   ability of NCs to modulate the ER stress pathway and alleviate
   neuroinflammation highlights their potential as a therapeutic strategy
   for PD.

   Astrocytes and microglia play crucial roles in neuroinflammation, a key
   feature of PD. Glial fibrillary acidic protein (GFAP), predominantly
   expressed in astrocytes, serves as a marker of astrocyte activation in
   response to neuroinflammation.^[ [169]^41 ^] GFAP staining revealed
   that MPTP administration significantly increased GFAP levels in the
   striatum and substantia nigra, which was reversed by the treatments
   (Figure [170] 9A,B,E,F). Among these, CRDA and HRDA treatments
   demonstrated superior therapeutic outcomes. Similarly, ionized
   calcium‐binding adaptor molecule 1 (Iba‐1), a biomarker for microglial
   activation and a key feature of neuroinflammation,^[ [171]^42 ^] was
   also evaluated. IHC staining showed that MPTP treatment significantly
   increased Iba‐1 intensity in the striatum and substantia nigra, while
   treatments, particularly with CRDA, reduced Iba‐1 levels
   (Figure [172]9C,D,G,H). The cyclical process of DA loss and
   neuroinflammation accelerates PD progression. To address this, our NCs
   are engineered to deliver CAT into the brain parenchyma, aiming to
   mitigate neuroinflammation and enhance DA efficacy. Collectively, our
   findings indicate that CRDA alleviate ER stress by reducing α‐syn,
   ATF6, and ROS levels, thereby diminishing neuroinflammation.
   Integrating the data on dopaminergic signaling, the in vivo therapeutic
   outcomes of CRDA were more pronounced than those of other treatments.
   This finding underscores the importance of a synergistic approach in
   the treatment of PD, where the combination of nanoformulation, cRGD
   modification, and the CAT loading work together to enhance the overall
   therapeutic efficacy.

Figure 9.

   Figure 9
   [173]Open in a new tab

   Reduction of Neuroinflammation by Therapeutic Nanocapsules. A)
   Immunofluorescence staining for GFAP in the striatum of mice from all
   experimental groups. B) IHC staining for GFAP in the substantia nigra
   across all groups. C,D) IHC staining for ‐ Iba‐1 in the striatum C) and
   substantia nigra D) for each group. E–H) Quantitative analysis of GFAP
   and Iba 1 expression in the striatum and substantia nigra, performed
   using Image J software. The presented quantitative results of IHC are
   derived from three independent samples (n = 3). Statistical
   significance across different groups was determined using the one‐way
   ANOVA method, with significance levels denoted as *p < 0.05,
   **p < 0.01, ***p < 0.001.

   In addition to their therapeutic efficacy, the in vivo biocompatibility
   of the NCs was confirmed following the treatment regimen. Serum
   biomarkers associated with liver and kidney function, including alanine
   aminotransferase (ALT), aspartate aminotransferase (AST), blood urea
   nitrogen (BUN), and creatinine (CREA), showed no significant changes in
   most groups, with only a marginal decrease in CREA levels in the MPTP +
   HRDA group compared to the Sham group (Figure [174]S34A–D, Supporting
   Information). Additionally, hematoxylin and eosin (HE) staining of
   vital organs such as the heart, liver, spleen, lung, and kidney
   revealed no apparent tissue damage post‐NCs treatments (Figure
   [175]S34E, Supporting Information). Collectively, these findings
   underscore the favorable in vivo biocompatibility of the NCs,
   highlighting their potential as therapeutic agents.

3. Conclusion

   This study aimed to address the challenges associated with the delivery
   of therapeutic agents to the brain for the treatment of PD. We
   introduced a novel approach for the co‐delivery of CAT and DA directly
   to the brain parenchyma using carrier‐free NCs. The carrier‐free NCs
   constructed by reaction with DA and FBA, which serve as a versatile
   platform for the simultaneous delivery of macromolecules and small
   molecules containing primary amine and catechol groups. The stability
   of the NCs under neutral conditions and their controlled degradation in
   mildly acidic environments enable the efficient release of DA at the
   target site. The incorporation of cRGD modification within CAT enhances
   the delivery efficiency of the NCs to the parkinsonian brain by
   ≈1.4‐fold, as it enables the recognition of integrins overexpressed on
   the BBB in the PD state. This targeted delivery approach also allows
   for a broader distribution of the therapeutic agents within brain
   tissues.

   The therapeutic strategy employed by carrier‐free NCs offers a
   synergistic approach to PD treatment. First, the NCs significantly
   increase brain DA levels by 1.8‐fold in the striatum and 3.5‐fold in
   the substantia nigra, respectively. The NCs further boost the activity
   of dopaminergic signaling‐related proteins, substantially alleviating
   PD symptoms. Second, the NCs markedly reduce neuroinflammation, which
   not only slows the progression of PD but also protects DA from
   oxidation. By integrating symptomatic and etiological treatments, our
   NCs present a comprehensive and innovative approach to PD therapy. This
   study demonstrates the potential of biocompatible, multi‐target
   nanoformulations in overcoming the limitations of current PD
   treatments.

   In conclusion, our findings provide a new strategic avenue for
   advancing the treatment of PD and pave the way for future research and
   clinical applications of targeted, synergistic nanotherapeutics in the
   field of neurodegenerative diseases.

4. Experimental Section

Synthesis and Characterizations of CAT‐cRGD

   In order to make the CAT‐cRGD complex, first, 30 mg of CAT was
   dissolved in 10 mL of PBS to create a solution. Then, 182.25 µL of
   N‐Succinimidyl iodoacetate (SIA; 1 mg mL^−1 in dimethylformamide (DMF);
   Aladdin, #N133327, China) was slowly added to the CAT solution. This
   mixture was then maintained at room temperature (RT) in a dark
   environment to enable the reaction to proceed for 1.5 h. Following the
   initial reaction period, the CAT‐SIA conjugate was isolated using an
   ultracentrifuge filter with a molecular weight cutoff of 100 kDa. The
   centrifugation was conducted at 6000 rpm for a duration of 30 min.
   Concurrently, cRGD, sourced from GL Biochem, were dissolved in a
   mixture of acetonitrile and ultrapure water at a ratio of 1:4 to
   achieve a concentration of 1 mg mL^−1. This solution was combined with
   461 µL of the prepared cRGD solution and 49.5 µL of hydroxylamine
   (Aladdin, #H164487, China) and then added to the CAT‐SIA solution at a
   temperature of 4 °C. The resulting solution was allowed to react
   overnight. Following the overnight incubation, 77.63 µg of cysteine
   (Aladdin, #C100539, China) was introduced into the reaction mixture. To
   purify the resultant CAT‐cRGD product, the solution underwent dialysis
   against a 100 kDa cutoff membrane at 4 °C for 6 h. The molecular weight
   of the purified CAT‐cRGD conjugate was determined using 10% sodium
   dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE). The
   enzymatic activity of the CAT‐cRGD complex was assessed via a
   colorimetric assay. This involved a reaction mix containing
   3,3′,5,5′‐tetramethylbenzidine (C[TMB] = 2.5 mm, Aladdin, #T100415,
   China), hydrogen peroxide (C[H2O2] = 88.2 mM, Aladdin, #H433857,
   China), and the CAT‐cRGD or CAT alone (both at a concentration of
   1 mg mL^−1) in sodium acetate‐acetic acid (NaOAc‐HAc) buffer with a pH
   of 5. The progression of the reaction was monitored and documented
   using a digital camera. Using the same procedure, a human serum albumin
   (HSA)‐cRGD conjugate was also synthesized for comparison. The key point
   of this procedure was that the reaction and purification steps should
   be carried out at 4 °C. Despite these precautions, a portion of the CAT
   may lose its enzymatic viability after the cRGD modification.
   Therefore, it was essential to quantify the CAT‐cRGD by measuring the
   enzymatic viability of CAT rather than relying solely on the
   concentration.

Synthesis and Characterization of Carrier‐Free Nanocapsules

   An inner‐core nanoparticle solution was synthesized by dissolving a
   mixture of CAT‐cRGD/CAT/HSA‐cRGD (4 mg), DA (m[DA] = 3.8 mg, Aladdin, #
   A303863, China), and FBA (m[FBA] = 1.5 mg, Aladdin, # F106771, China)
   in 10 mL of Citric acid–Na[2]HPO[4] buffer (pH 7.8) containing ascorbic
   acid (AA, m[AA] = 8.8 mg, Aladdin, # A103534, China). The reaction was
   allowed to proceed for 3.5 h at RT. The nanoparticles were then
   purified using a centrifuge at 1500 rpm for 15 min, followed by
   dialysis against ultrapure water at pH 8.0 over 6 h using a 100 kDa
   membrane. To demonstrate the versatility of the synthesis procedure,
   the macromolecules were replaced with pepsin (Pep, Aladdin, # P110927,
   China), bovine serum albumin (BSA, Aladdin, # A104912, China),
   hemoglobin (Hb, Aladdin, #H195714, China), and α‐chymotrypsin (α‐CT,
   Aladdin, # C128654, China). Similar methods were applied to small
   molecules such as levodopa (L‐DOPA, Aladdin, #D111049, China) and
   norepinephrine (NE, Aladdin, #L335487, China).

   Subsequently, these inner‐core nanoparticles were incubated with Ang
   supplied by Shanghai GL Biochem at a mass ratio of 1:0.5 for 1 h at RT.
   The therapeutic nanoparticles formed were further purified via dialysis
   in ultrapure water at pH 8.0 for 6 h using a 100 kDa membrane, followed
   by lyophilization to yield the final NCs. The critical aspect of the
   carrier‐free NCs synthesis was the inclusion of an anti‐oxidant
   reagent, such as ascorbic acid, in the buffer. DA, which contains two
   phenol groups, is highly susceptible to oxidation. To construct the NCs
   effectively, it was crucial to use non‐oxidized dopamine in the
   reaction.

   The hydrodynamic size distributions (N(d[h])) of the obtained NCs were
   characterized using DLS in a UV‐cuvette (ZH 8.5 mm; Deckel; Sarstedt,
   Germany). The ζ‐potential distribution (I(ζ)) was also recorded using
   DLS with laser Doppler anemometry (LDA). To assess the stability of the
   NCs, they were incubated in PBS for 96 h and characterized periodically
   using DLS. The morphology of three representative NCs was imaged using
   TEM (Talos F200S SUPERX, Thermo Scientific, USA).

   The enzyme stability of CAT within the CRDA and CDA was evaluated in
   PBS for 96 h. CRDA, CDA, and free CAT were each dissolved in 1 mL of
   PBS (C[CAT] = 50 µg mL^−1) and maintained at RT. CAT activity was first
   measured at t = 0 h as a control using a testing kit (Solarbio,
   #BC0200, China), with subsequent CAT viability normalized to 100% at
   t = 0 h and expressed as percentage viabilities at different time
   points. Details on the quantification of components within the NCs are
   provided in the Supporting Information.

Stimuli‐Responsive Release of DA

   To investigate the stimuli‐responsive release of DA, HPLC was initially
   employed in conjunction with Electrospray Ionization Mass Spectrometry
   (ESI‐MS) for verification purposes. CRDA and HRDA were prepared at a
   concentration of C[DA] = 30 µg mL^−1. These samples were incubated in
   citric acid‐Na[2]HPO[4] buffer solutions at different pH levels (7.4,
   6.4) and also in a citric acid‐Na[2]HPO[4] buffer (pH 6.4) supplemented
   with ROUSP (ratio 1:1000, Beyotime, #S0033S, China) for a duration of
   72 h. The released DA was isolated using an ultracentrifuge filter
   (5 kDa) at 8000 rpm for 30 min. The filtrates were collected and their
   DA content was quantified using HPLC. The HPLC procedure, as outlined
   in Supporting Information, was consistently applied across all samples.
   Fractions with retention times ranging from 2 to 2.5 min were gathered
   and subsequently analyzed by ESI‐MS to verify the molecular weight of
   DA, thereby confirming its stimuli‐responsive release. Additionally,
   the DA release profiles of CRDA and HRDA at an elevated concentration
   (C[DA] = 50 µg mL^−1) were quantitatively assessed through HPLC. The
   HPLC analysis and the preparation of the standard curve were conducted
   according to the methods described in Supporting Information.

   Furthermore, the influence of pH on the stimuli‐responsive release of
   DA was visually documented. During a 2 h incubation period, CAT
   (C[CAT] = 1 mg mL^−1) and DA (C[DA] = 1 mg mL^−1) were incubated in
   citric acid‐Na[2]HPO[4] buffer solutions at pH 7.4 and 6.4, with and
   without the addition of ROUSP. After incubation, the effects of pH were
   visually documented through photographs taken with a digital camera.

Cell Cultures, Cytotoxicity Assays, and Cellular Uptake

   The cell experiments of study adopted mouse brain endothelial cell line
   bEnd.3 (passage numbers 5–15) and the rat pheochromocytoma cell line
   PC‐12 (passage numbers 5–15). These cell lines were grown in Dulbecco's
   Modified Eagle Medium (DMEM, Gibco, USA) with 10% fetal bovine serum
   (FBS) (Excell, China) and 100 U mL^−1 penicillin/streptomycin (Gibco,
   USA), and were incubated at 37 °C in a 5% CO[2] atmosphere. To assess
   the cytotoxic effects of CRDA, CDA, and HRDA on bEnd.3 and PC‐12 cells,
   the resazurin assay was employed for cell viability evaluation, which
   is described in the Supporting Information. The methods of
   time‐dependent cellular uptake are provided in Supporting Information.

In Vitro PD Model for Detecting NC Penetration Efficiency

   To simulate the neuronal microenvironment affected by PD, an in vitro
   model was established using PC‐12 cells and bEnd.3 cells. PC‐12 cells
   were plated at 100,000 cells per well in 24‐well plates (1.9 cm^2
   surface area) and cultured in 1 mL of complete medium. On the next day,
   these cells were treated with MPP^+ at a concentration of 3 mM Mfor
   24 h to induce a PD‐like condition. Concurrently, bEnd.3 cells were
   seeded on transwell inserts (pore size: 0.4 µm, diameter: 6.5 mm,
   Costar, USA) at a density of 60,000 cells per well. The following day,
   these endothelial cells were exposed to the NCs (C[DA] = 50 µg mL^−1)
   in 0.3 mL of complete medium for 5 h (t[exp] = 5 h). Part of this setup
   was designated for flow cytometry analysis to assess cellular uptake,
   while the remaining setup was reserved for further examination.
   Post‐exposure, both PC‐12 and bEnd.3 cells were washed with PBS and
   then incubated in a fresh medium. Subsequently, the bEnd.3
   cell‐containing inserts were placed over the PC‐12 cells treated with
   MPP^+ for an additional incubation time for 24 h to evaluate NC
   penetration from the apical to the basolateral chamber (t[inc] = 24 h).
   The intracellular fluorescence in cells from both chambers was
   quantified via flow cytometry, considering both the exposure and
   incubation periods (t[exp] + t[inc] = 5 h + 24 h), to ascertain the
   penetration efficiency. This assessment accounted for cell
   proliferation, adjusting the penetration efficiency calculations based
   on cell counts and growth factors as detailed in Figure [176]S18
   (Supporting Information). Additionally, confocal laser scanning
   microscopy (CLSM; LSM900, Zeiss, Germany) was employed for visualizing
   the penetration efficiency. At the conclusion of the experiment, cells
   were fixed with 4% paraformaldehyde, rinsed, and stained with DAPI
   (Beyotime, #C1006, China) before imaging under CLSM

Therapeutic Outcomes of NCs Characterized by an In Vitro PD Model

   To evaluate the therapeutic potential of NCs in a PD model, their
   anti‐inflammatory capabilities were focused on, specifically their
   effectiveness in scavenging ROS and regulating mitochondrial
   dysfunction. The intracellular ROS levels were determined using 2',7'
   –dichlorofluorescein diacetate (DCFH‐DA), a widely accepted indicator,
   where DCFH‐DA fluorescence intensity directly correlates with ROS
   concentration. Following the in vitro PD model protocol, PC‐12 cells
   were treated with the three distinct NCs for a combined exposure and
   incubation time (t[exp] + t[inc] = 5 h + 24 h). Post‐treatment, cells
   underwent a double PBS wash and were incubated with 0.5 mL of 0.1%
   DCFH‐DA (Beyotime, #S0033S, China) in serum‐free DMEM for 30 min at
   37 °C. Following another PBS wash, cells were exposed to serum‐free
   DMEM and the fluorescence of DCFH was quantified using both a
   microplate reader (Envision@2015, PerkinElmer, USA) and an inverted
   fluorescence microscope (Eclipse Ti2, Nikon, Japan) at specified
   excitation and emission wavelengths.

   Mitochondrial dysfunction, indicative of cellular health and a
   precursor to apoptosis, was assessed using the JC‐1 probe. JC‐1's
   aggregation within the mitochondrial matrix results in red
   fluorescence, which shifts to green as mitochondrial potential
   decreases. This shift was a critical early indicator of apoptosis. At
   t[exp] + t[inc] = 5 h + 24 h, the treated PC‐12 cells were incubated
   with 0.5 mL of 0.5% JC‐1 (Beyotime, #C2003S, China) in complete DMEM
   for 20 min at 37 °C, followed by washing and exposure to FBS‐free DMEM.
   The JC‐1 fluorescence was then analyzed using both a microplate reader
   and CLSM (LSM900, Zeiss, Germany).

   To further elucidate the therapeutic impacts, protein expression levels
   of α‐syn and TH were analyzed post‐treatment (t[exp] + t[inc] =
   5 h + 24 h,). PC‐12 cells were lysed, centrifuged to remove debris, and
   the supernatants were assayed for protein concentration using the
   Bradford method (Beyotime, #P0006C, China). Forty micrograms of
   proteins were separated via 12% SDS‐PAGE. The gels were subsequently
   transferred onto polyvinylidene fluoride(PVDF) membranes using standard
   procedures. The PVDF membranes were then subjected to immunoblotting
   them with primary and secondary antibodies. Immunoreactive bands were
   visualized using enhanced chemiluminescence (Beyotime, #P0018AS, China)
   and captured with a gel documentation system. The following antibody
   dilutions were used: 1:1000 for rabbit polyclonal antibodies against
   α‐syn (Abacm, #ab51253, UK), 1:5000 for rabbit polyclonal antibodies
   against TH (Abcam, #ab137869, UK), 1:2000 for rabbit polyclonal
   antibodies against β‐actin (Proteintech, #120536‐1‐AP, China), and
   1:2000 for goat anti‐rabbit IgG (H+L) peroxidase/HRP‐conjugated
   secondary antibodies (Elabscience, #E‐AB‐1003, China).

   Lastly, the release of DA monomers from NCs was quantified in PC‐12
   cells under various conditions, including neutral and acidic media,
   with and without MPP^+. PC‐12 cells were cultured in 24‐well plates,
   each well possessing a surface area of 1.9 cm^2 and containing 150,000
   cells in 1 mL of medium. The day following seeding, the medium was
   adjusted to a pH of 6.4 by incorporating 1 m HCl into
   serum‐supplemented medium. Additionally, a specialized medium (pH 6.4 +
   MPP^+) was prepared by diluting MPP^+ reagent into complete DMEM to
   achieve a final concentration of C[MPP+] = 3 mm. The cells were then
   treated with three different NCs at a dosage of C[DA] = 50 µg mL^−1,
   utilizing complete DMEM, pH‐adjusted medium (pH 6.4), and the pH 6.4
   medium supplemented with MPP^+, for a duration of 5 h. The supernatant
   was collected after treatments, and the cells underwent two PBS washes.
   Cell detachment was facilitated using 0.05% trypsin/EDTA, applied in a
   volume of 0.1 mL. Subsequent to trypsin removal, 0.3 mL of medium was
   added to facilitate the collection of cell pellets through
   centrifugation at 400 g for 8 min. After a double PBS wash, the cell
   pellets were resuspended in 0.1 mL of PBS. A handheld homogenizer was
   employed to disrupt the cell samples, preparing them for analysis. The
   quantification of DA release was conducted using a DA ELISA Kit
   (CUSABIO, # CSB‐E08661m, China), adhering strictly to the provided
   manufacturer's protocol. This approach enabled the precise measurement
   of DA concentrations in both the supernatant and cell lysates,
   providing insight into the efficiency of DA monomer release from the
   NCs under different experimental conditions.

Gadolinium Labeling through Chelation Reaction

   For the Gd labeling of NCs, CRDA, or HRDA was dissolved in 1 mL of
   citric acid‐Na[2]HPO[4] buffer (pH 7.4) at a concentration of 22 µM.
   Subsequently, 230 µM of GdCl[3]·6H[2]O was prepared in 9 mL of the same
   buffer. The NC solutions were then incrementally added to the
   GdCl[3]·6H[2]O solution. The mixture was vigorously stirred and allowed
   to react for 24 h at RT. Following this, unbound Gd^3+ ions were
   removed via membrane dialysis using a membrane with a 5 kDa molecular
   weight cutoff. The Gd‐labeled NCs were subsequently collected through
   lyophilization. The hydrodynamic size (d[h(N)]) and surface zeta
   potential (Iζ) of the Gd‐labeled CRDA (Gd‐CRDA) and Gd‐labeled HRDA
   (Gd‐HRDA) were determined DLS as outlined in previous sections. The
   quantification of Gd content within the labeled NCs was performed using
   ICP‐MS. Samples for ICP‐MS analysis were prepared by digesting the NCs
   in aqua regia, followed by appropriate dilution. The digested and
   diluted samples were then analyzed by ICP‐MS to determine the
   concentration of Gd present.

In Vivo Brain Targeting Ability of NCs

   All animal procedures were approved by the Committee on Experimental
   Animal at Central South University (grant number: CSU‐2023‐0273). To
   establish a PD model in mice, MPTP (C[MPTP] = 22.5 mg kg^−1, Saline
   with 6% DMSO, Macklin, #M917275, China) was administered via
   intraperitoneal injection over a period of 13 days. The brain‐targeting
   capability of the NCs was then assessed. Cy5.5‐labeled NCs were
   administered intravenously at a dosage of C[DA] = 600 µg kg^−1 to male
   C57BL/6J mice (20–22 g) for durations of 3, 5, and 7 h. The mice were
   purchased from Hunan SJA Laboratory Animal Co., Ltd. The in vivo
   fluorescence attributed to Cy5.5 was monitored using an IVIS Lumina II
   system (Perkin Elmer, USA).

   For in vivo brain MRI, Gd‐CRDA, and Gd‐HRDA (C[DA] = 600 µg kg^−1) were
   introduced to the mice via tail vein injection. MRI scans of the mouse
   brain were performed on a 3 Tesla MR scanner (GE, USA) at
   post‐injection times of 5, 12, and 24 h. T1‐weighted imaging was
   conducted using a conventional sequence with the parameters: repetition
   time (TR) = 679 ms, echo time (TE) = 9.5 ms, matrix size = 256 × 256,
   field of view (FOV) = 31 × 16 mm^2, slice thickness = 1 mm, and number
   of slices = 18. For assessing the concentration‐dependent effects of
   Gd‐labeled NCs, MRI scans were also carried out under the following
   conditions: TR = 773 ms, TE = 10 ms, matrix size = 256 × 256,
   FOV = 29 × 14 mm^2, slice thickness = 1 mm, and number of slices = 20.
   The data was analyzed by DOCIM viewer with hotmetal bar. For the NCs,
   the images were further analyzed by image J to calculate the standard
   curve.

   Subsequently, the Gd content within the brain tissue was quantified
   using ICP‐MS. Brain tissues were harvested 5 h post‐injection of
   Gd‐CRDA and Gd‐HRDA, weighed, and digested in 4 mL of nitric acid over
   3 days. A 40 µL aliquot of the digested sample was diluted with
   ultrapure water to a final volume of 2 mL for ICP‐MS analysis.

   To identify specific brain regions involved in the uptake of
   Cy5.5‐labeled CRDA and HRDA, brain tissue was processed post 5‐h
   exposure. Mice were perfused with PBS followed by 4% paraformaldehyde
   (PFA), and the brains were excised, fixed in 4% PFA containing an
   anti‐fading agent (Beyotime, #P0128, China) embedded in OCT compound,
   and sectioned into 9 µm slices. These slices were then examined using
   confocal laser scanning microscopy (CLSM) (LSM900, Zeiss, Germany).

Behavioral Testing

   To establish a PD model, MPTP was administered through daily
   intraperitoneal injections at a dosage of 22.5 mg kg^−1. Concurrently,
   the NCs were intravenously administered to the MPTP‐treated mice at a
   concentration of C[DA] = 600 µg kg^−1 every 3 days. For the
   quantification of nanocapsules, the DA concentration was analyzed by
   HPLC, which was provided in supporting information. Behavioral
   assessments were conducted alongside these procedures. For the
   screening of behavioral data, the data of mice with obvious behavioral
   abnormalities were removed, and at the same time, the maximum and
   minimum values were eliminated.

Morris Water Maze

   The Morris water maze test was performed using a circular pool (120 cm
   in diameter) filled to a depth of 40 cm with water maintained at
   18–19 °C. The water was rendered opaque using the food additive
   titanium dioxide to obscure a submerged platform (10 cm in diameter),
   located 1 cm below the water surface. The pool was segmented into four
   quadrants: northeast (NE), northwest (NW), southeast (SE), and
   southwest (SW), with the platform placed in the SW quadrant.

   Over a training period of 4 days, the mice underwent 3 trials daily,
   released from the NE, NW, and SE positions into the pool. A minimum
   interval of 30 min was ensured between each trial. Mice that located
   the platform within 60 s were permitted to remain on it for 5 s.
   Conversely, mice unable to find the platform within this timeframe were
   guided to it and allowed to stay for 15 s to ensure familiarity with
   its location.

   On the day following the last training session, the platform was
   removed for the testing phase. Mice were released from the quadrant
   farthest from the original platform location into the pool for a probe
   test, entailing a 60 s free swim in the absence of the platform. Their
   performance was captured on video and subsequently analyzed using Smart
   V03 software to evaluate their memory, learning capabilities, and
   locomotor activity.

Rotarod Test

   Prior to the actual testing, mice underwent a two‐day training regimen
   consisting of three trials each day. During both training and testing,
   the mice were placed on a rotarod cylinder that accelerated from 4 to
   40 rpm over a 5 min period. On the day of the test, the procedure was
   replicated, and the time taken for the mice to fall off the cylinder
   was recorded over three trials, measuring their motor coordination and
   balance.

Open Field Test

   For the open field test, each mouse was introduced to a black,
   open‐topped arena measuring 60 cm by 40 cm by 30 cm, situated in a
   quiet room. The test was preceded by a 3 min habituation period to
   reduce stress, followed by a 5 min testing session. Movements were
   tracked and analyzed using Smart V03 software, focusing on the
   distance, central time, and speed to assess locomotor activity and
   exploratory behavior. All sessions were recorded for subsequent
   analysis.

Pole Test

   The pole test involved a vertical pole 75 cm in height and 1 cm in
   diameter. Mice were placed at the top of the pole facing upwards and
   the time it took for them to descend to the base was measured. To
   familiarize the mice with the test, a two‐day training period was
   implemented, consisting of three trials each day. On the testing day,
   the descent times were recorded, with a maximum cutoff time of 120 s to
   conclude the test and finalize recordings. This test aimed to evaluate
   the mice's motor coordination and agility.

Histological Assays

   The mice underwent perfusion with PBS followed by 4% PFA. Subsequently,
   their brains were extracted, embedded in both paraffin and OCT
   compound, and then sectioned into slices of 4 and 9 µm thickness,
   respectively. Major organs including the heart, liver, spleen, lung,
   and kidney were excised for further examination.

   The prepared tissue sections underwent several staining procedures: IHC
   staining was performed to visualize specific proteins; ROS were
   detected using fluorescent staining to assess oxidative stress; and
   immunofluorescence (IF) staining was employed to visualize within the
   tissues; HE was used to check the state of major organs. The detailed
   protocols are provided in Supporting Information.

Reverse Transcription Quantitative Polymerase Chain Reaction (RT‐PCR)

   The striatum and substantia nigra were separated from the whole brain.
   For the RT‐qPCR assay, total RNA was isolated from the hippocampus
   using the Trizol™ Reagent (Life Technologies, Carlsbad, USA). The cDNA
   synthesis was carried out utilizing the RevertAid First Strand cDNA
   Synthesis Kit (Thermo Fisher Scientific, #K1622, USA). The specific
   sequences of the primers used for this assay will be detailed
   subsequently. The RT‐qPCR reactions were performed employing the Master
   Mix (Novoprotein, #E099‐01A, China). The QuantStudio 6 Flex Real‐Time
   PCR System (Applied Biosystems, Life Technologies, USA) was utilized to
   quantify the relative RNA expression levels of the target genes,
   applying the 2^−ΔΔCt method for analysis. Glyceraldehyde 3‐phosphate
   dehydrogenase (GAPDH) served as the endogenous control, providing a
   baseline for normalization of the gene expression data. The primer
   pairs were as follows:
            Primer sequence(5'to3')
   DAT   forward TTTCTCCTGTCCGTCATTGGC
         reverse AGCCCACACCTTTCAGTATGG
   TH    forward GAAGGGCCTCTATGCTACCCA
           reverse TGGGCGCTGGATACGAGA
   DRD2   forward CAACACCAAGCGTAGCAGC
          reverse TGGTGCTTGACAGCATCTCC
   BDNF    forward CAGGGGCATAGACAAAAG
          reverse GAGGGGCCATCCACAGTCTT
   SNCA   forward AGAAAACCAAGCAGGGTGTG
          reverse TCCAGGATTCCTTCCTGTGG
   ATF6  forward CTTGGCAGCACCTTGACCTTC
          reverse TGGCTCGGCAGGGAGAAATG
   GAPDH forward GCCAAGGTCATCCATGACAACT
          reverse GAGGGGCCATCCACAGTCTT
   [177]Open in a new tab

In Vivo Western Blot Analysis

   The striatum and substantia nigra regions were meticulously dissected
   from the mouse brain. Protein concentrations within these brain areas
   were determined using the Bradford assay (Beyotime, #P0006C, China).
   For electrophoresis, 40 µg of protein from striatum samples and 20 µg
   from substantia nigra samples were resolved by SDS‐PAGE. The separated
   proteins were then transferred onto PVDF membranes following standard
   protocols. The PVDF membranes underwent immunoblotting, where they were
   incubated with both primary and secondary antibodies. The detection of
   immunoreactive bands was achieved through enhanced chemiluminescence
   (Beyotime, #P0018AS, China) and documentation using a gel imaging
   system. The utilized primary antibodies included: rat monoclonal
   anti‐DA transporter (1:30, Santa Cruz, #sc‐32258, USA), rabbit
   polyclonal anti‐TH (1:5000, Abcam, #ab137869, UK), mouse monoclonal
   anti‐DRD2 (1:30, Santa Cruz, #sc‐32258, USA), rabbit monoclonal
   anti‐BDNF (1:1000, Abcam, #ab108319, UK), rabbit polyclonal anti‐α‐syn
   (1:1000, Abcam, #ab51253, UK), rabbit polyclonal anti‐ATF6 (1:1000,
   Proteintech, #24169‐1‐AP, China), rabbit polyclonal anti‐β‐actin
   (1:2000, Proteintech, #120536‐1‐AP, China), and rabbit polyclonal
   anti‐GAPDH (1:2000, Affinity, #AF7021, China).Secondary antibodies were
   applied as follows: goat anti‐rabbit IgG (H+L)
   peroxidase/HRP‐conjugated (1:2000, Elabscience, #E‐AB‐1003, China),
   goat anti‐mouse IgG (H+L) peroxidase/HRP‐conjugated (1:2000,
   Elabscience, #E‐AB‐1001, China), and goat anti‐rat IgG (H+L)
   peroxidase/HRP‐conjugated (1:2000, Elabscience, #E‐AB‐1041, China),
   facilitating the visualization of specific protein targets related to
   dopamine signaling and neuroprotection within the brain.

Conflict of Interest

   The authors declare no conflict of interest.

Supporting information

   Supporting Information
   [178]ADVS-11-2404717-s008.pdf^ (3.5MB, pdf)

   Supplemental Movie 1
   [179]Download video file^ (2.8MB, avi)

   Supplemental Movie 2
   [180]Download video file^ (2.6MB, avi)

   Supplemental Movie 3
   [181]Download video file^ (5MB, avi)

   Supplemental Movie 4
   [182]Download video file^ (5MB, avi)

   Supplemental Movie 5
   [183]Download video file^ (3MB, avi)

   Supplemental Movie 6
   [184]Download video file^ (5.4MB, avi)

   Supplemental Movie 7
   [185]Download video file^ (2.9MB, avi)

   Supplemental Movie 8
   [186]Download video file^ (5.4MB, avi)

   Supplemental Movie 9
   [187]Download video file^ (2.9MB, avi)

   Supplemental Movie 10
   [188]Download video file^ (2.8MB, avi)

   Supplemental Movie 11
   [189]Download video file^ (2.9MB, avi)

   Supplemental Movie 12
   [190]Download video file^ (5.6MB, avi)

   Supplemental Movie 13
   [191]Download video file^ (5.7MB, avi)

   Supplemental Movie 14
   [192]Download video file^ (6.4MB, avi)

   Supplemental Movie 15
   [193]Download video file^ (6.4MB, avi)

   Supplemental Movie 16
   [194]Download video file^ (5.6MB, avi)

   Supplemental Movie 17
   [195]Download video file^ (3.3MB, avi)

   Supplemental Movie 18
   [196]Download video file^ (5.9MB, avi)

   Supplemental Movie 19
   [197]Download video file^ (5.9MB, avi)

   Supplemental Movie 20
   [198]Download video file^ (3.5MB, avi)

   Supplemental Movie 21
   [199]Download video file^ (5.9MB, avi)

   Supplemental Movie 22
   [200]Download video file^ (5.8MB, avi)

   Supplemental Movie 23
   [201]Download video file^ (3.1MB, avi)

   Supplemental Movie 24
   [202]Download video file^ (6MB, avi)

   Supplemental Movie 25
   [203]Download video file^ (5.7MB, avi)

   Supplemental Movie 26
   [204]Download video file^ (5.5MB, avi)

   Supplemental Movie 27
   [205]Download video file^ (6MB, avi)

   Supplemental Movie 28
   [206]Download video file^ (5.3MB, avi)

   Supplemental Movie 29
   [207]Download video file^ (6MB, avi)

   Supplemental Movie 30
   [208]Download video file^ (2.9MB, avi)

   Supplemental Movie 31
   [209]Download video file^ (2.8MB, avi)

   Supplemental Movie 32
   [210]Download video file^ (6.1MB, avi)

   Supplemental Movie 33
   [211]Download video file^ (6.1MB, avi)

   Supplemental Movie 34
   [212]Download video file^ (3MB, avi)

   Supplemental Movie 35
   [213]Download video file^ (2.9MB, avi)

   Supplemental Movie 36
   [214]Download video file^ (3.1MB, avi)

   Supplemental Movie 37
   [215]Download video file^ (5.4MB, avi)

   Supplemental Movie 38
   [216]Download video file^ (3MB, avi)

   Supplemental Movie 39
   [217]Download video file^ (5.9MB, avi)

   Supplemental Movie 40
   [218]Download video file^ (3MB, avi)

   Supplemental Movie 41
   [219]Download video file^ (2.9MB, avi)

Acknowledgements