Abstract Background Human platelet lysate (hPL) has emerged as a promising serum substitute to enhance the self-renewal and multipotency of human mesenchymal stem cells (MSCs). Despite its potential, the specific biological mechanisms by which hPL influences MSC phenotypes remain inadequately understood. Methods We investigated the biological signaling activated by hPL in two common types of human MSCs: bone marrow-derived MSCs (BMSCs) and adipose-derived MSCs (ASCs). Cell adhesion and cell-matrix interaction were assessed through immunofluorescence staining and western blotting. The impact of hPL on lipid droplet formation in MSCs was thoroughly examined using oil red O/BODIPY staining, semi-quantitative analysis, and qRT-PCR. RNA sequencing and intracellular inhibition assays were also performed to elucidate the mechanisms by which hPL modulates MSC behavior. Results MSCs cultured in hPL medium demonstrated a reduction in cell size, spreading area, and vinculin puncta, while enhancing cell proliferation and lipid droplet accumulation compared to those cultured in control media. Notably, the lipid droplets in hPL-treated MSCs were significantly smaller than those in adipocyte-like cells differentiated from MSCs, highlighting hPL’s distinctive role in lipid production. Gene and protein expression profiles of hPL-treated MSCs differed from those in adipocyte-like cells. An angiogenic factor array revealed that hPL-MSCs had a distinct angiogenic factor profile compared to FBS-MSCs, with VEGF expression closely linked to HIF-1α expression. RNA-seq data identified approximately 1,900 differentially expressed genes (DEGs) between hPL-MSCs and FBS-MSCs, with enrichment in focal adhesion, ECM-receptor interaction, and PI3K-Akt/MAPK signaling pathways. Inhibition of MAPK phosphorylation significantly hampered lipid formation in hPL-MSCs, underscoring the pivotal role of MAPK signaling in hPL-driven adipogenesis. Conclusion This study reveals the biological mechanisms by which hPL infleunces MSC behavior and differentiation, offering new insights into its potential application in regenerative medicine and tissue engineering. Supplementary Information The online version contains supplementary material available at 10.1186/s13287-024-04085-5. Keywords: Human platelet lysate, Mesenchymal stem cell (MSC), Focal adhesion, Lipid droplet, MAPK phosphorylation Introduction Mesenchymal stem cells (MSCs) is one of the most often used cell types in tissue engineering and regenerative medicine due to their multipotency [[38]1], paracrine functions (pro-angiogenic, anti-apoptotic, and antioxidative effects) [[39]2], and homing property [[40]3]. The low host immunological response of MSCs allows allogeneic transplantation in tissue regeneration [[41]4]. However, fetal bovine serum (FBS) has been a major supplement of in vitro MSC expansion for many decades and may pose a clinical risk, such as the risk of transferring animal factors and pathogens [[42]5]. It is necessary to have safer xeno-free alternatives to maintain MSC characteristics and functions for clinical application. Platelets are small enucleated structures of hematopoietic origin that contribute to hemostasis and wound healing by secreting abundant chemokines, cytokines, growth factors, and adhesion and immunologic molecules [[43]6, [44]7]. The bioactive factors released from platelets upon activation via freezing-thawing cycles, by thrombin, or by sonication [[45]8], include angiopoietin-1, vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), hepatocyte growth factor (HGF), insulin-like growth factor 1 (IGF-1), brain-derived neurotrophic factor (NGF), basic fibroblast growth factor (bFGF), connective tissue growth factor (CTGF), thrombospondin, etc [[46]9]. Human platelet lysate (hPL) is an attractive serum alternative for MSC expansion [[47]10, [48]11]. A series of reports have shown that hPL is superior to FBS regarding MSC proliferation and differentiation [[49]6]. A previous study demonstrated that the supplementation of gelatin methacrylate (GelMA) hydrogel with hPL not only increased the viscosity of GelMA hydrogel but also exhibited a positive effect on cell spreading, proliferation, and differentiation of human adipose tissue-derived stem cells (ASCs) [[50]12]. Another study developed a hPL hydrogel and applied it to MSC culture, which showed that hPL hydrogel stimulated the pro-angiogenic activity of MSCs by promoting MSC growth and invasion in a 3D environment. hPL hydrogel also enhanced endothelial sprouting alone and in co-culture with MSCs and improved cell therapy effect when used as a cell delivery vehicle for MSCs [[51]13, [52]14]. Platelet-based biomaterials such as platelet gel, glue, and platelet-rich plasma (PRP) have also been designed and used in oral/maxillofacial surgery, treatment of chronic ulcers, and orthopedics to improve healing and bone-grafting following implantation [[53]15, [54]16]. The use of platelet-derived biomaterials in regenerative medicine has different advantages, such as being either autologous or allogeneic and exhibiting a modulatory effect on both inflammatory and wound-healing processes [[55]12, [56]17]. However, the detailed biological functions of hPL have not been fully discovered. Exploring the biological differences between hPL and FBS is crucial, as it will lay a solid foundation for hPL to replace FBS in the clinic. This study explored the biological functions of hPL on two types of human MSCs, sourced from bone marrow and adipose tissue. Cell behaviors and functions of MSCs in hPL media were thoroughly investigated compared to the FBS media. It is known that cell adhesion, proliferation, and differentiation of MSCs are regulated by various signaling factors, including the PI3K-Akt/MAPK signaling pathway. We hypothesized that the abundant growth factors and cytokines in hPL would activate the PI3K-Akt/MAPK signaling pathways in MSCs. Immunostaining, RNA-seq, and inhibition experiments targeting PI3K and MAPK signaling were performed to elucidate the underlying mechanisms of hPL in regulating the cellular behavior changes of MSCs (Fig. [57]1). Current study would give some novel findings on the critical role of PI3K-Akt/MAPK phosphorylation on the lipid droplet formation in MSCs. Understanding the modulating mechanisms and efficacy of hPL on different origins of MSCs will benefit the development of customized strategies to use hPL and hPL-MSCs in tissue engineering and regenerative medicine. Fig. 1. [58]Fig. 1 [59]Open in a new tab The schematic process of this study. Two types of MSCs (ASCs and BMSCs) were investigated using hPL or FBS as the supplement for the medium. Cell phenotype and differentiation were characterized using RNAseq, qRT-PCR, Western Blot, and immunostaining. The mechanism was confirmed using biological signaling inhibitors. This study compared the different prospects of MSCs in media supplemented with hPL and FBS in detail Materials and methods Cell culture Human fetal bone marrow mesenchymal stem cells (BMSCs) and human adipose-MSCs (ASCs) were purchased from Cyagen Biosciences (HUXMF-01001 and HUXMD-01001; Suzhou Inc.) at passage 2. The above two types of MSCs were routinely maintained in complete growth media (HUXMF-90011 and HUXMD-90011; Cyagen Bioscience) with 100 U/mL penicillin and 100 µg/mL streptomycin (Invitrogen, Carlsbad, CA), and MSCs were characterized as described in previous work [[60]11, [61]18]. Human umbilical vein endothelial cells (HUVECs) purchased from ATCC (PCS-100-013™) were maintained in a vascular cell basal medium (PCS-100-030; ATCC) supplemented with an endothelial cell growth kit (PCS-100-041; ATCC). All cells were cultured at 37 °C under a 5% CO[2] humidified atmosphere. MSCs were cultured in MEM-α media (C12571500BT; Gibco) supplemented with either 10% (v/v) fetal bovine serum (FBS, 1099141 C; Gibco-New Zealand) or 5% (v/v) of human platelet lysate (hPL, HPCFDCRL10; UltraGRO™ Advanced, Helios BioScience). All the cells used in this study were between passages 6–8. To investigate the role of the PI3K/MAPK signaling pathway on MSC behavior changes, MSCs cultured in different media were treated with 1 µM MAPK inhibitor (PD0325901; MedChem Express) or 15 µM PI3K inhibitor (LY294002, S1737; Beyotime), and then the cell proliferation, lipid droplet formation, and protein expression were examined, respectively. Cell proliferation assay For cell proliferation assay, MSCs were inoculated in 6-well plates at a density of 30,000 cells/well in α-MEM media with 5% hPL or 10% FBS, respectively. Cells were harvested at each time point (2, 4 or 6 days) using 0.05% trypsin-EDTA and resuspended in growth media, then the numbers and diameters of the harvested cells from different media were compared using an automatic cell counter (Luna-II Autofocus Cell Counter; South Korea). The cell population doubling time (PDT) was calculated with the following formula: PDT=(t-t[0])/log[2](log[N[t]/N[0]]), where N[0] and N[t] is the cell number at the starting and ending time point, respectively [[62]19]. The cell proliferation assays were carried out for three repeats. Immunofluorescence staining For cell morphology and focal adhesion staining, MSCs were inoculated in 5% hPL and 10% FBS media at a density of 5,000 cells/cm^2 on glass coverslips (14 mm-diameter) plated in a 24-well plate and fixed after cultivation for 48 h. The primary antibody of mouse monoclonal anti-vinculin (v9131; Sigma-Aldrich, 1: 400) and secondary antibody of goat anti-mouse IgG-H&L FITC (ab6785; Abcam) were employed for vinculin staining. Phalloidin-Rhodamine B (P1961; Sigma-Aldrich) was used for cytoskeleton staining. Samples were washed, mounted via Fluoroshield Mounting Medium with DAPI (ab104139; Abcam), and examined under inverted fluorescence microscopy (Olympus; Japan). Vinculin puncta (dots per cell) and cell morphology (aspect ratio and spreading area) were quantified using Image J software [[63]11]. To compare the extracellular matrix (ECM) protein secretion levels of MSCs in different media, MSCs were expanded in 5% hPL or 10% FBS media for 4 days, respectively. Cells were fixed, washed, and incubated with primary antibodies against Col1A1 (ab34710; Abcam, 1: 500 dilution) and fibronectin (EP5) (sc-8422; 1: 200 dilution) at 4 °C for overnight. On the following day, samples were washed in PBS 3 times and then stained with secondary antibodies of donkey anti-rabbit IgG H&L Alexa Fluor^® 488 (ab150073) and goat anti-rabbit IgG H&L Alexa Fluor^® 555 (ab150078) for 1 h, respectively. At last, the samples were washed, mounted, and imaged using inverted fluorescence microscopy (Olympus; Japan). The fluorescence staining intensities were semi-quantitatively analyzed using image J. Adipogenic differentiation For adipogenic differentiation, MSCs were plated in multi-well plates at a cell density of 1 × 10^4 cells/cm^2 and maintained in MEM-α media with 10% FBS until confluence. Upon confluence, cells were cultured in adipogenic induction (AI) media with the addition of 10 nM dexamethasone (D8893; Sigma-Aldrich), 0.1 mM IBMX (I5979; Sigma-Aldrich), 10 µg/mL insulin (40112ES25; YEASEN), and 50 µg/mL indomethacin (I7378; Sigma-Aldrich) [[64]20]. The media were changed every other day. The adipogenic induction media with hPL and FBS were abbreviated as hPL + AI and FBS + AI, respectively. Oil red O staining and semi-quantitative assay To examine the lipid droplet accumulation levels of MSCs in different conditions after adipogenic differentiation for 10–14 days, cells were fixed with 4% PFA (paraformaldehyde) for 30 min at room temperature. Samples were washed thoroughly and stained with 0.5% oil red O (O0625-25G; Sigma Aldrich) in isopropyl alcohol for 30 min. After washing, the stained samples were examined under a bright field microscope (Olympus). For a semi-quantitative comparison of the staining intensity, samples were extracted with isopropanol alcohol and quantified by measuring the absorbance at 520 nm on a microplate reader. BODIPY staining and semi-quantitative analysis To evaluate lipid droplet formation levels, MSCs were cultured in different media and then stained with a green fluorescent dye BODIPY™ 493/503 (D3922; Invitrogen) at a final concentration of 2 µg/mL. Meanwhile, the nuclei were stained with 2 µg/mL Hoechst 33,258 (C1011; Beyotime). The stained samples were evaluated using a fluorescent microscope (Olympus), and the size of the lipid droplets was quantitatively measured using Image J software. The staining intensity of BODIPY was quantitatively analyzed and normalized against the intensity of Hoechst to further compare the lipid formation levels in different groups. RNA sequencing MSCs were cultured in GM (growth media) with 5% hPL or 10% FBS for 7 days, respectively, and then cells were harvested using Trizol (Invitrogen) for mRNA extraction according to the manufacturer’s instructions. The samples were analyzed via a HiSeq3000 platform, and the differently expressed genes (DEG, Q value < 0.05, |log[2](fold change) |>1) genes were assessed by DEseq using read counts as the input. Kobas 3.0 was used for KEGG and GO enrichment analysis, which was calculated using Fisher’s exact test with an FDR correction via the Benjamini and Hochberg method. Western blot analysis After a 7-day culture in 5% hPL and 10% FBS for 7 days, MSCs were harvested by RIPA cell lysis buffer (Beyotime; China) with proteinase inhibitor cocktails (P8304; Sigma Aldrich). According to the protein quantification, 20 µL proteins in each sample were used for the western blot analysis [[65]18]. Semi-quantification was carried out by measuring the intensity of bands using Image Lab™ 5.2.1 software. The primary and secondary antibodies used in this work are listed in Table [66]1. Table 1. Primary and secondary antibodies for Western blot Primary antibodies Catalog No. Dilution Factor Protein Size 1 p21 Waf1/Cip1 (12D1) Rabbit mAb #2947, CST 1:1000 21 kD 2 PI3 Kinase p110α (C73F8) Rabbit mAb #4249, CST 1:1000 110 kD 3 PhosphoPlus^® p44/42 MAPK (Erk1/2) (Thr202/Tyr 204) Antibody Duet #8201, CST 1:1000 42, 44 kD 4 HIF-1α (D1S7W) XP^® Rabbit mAb #36169, CST 1:1000 120 kD 5 Fibronectin/FN1(E5H6X) Rabbit mAb #26836, CST 1:2000 230 kD 6 COL1A1 (E6A8E) Rabbit mAb #39952, CST 1:2000 220 kD 7 Akt (pan) (C67E7) Rabbit mAb #4691, CST 1:1000 60 kD 8 Phospho-Akt (Ser473) (D9E) XP^® Rabbit mAb #4060, CST 1:2000 60 kD 9 FAK Antibody #3285, CST 1:2000 125 kD 10 Anti-vinculin antibody ab129002, Abcam 1:5000 124 kD 11 Ani-paxillin antibody ab32084, Abcam 1:5000 68 kD 12 Anti-beta actin antibody ab8226, Abcam 1:5000 42 kD 13 GAPDH (14C10) Rabbit mAb #2118, CST 1:2000 37 kD 14 CDK4 (D9G3E) rabbit mAb #12790T, CST 1:1000 30 kD 15 Perilipin-1 (D1D8) XP^® Rabbit mAb #9349, CST 1:1000 60 kD 16 PI3 Kinase p85 alpha Antibody [67]T40115, Abmart 1:1000 85 kD 17 Phospho-PI3-kinase p85-alpha/gamma (Tyr467/199) pAb [68]T40116, Abmart 1:1000 54 kD, 85kD Secondary antibodies 1 Goat Anti-Mouse IgG H&L (HRP) ab205719, Abcam 1:5000 2 Goat anti-Rabbit IgG H&L (HRP) ab31460, Abcam 1:5000 [69]Open in a new tab Angiogenesis antibody array and VEGF Elisa The expression of angiogenic factors of MSCs in different media was profiled using a sandwich immunoassay array kit (ARY007; Proteome Profiler™ Human Angiogenesis Array Kit; R&D system) following the manufacturer’s instructions [[70]21]. BMSCs and ASCs were cultured in media with 5% hPL and 10% FBS for 7 days, respectively, and then cells were lysed on ice for 30 min using RIPA lysis buffer (R0278; Sigma) with EDTA-free protease inhibitors cocktail (P8304; Sigma Aldrich). The lysates were then collected and centrifuged at 14 000 g for 5 min. The supernatant of each sample was transferred to a new tube and subjected to BCA assay. A total protein amount of 200 µg per sample in less than 1 mL supernatant was used for the angiogenic factors array. The antibody-coated membranes were first blocked with the supplied array buffer and then incubated with a 1.5 mL protein sample, along with the detection antibody in the array buffer. Once incubated overnight at 2–8 °C on a rocking platform shaker, the membranes were rinsed extensively with washing buffer and then incubated with diluted streptavidin-HRP for 30 min at room temperature on the shaker. After another 3-time rinsing, the membranes were treated with 1 mL prepared Chemi Reagent mix for 1 min. Chemiluminescence was examined via a BIO-RAD Image Lab 5.2.1, and the quantitative data were obtained by normalizing the intensity of each dot with that of a positive (100%) dot [[71]21]. Meanwhile, the VEGF levels in the MSC lysate from the above samples were examined using a human/mouse HIF1A-ELISA kit (PH368; Beyotime). The level of VEGF was then normalized against the DNA concentration in the lysate, which was determined using a Picogreen DNA quantitation assay kit ([72]P11496; Invitrogen). Angiogenic function examination After a 7-day culture in 5% hPL or 10% FBS, the media of BMSCs and ASCs were replenished with serum-free MEM-α media and cultured for 48 h for condition media (CM) collection. The CM collected from hPL-cultured MSCs were named hPL-CM, whereas those collected from FBS-cultured cells were named FBS-CM, respectively. The collected CM was centrifuged, and the supernatants were freshly used for the HUVEC proliferation assay. In brief, HUVEC were inoculated in each CM, serum-free MEM-α (negative control), and the standard endothelial growth medium (EGM-2, positive control) in a 96-well plate (5 000 cells/well), respectively. HUVEC proliferation levels in different media were compared by CCK-8 assay at 24 h. The experiments were repeated twice. Quantitative real-time PCR Total mRNAs of MSCs cultured in different media were extracted using Trizol reagent (15596; ThermoFisher Scientific). The extracted mRNAs were used for cDNA synthesis using a Transcript First Strand cDNA synthesis kit (RR037A; Takara). Quantitative Real-time polymerase chain reaction (qRT-PCR) was performed using 2X Real Star Power SYBR Mixture (A311; Genestar) with a LightCycler^®96 Real-Time PCR System (Roche). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control, and transcript levels of target genes were calculated using the comparative ddCt method. Target genes and designed primer sequences are listed in Table [73]2. Table 2. Primer sequences for qRT-PCR Gene name mRNA　ID Primer Sequence Product length (bp) GAPDH [74]NM_002046.7 5’GGCTCTCCAGAACATCATCC3’ 5’TTTCTAGACGGCAGGTCAGG3’ 149 PPARG [75]NM_138712.5 5’AGCCTCATGAAGAGCCTTCCA3’ 5’TCCGGAAGAAACCCTTGCA3’ 120 CEBPA [76]NM_001287424.2 5’CTTGTGCCTTGGAAATGCAA3’ 5’GCTGTAGCCTCGGGAAGGA3’ 112 PLIN2 [77]NM_001122.4 5’GCTGCAGTCCGTCGATTTCT3’ 5’CCACACTCGGTTGTGGATCA3’ 73 FABP3 [78]NM_004102.5 5’ATGAAGTCACTCGGTGTGGG3’ 5’CGAACTCCACCCCCAACTTA3’ 154 [79]Open in a new tab Flow cytometry assay For cell cycle analysis, MSCs cultured in different media with or without MAPK PD0325901 (MedChem Express, Monmouth Junction, NJ, USA) were harvested by Accutase (07922; STEMCELL Technologies) at day 2, and fixed overnight with pre-cooled 70% EtOH. After fixation, cells were stained with PI (50 µg/mL) and examined under flow cytometry. ModFit Lt3.0 analysis software was used to analyze the cellular DNA content. Statistical analysis Statistical data analyses were performed using a one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons (GraphPad Prism 10.1.2). All the data represented the mean values and standard deviations. Values of p < 0.05 were considered significant. Results hPL enhanced MSC proliferation After several days of culture, both types of MSCs showed a significantly higher cell density in hPL media than those in the FBS group (Fig. [80]2A and F). The cell counting assay showed that the cell number of hPL-ASCs was 2.78-fold of FBS-ASCs at day 4 (Fig. [81]2B), and the cell number of hPL-BMSCs was 1.76-fold of FBS-BMSCs at day 6 (Fig. [82]2G); the PDT of hPL-ASCs was 23.14 h, which was almost half-time reduced compared with FBS-ASCs (38.98 h, Fig. [83]2D); the PDT of hPL-BMSCs was 17.46 h, which was significantly reduced in comparison with FBS-BMSCs (21.84 h, Fig. [84]2I). In addition, Gene set enrichment analysis (GSEA) of RNA-seq data showed that the gene terms of cell cycle and DNA replication of MSCs were generally upregulated in hPL compared to cells in FBS control (Fig. [85]2E and J). Fig. 2. [86]Fig. 2 [87]Open in a new tab hPL enhanced MSC proliferation but reduced cell diameter. Phase-contrast images of ASCs (A) and BMSCs (F) after they were cultured in hPL and FBS media for 4 and 6 days, respectively. Scale bars are 50 μm. Quantitative data of the cell numbers, cell diameters, and doubling times of ASCs (B-D) and BMSCs (G-I) in media with hPL versus FBS, respectively. GSEA analysis showed that the gene sets of cell cycle and DNA replication in ASCs (E) and BMSCs (J) were all upregulated in hPL compared with cells in FBS. Data are shown as mean ± SD (n = 4). *p < 0.05, **p < 0.01 and ***p < 0.001. Statistical analysis is performed using an unpaired two-tailed t-test hPL reduced cell size, cell spreading, and cell-matrix adhesion Cell size analysis showed that the average cell diameter of the hPL-ASCs was 18.38 μm which was significantly smaller than FBS-ASCs (20.98 μm, Fig. [88]2C), while that of hPL-BMSCs was about 13.10 μm which was also significantly smaller than FBS-BMSCs (15.14 μm, Fig. [89]2H). The vinculin- and F-actin-stained images showed that the cell spreading area and vinculin-positive puncta of MSCs in hPL were lower than those cultured in the FBS media (Fig. [90]3A and E). Quantitative analysis of the stained images showed that the cell spreading areas of ASCs and BMSCs in hPL media were reduced by 52.47% (2593 vs. 5455 µm^2) and 25.61% (1519 vs. 2042 µm^2) compared with those in the FBS media, respectively (Fig. [91]3B and F). In addition, the average number of vinculin puncta per cell of ASCs and BMSCs in hPL was about 21.21% (26.38 vs. 33.48) and 18.21% (21.87 vs. 26.74) less than cells in the FBS control (Fig. [92]3C and G), respectively. Fig. 3. [93]Fig. 3 [94]Open in a new tab hPL reduced cell spreading and cell-matrix adhesion. Immunofluorescence-stained images showed the adhesion molecule (vinculin, red) and cell morphology (F-actin, green) of ASC (A) and BMSC (E) in hPL and FBS media, respectively. Scale bars are 50 μm. Quantitative comparison of cell spreading area and vinculin-positive puncta of MSCs (B and C for ASC; F and G for BMSC) in different media. GSEA, with RNA-seq data compared the gene sets expression of focal adhesion and ECM-receptor interaction of ASC (D) and BMSC (H) in hPL versus FBS. The protein levels examination (I) and semi-quantitative analysis (J and K) of FAK, vinculin and paxillin expression in cells at day 7. Full-length blots are presented in Supplementary Information: Fig. S6. Data are shown as mean ± SD (n = 3 or 4). *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Statistical analysis is performed using an unpaired two-tailed t-test GSEA analysis indicated that the expression of focal adhesion and ECM-receptor-related transcripts were down-regulated in both hPL-ASCs (Fig. [95]3D) and hPL-BMSCs (Fig. [96]3H) compared with the FBS-cultured cells. The protein level examination showed that vinculin expression was significantly decreased in hPL-cultured BMSCs and ASCs. On the other hand, the expressions of paxillin and FAK proteins were increased in hPL-BMSCs but decreased in hPL-ASCs compared with the FBS-cultured cells (Fig. [97]3I-K). hPL downregulated the expression of ECM proteins Col1A1- and Fn-stained fluorescent images and the semi-quantitative data showed that their expression levels were decreased in both hPL-ASCs (Fig. [98]4A and E) and hPL-BMSCs (Fig. [99]4C and E). This result was consistent with RNA-seq data that the gene sets of the complex of collagen trimers and protein complexes involved in cell adhesion were significantly down-regulated in hPL-ASCs (Fig. [100]4B) and hPL-BMSCs (Fig. [101]4D). Western blot (WB) analysis and the semi-quantitatively analyzed band intensities showed that Col1A1 expressions in hPL-ASCs and hPL-BMSCs were decreased for 46% and 84% compared with the FBS-cultured cells, respectively; the fibronectin (Fn) expressions in hPL-ASCs and hPL-BMSCs were reduced by 13% and 62% (Fig. [102]4F and G), respectively. Heatmap images of RNA-seq data showed that most collagen components and protein complexes involved in cell adhesion were down-regulated in hPL-MSCs compared with the FBS-MSCs (Fig. S1). Fig. 4. [103]Fig. 4 [104]Open in a new tab hPL altered the expression of ECM proteins. Immunofluorescence staining against Col1A1 and Fn of ASC (A) and BMSC (C) after cultured in different media for 4 days. Scale bars are 100 μm. GSEA data compared the gene sets of collagen trimers and protein complexes involved in cell adhesion of ASC (B) and BMSC (D) cultured in hPL versus FBS. Semi-quantitative analysis of Fn and Col1A1 staining intensity that normalized by DAPI (E). Protein level examination of Fn and Col1A1 expression levels of MSC at day 4 (F). Semi-quantitative comparison of Fn and Co11A1 expression of BMSC and ASC (G) in different media. Full-length blots are presented in Supplementary Information: Fig. S7. Data are shown as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, and ***p < 0.001. Statistical analysis is performed using one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons hPL enhanced lipid droplet accumulation within MSCs Oil red O- and BODIPY-stained images showed that the accumulation of lipid droplets in MSCs was significant in hPL media compared with cells in FBS media (Fig. [105]5A-D), as illustrated by the absorbance measurement of the oil red O-stained sample extraction (Fig. [106]5G). GSEA of RNA-seq data showed that the gene sets of adipose tissue development and PPAR signaling pathway were significantly upregulated in both hPL-ASCs (Fig. [107]5E) and hPL-BMSCs (Fig. [108]5F). Consistent with GSEA, qRT-PCR data showed that the adipogenic markers of PLIN2, CEBPA, and FABP3 were all significantly upregulated in hPL-BMSCs; PPARG is also upregulated in hPL-BMSCs but not significantly different with FBS-BMSCs (Fig. [109]5I); nevertheless, in hPL-ASCs, only the expression of PPARG rather than PLIN2, CEBPA, and FABP3 were significantly upregulated (Fig. [110]5H). Fig. 5. [111]Fig. 5 [112]Open in a new tab hPL enhanced small lipid droplet formation in MSC. Oil red O-stained (A, B) and BODIPY-stained images (C, D) exhibited the accumulation of lipid droplets in ASC (A, C) and BMSC (B, D). Scale bars are 50 μm. GSEA analysis of gene sets related to adipose tissue development and PPAR signaling pathway (E, ASC) and (F, BMSC). Semi-quantitative comparison of oil red O-stained samples (G). Transcripts expression of adipogenic markers of ASC (H) and BMSC (I) in different media. Data are shown as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Statistical analysis is performed using unpaired two-tailed t-test hPL failed to support adipogenesis of MSCs To further investigate the effect of hPL on adipogenesis, BMSCs and ASCs were cultured in adipogenic induction (AI) media using hPL or FBS as serum. Oil red O- and BODIPY-stained images at day 10 showed that AI media with hPL induced a significantly greater accumulation of lipid droplets (Fig. [113]6A and B), as confirmed by the absorbance measurement of the oil red O-stained sample extraction (Fig. [114]6C and D). However, the transcript expression of adipogenic markers, such as PPARG and PLIN2, except FABP3, was down-regulated in hPL-MSCs compared with FBS-MSCs (Fig. [115]6E and F). Fig. 6. [116]Fig. 6 [117]Open in a new tab hPL media failed to support adipogenesis of MSC in adipogenic media. Oil red O (A), BODIPY staining (B), and semi-quantitative analysis data (C and D) of ASC and BMSC after adipogenic induction (AI) for 10 days. PPARG, PLIN2, and FABP3 transcriptional expression levels in ASC (E) and BMSC (F) after adipogenic induction for 10 days. Staining (G) and quantitative analysis (H) of the lipid droplet size formed in ASC that cultured in hPL media (hPL), hPL media with adipogenic induction cocktail (hPL + AI), FBS media (FBS), and FBS media with AI (FBS + AI), respectively. Perperlin1 protein expression levels in ASC at day 10 (I). Scale bars in A-B are 50 μm, and in G are 100 μm, respectively. Full-length blots are presented in Supplementary Information: Fig. S8. Data are shown as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Statistical analysis between hPL-MSC and FBS-MSC is performed using unpaired two-tailed t-test (C-F). Statistical analysis among different test groups was compared using one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons (H) The lipid droplet formation levels of ASC were then compared in growth media supplemented with hPL or FBS, adipogenic induction media (AI) with hPL or FBS, and the above culture conditions were abbreviated as hPL, FBS, hPL + AI, and FBS + AI, respectively. It was found that the size of lipid droplets in ASCs was different in each media (Fig. [118]6G), and the quantitative data demonstrated that the average diameters of lipid droplets formed in hPL media, hPL media with AI, in FBS media were 1.24, 3.97, and 1.01 μm, respectively; in contrast, the average diameter of lipid droplets of ASCs in adipogenic media (FBS + AI) is 40.52 μm (Fig. [119]6H). At last, WB analysis of ASCs cultured in different media showed that the adipogenic marker of perperlin1 was barely expressed in adipogenic media with hPL (hPL + AI), while that was obviously expressed in adipogenic media with FBS (FBS + AI) (Fig. [120]6I). hPL altered the angiogenic functions of MSCs Next, we examined the influence of different media supplements on the expression of angiogenic factors. The angiogenic factor array results showed that hPL significantly altered the paracrine functions of MSCs (ASCs and BMSCs); in general, most of the angiogenic factors were down-regulated in hPL-ASCs (Fig. [121]7A) while most of them were upregulated in hPL-BMSCs (Fig. [122]7B). GSEA with RNA-seq showed that the growth factor activity gene sets were mainly decreased in hPL-ASCs (Fig. [123]7C) and hPL-BMSCs (Fig. [124]7F) compared with the FBS-cultured cells. Fig. 7. [125]Fig. 7 [126]Open in a new tab hPL altered the angiogenic functions of MSCs. Angiogenic factor profiling and semi-quantitative analysis compared the relative expression levels of angiogenic factors in hPL- and FBS-cultured ASCs (A) and BMSCs (B). GSEA of RNA-seq showed the gene sets of growth factor activity of ASCs (C) and BMSCs (F) in hPL versus FBS. VEGF Elisa compared the VEGF expression levels of ASC (D) and BMSC (G) in different media. The conditioned media effect of ASCs (E) and BMSCs (H) on HUVEC proliferation. Data are shown as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Statistical analysis between hPL-MSCs and FBS-MSCs is performed using unpaired two-tailed t-test (A, B, D, G, n = 3). Statistical analysis among different test groups was compared using one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons (E and H, n = 5) Consistent with the angiogenic factor profiling results, VEGF expression was significantly increased in hPL-ASCs (Fig. [127]7D) but decreased in hPL-BMSCs (Fig. [128]7G) as determined by VEGF Elisa. The HUVEC proliferation assay showed that the conditioned media of hPL-ASC exhibited a better promotive effect on HUVEC proliferation than that of FBS-ASC (Fig. [129]7E); on the contrary, the conditioned media of hPL-BMSCs had a lower promotive effect on HUVEC proliferation than that of FBS-BMSCs (Fig. [130]7H). hPL upregulated the PI3K-Akt/MAPK signaling pathway According to the RNA-seq data, a total of 1,843 different expressed genes (DEGs) were detected between hPL- and FBS-BMSCs, with 773 upregulated and 1070 down-regulated; a total of 1965 DEGs were detected between hPL- and FBS-ASC with 1074 upregulated and 891 down-regulated (Fig. S2). The top 20 enriched KEGG pathways (ranked by p-value) of the differently expressed genes (DEGs) between hPL-ASCs vs. FBS-ASCs (Fig. [131]8A), and hPL-BMSCs vs. FBS-BMSCs (Fig. [132]8B) both included PI3K-Akt signaling pathway, MAPK signaling pathway, focal adhesion, and ECM-receptor interaction. The expression levels of PI3K, Akt, phosphatase-Akt, MAPK, CDK4, and p21 proteins were upregulated for 6.74, 1.48, 2.78, 4.86, 1.80, and 4.11-fold in hPL-ASC compared with these in FBS-ASCs (Fig. [133]8C and D), whereas these proteins were upregulated for 2.87, 1.89, 2.58, 2.81, 3.33, and 2.44-fold in hPL-BMSCs (Fig. [134]8C and E) compared with these in FBS-BMSCs, respectively. However, the expression of HIF1A was down-regulated in hPL-BMSCs but upregulated in hPL-ASCs compared with the FBS-cultured cells (Fig. [135]8C-E). Fig. 8. [136]Fig. 8 [137]Open in a new tab KEGG pathway enrichment analysis of RNA-seq data and protein level examination. KEGG enrichment analysis of ASCs (A) and BMSCs (B) after they were cultured in different media for 7 days. Protein level examination (C) and semi-quantitative analysis of HIF1A, PI3K, Akt1, Phospho-Akt1, MAPK, CDK4, and P21 of ASCs (D) and BMSCs (E) in hPL or FBS, respectively. Full-length blots are presented in Supplementary Information: Fig. S9. Data are shown as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, and ***p < 0.001. Statistical analysis is performed using unpaired two-tailed t-test Lipid droplet accumulation in MSCs is regulated by MAPK phosphorylation PI3K and MAPK inhibition experiments were conducted using LY294002 and PD0325901 in ASC, respectively. BODIPY- and oil red O-stained images showed the inhibition of PI3K did not significantly change the lipid formation levels in hPL media (Fig. [138]9A-C). In contrast, the inhibition of MAPK phosphorylation significantly reduced the lipid formation levels in hPL (Fig. [139]10A-D). The inhibition of PI3K (Fig. [140]9D) and MAPK (Fig. [141]10E) reduced cell proliferation levels in media with either hPL or FBS. It was observed that LY294002 effectively inhibited the expression of both total and phosphorylated PI3K protein; however, it did not significantly alter the expression levels of total Akt or MAPK in hPL-MSCs (Fig. [142]9E-F). We observed an enhanced p-MAPK level in hPL-MSCs, which directly correlated with the lipid droplet formation level and the treatment of the PI3K inhibitor (Fig. [143]9C and F). Furthermore, it was found that LY294002 reduced CDK4 expression levels (Fig. [144]9E) without changing the stimulatory trend of hPL on MSC proliferation compared to FBS. Fig. 9. [145]Fig. 9 [146]Open in a new tab Cell proliferation and lipid droplet accumulation in ASCs with PI3K inhibitor. Lipid droplet visualization in ASCs by oil red O- (A) and BODIPY-staining (B) with or without the treatment by PI3K inhibitor. The scale bar is 50 μm. Semi-quantitatively analyzed BODIPY staining intensity that normalized against the Hoechst staining intensity (C) and the relative cell density per field (D). Examine total and phosphorylated PI3K, Akt, and MAPK protein expressions and the semi-quantitative data (E and F). Full-length blots are presented in Supplementary Information: Fig. S10. Data are shown as mean ± SD (n = 3 per group, and 20–50 images were analyzed for C and D). *p < 0.05, **p < 0.01, ***p < 0.001, and **** p < 0.0001. Statistical analysis among different test groups was compared using one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons Fig. 10. [147]Fig. 10 [148]Open in a new tab Cell proliferation and lipid droplet accumulation in ASCs with MAPK inhibitor. Lipid droplet visualization in ASC by oil red O-(A) and BODIPY-staining (B, C) with or without MAPK inhibitor, respectively. The scale bar is 50 μm. Lipid droplet observation using a high-sensitivity structured illumination microscope (HIS-SIM; China) (C). Semi-quantitatively analyzed BODIPY staining intensity normalized against the Hoechst staining (D), and the relative cell density per field (E). Total MAPK, phosphorylated MAPK, and CDK4 expression levels with or without MAPK inhibitor (F and G). Full-length blots are presented in Supplementary Information: Fig. S11, and the original flow cytometry assay results are presented in Fig. S3. Data are shown as mean ± SD (n = 3 per group, and 20–50 images were analyzed for D-E). *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Statistical analysis among different test groups was compared using one-way analysis of variance (ANOVA), with Tukey’s post-hoc multiple comparisons The MAPK inhibition by PD0325901 effectively decreased both lipid droplet formation (Fig. [149]10A-D) and cell density (Fig. [150]10E) in hPL-MSC. The protein level examination showed that the PD0325901 effectively inhibited MAPK phosphorylation and CDK4 expression (Fig. [151]10F and G). The cell cycle analysis showed that hPL significantly increased the percentage of cells in the G2- and S- phase by 20.24% (32.77% vs. 12.53%) and 14.37% (24.97% vs. 10.60%) compared with these in FBS media, respectively. The PD0325901 treatment significantly increased the percentage of cells in the S-phase with both hPL- and FBS-MSCs (Fig. [152]10H and Fig. S3). Discussion This work demonstrated that hPL, the potential xeno-free media supplement, had a significantly different modulating effect on MSC behaviors such as proliferation, cell size, cell adhesion, cell spreading, ECM secretion, and angiogenic functions compared to FBS. The most exciting finding of the current study was that hPL in growth media enhanced lipid droplet accumulation but failed to support MSC adipogenesis in adipogenic media. Bulk RNA-seq data revealed that hPL media induced a significant alteration in transcriptomic profiles of MSCs compared with the FBS-cultured cells, which indicated that the variable cell culture conditions could influence many biological features of MSCs. In addition, the comprehensive cellular biology investigations in this work shed some light on the modulating mechanisms of hPL and the changes in the characteristics of BMSCs and ASCs. First, we found that hPL improved the self-renewal capability of ASCs better than that of BMSCs, as illustrated by the more significantly increased cell number, reduced population doubling time, and the upregulated cell cycle and DNA replication gene sets (Fig. [153]2). These findings are consistent with previous reports [[154]22, [155]23]. PI3K/AKT and MAPK are critical signaling pathways regulating stem cell self-renewal, differentiation, and proliferation [[156]24]. Then, we carried out protein-level examinations of the critical signaling molecules in these pathways. It is found that PI3K and MAPK proteins were more significantly upregulated in hPL-ASCs than in hPL-BMSCs, this result explained the better stimulatory effect of hPL on ASCs proliferation than on BMSCs (Fig. [157]8). To further explore the role of PI3K and MAPK signaling on MSC behaviors changes, cells were treated with either LY294002 or PD0325901, and the treatment successfully suppressed the phosphorylation of PI3K (Fig. [158]9E) and MAPK (Fig. [159]10F), respectively. The treatment of hPL-MSCs by MAPK inhibitor (PD0325901) not only hindered lipid droplet formation in ASC but also reduced cell number (Fig. [160]10). PI3K inhibitor did not significantly alter the expression levels of total Akt/MAPK or the lipid droplet formation levels, however, it enhanced the phosphorylation levels of Akt/MAPK in hPL-MSCs (Fig. [161]9E). The finding that PI3K inhibitor upregulated p-MAPK protein level is opposite with the previous report that PI3K inhibitor suppress p-MAPK level [[162]25]. This result can be explained by the fact that multiple upstream signaling molecules could stimulate the phosphorylation of MAPK in hPL-MSCs. In summary, the abundant bioactive components such as growth factors, chemokines, and cytokines in hPL upregulated the MAPK signaling pathway (Fig. S4), which sequentially accelerated the cell cycle, DNA replication process, and lipid droplet accumulation in MSCs as illustrated in the table of contents (TOC, Fig. [163]11). Fig. 11. [164]Fig. 11 [165]Open in a new tab An overview of this study. The intricate factors in hPL modulated the phenotypic expression and angiogenic factor secretion of MSCs and downregulated cell-ECM interactions; these factors in hPL upregulated the PI3K/Akt and MAPK signaling pathways, which in turn stimulated lipid droplet formation and cell cycle progression Second, it was found that hPL-cultured MSCs (both ASCs and BMSCs) showed a significant decrease in cell diameter (Fig. [166]2C and H) and spreading area (Fig. [167]3B and F). This finding is consistent with previous studies [[168]11, [169]26] that hPL-cultured MSCs displayed different morphologies characterized by more spindle-shaped, elongated, and denser cell bodies than that of FBS-cultured cells; these features were also consistent with previous flow cytometry assay that hPL-cultured cells had reduced forward scatter and side scatter rates which represented less complexity and smaller dimensions of cells [[170]26, [171]27]. A previous study demonstrated that cell size was vital for cellular function; however, the question of how cell size is determined and regulated is poorly understood [[172]28]. Nevertheless, it is generally accepted that both growth rate and cell cycle duration control cell size. Thus, we speculate that the shorter population doubling time of MSCs in hPL media might decrease the growth periods between mitoses, which sequentially reduces cell size, as described by a previous study [[173]22]. Third, the most exciting finding of current work is that hPL induces a significant accumulation of lipid droplets in MSCs (Fig. [174]5A-D). A previous study has reported that hPL can induce lipid vacuole formation in ASCs even without supplementing adipocyte differentiation cocktails, and they claimed that the ASC inherently possess the predictive capacity to differentiate into their tissue of origin in hPL and the differentiation was not affected by the choice of growth supplements [[175]22]. However, we found that hPL media with adipogenic induction (AI) reagents failed to support MSC adipogenesis according to the transcriptional examination of PPARG and PLIN2 (Fig. [176]6E-F), protein examination of perperlin1 (Fig. [177]6I), and the size quantification of lipid droplet (Fig. [178]6H). Lipid droplets can be found in many types of cells, where they play essential roles in energy and membrane lipid metabolism [[179]29]. We also found that hPL can induce lipid droplet accumulation in THP-1/macrophage (Fig. S5). It is shown that all the lipid droplets share the same structure- a hydrophobic oil core of the storage lipids, which mainly comprise triacylglycerols and sterol esters, are shielded by a phospholipid monolayer that contains specific protein [[180]30]. Despite their similar architecture, the size and number of lipid droplets vary dramatically within cell types. In most mammalian cells, the average diameter of lipid droplets is 1–4 μm; however, in brown adipocytes, the size can reach up to 10 μm, and most strikingly, in white adipocytes, the size can reach over 100 μm [[181]31]. According to the quantitative result of the lipid droplet, the average diameters of lipid droplets of ASC formed in hPL media, hPL media with AI, and FBS media are less than 4 μm; in contrast, the average diameter of lipid droplets formed in ASCs cultured in adipogenic media is 40.52 μm (Fig. [182]6H). In summary, the lipid droplets of MSCs formed in hPL media differ from those in adipocytes in modulating molecules and size. The previous study demonstrates that the lipid droplet is a highly dynamic storage organelle that is important in balancing the fluctuations in availability and requirement of metabolic energy in cells. It is generally accepted that the number and size of lipids are influenced by nutrient availability [[183]31]. Accordingly, it can be concluded that the significantly enhanced accumulation of lipid droplets in hPL-MSCs was attributed to the upregulated phosphorylated MAPK that was stimulated by the abundant growth factors, chemokine, and cytokines in hPL (Fig. [184]11 and S4). At last, according to RNA-seq analysis, there were about 1843 DEGs between hPL- and FBS-BMSCs, with 773 upregulated and 1070 down-regulated in hPL-BMSCs, whereas there are about 1965 DEGs between hPL- and FBS- cultured ASC with 1074 upregulated and 891 down-regulated in hPL-ASC (Fig. S2). This finding is generally consistent with a previous study that a total number of 1974 DEGs were detected between hPL- and FBS-cultured MSCs [[185]32]. However, another published work showed 3708 significant DEGs between hPL- and FBS-cultured ASCs [[186]33]. The distinct number of DEGs in different studies is probably attributed to the variation in culture time, hPL preparation, and statistical analysis methods. Furthermore, the GSEA of RNA-seq reveals that growth factor activities in hPL-MSCs are down-regulated, and the angiogenic factor profiling assay demonstrates that the angiogenic factor expression of hPL-MSCs is significantly changed compared with the FBS-cultured cells. Specifically, the VEGF expression is decreased substantially in hPL-BMSCs whereas that is increased considerably in hPL-ASC as further verified via VEGF Elisa and angiogenic function assay of MSCs conditioned media (Fig. [187]7). HIF-1α is reported as an essential transcription factor that regulates VEGF expression via the binding of hypoxia-response element (HRE) sites in the VEGF promoters in stem cells [[188]34]. Thus, we examined the expression level of HIF-1α, and it was found that the HIF-1α expression in hPL-BMSCs was significantly down-regulated, whereas that in hPL-ASCs was upregulated considerably in comparison with the FBS-cultured cells. The direct correlation of HIF-1α with VEGF expression in MSCs cultured in different media suggested HIF-1α modulated the VEGF expression in MSCs, which was regulated by the upstream PI3K-Akt signaling pathway (Fig. [189]11). Conclusion This study demonstrated that hPL can significantly alter the genetic profiles and biological characteristics of MSCs in a source-dependent manner. In hPL, BMSCs and ASCs exhibited enhanced proliferation, reduced cell diameter, and distinct angiogenic potential. Additionally, hPL promoted lipid droplet accumulation in MSCs, with these droplets differing in size and molecule expression from those typically associated with adipogenesis. These findings underscore the potential of using hPL to explore lipid metabolism and its regulatory mechanisms. The improved angiogenic properties of ASCs cultured in hPL suggest that hPL-expanded ASCs may be more suitable for treating ischemic diseases. Through a detailed mechanism study, this study found that hPL exerts unique effects on MSCs compared to fetal bovine serum (FBS), providing valuable insights for the future application of hPL and hPL-expanded MSCs in tissue engineering and regenerative medicine. Electronic supplementary material Below is the link to the electronic supplementary material. [190]Supplementary Material 1^ (9.5MB, docx) Acknowledgements