Abstract Background Huanglian-ejiao decoction (HED) is a Chinese traditional medicinal formula evolved from the Shanghan Lun (Treatise on Febrile Diseases). However, HED ultimate mechanism of action remained indistinct. Therefore, this study aimed to investigate whether HED could exert anti-inflammatory effects on 2,4,6-Trinitrobenzenesulfonic acid (TNBS)-induced colitis (UC) model through the regulation of CD4^+T subsets and gut microbiota. Methods Fifty-eight major compounds in HED were identified by UPLC-Q-TOF/MS. The therapeutic efficacy of HED on UC was assessed by evaluating survival rate and so on. Flow cytometry was employed to assay the percentages of CD4^+T cell. RT-PCR and Western blot took advantage of detecting transcription factors, inflammatory factors, and tight junction proteins. Transcriptome sequencing was performed on colon tissue and 16S rRNA gene sequencing was enforced on intestinal contents. Results The administration of HED enhanced the survival rate of colitis mice, significantly restored body weight, DAI score, colon weight and index, spleen weight and index. HED effectively reshaped intestinal barrier dysfunction, inhibited the ratio of Th1 to Th2 cells, and preserved Th2/Th1 and Tregs/Th17 balance. Moreover, HED notably decreased the secretion of transcription factors and related cytokines. Interestingly, HED also exerts regulatory effects on gut dysbiosis by cumulative the plenteous of beneficial probiotics like Lactobacillus and Bacteroides, while inhibiting the overgrowth of opportunistic pathogens such as Helicobacter. Conclusion The regulation of Th2/Th1 and Tregs/Th17 cell balance, as well as the modulation of gut microbiota by HED, provides further experimental evidence for the feasibility of its treatment of UC. Keywords: HED, ulcerative colitis, Th2/Th1, Treg/Th17, gut microbiota Introduction Ulcerative colitis (UC) is a nonspecific, chronic inflammatory bowel disease (IBD) involving the submucosa and mucosa of the colon and rectum, which is primarily characterized by diarrhea (with bowel movement frequency ranging from 2–10 times per day) accompanied by the presence of blood, pus and mucus in the feces.[44]1 This disease can occur at any age but is more ubiquitous in middle-aged and young people aged 20–40 years.[45]2 The current therapeutic efficacy of UC is considerably limited due to its multifactorial etiology and pathogenic mechanism, encompassing genetic predisposition, immune dysregulation, gut microbiota imbalances, smoking habits, psychological stressors, and dietary patterns.[46]3 The conventional treatment of UC includes anti-inflammatory drugs such as immunosuppressant therapies, mesalazine derivatives and corticosteroids.[47]4 However, the efficacy of these treatments is limited in achieving the therapeutic goals for UC, which include reducing inflammatory symptoms, inducing or maintaining clinical and endoscopic remission, and minimizing disability.[48]5 Consequently, some patients may require colon surgery due to insufficient effectiveness or severe complications. The pathogenesis of UC remains a contentious topic, characterized by its intricate nature. CD4^+T cells play a pivotal factor in regulating overall wellness and sickness, while restoring the equilibrium of CD4^+T cells aids in maintaining intestinal mucosal homeostasis.[49]6 The immunology community has discovered that activation is necessary for the discrimination of naive CD4^+T cells into Th1, Th2, Th17, and Tregs, thereby coordinating various adaptive immune responses. Furthermore, the gut microbiota provides numerous beneficial functions for the host encompassing immunity, metabolism, diseases etc., with its most dramatic function being its influence on the host’s immune system. On the one hand, it promotes early development and maturation of the immune system; on the other hand, it helps maintain the completeness of the intestinal barrier as well as regulate and sustain immune balance within the host.[50]7 The gut microbiota and its microbial metabolites can induce differentiation of CD4^+T cells through direct or indirect mechanisms to maintain immune homeostasis. Research data demonstrate that colitis induced by TNBS triggers Th1 and Th17 immune responses, resulting in the expression of numerous pro-inflammatory cytokines.[51]8 These immune responses of Th1 and Th17 lead to infiltration of inflammatory cells such as neutrophils, causing severe symptoms such as weight-loss, diarrhea and rectal prolapse. Both induced and spontaneous experimental models of colitis have authorized the involvement of inflammatory processes mediated by Th1 and Th2.[52]9 Recent evidence suggests that cytokines (secreted by Th2 and Tregs) have the ability to suppress the secretion of cytokines related to Th1/Th17 pathways, thereby alleviating IBD symptoms. Restoring the balance between Th1/Th2 and Th17/Tregs may represent an efficacious therapeutic approach for UC.[53]10 HED is a traditional Chinese medicinal (TCM) prescription, initially documented in Zhang Zhongjing’s Treatise on Cold Disease during the Han Dynasty. UC falls under TCM category “diarrhea, intestinal wind” with specific syndrome types including liver-kidney deficiency syndrome, dampness-toxin nostalgia syndrome, Yin-blood deficiency syndrome eg.[54]11,[55]12 The composition of HED includes Coptidis Rhizoma, Scutellariae Radix, Paeonia lactiflora Pall and Donkey-hide Gelatin. HED was changed by Gegen Qinlian decoction (GQD), which removed Gegen and licorice, and added Paeonia lactiflora pall and Donkey-hide Gelatin. HED has the potential to ameliorate colonic inflammation through restructuring of gut flora, specifically by regulating the CD4^+T cell subsets balance associated with gut microbiota.[56]13 White peony root has the effect of treating pus and blood and anti-inflammatory properties, and Colla corii asini has the effect of stopping bleeding and anti-inflammatory effect.[57]14 HED has a variety of effective chemical components, such as berberine, paeoniflorin, and baicalin.[58]15 Berberine has been utilized to cure intestinal infection and inflammation.[59]16 Paeoniflorin possesses extensive anti-inflammatory and immune regulatory effects.[60]17 Baicalin enhances the completeness of the intestinal barrier, exhibits antioxidant and anti-inflammatory properties, and promotes a healthy gut microbiota in individuals with UC.[61]18 In TCM, HED demonstrates efficacy in treating hematochezia, abdominal pain, and diarrhea, aligning with the Yin deficiency and blood deficiency characteristic of UC. HED’s therapeutic approach for ulcerative colitis (UC) aligns with traditional Chinese medicine (TCM) dialectics, particularly by addressing Yin-blood deficiencies. This alignment is supported by both theoretical underpinnings and clinically proven effectiveness. In addition, HED efficacy has been explored in our previous experiment. However, the underlying mechanism of action remained obscure. Furthermore, the potential role of HED in restoring CD4^+T cell balance during intestinal inflammation and its implications for the treatment of UC have not yet been reported. Thus, this study aimed to further investigate the therapeutic effects and mechanisms of HED on TNBS-induced UC mice by investigating its impact on gut microbiota and CD4^+T cells. Materials and Methods Composition and Preparation of HED HED was procured from the Traditional Chinese Medicine (TCM) Out-patient Department at Zhejiang Chinese Medicine University (Zhejiang, China), according to the original prescription dosage of Shanghanlun, made with the following four herbs: Coptidis Rhizoma (Huanglian, 12 g), Scutellariae Radix (Huangqin, 6 g), Paeonia Lactiflora Pall (Baishao, 6 g), and Donkey-hide Gelatin (Ejiao, 9 g), in a ratio of 4:2:2:3[62]19 which corresponds to the daily clinical dosage for humans, based on the equivalent dose ratio table, the dosage administered to mice is 9.1 times that of general humans (60kg). As a result, the low and high doses of HED for mice are approximately 2.5025 g crude herbs/kg and 10.01 g crude herbs/kg, respectively (analogous to half and twice the common dose for clinical patients). TCM was drenched in double distilled water (ddH[2]O) for 90 min, boiled over a fire for 40 minutes, simmered on low heat for 90 min, and then filtered. This process was iterative three times to extract the desired volume of solution. The extracted solution was subsequently evaporated and condensed into a final low dose of 98.9 mL and a high dose of 24.7 mL. Finally, the solution was sealed and deposited in a refrigerator at a temperature of 4°C. Component Analysis of HED The UPLC-Q-TOF/MS (Waters SYNAPT G2-Si, Milford, MA, USA) with Unifi/Qi software (Waters, Milford, MA, USA) was accomplished for the qualitative analysis and data processing. The liquid phases comprised water (A) containing 0.1% formic acid and acetonitrile (B) 0.1% formic acid, and the elution time was set at 35 minutes, whose conditions were as follows: A: 0–2 min; 5–100% A: 2–32 min; 100% A: 32–33 min; 5% A: 33–35 min. The pillar temperature was held steady at 35 °C throughout and the flux rate was 0.3 mL/min with the injection volume of 2ul. The specimens were primarily deliquescent in 75% ethanol, and the epipelagic sample was selected as the test solution following filtration through a membrane (0.22 µm). The mass spectra were procured by electrospray ionization (ESI) source by scanning negative and positive ions mode in the scope of m/z 50 ~ 1200 Da. The calibration of the mass spectrometer calibration was conducted utilizing sodium formate, and real-time mass correction was performed using leucine enkephalin (negative mode: 554.2615 m/z; positive mode 556.2771 m/z). The following parameter settings were performed: capillary voltage, 2.5 kV (negative) and 3 kV (positive); desolvation and ion source temperature, 500 °C and 120 °C; cone voltage and collision energy, 40 V and 15–45 V; scan time, 0.2 s; scan range, 50–1200 Da; desolvation and cone gas flow rate, 1000 L/h and 100 L/h. Animals A total of Specific Pathogen Free (SPF) 50 male Balb/c mice male Balb/c mice (6–8 weeks old; weighing 22±2 g) were acquired from Beijing HFK Bio-Technology. CO., Ltd (Animal License No. SCXK, Beijing, 20230811Abzz0100999606). The mice resided in a controlled SPF laboratory environment with a 12 hour-dark/12 hour-light cycle and temperature maintained at 21±1°C, which was provided with standard mouse diet and unrestricted access to tap water for an acclimation period of one week. The procedures were executed compliance with the Guidelines for Care and Use of Laboratory Animals of Zhejiang Chinese Medical University (IACUC-20220307-22). Experimental Model of UC The experimental mice were mildly anesthetized with 0.3% pentobarbital sodium by intraperitoneal injection (50 mg/kg).[63]20 Then, the mice were placed in prone position and the cannula surface of the intravenous indentor needle was smeared with paraffin oil and gently inserted into the colon through the anus. When the tip of the cannula was inserted about 4 cm from the anus, the inner core of the trocar with a syringe was immediately inserted into the cannula. At the same time, mice were inverted and slowly injected with TNBS (No. 20101002, Sigma-Aldrich) solution at the dose of 100 mg per kg of body weight.[64]21 Then the trocar was pulled out, and the mouse tail was held in an inverted position for 60 seconds to ensure better absorption and distribution of the injected solution in the intestine. Finally, the mouse head tilted down to the natural recovery, with normal saline scrub off the anus outflow of enteric liquid, to prevent the mice from licking poisoning. Then, the mice were put back into the cage to eat and drink freely. Animal Administration and Sampling The 50 mice were erratically allocated into five groups: the Control (CON), TNBS, HED-L, HED-H, sulfasalazine (Salazosulfapyridine; SASP) groups. The CON group was not treated, and the other four groups were intrarectally injected with TNBS to induce UC. The mice in the CON and TNBS groups were orally administered ddH[2]O, while the HED-L and HED-H groups orally received 2.50 and 10.01 mg/kg of HED, and the SASP group was orally treated with 500 mg/kg of SASP (No. H31020557, Tianping Pharmaceutical, Shanghai, China).[65]22 The drugs were administered on the first day after modeling and continued for 6 days, 0.4mL/20g, once a day. On the 6th day after modeling, the mice were euthanized with carbon dioxide and blood was taken from the heart. The colon of mice was extracted by laparotomy along the midabdominal line. Mice colons were taken for flow cytometry, part of the colon was taken for pathological HE, and the rest was frozen and stored for real-time polymerase chain reaction (qPCR) detection and Western blot detection. Colonic feces were frozen at −80 °C for 16S rRNA gene sequencing. Disease Activity Index From the modeling date, the mental state, eating, drinking, activity and body hair of the mice were observed and recorded every day.[66]23,[67]24 The shape of stool and the condition of stool blood were observed. Weight loss was the disparity between initial weight and measured weight, while diarrhea was characterized by the absence of fecal pellet formation and continuous presence of liquid fecal material in the colon. DAI scoring = (weight loss score)/3 + (Fecal trait score)/3+ (blood stool score)/3. ([68]Table 1) In the DAI score, stool bleeding was divided into normal (0 points), occult blood positive (1–3 points) and overt bleeding (4 points), and occult blood positive was further subdivided into +, ++ and +++, which were detected by o-toluidine method. + indicated mild occult blood, which changed from light green to blue after adding reagent for 10 seconds. ++ indicates moderate occult blood that changes in color to blue and gradually changes to blue-brown, and +++ indicates severe occult blood that changes in color to blue-brown and gradually changes to blue-black. Table 1. The DAI Scoring Standards Weight Loss (%) Stool Consistency Presence of Gross Bleeding or Bloodstain Score <0 Normal Negative 0 1–5 / + 1 5–10 Loose ++ 2 10–20 / +++ 3 >20 Diarrhea Rectal Hemorrhoea 4 [69]Open in a new tab Transcriptome Sequencing Analysis The RNA of colonic tissue was isolated from colonic tissues of mice in CON, TNBS, and HED-H groups and its integrity confirmed by formol agarose gel electrophoresis (Contains formaldehyde) and Bioanalyzer 2100 (Agilent, CA, USA). The NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA) was used to detect the amount and purity of total RNA. Total RNA > 1 µg, RNA integrity number (RIN) > 7.0, Concentration > 50 ng/µL meet the criteria for RNA library inclusion. Following cluster generation, the RNA libraries were sequenced on the illumina NovaseqTM 6000 platform by LC Bio Technology CO, Ltd (Hangzhou, China). After the transcriptome sequencing, we manipulated the OmicStudio tools ([70]https://www.omicstudio.cn/tool) to analyze the raw data constitute the Kyoto Encyclopaedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses. Isolation of Intestinal Immune Cells The isolation technique of lamina propria lymph nodes were experimentally optimized and refined, but with some specific modifications.[71]25 The colon was opened longitudinally, kept in 3 mL HBSS (Thermo Fisher Scientific) with 5 mM EDTA (Thermo Fisher Scientific) and 2% FBS (Omega Scientific) and oscillated at 37 °C for 30 min. Then, the tissue was washed twice with prechilled PBS (Biosharp), kept in 1.2 mL RPMI 1640 (Thermo Fisher Scientific) and sheared into tiny pieces. Next, 1 mL RPMI 1640 embracing 10% FBS, and 0.4 U/mL Dispase II (Solarbio), 1 mg/mL collagenase III (Solarbio) and 20 µg/mL DNase I (Beyotime) were added. The digestion was carried out at 37 °C for 45 min by shaking, and then the sample was filtered through 70 μm nylon mesh to obtain a tissue suspension.[72]26–28 Flow Cytometry The antibodies used in the flow cytometry (Anti-CD45-PE-cy7, anti-CD4-FITC, anti-T-bet-BV421, anti-GATA-3-BB700, anti-RORγT-AF647, anti-Foxp3-PE, anti-CD25-BV605 and Transcription Factor Buffer Set (TF)) were purchased from BD Biosciences (San Jose, CA, USA). The isolated mononuclear cell suspension was prepared, washed, mixed with antibodies CD45-PE-Cy7, CD4-FITC and CD25-BV605, incubated in dark light for 15 min, washed with PBS, then incubated with film TF at −4 °C for 60 min, and washed with PBS. The mixture of T-bet-BV421/GATA-3-BB700 was added, incubated at −4 °C degrees away from light for 60 min, washed, fixed, and analyzed by flow cytometry (BD Biosciences).[73]29 Western Blot Analysis The antibodies used in WB (anti-IL-1β (GB11113, Servicebio, Wuhan, China), anti-GAPDH (GB11002, Servicebio, Wuhan, China), anti-ZO-1 (bs-1329R, Bioss, Woburn, MA, USA), anti-Occludin (#91131, CST, Danvers, MA, USA), anti-IL-6 (DF6087, Affinity Biosciences, Jiangsu, China). Anti-IL-4 ([74]P05112), anti-IL-10 ([75]P22301), anti-IL-17A ([76]Q16552) and anti-β-actin ([77]P60709) were purchased from Proteintech Company in Wuhan, China. Briefly, proteins of colon were lysed and extracted using RIPA buffer, and protein quantification was measured using the BSA method. After blocking with 5% defatted milk, membranes were incubated with primary antibodies containing anti-ZO-1 (1:1000), anti-Occludin (1:500), and anti-IL-1β (1:500) for 1 h overnight at 4 °C. Then, the second antibody was added dropwise at room temperature incubating 2 h, and after that, washed Tris-buffered saline (TBST) 3 times. Finally, the FluorChem R (ProteinSimple, USA) and ImageJ analysis software 1.4.3.67 (National Institutes of Health, Bethesda, MD, USA) were wielded for band visualization and quantification. RNA Extraction and Real-Time PCR Total RNA was extracted out from snap frozen (at −80 °C) intestine tissue using a TRIzol-based method. Reverse transcription was performed using a HiScript III RT SuperMix for qPCR kit abiding by the manufacturer’s instructions. Primers were designed for qRT-PCR based on the 16S rRNA gene sequences available in the National Center for Biotechnology Information (NCBI) databases, and ([78]Table 2). The amplification primers and reagent on top were furnished by Accurate Biotechnology (China) CO., LTD (Shanghai, China). The experimental results were calculated using the 2^−∆∆Ct formula. Table 2. Primer Sequences of the Genes Used for qRT-PCR Gene Forward Primer Reverse Primer Gene ID β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA 14433 ZO-1 ACCAGATGTGGATTTACCCGTCA ACATCATTTCCACCAGCTAGTCG 21872 Occludin GGCAAGCGATCATACCCAGA GGCAAGCGATCATACCCAGA 18260 IL-4 ACGGAGATGGATGTGCCAAAC AGCACCTTGGAAGCCCTACAGA 16189 IL-6 TGATGGATGCTACCAAACTGGA TCTCTCTGAAGGACTCTGGCT 16193 IL-10 TCTCTCTGAAGGACTCTGGCT TCACTCTTCACCTGCTCCAC 16153 IL-17A TCAGACTACCTCAACCGTTCCA CTTTCCCTCCGCATTGACACA 16171 IL-1β TGGTGTGTGACGTTCCCATT TGTCGTTGCTTGGTTCTCCT 16176 T-bet CCACCTGTTGTGGTCCAAGT TGTAATGGCTTGTGGGCTCC 57765 Gata-3 CTCGGCCATTCGTACATGGAA CATACCTGGCTCCCGTGGTG 14462 [79]Open in a new tab Investigation of Gut Microbiota by 16S rRNA Gene Sequencing Fecal samples were acquired from the colon contents to extract genomic DNA of the gut microbiota and accomplished 16S rRNA Gene Sequencing (LC Bio Technology CO., Ltd, Hangzhou, China). The sequencing analysis process put to avail QIIME 2 version, which was tantamount to clustering with 100% similarity, and next invoked the split amplification de-noising algorithm (DADA2) to de-noise the data, excluded the redundancy, and acquired the features. Pursuant analysis results were reliant on features data. We utilized the OmicStudio tool to constitute Correlation Network diagram, Violin plot and Clustering correlation heatmap at OmicStudio. Statistical Analysis The data were denoted as mean ± standard error of mean (SEM). The t-test was exploited for pairwise comparisons, and one-way ANOVA of variance followed by Tukey’s tests when groups were more than two. P≤0.05 is an enormous difference. Result Chemical Compounds of HED Was Identified The base peak intensity (BPI) chromatogram profile of HED included positive and negative ions ([80]Figure 1). A total of 58 compounds (1–58) were identified by the Unifi/Qi software, binding the fragment ions and the empirical molecular formulas ([81]Table 3). Forty-one major components were detected in the positive ions and 33 major components were detected in the negative ions, of which 16 major components were detected by both positive and negative ions. In addition, the mass spectrometry analysis of the formula was obtained by the analysis of Coptidis rhizoma, Scutellaria baicalensis and Paeonia lactiflora pall. Ejiao, a traditional Chinese medicinal material sourced from donkey skin, primarily consists of high-molecular-weight collagen. However, the complex structure and thermal instability of this collagen present substantial obstacles for mass spectrometry analysis, making Ejiao unsuitable for this type of analytical technique. Berberine, Tetrandrine, Coptisine and Groenlandicine found in Coptidis rhizoma; Baicalin, Baicalein and Chrysin present in Scutellaria baicalensis; as well as Paeoniflorin, Albiflorin, and Lactiflorin derived from Paeonia lactiflora pall were well-established active ingredients. The functions of several of these components were intricately linked to T-cell differentiation and the composition of gut microbiota, for instance, Berberine, Tetrandrine, Baicalin, Baicalein, Chrysin, Paeoniflorin.[82]30,[83]31 Figure 1. [84]Figure 1 [85]Open in a new tab Representative base peak intensity (BPI) chromatograms of PNS in (A) positive and (B) negative modes. The numbering of identified compounds (1–58) is the same as in [86]Table 1. Table 3. Compounds Identified from HED by UPLC-Q-TOF/MS NO. T[R] (min) Identification Molecular Formula Theoretical Mass (Da) [M-H]^− / [M+H]^+(m/z) Fragment Ions (Negative/Positive) Source 1 0.85 D-(+)-Sorbose C6H12O6 180.06 179.05 99.04, 145.05, 149.04/135.06, 145.04, 163.05 Baishao 2 2.27 Danshensu C9H10O5 198.05 197.04/ 135.04, 149.05, 151.03/ Huanglian 3 2.38 3-Carboxy-4-hydroxy-phenoxy glucoside C13H16O9 316.07 315.07/ 152.01, 230.01/ Huanglian 4 5.1 Tetrandrine C38H42N2O6 622.30 /623.31 /596.29, 609.30 Huanglian 5 5.36 Cosmetin C21H20O10 432.11 433.11 293.04, 311.05, 341.06/337.06, 379.08, 397.09 Huanglian 6 5.43 Cis-Ferulic acid C10H10O4 194.06 193.05/ 134.03, 149.05, 179.03/ Huanglian 7 5.46 Neochlorogenic acid C16H18O9 354.09 353.09/ 173.04, 179.03, 193.04/ Huanglian 8 5.88 Darendoside B C21H32O12 476.18 475.18/ 343.13, 387.12, 459.18/ Huanglian 9 6.1 Daidzin C21H20O9 416.11 417.11 339.08, 379.08, 397.09/297.07, 341.09, 381.09, 399.10 Huanglian 10 6.1 1-O-β-D-Glucopyranosylpaeonisuffrone C16H24O9 360.14 399.11 379.08, 337.07/281.08, 367.08, 449.14 Baishao 11 6.13 4-O-Galloylalbiflorin C30H32O15 632.17 /631.16 /383.11, 415.10, 513.15, 574.12 Baishao 12 6.35 Hormothamnione C21H20O8 400.11 445.11/ 331.07, 355.08, 383.07/ Huangqin 13 6.42 2-Carboxymethyl-3-phenyl-2,3-epoxy-1,4-naphthoquinone C17H16O5 300.09 /301.1 /197.09, 198.08 Huanglian 14 6.42 Paeonilactone-B C10H12O4 196.07 /197.08 /109.06, 133.06, 151.07 Baishao 15 6.42 Paeonilactone-C C17H18O6 318.11 /319.11 /179.07, 197.09, 301.10 Baishao 16 6.79 Albiflorin R1 C23H28O11 480.16 /503.15 /301.10, 463.16 Baishao 17 6.79 Lactiflorin C23H26O10 462.15 463.16 309.09, 366.09, 479.15/323.11, 338.10 Baishao 18 6.79 Oxypaeoniflorin C23H28O12 496.16 495.15/ 405.15, 479.15, 508.15/ Baishao 19 6.79 Paeonoside C15H20O8 328.12 327.11/ 309.09, 445.11, 449.14/ Baishao 20 7.63 Eugeniin C41H30O26 938.10 /977.06 /441.10, 751.04386 Baishao 21 7.7 Albiflorin C23H28O11 480.16 525.16/ 255.06, 297.07, 417.11/ Baishao 22 7.73 Paeonin C C17H24O9 372.14 /411.10 /219.07, 289.07 Baishao 23 7.77 Berlambine C20H17NO5 351.11 /352.11 /325.07, 295.06 Huanglian 24 8.01 1,2,3,4,6-Pentagalloylglucose C41H32O26 940.11 /941.12 /731.11, 743.11 Baishao 25 8.02 Galloylpaeoniflorin C30H32O15 632.17 631.16/ 491.11, 583.14, 613.15/ Baishao 26 8.11 8-Debenzoylpaeonidanin C17H26O10 390.15 /429.11 /322.10, 336.12 Baishao 27 8.78 Jatrorrhizine C20H20NO4 338.13 /339.14 /306.11, 323.11 Huanglian 28 9.06 Paeoniflorin C23H28O11 480.16 525.16/ 338.10, 403.14, 463.15/ Baishao 29 9.07 1-O-beta-D-Glucopyranosyl-8-O-benzoylpaeonisuffrone C23H28O10 464.16 509.16/ 283.08, 338.10, 403.14/ Baishao 30 9.12 5,7,4′-Trihydroxy-8-methoxyflavanone C16H14O6 302.07 /303.08 /271.05 Huangqin 31 9.33 Groenlandicine C19H16NO4 322.10 323.11 275.05, 293.06, 306.07/279.08, 308.09 Huanglian 32 9.37 Moupinamide C18H19NO4 313.13 /336.12 /174.04, 178.06, 279.08 Huanglian 33 9.5 (R)-Canadine C20H21NO4 339.14 338.13/ 309.09, 323.11/ Huanglian 34 9.7 Baicalin C21H18O11 446.08 447.09 269.04, 311.05, 341.06, 383.07/269.04, 271.05, 417.11 Huangqin 35 9.7 Baicalein C15H10O5 270.05 /271.05 /253.04 Huangqin 36 9.7 Norwogonin C15H10O5 270.05 269.04/ 192.01, 251.03/ Huangqin 37 9.79 Viscidulin II C17H14O7 330.07 331.08 299.01, 314.04/301.03, 316.056 Huangqin 38 10.15 Dihydrobaicalein C15H12O5 272.06 273.07 271.05, 371.11/169.01 Huangqin 39 10.15 Dihydrobaicalin C21H20O11 448.10 449.10 313.07, 371.11/253.04, 269.04,271.05 Huangqin 40 10.45 Berberine C20H18NO4 336.12 /337.12 /276.06, 290.08, 309.13 Huanglian 41 10.46 Javanicin C15H14O6 290.07 /291.08 /222.08, 250.08, 274.08 Huangqin 42 10.47 Salidroside C14H20O7 300.12 323.11 121.06, 165.05, 233.08/232.07, 236.11, 251.08 Huangqin 43 10.47 Berberrubine C19H15NO4 321.10 322.10 292.09, 304.09, 309.09/276.06, 294.11 Huanglian 44 10.47 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one C19H17NO3 307.12 /308.12 /275.09, 279.12 Huangqin 45 10.47 Paeonilactone A C10H14O4 198.08 /221.07 /179.06, 169.01 Baishao 46 10.51 Scutevulin C16H12O6 300.06 /301.06 /286.04 Huangqin 47 10.51 5,8,2′-Trihydroxy-7-methoxyflavone C16H12O6 300.06 299.05/ 267.02, 284.03/ Huangqin 48 10.56 Isomartynoside C31H40O15 652.23 651.23/ 426.11, 461.11, 487.16/ Huangqin 49 10.57 Coptisine C19H14NO4 320.09 /321.09 /290.08, 304.09 Huanglian 50 10.71 Chrysin C15H10O4 254.05 255.06 151.00, 237.05/239.06 Huangqin 51 11.12 Wogonin C16H12O5 284.06 285.07 240.04, 268.03/241.04, 270.05 Huangqin 52 11.12 Oroxindin C22H20O11 460.10 461.10 283.06, 293.04, 441.08/269.04, 285.07 Huangqin 53 11.33 5,8-Dihydroxy-6,7-dimethoxyflavone C17H14O6 314.07 315.08 283.02,298.04/183.02, 285.03 Huangqin 54 11.35 Dihydrooroxylin C16H14O5 286.08 287.09 229.04, 253.04, 271.05/183.02, 254.05686 Huangqin 55 14.12 3beta,23-Dihydroxyoleana-11,13(18)-dien-28-oic acid C30H46O4 470.33 /471.34 /285.22, 435.32, 453.33 Baishao 56 15.18 Neobaicalein C19H18O8 374.10 /375.10 /345.05 Huangqin 57 15.18 Skullcapflavone II C19H18O8 374.10 373.09/ 328.02, 358.06, 343.04/ Huangqin 58 31.98 Magnograndiolide C15H22O4 266.15 265.14 233.15, 249.11/235.09 Huangqin [87]Open in a new tab Notes: *Only three components of Coptidis Rhizoma, Radix scutellariae and White peony root were identified. *The mass spectrometry is used for qualitative detection of traditional Chinese medicine, and what is measured is the relative mass number. HED Alleviated TNBS-Induced Experimental Colitis All Balb/c mice were sacrificed on day 6 after TBNS induction ([88]Figure 2A). During the experiment, the TNBS group displayed typical clinical symptoms of UC relative to the CON group, comprising weight loss, diarrhea and macroscopic bloody stool ([89]Figure 2B and [90]C). Treatment with HED-L, HED-H, and SASP restored the weight loss in mice with colitis during disease progression ([91]Figure 2C). Compared with the TNBS group, HED-L, HED-H and SASP groups enriched the survival rate of the colitis mice, due to death of two mice, the number of mice per group become eight instead of ten ([92]Figure 2D). In terms of disease activity index (DAI) scores, the highest score was obtained on the first day after modeling and three drug intervention groups had significantly (P ≤ 0.05 - P ≤ 0.001) lower DAI score and inflammation than TNBS group ([93]Figure 2E). TNBS induced intestinal wall thickening, edema, and ulcer formation in colitis mice ([94]Figure 2F). Additionally, TNBS significantly (P ≤ 0.001) increased colon weight and colon index (colon weight/length ratio), spleen weight and spleen index (spleen weight/body weight ratio) in the CON group. Treatment with HED-L, HED-H and SASP significantly (P ≤ 0.05- P ≤ 0.0001) alleviated TNBS-induced colonic edema and splenomegaly ([95]Figure 2G–J), suggesting that HED has an anti-inflammatory effect on UC model mice. Figure 2. [96]Figure 2 [97]Open in a new tab HED treatment mitigated TNBS-induced UC in mice. (A) Experimental design; (B) Modeling of Balb/c colitis mice; (C) Body weight of mice; (D) Survival rate in TNBS-induced ulcerative colitis in mice; (E) DAI score; (F) Image of the colon (arrows indicating the injury sites); (G) Colon weight; (H) Spleen Weight; (I) Colonic index; (J) Spleen index; (K) Representative H&E-stained colon sections (40× magnification, cross-sectional images of the colon selected at random). Data were shown as mean ± SEM (n=6): ^###P < 0.001, ^####P < 0.001, compared to the CON group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001, compared to the TNBS group. Histological analysis manifested that the colonic mucosal epithelial cells in the CON group were intact, the structure of crypts was normal, the glands were tidily organized, and no atrophy, necrosis, inflammatory infiltration and other lesions were observed ([98]Figure 2K). For the TNBS group, the severe epithelial cell injury showed less damage to glands, ulcers, and goblet cells, and severe inflammation accompanied by submucosal immune cell infiltration, leading to higher histological grades. Treatment with HED-L, HED-H and SASP, alleviated the degree of intestinal epithelial injury, markedly modified the number and area of ulcer lesions, substantially converted the infiltration of neutrophils and other immune cells. Transcriptomic Effects of HED-H on TNBS-Induced Colitis Following a rigorous evaluation based on the above provided data, colon of the HED-H group was chosen for transcriptome sequencing due to its demonstrably greater improvement over HED-L. To profoundly explore the underlying mechanisms of HED-H in the treatment of colitis mice, we adopted a transcriptome sequencing using the colon tissues. Volcano graphs were prepared for demonstrating DEGs in TNBS VS CON and HED-H VS TNBS ([99]Figure 3A–B). As for the CON group, 682 genes were downregulated and 482 genes were upregulated in the TNBS group. In the TNBS group 773 genes were downregulated and 1332 genes upregulated after treatment with HED-H. As analyzed in KEGG, with reference to the results of P-values, the majority of DEGs were distinctly enriched in the T cell-related pathways (Th17 cell differentiation, Th1 and Th2 cell differentiation and T cell receptor signaling), NF-kappa B signaling pathway and cytokine–cytokine receptor interaction ([100]Figure 3C). GO enrichment BarPlot results indicated that the DEGs mainly participated in T cell proliferation, inflammatory response, immune response, response to bacterium and extracellular space, eg([101]Figure 3D). The top 25, 15, and 10 most meaningful GO terms in biological processes (BP), cellular component (CC), and molecular function (MF) were oxidation-reduction process, metabolic process, and regulation of transcription in BP; nucleus, membrane, nucleosome and integral component of membrane in CC; DNA bonding, protein bonding and ATP bonding in MF ([102]Figure 3E). Through KEGG and GO analysis, the anti-inflammatory mechanism of HED-H in UC could be related to CD4^+T cell subsets (Th1/Th2/Th17) and gut microbiota. Figure 3. [103]Figure 3 [104]Open in a new tab Colon transcriptome analyzed by RNA sequencing (n=3). (A) Volcano plot demonstrating the DEGs in the TNBS and CON groups. The red dots indicate the upregulated genes, the blue dots show the downregulated genes, and the grey dots indicate genes with no significant change; (B) Volcano plot showing the DEGs in the HED-H and TNBS groups; (C) KEGG pathway enrichment analysis; (D) GO pathway enrichment analysis; (E) Specific BP, CC, and MF are shown in barplot; Deep red bars represent MF terms. Light red bars represent CC terms. Light yellow bars represent BP (n=3). HED Restored Th2/Th1 and Th17/Treg Cells Balance in the Colon of TNBS-Induced Colitis Mice The dynamic balance between CD4^+T cell subsets plays a crucial portion in the deformation and occurrence of UC.[105]32 To explore whether HED could induce anti-inflammatory mechanism in UC model mice, we applied flow cytometry to analysis CD4^+T cell subsets (Th1, Th2, Th17, Tregs). Then, we ascertained the effect of HED on the balance of regulatory CD4^+T cell subsets in TNBS-induced UC by measuring the percentages of Th1, Th2, Th17 and Tregs in colonic tissue by flow cytometry ([106]Figure 4A). The percentage of CD4, Th1 and Th2 cells in the TNBS group were significantly (P≤0.01-P≤0.0001) increased compared to the CON group. In the 3 treated groups, the HED-L and SASP groups had a significant recovery of CD4, Th1 and Th2 cell proportions ([107]Figure 4B-D). The HED-L group significantly (P≤0.01-P≤0.001) restored the percentage of Th1 and Th2 cells, but did not restore the percentage of CD4+ cells, compared with the TNBS group ([108]Figure 4B–D). The percentage of Th17 and Tregs showed no statistically significant difference in all groups, except for the percentage of Th17 in the SASP group ([109]Figure 4E–F). The Th2/Th1 ratio was significantly (P≤0.01) increased in the TNBS group, while it was significantly (P≤0.01) reduced in HED-H and SASP ([110]Figure 4G). In the TNBS group, Tregs/Th17 ratio was also significantly (P≤0.01) decreased, while in the 3 treated groups this ratio was significantly (P≤0.01) recovered to a limit comparable to the CON group ([111]Figure 4H). Figure 4. [112]Figure 4 [113]Open in a new tab HED treatment restored the balance of Th2/Th1 and Tregs/Th17 cells in the colon tissue of TNBS-induced colitis mice. (A) Percentage of Th1, Th2, Th17, and Treg cells; (B-F) Statistics of the proportion of CD4, Th1, Th2, Th17, and Treg cells; (G-H) The ratio of Th2/Th1 and Tregs/Th17 cells; Data were shown as mean ± SEM (n=6): ^#P < 0.05, ^##P < 0.01, ^####P < 0.001, compared to the CON group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001, compared to the TNBS group. HED Shifted the TNBS-Induced UC Mice Th2/Th1 and of Tregs/Th17 Related Cytokines We initially assessed the protein and mRNA expression of T-bet and Gata3 in colon tissues. As compared to the CON group, T-bet and Gata3 gene and protein expression was significantly (P≤0.01- P≤0.001) elevated in the TNBS group, which were (P ≤ 0.05- P ≤ 0.001) reduced towards normal levels by treatment with HED-L, HED-H and SASP ([114]Figures 5A and 6A). Figure 5. [115]Figure 5 [116]Open in a new tab Western blot for (A) T-bet and Gata-3; (B) IL-6 and IL-4; (C) IL-1β, IL-10 and IL-17A; (D) Zo-1 and Occludin; Data were presented as mean ± SEM (n=5): ^##P < 0.01, ^###P < 0.001, ^####P < 0.001, compared to the CON group; *P < 0.05, **P < 0.01, ***P < 0.001, compared to the TNBS group. Figure 6. [117]Figure 6 [118]Open in a new tab Relative mRNA expression of (A) T-bet and Gata-3; (B) IL-6 and IL-4; (C) IL-1β, IL-10 and IL-17; (D) Zo-1 and Occludin; Data were presented as mean ± SEM (n=5): ^##P < 0.01, ^###P < 0.001, ^####P < 0.001, compared to the CON group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.001, compared to the TNBS group. The TNBS group exhibited significantly (P ≤ 0.01- P ≤ 0.0001) higher expression of IL-4 and IL-6 genes/proteins compared to the CON group, and this expression was significantly (P ≤ 0.05- P≤0.0001) downregulated in the HED-L, HED-H and SASP groups ([119]Figures 5B and 6B). In the TNBS group, there was a significant (P≤0.0001- P≤0.0001) decrease in the expression of IL-10 and a significant (P≤0.001 - P≤0.0001) increase in the expression of both IL-1β and IL-17A genes/proteins. Moreover, treatment with HED-L, HED-H and SASP effectively mitigated these inflammatory changes towards normalization, which was a significant (P≤0.05- P≤0.001) increase in the expression of IL-10 and a significant (P≤0.05 - P≤0.001) decrease in the expression of both IL-1β and IL-17A genes/proteins ([120]Figures 5C and 6C). HED Enhanced Intestinal Barrier Function of TNBS-Induced UC The close relationship between T cells and intestinal barrier function prompted us to ulteriorly investigate the influence of HED on intestinal barrier function. Tight junction protein Occludin and ZO-1 were chosen to assess HED treatment effects on UC intestinal barrier function. Western blot and qPCR results revealed that the expression of Occludin and ZO-1 tight junction proteins/genes were significantly (P≤0.0001) declined in the TNBS group, while treatment with HED-L, HED-H or SASP significantly (P≤0.05- P≤0.001) elevated this expression. These results infer that HED and SASP therapy can restore bowel barrier function in UC mice ([121]Figures 5D and [122]6D). HED Treatment Significantly Altered the Gut Microbiota in TNBS-Induced Colitis Mice To determine whether the HED treatment altered the microflora, we performed high-throughput genetic sequencing of 16Sr DNA in the faecal bacterial DNA of the CON, TNBS and HED-H groups. As shown in [123]Figure 7A–B, the occurrence of Chao1 and Shannon indices representing α-diversity of the intestinal ecosystem were markedly different among the three groups, both indices were massively down-regulated in the TNBS group relative to the CON, while both indices were reinstated after HED-H intervention. Additionally, β-diversity analysis such as Principal coordinate analysis (PCoA) and the differences of principal component analysis (PCA) were also performed among the groups ([124]Figure 7C-D). The strain repetition rate was higher in HED-H group and CON group, especially in PCA. The results showed that UC mice colonies gradually returned to normal after the HED-H intervention. Based on the results of the α-diversity and β-diversity analysis described above, we suggest that HED could restore microbial community diversity in TNBS-induced colitis mice to some extent. Figure 7. [125]Figure 7 Continued. Figure 7. [126]Figure 7 HED-H altered the gut microbiota in TNBS-induced colitis mice. (A-B) The results of ɑ-diversity analysis containing Chao1 and Shannon among CON, TNBS and HED-H groups; (C-D) The results of β-Diversity analysis including PCA and PCoA in different groups; (E-F) Community bar plot analysis of gut microbiota at the phylum level and genus level; (G-H) Gut microbiota and inflammatory cytokines were shown with Correlation Heatmap and Correlation Network between (n=3): ^###P < 0.001, compared to the CON group; ***P < 0.001, compared to the TNBS group; ns indicated no significant (P > 0.05). [127]Open in a new tab In the microbial diversity analysis of cluster analysis, we have shown the results of flora richness at the phylum and genus levels, where phylum includes Firmicutes, Bacteroidetes and Proteobacteria and genus level contains Lactobacillus, Muribaculaceae_unclassified, Ruminococcaceae_UCG-014, Bacteroides and Helicobacter pylori, the seven colonies mentioned above showed that exhibited prominent differences of the relative abundance between the TNBS and CON groups. Their relative abundances were enormously reversed by HED-H ([128]Figure 7E–G). To further investigate the relationship between gut microbiota and inflammation, we analyzed the strains and inflammatory factors that showed significant differences in the experiment by drawing heat maps. Most of the inflammatory factors such IL-Iβ, IL-6, IL-17AA and strains were closely related, as indicated by the correlation diagram ([129]Figure 7H), in which Muribaculaceae_unclassified, Bacteroidetes and Ruminococcaceae_UCG-014 were significantly different from all inflammatory factors, manifesting that these bacteria groups play an influential regulatory assignment in the anti-inflammatory effects of observed in the HED-H group. Discussion Traditional Chinese medicine (TCM) plays a crucial role as one of the effective treatments for UC, especially for the remission and recurrence of the clinical symptoms of UC.[130]33 The discovery and exploration of effective TCM prescriptions for the treatment of UC have been progressing. Of these, TCM, Gegen Qinlian Decoction, Peony Decoction, Licorice Xiexin Decoction were reported to play a significant anti-inflammatory effect in the treatment of UC animal model.[131]13,[132]34–37 HED is one of the classic prescriptions of TCM In our current study, HED was shown to be effective against UC and to improve survival in TNBS-induced colitis mice. Moreover, UC mice recovered significantly after HED treatment in terms of body weight, DAI score, colon weight and index, spleen weight and index, and pathological score. In order to further probe into the potential mechanism of HED anti-UC, we conducted research from two aspects. On the one hand, transcriptional sequencing KEGG and GO analysis showed that HED could positively affect CD4^+T cell subsets (Th1, Th2 and Th17) and gut microbiota. On the other hand, the main components of HED decoction, such as Berberine, Tetrandrine, Baicalin, Baicalein, Chrysin, Paeoniflorin, eg. were identified as monomers to exert anti-UC effects by regulating CD4^+T cells and gut microbiota.[133]38–43 Therefore, we hypothesized that the HED mechanism could involve CD4 subsets and gut microbiota, which were further validated by us using flow cytometry, WB, and 16s sequencing. The imbalance between CD4 subsets, especially Th1, Th2, Th17, and Tregs, leads to progressive and recurrent episodes of UC.[134]32 The latter was previously defined as a disease dominated by atypical Th2 elevation.[135]44 It has been reported in the literature that TNBS can cause disorders of Th1, Th2 and Th17.[136]45 So we used TNBS to induce Balb/c mice and established a model with significantly elevated Th2 ratio. Flow cytometry results revealed that the proportion of Th1, Th2 and Th17 increased in the TNBS group, especially the proportion of Th2, which was most significantly increased. Contrarily, HED treatment reversed this trend, specifically inhibiting the increase in Th2 and Th1 ratios. GATA3 and T-bet are key transcription factors of Th2 and Th1, which facilitate the differentiation of Th1 and Th2.[137]46 The protein and mRNA of GATA3 and T-bet in the TNBS group were highly expressed, while treatment with HED significantly reduced the levels of GATA3 and T-bet in a dose-dependent manner, which indicates that HED could weaken the activity of Th1 and Th2 cells by reducing the expression levels of GATA3 and T-bet. Additionally, high dose HED could also significantly restore higher Th2/Th1 and lower Treg/17 ratio in UC mice. Taken together, HED could exert anti-inflammatory effects by regulating the balance of Th2/Th1 and Treg/Th17, mainly through the inhibition of the Th2 /Th1 ratio. Previous studies reported that the overexpression of specific pro-inflammatory factors such as IL-6, IL-1β and IL17 in UC patients could induce intestinal mucosal inflammation and damage, while the inhibition of the anti-inflammatory factor IL-10 could aggravate the inflammatory response of UC.[138]46 Subsequently, we evaluated CD4^+T subgroup-related cytokines (IL-4, IL-6, IL-17A, IL-10, and IL-1β), and found remarkable changes in these markers. Of interest, HED therapy reversed the increase in IL-6 and IL-17A and the decrease in IL-10 in the TNBS group. IL-4 fosters undifferentiated CD4^+T cells into Th2 subsets and activates Th2 cells, which can activate Th2 cells, inhibit Th1 cells, and maintain the balance between Th1 and Th2.[139]47 Overexpression of IL-4 may lead to immune disorders and the persistence of intestinal inflammation, which has a negative impact on the treatment and prognosis of UC.[140]48 Our results showed that the expression of IL4 was vastly increased in UC mice, while this expression was decreased after HED treatment. This result indicated that HED could reduce inflammation by decreasing IL-4, thereby inhibiting the differentiation of Th2 and Th1. Accumulating evidence has established that intestinal flora is one of the essential pathogenesis mechanisms of UC.[141]33 The imbalance of gut microbiota causes immune disorders, accompanied by impaired intestinal barrier function and continuous inflammatory response, resulting in the progression of UC.[142]49 In this present study, we substantiated that the intestinal microbial composition of UC mice treated with HED not only changed significantly, but also the microbiota diversity was restored, revealing that the phylactic effect of HED on TNBS-induced UC may be correlated with the intestinal microbial population. In agreement with previous DSS model studies, at the phylum level, relative abundances of Firmicutes increased overwhelmingly and Bacteroidetes decreased tremendously after TNBS treatment relative to the CON group. In UC patients, a similar microbiota dysbiosis was observed, with a decreased ratio of Firmicutes to Bacteroidetes (F/B).[143]50 The phylum Proteobacteria was found to be the predominant group in the intestinal microbiota of the normal control mice, enormously increased in TNBS group, while HED treatment restored the changes in Proteobacteria, Firmicutes and Bacteroides.[144]51 At the genus level, HED impaired the effect of TNBS on beneficial bacterial genera in the gut. Lactobacillus and Bacteroides were shown to beef up intestinal barrier function through the promotion of TJ protein expression in intestinal epithelial cells, reduction of apoptosis in epithelial cells, and modulation of the intestinal mucus layer.[145]52 Ruminococcaceae_UCG-014 is closely related to the production of butyrate, a major energy source of intestinal epithelial cells, and also inhibits the signaling pathway for pro-inflammatory cytokines. In addition, its abundance leads to increased mucin secretion and tight junctions, thereby enhancing intestinal barrier function. The abundance of these three bacteria after HED treatment suggests that improved intestinal barrier function in UC mice after HED treatment. In addition to the above three obvious flora, there is Akkermansia muciniphila, as an important microorganism in the intestinal flora, which can provide energy for intestinal cells by degrading mucin and promote the release of intestinal mucin, thereby enhancing the integrity of the intestinal mucosal barrier.[146]53 In support, HED treatment reversed the decline in intestinal barrier function, as evidenced by the expression of key tight junction proteins ZO-1 and occludin in the TNBS group. Levels of these crucial proteins/genes returned to near normalcy, mirroring those observed in the healthy control group.[147]54,[148]55 Notably, Helicobacter pylori (H. pylori), as an opportunistic pathogen, is highly associated with inflammation of the gut and is commonly significantly increased after induction of the DSS model. Similarly, we found that H. pylori abundance increased significantly after TNBS induction and decreased significantly after HED treatment, suggesting that HED may reduce the pathogen content to alleviate colitis. These results demonstrated that the variation in the levels of these bacteria may have predominantly contributed to the anti-UC effects of HED. Interactions between gut microbiota and cytokines are complex and bidirectional.[149]56 With HED regulation of cytokines and key flora, correlation heatmaps and network results were drawn to show that most flora and cytokines are closely related, reflecting that flora and CD4^+T are indispensable components of the HED anti-inflammatory mechanism.[150]57 The study validated the potential mechanisms of HED on TNBS-induced UC Balb/c mice. The regulation of Th2/Th1 and Tregs/Th17 cell balance, as well as the modulation of gut microbiota by HED and restoring intestinal barrier function providing more mechanistic basis for amelioration of UC. Acknowledgments