Abstract

   Nutritional intake is closely linked to gonadal development, although
   the mechanisms by which food intake affects gonadal development are not
   fully understood. Cholecystokinin (CCK) is a satiety neuropeptide
   derived from the hypothalamus, and the present study observed that
   hypothalamic CCK expression is significantly influenced by food intake,
   which is mediated through blood glucose levels. Interestingly, CCK and
   its receptors were observed to exhibit a high expression in the
   hypothalamus–pituitary–gonad (HPG) axis of grass carp (Ctenopharyngodon
   idellus), suggesting that CCK is potentially involved in regulating
   fish reproduction through the HPG axis. Further investigations revealed
   that CCK could significantly stimulate the expression of
   gonadotropin-releasing hormone-3 (GnRH3) in the hypothalamus. In
   addition, single-cell RNA sequencing showed that cckrb was highly
   enriched in pituitary follicle-stimulating hormone (FSH) cells. Further
   study confirmed that CCK can significantly induce FSH synthesis and
   secretion in primary cultured pituitary cells. Additionally, with
   primary cultured ovary cells as a model, the in vitro experiment
   demonstrated that CCK directly induces the expression of lhr, fshr, and
   cyp19a1a mRNA. This indicates that hypothalamic CCK may act as a
   nutrient sensor involved in regulating gonadal development in teleosts.

   Keywords: satiety neuropeptide, follicle-stimulating hormone, GnRH3,
   pituitary, sexual maturity

1. Introduction

   Nutritional intake is closely linked to gonadal development. In
   mammals, it has been observed that over nutrition can trigger
   precocious sexual maturation in rats and monkeys [[42]1,[43]2,[44]3],
   while inadequate nutrition tends to delay sexual maturation
   [[45]4,[46]5]. In teleosts, food intake is closely linked to the age of
   sexual maturity. Food restriction delays both growth and sexual
   maturity [[47]6]. These results emphasize how dietary intake levels
   affect fish gonadal development. However, the precise mechanisms by
   which food intake modulates sexual maturation are still not fully
   understood.

   In mammals, cholecystokinin (CCK) is a satiety neuropeptide, and food
   intake could significantly upregulate CCK expression in the
   hypothalamus [[48]7,[49]8,[50]9,[51]10]. Similarly, in fish, feeding
   has been shown to have the ability to increase hypothalamic CCK
   transcription levels [[52]11,[53]12]. However, the physiological
   mechanisms underlying diet-induced hypothalamic CCK expression in fish
   remain unclear. Recent studies in mammals have identified
   CCK-expressing neurons as glucose-sensing neurons capable of detecting
   changes in blood glucose concentration [[54]13,[55]14]. This has raised
   the question of whether fish CCK neurons are also glucose sensitive and
   whether feeding induces hypothalamic CCK expression by raising the
   blood glucose levels. At present, these questions remain unanswered.

   In the mammalian hypothalamus, CCK is recognized as a post-prandial
   satiety factor, providing short-term satiety and inhibiting appetite to
   maintain a balance between food intake and weight regulation
   [[56]15,[57]16]. The regulation of feeding behavior and the secretion
   of gonadotropin-releasing hormone (GnRH) are closely linked, with
   various anorexic and anorexigenic signals controlling feeding behavior
   and altering GnRH secretion via receptors on GnRH neurons. This
   relationship has been studied in mice, with GT1-7, a mouse hypothalamic
   neuronal cell line, being commonly used as an in vitro model to
   investigate the expression of feeding-related peptide receptors and
   their roles in GnRH secretion [[58]17]. Beyond its role in regulating
   feeding, CCK is proposed to be involved in reproductive control by
   stimulating the migration and activation of gonadotropin-releasing
   hormone (GnRH) neurons in the mammalian brain [[59]18,[60]19]. In
   goldfish (Carassius auratus), feeding has been shown to increase
   hypothalamic CCK transcript levels [[61]20], and exogenous CCK
   injections can inhibit fish feeding in grass carp (Ctenopharyngodon
   idellus) and Siberian sturgeon (Acipenser baerii Brandt)
   [[62]21,[63]22], suggesting that CCK may also act as an appetite
   suppressant in fish. In addition, recent research has identified the
   highly specific expression of CCK receptors (CCKRs) in the pituitary
   follicle-stimulating hormone (FSH)-secreting cells of tilapia
   (Oreochromis mossambicus) [[64]18], and CCK has been demonstrated to
   stimulate gonadotropin secretion in the pituitary gland of goldfish
   [[65]19]. The results indicate that CCK could play a role in regulating
   sexual maturation in fish by mediating pituitary gonadotropins. Based
   on the above information, we propose that feeding can modulate gonadal
   development through the mediation of the satiety factor CCK in fish.

   In order to test this hypothesis, this study focused on the grass carp
   as a model for research. Firstly, both in vivo and in vitro experiments
   were conducted to investigate the relationship between CCK and key
   reproductive factors (GnRH, gonadotropins, and sex steroid hormones)
   within the hypothalamic–pituitary–gonadal axis, providing further
   insights into the regulatory mechanisms of sexual maturation by CCK in
   fish. Secondly, we demonstrated the mechanism of feeding-induced CCK
   expression and identified the key regulators of CCK expression in the
   fish hypothalamus. This provided valuable insights into the mechanisms
   by which CCK induces sexual maturation in fish. Building on these
   findings, our ultimate goal was to gain a deeper understanding of how
   feeding modulates gonadal development via the satiety factor CCK.

2. Materials and Methods

2.1. Animals and Drugs

   One-year-old (1+) grass carp weighing between 1.0 and 2.5 kg were
   obtained from the fish farm of Huazhong Agricultural University, China.
   The fish were housed in 250-L tanks at a temperature of 22 ± 1 °C and
   maintained on a 12 h light:12 h dark photoperiod for seven days. The
   animals were provided with a commercial grass carp diet from Tongwei
   (Chengdu, China) at a rate of 3% of their body weight twice daily over
   the course of the study. Subsequently, the females were subjected to
   screening using primers that were specific to the sex of the subject
   (P[F]: AGCAGCAGGTAGCGGAAGAG; P[R]: AATAACGACAGTTGACAGGATTGAATG)
   [[66]23]. The use of grass carp in this study was conducted in
   accordance with the guidelines of the Animal Care and Use Committee of
   Huazhong Agricultural University (Ethical Approval No. HBAC20091138;
   date: 15 November 2009). The grass carp CCK1 (DYLGWMDF-NH2) and CCK2
   (DYVGWMDF-NH2) peptides were produced by GenScript Corporation
   (Piscataway, NJ, USA), and their respective sequences are shown in
   [67]Figure S1A. Dimethyl sulfoxide (DMSO) was employed as the solvent
   for these peptides. Further details on the administered drugs can be
   found in [68]Table S1.

2.2. Cell Transfection with Dual Luciferase Assay

   In order to characterize the functional coupling of carp CCKRs with
   ligand selectivity, the functional expression of CCKRs was carried out
   in HEK-293 cells (Catalog No. WN-10257, Warner Bio, Wuhan, China) in
   accordance with our recent study [[69]24]. Firstly, the open reading
   frame (ORF) of grass carp CCKRs were sub-cloned into the eukaryotic
   expression vector pcDNA3.1/Zeo(-) to generate the expression vector of
   the CCKRs (pcDNA3.1/Zeo(-)-CCKRs). Subsequently, the
   pcDNA3.1/Zeo(-)-CCKRs were transfected into HEK-293 cells to establish
   stable cell lines expressing CCKRs. Following this, the CRE-Luc
   reporter, NFAT-Luc reporter, and green fluorescent protein (GFP)
   reporter (serving as an internal control) were transiently transfected
   into HEK-293 cells with the stable expression of grass carp CCKRa
   (GeneID:127516394), CCKRb (GeneID:127519351), and CCKRl
   (GeneID:127509240), respectively. Subsequently, the HEK-293 cells were
   treated with various CCK peptides. Following a 24 h period of drug
   treatment, the cells were lysed using a passive lysis buffer (E1941,
   Promega, Beijing, China). Lysate samples of the cells were analyzed for
   firefly luciferase activities using a Dual-Glo^TM Luciferase Assay Kit
   (E2920, Promega, Beijing, China) in a Lumat LB9507 luminometer (EG&G,
   Gaithburg, MD, USA).

2.3. Cell Culture

   The hypothalamus and pituitaries of grass carp were isolated and
   processed using the trypsin/DNase II/EDTA digestion protocol [[70]25],
   while the ovaries were treated with the collagenase II/DNase I/EDTA
   method [[71]26]. The dissociated cells from the brain, pituitary, and
   ovary were seeded into 24-well plates at a density of 1 × 10^5 cells/mL
   per well. Initial culturing was performed in plating medium at 28 °C in
   a 5% CO[2] environment. Following 24 h of cultivation, the cells were
   exposed to specific drugs for another 24 h.

2.4. Immunofluorescence

   The hypothalamus and pituitaries of grass carp were dissected and fixed
   in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 24 h. All
   samples were subsequently embedded in paraffin wax and sectioned at a
   thickness of 5 μm. In the immunofluorescence experiment, the
   paraffin-embedded tissue sections were subjected to a series of
   dewaxing and rehydration procedures. Subsequently, the tissue section
   was immersed in citric acid antigen repair buffer and subjected to
   microwave irradiation at a high to medium temperature to facilitate
   antigen retrieval. For the purpose of immunofluorescence staining, the
   slides were incubated for 30 min in 1×PBST (PBS containing 0.1%
   Tween-20) supplemented with 5% normal goat serum. The slides were then
   incubated at 4 °C in a humidified chamber overnight with primary
   antibodies. Further details regarding the antibodies are provided in
   [72]Table S2. Following three washes with 1×PBST, the secondary
   antibodies were applied for one hour at 37 °C in a humidified chamber.
   Both primary and secondary antibodies were appropriately diluted in
   1×PBST supplemented with 5% normal goat serum. After incubation with
   the secondary antibody, the slides were washed three to five times in
   1×PBST and some of the samples were labelled with
   4′,6-diamidino-2-phenylindole (DAPI). The visualization and observation
   of signals were conducted using either a FV1000 confocal microscope
   (Olympus, Tokyo, Japan) or a Leica TCS SP8 microscope (Leica
   Microsystems, Wetzlar, Germany).

2.5. Single-Cell RNA-Seq Library Construction and Sequencing

   The tissues were washed in ice-cold minimum essential medium and
   dissociated using trypsin, ethylenediamine tetraacetic acid (EDTA), and
   DNase II. After cell counting, the cells were washed twice in NeuroGro
   medium (T710KJ, BasalMedia, Shanghai, China) and then resuspended at a
   concentration of 1 × 10^6 cells per ml in PBS. The resuspended cells
   were then added to the well of the SeekOne^® DD Chip S3 (Chip S3). For
   the hypothalamus and pituitary samples, 12 and 10k cells were loaded
   onto the chip, respectively. Subsequently, barcoded hydrogel beads
   (BHBs) and partitioning oil were added separately to their respective
   wells within Chip S3. After the emulsion droplets had been generated,
   reverse transcription was performed at a temperature of 42 °C for 90
   min, followed by inactivation at 85 °C for 5 min. The cDNA was
   extracted from the disrupted droplets and amplified by PCR. The
   amplified cDNA product was subjected to a series of steps including
   purification, fragmentation, end repair, A-tailing, and ligation to
   sequencing adapters. Indexed PCR was subsequently conducted to amplify
   the DNA, representing the 3′ polyA region of expressed genes including
   the cell barcodes and unique molecular index. The indexed sequencing
   libraries were purified using SPRI beads and quantified by quantitative
   PCR (KAPA Biosystems KK4824, Wilmington, MA, USA).

   The libraries were then sequenced using either an Illumina NovaSeq 6000
   platform (San Diego, CA, USA) with PE150 read length or a DNBSEQ-T7
   platform with PE150 read length. Subsequently, the raw sequencing data
   were processed by Fastp, which involved trimming the primer sequence
   and eliminating low-quality bases. Subsequently, the SeekOneTools
   software ([73]https://seeksoul.online) was employed to preprocess the
   sequencing data and align it to the GRCm38 reference genome to obtain a
   gene expression matrix. For further analysis of the scRNA-Seq data, the
   R packages Seurat (version 4.3.0.1)71 and Harmony (version 0.1.1)72
   were employed for filtering, data normalization, dimensionality
   reduction, clustering and further analysis of the single-cell RNA-Seq
   data. The marker genes are presented in [74]Tables S3 and S4.

2.6. Real-Time PCR

   Total RNA was extracted using the MolPure^® Cell/Tissue Total RNA Kit
   (Yeasen Biotech, Shanghai, China) following the provided protocol. The
   purified RNA was then reverse-transcribed into cDNA using the HiScript
   III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Cat#R312,
   Nanjing, Jiangsu, China). Quantitative RT–PCR (RT–qPCR) was conducted
   using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Cat# Q711) on a
   Quantagene q225. The relative gene expression levels were normalized to
   β-actin. All experiments were conducted in triplicate on at least three
   separate occasions. The primer sequences are provided in
   [75]Supplementary Table S5.

2.7. Measurement of FSH Secretion and Glucose

   To investigate the regulatory effects of CCK on the secretion of FSH in
   the grass carp pituitaries, we obtained pituitaries from 15 to 18
   immature grass carp. Primary cultures of grass carp (2-year-old)
   pituitary cells were prepared by the trypsin digestion method [[76]23].
   The pituitary cells were then seeded in 24-well cell culture plates at
   a density of 2.5 × 10^6 cells per well and incubated with CCK1 and
   CCK2. After drug treatment, the cell culture medium was collected for
   hormone secretion analysis. The quantification of grass carp FSH
   protein secretion was conducted utilizing an ELISA assay kit produced
   by our laboratory (Patent No. CN202211185349.8). Fluorescence signals
   were quantified using a FluoStar OPTIMA fluorescence plate reader (BMG
   Labtech GmbH, Ortenberg, Germany). In the feeding experiment, sixteen
   healthy grass carp were selected and temporarily reared in a 250 L
   tank. Prior to the feeding experiment, the fish were fed once daily for
   seven consecutive days. Blood samples were collected at 0 h (before
   feeding) and at 1, 3, and 6 h post-feeding. Blood glucose levels were
   measured using a blood glucose monitor (Accu-Chek Performa, Roche,
   Basel, Switzerland).

2.8. Intraperitoneal Injection of CCK in Grass Carp

   Prior to the commencement of the experiments, the female grass carp,
   with a weight range of 1.0 to 1.5 kg, were anesthetized with 0.05%
   MS222 in accordance with the animal regulations of Huazhong
   Agricultural University. The stock solution of CCK peptide dissolved in
   DMSO was dissolved in fish saline and 200 μg of mature peptide was
   injected per kg of fish body weight. Subsequently, the CCK peptides
   were administered by intraperitoneal injection to eight grass carps in
   each of the two experimental groups. Concurrently, eight control fish
   received an equivalent volume of fish saline containing the same
   concentration of DMSO. Grass carp were anesthetized for gonad removal
   24 h after injection and then placed in cryopreservation tubes and
   stored in a liquid nitrogen tank. Following sample collection, the
   total RNA was extracted for reverse transcription, and RT-qPCR was used
   to detect the relevant gene expression changes.

2.9. Data Transformation and Statistical Analysis

   Transcript levels were measured via qRT-PCR using ABI 7500 SDS v1.5.1
   software, with calibration achieved through standard curves (dynamic
   range: 10^5, correlation coefficient: >0.95). β-Actin served as the
   internal control, and the target gene mRNA levels were normalized and
   expressed as a percentage of the mean value (“% Ctrl”). Data, pooled
   from four to eight replicates (mean ± SEM), were analyzed using one-way
   ANOVA to identify significant differences among treatments. Dunnett’s
   post hoc test was conducted in SPSS Statistics 26.0 (Chicago, IL, USA).
   Significance was denoted as p < 0.05 (“*”) or p < 0.01 (“**”), while
   different letters represented significant differences (p < 0.05)
   between groups.

3. Results

3.1. Analysis of CCK and Its Activation of the Receptor

   In grass carp, two subtypes of CCK have been successfully cloned and
   identified as CCK1 and CCK2, respectively. Sequence analysis revealed
   that each subtype encodes a mature peptide consisting of exactly eight
   amino acids ([77]Figure S1A). Sequence alignment across different
   species revealed a difference of only one amino acid in the mature CCK
   peptide sequence ([78]Figure 1A), indicating the conservation of CCK
   and its potential involvement in important functions. Phylogenetic
   analysis based on nucleotide sequence further confirmed that the newly
   cloned CCK cDNAs could be clustered in the evolutionary branch of fish
   CCKs. It was observed that CCK1 and CCK2 were split into two separate
   evolutionary branches, but both were similar to CCK1 in zebrafish
   ([79]Figure S1B). In addition, three CCK receptor subtypes, namely
   CCKRa, CCKRb, and CCKRL, were also identified in grass carp.
   Co-transfection of HEK-293 cells expressing CCKRa, CCKRb, and CCKRl
   with CCK1 and CCK2 all resulted in the expression of NFAT-Luc and
   CRE-Luc luciferase activities in a dose-dependent manner ([80]Figure
   1C). CCK1 demonstrated a higher activation efficiency for CCKRb and
   CCKRl compared to CCK2; however, CCK1 exhibited a similar activation
   rate to CCK2 in the CCKRa activation assay. After confirming the
   sequences of grass carp cck and its receptor cckr, we detected their
   transcript levels in the grass carp hypothalamus–pituitary–gonad axis.
   The study found that cck1 was expressed in the hypothalamus, pituitary,
   and gonads of grass carp, while cckra was not detected in the
   pituitary. Additionally, both cckrb and cckrl were highly expressed in
   the grass carp HPG axis ([81]Figure 1B and [82]Figure S1C). This
   evidence suggests that the CCK/CCKR system may play a significant role
   in the hypothalamus–pituitary–gonad axis of grass carp.

Figure 1.

   [83]Figure 1
   [84]Open in a new tab

   Analysis of the aptitude of CCK and its receptor. (A) Amino acid
   sequence alignment of mature peptides among grass carp CCK1 and CCK2.
   (B) Tissue expression profile of carp CCKs and CCKRs. (C) Ligand
   selectivity of grass carp CCK-Rs for CCKs. To verify the affinity of
   grass carp CCKRa, CCKRb, and CCKRl to the two ligands (CCK1 and CCK2),
   the NFAT-Luc and CRE-Luc reporter genes were co-transfected with GFP
   into HEK293T, which can stably express grass carp CCKRa, CCKRb, and
   CCKRl. Then, the cells were treated with CCK1 or CCK2 for 24 h.
   Statistical significance is represented by different letters at p <
   0.05.

3.2. Food Intake Induces CCK Expression in the Hypothalamus

   There was a significant increase in the expression levels of cck1 and
   cck2 mRNA in the hypothalamus of grass carp 6 h after feeding
   ([85]Figure 2A). Conversely, after one week of fasting, there was a
   significant decrease in cck1 and cck2 mRNA expression in the
   hypothalamus. It is interesting to note that starvation markedly
   suppressed gnrh3 expression in the hypothalamus, fshβ in the pituitary,
   and cyp17a1 and cyp19a1 in the ovaries ([86]Figure 2B). To explain the
   mechanism behind feeding-induced CCK expression, we found that the
   blood glucose levels were significantly elevated 1 h after feeding by
   measuring the blood glucose levels in grass carp at different times
   after feeding. Based on this finding, we intraperitoneally injected
   glucose into the grass carp and found that the expression levels of
   hypothalamic cck1 and cck2 were elevated after 1 h ([87]Figure 2C). In
   vitro, we found that 2-DG significantly inhibited CCK expression in the
   hypothalamic cells ([88]Figure 2D). Moreover, the analysis of the
   single-cell transcriptome revealed that glucose-sensing genes were
   highly expressed in the CCK-expressing neurons ([89]Figure 3E). These
   results indicate that CCK acts as a satiety factor in grass carp, and
   feeding may trigger an upregulation of hypothalamic CCK expression by
   elevating the blood glucose levels.

Figure 2.

   [90]Figure 2
   [91]Open in a new tab

   Food intake induces CCK expression in the hypothalamus. (A)
   Postprandial changes in grass carp hypothalamus cck1 and cck2 mRNA
   expression were observed within 12 h. (B) Changes in
   reproduction-related hormones were observed in grass carp after a 7 day
   period of starvation stress. (C) Changes in blood glucose concentration
   were observed in postprandial grass carp as well as changes in CCK
   transcript levels in the hypothalamus after glucose injection. (D)
   Changes in cck in the hypothalamic cells of grass carp after 24 h of
   2-DG treatment (40×). Different letters mean significant differences. *
   p < 0.05. ** p < 0.01. *** p < 0.001.

Figure 3.

   [92]Figure 3
   [93]Open in a new tab

   CCK induces the expression of GnRH3 in the hypothalamus. (A)
   Immunohistochemistry showing co-localization of CCK (red) and GnRH3
   (green) in the hypothalamic tissues and cells. Black box shows
   immunohistochemistry area. (B) CCK1 and CCK2 induced GnRH3 (red)
   expression in the grass carp hypothalamic cells. * p < 0.05. ** p <
   0.01. (C) Workflow of single-cell RNA-Seq of grass carp hypothalamus.
   (D) UMAP visualization shows the unsupervised clustering of the
   aggregate of scRNA-Seq experiments, revealing 17 major clusters of
   hypothalamic cells present in grass carp. (E) The dot plot displaying
   the percentage and average expression of genes related to glucose
   metabolism. (F) The UMAP visualization of cckra, cckrb, cckrl, and
   gnrh3. Purple arrow indicates area of expression.

3.3. CCK Stimulates the Expression of GnRH3 in the Hypothalamus

   The analysis of tissue expression showed that CCK and its receptor are
   highly expressed in the hypothalamus of grass carp ([94]Figure S1C).
   Subsequently, immunohistochemistry was used to detect the CCK
   distribution in the hypothalamus of grass carp using a CCK antibody.
   The results showed that CCK was mainly distributed in the arcuate
   nucleus region of the hypothalamus, which is also the main distribution
   region of GnRH3. Dual fluorescence immunolocalization analysis
   demonstrated the co-expression of CCK and GnRH3 in the same brain cells
   ([95]Figure 3A). To characterize cellular heterogeneity in the
   hypothalamus, we performed scRNA-Seq on cells dissociated from the
   hypothalamus of grass carp ([96]Figure 3C). Seurat was used to identify
   cell clusters and Uniform Manifold Approximation and Projection (UMAP)
   was used for visualization ([97]Figure 3D). In addition, the
   single-cell transcriptome analysis showed that cckrb and cckrl were
   detected in GnRH3-expressing neurons ([98]Figure 3F). The results
   suggest that CCK may regulate GnRH3 expression in the hypothalamus
   through autocrine or paracrine mechanisms. To test the hypothesis, the
   in vitro experiment found that CCK could significantly induce GnRH3
   mRNA expression and synthesis in grass carp hypothalamic cells
   ([99]Figure 3B). Meanwhile, the analysis of single-cell transcriptome
   results revealed that glucose metabolism-related genes were also found
   to be highly expressed in the CCK-overexpressing neurons ([100]Figure
   3E).

3.4. CCK Could Induce FSH Synthesis and Secretion in the Pituitary

   In contrast to mammals, immunofluorescence showed that grass carp
   luteinizing hormone (LH) and FSH were secreted from two different cells
   ([101]Figure 4A). Single-cell transcriptome analysis revealed that
   CCKRb was only highly expressed in grass carp pituitary FSH cells, but
   very low in the LH cells ([102]Figure 4C,D). These findings suggest
   that CCK can directly affect pituitary FSH cells. To examine the
   pituitary actions of CCK, carp CCK1 and CCK2 were synthesized and
   tested in the primary culture of carp pituitary cells. In our initial
   study, 24 h 100 nM static incubation with CCK1 or CCK2 was able to
   elevate FSH synthesis ([103]Figure 4E). Time-course experiments also
   revealed that CCK1 and CCK2 could significantly stimulate fshβ mRNA
   expression from 1 µM to 3 in 24 h ([104]Figure 4F). In dose-dependence
   studies, 24 h incubation with increasing levels of CCK1 or CCK2
   (0.1–1000 nM) also triggered FSH release and fshβ mRNA expression in a
   dose-related fashion ([105]Figure 4F). To further elucidate the signal
   transduction for FSH regulation by CCK1 and CCK2, the possible
   involvement of the AC/cAMP/PKA, PLC/PKC, and Ca^2+/CaM pathways was
   examined. As shown in [106]Figure 4H, co-treatment with AC inhibitor
   MDL12330A, PKA inhibitor H89, PLC inhibitor U73122, VSCC blocker
   nifedipine, PKC inhibitor GF109203X, IP3 receptor blocker 2-APB, CaM-II
   inhibitor KN62, or CaM antagonist CMZ could all block the stimulatory
   effects of CCK1 (1 μM) on fshβ mRNA expression. The results suggest
   that CCK-induced fshβ mRNA expression was caused by AC/cAMP/PKA,
   PLC/PKC, and Ca^2+/CaM activation.

Figure 4.

   [107]Figure 4
   [108]Open in a new tab

   CCK induces FSH synthesis and secretion in the pituitary. (A)
   Immunofluorescence localization analysis of LH (red) and FSH (green) in
   the pituitary gland. (B) The UMAP visualization displays the
   unsupervised clustering of the aggregate of scRNA-Seq experiments,
   revealing 14 major clusters of pituitary cells. (C) Dot plot
   demonstrating the percentage and mean expression of the most prevalent
   genes in the pituitary gland. (D) UMAP visualization of cckra, cckrb,
   cckrl, and gnrh3. Purple arrow indicates area of expression. (E)
   Immunohistochemical analysis of CCK induced-FSH levels in pituitary
   cells (40×). (F) Time-dependent experiments of CCK1 and CCK2 on fshβ
   mRNA expression in the grass carp pituitary cells. (G) Dose-dependent
   experiments of CCK1 and CCK2 on the regulation of FSH protein secretion
   and fshβ mRNA expression in the grass carp pituitary cells. (H) Signal
   transduction of CCKs-regulated fshβ mRNA expression in the grass carp
   pituitary cells. Different letters mean significant differences.

3.5. CCK Could Induce the Sexual Steroid Hormone Synthesis in the Gonad

   Tissue expression analysis revealed the high expression of cck and its
   receptor cckrb and cckrl in the grass carp ovary and testes
   ([109]Figure 1B). Immunofluorescence localization analysis demonstrated
   that the ovary secreted the CCK maturation peptide ([110]Figure 5A).
   Intraperitoneal injection of CCK1 and CCK2 could significantly induce
   the expression of the sexual steroid hormone synthetase genes including
   cyp11a, cyp17a1, and cyp19a1a ([111]Figure 5B). Using primary cultured
   ovary cells as a model, it was found that CCK1 was able to
   significantly induce the mRNA expression of fshr, lhr, and cyp19a1a
   ([112]Figure 5C). The above results indicate that CCK can directly act
   on the ovary to promote the synthesis of ovarian sexual steroid
   hormones.

Figure 5.

   [113]Figure 5
   [114]Open in a new tab

   Functional studies of CCK in the grass carp gonads. (A)
   Immunofluorescence localization of CCK in the ovary. (B) Effect of CCK
   on cyp11a, cyp17a1, and cyp19a1a mRNA expression in the female and male
   gonads. (C) Effect of CCK on lhr, fshr, and cyp19a1a mRNA expression in
   oocytes. Different letters mean significant differences.

4. Discussion

   Previous studies have shown that CCK is a neuropeptide that induces
   satiety and is secreted in the hypothalamus in mammals. Food intake
   significantly increases CCK expression in the hypothalamus
   [[115]7,[116]8,[117]9,[118]10,[119]27]. Recent research in mammals has
   revealed a fascinating connection between neurons that express CCK and
   glucose sensing [[120]13,[121]14]. In addition, the study observed the
   expression genes related to glucose metabolism in hypothalamic
   CCK-expressing neurons. These neurons are capable of detecting changes
   in blood glucose concentrations, indicating a potential connection
   between blood glucose regulation and CCK. In this study, which was
   conducted on grass carp, we revealed similarities between the
   regulation of blood glucose levels and hypothalamic CCK expression in
   response to food intake. These compelling results suggest that glucose
   may be a key factor in inducing CCK expression in the hypothalamus of
   grass carp, and that food intake stimulates hypothalamic CCK expression
   by elevating the blood glucose levels. Furthermore, it has been
   demonstrated that a deficiency in CCK is associated with gonadal
   abortion in zebrafish and medaka [[122]28,[123]29]. Given the role of
   CCK in regulating satiety in fish, this hypothalamic circuit directly
   links the metabolic state of fish to their reproductive capacity. In
   summary, this study demonstrates the complex relationship between food
   intake, blood glucose regulation, and hypothalamic CCK expression.
   These findings provide valuable insights into the mechanisms that
   control appetite and metabolic responses.

   The objective of this study was to investigate the mechanistic role of
   CCK in regulating grass carp sexual maturation through the HPG axis.
   Similar to mammals, sexual maturation initiation in fish is also
   regulated by the HPG axis, with GnRH being a major inducer of
   gonadotropins (GtHs) in the pituitary [[124]11,[125]30]. Recent
   research has shown that GnRH3 plays a crucial role in the proliferation
   and sexual differentiation of primordial germ cells during early
   embryonic development in zebrafish [[126]31]. In mammals, CCK has been
   found to play a role in regulating GnRH expression in the hypothalamus
   [[127]15,[128]16]. In chameleon, some neurons show evidence of the
   co-expression of GnRH and CCK [[129]32]. Additionally, recent studies
   in zebrafish and medaka have revealed that CCK functions as a potent
   FSH-RH, challenging the traditional “solo GnRH model” recognized in
   mammals [[130]28,[131]29]. In this study, both CCK and CCKR were
   expressed in GnRH3 neurons, and exogenous CCK could significantly
   induce the expression of GnRH3 in hypothalamic cells. These findings
   indicate that CCK may have a role in reproduction by stimulating the
   expression of hypothalamic GnRH.

   The pituitary glycoprotein hormone gonadotropin (GTH) is a crucial
   regulator of vertebrate reproduction, consisting of two distinct
   subtypes [[132]33]. Similar to mammals, fish pituitaries secrete two
   primary gonadotropins: LH and FSH. Recent research in zebrafish has
   revealed the crucial role of FSH and its receptor (FSHR) in female
   fertility and sexual maturation. The knockout of FSH or FSHR in
   zebrafish leads to female infertility, hindering sexual maturation
   [[133]34,[134]35,[135]36]. These findings highlight the crucial
   function of pituitary-secreted FSH in regulating fish gonadal
   development and the initiation of sexual maturation. Identifying the
   key factors that govern FSH synthesis and secretion is crucial for
   understanding the mechanisms underlying the initiation of fish sexual
   maturation. In this study, we identified three CCK-Rs in grass carp:
   CCKRa, CCKRb, and CCKRl. Single-cell analysis revealed that cckrb is
   predominantly expressed in pituitary FSH cells. In zebrafish, the
   knockout of cckbrb significantly decreases the pituitary FSH levels
   [[136]28]. Furthermore, it is important to note that the stimulatory
   effect of CCK on FSH production and secretion was significantly more
   potent than that of GnRH on FSH [[137]30]. These results suggest that
   CCK is one of the main inducers of FSH in fish and exerts a direct
   influence on pituitary FSH cells, prompting FSH synthesis and
   secretion, which in turn promotes the development of fish gonads and
   the initiation of sexual maturation.

   In addition to their well-established roles in the hypothalamus and
   pituitary, our recent studies have also shown that CCK and its
   receptors are highly expressed in the testes and ovaries of grass carp,
   suggesting their potential direct regulatory role in gonadal
   development. Similarly, the analyses of tissue expression in chickens
   have confirmed the expression of CCK and CCKR within gonadal tissues
   [[138]37]. Furthermore, investigations have shown that CCK
   significantly induces the expression of gonadotropin receptors (fshr
   and lhr) and sex steroid hormone synthetase (cyp19a1a) in grass carp
   ovary cells. While these findings suggest a potential regulatory role
   for CCK in gonadal function, additional studies are needed to further
   elucidate the underlying mechanisms. These findings suggest that CCK
   can directly influence gonadal tissues, potentially exerting paracrine
   or autocrine effects. Similar patterns of autocrine or paracrine
   regulation have been demonstrated for other neuropeptides. For
   instance, GnRH controls zebrafish spermatogenesis as part of a complex
   multifactorial regulatory system [[139]38], while
   gonadotropin-inhibitory hormone (GnIH) and GnRH polypeptides produced
   in the ovary collaboratively act in a paracrine/autocrine manner,
   working synergistically with gonadotropins to regulate the final
   maturation of zebrafish oocytes [[140]39]. In addition, neurokinin B
   (NKB) induces the expression of aromatase and P450scc via the
   PKA/CAMKII/CREB and MEK/ERK pathways, respectively, by acting through
   NK3R. This directly influences gonadal development and the synthesis of
   sex steroid hormones in zebrafish [[141]40]. These findings highlight
   the complex interaction between neuropeptides and their receptors in
   regulating reproductive processes and gonadal development. The article
   discusses the potential role of paracrine and autocrine mechanisms in
   regulating sex steroid hormone synthesis and reproductive function.

5. Conclusions

   Similar to mammals, the nutritional intake of fish is a crucial factor
   in determining gonadal development, highlighting the close link between
   feeding and reproductive processes. Tissue expression analysis has
   shown a significant expression of CCK and CCKR within the HPG axis of
   grass carp. This finding strongly suggests that CCK may play a key role
   in regulating fish reproduction through the HPG axis. Further
   investigations revealed the intricate mechanisms underlying CCK’s
   influence at multiple levels of the HPG axis. At the hypothalamic
   level, CCK acts as a glucose-sensitive neuron and induces the
   expression of GnRH3, a critical regulator of reproductive processes, in
   the hypothalamus. Furthermore, at the pituitary level, CCK interacts
   directly with the pituitary gland, resulting in a significant increase
   in the synthesis and secretion of FSH in grass carp. Additionally, CCK
   has a direct impact on the ovary, where it stimulates the synthesis and
   secretion of gonadal sex steroid hormones. This is achieved by inducing
   the expression of gonadotropin receptors (lhr and fshr) and sex steroid
   synthase genes. Based on this information, it is clear that CCK plays a
   crucial role in regulating sexual maturation in fish. Additionally, our
   findings indicate that ingestion can affect gonadal development through
   the mediation of the satiety factor CCK, highlighting the complex
   relationship between nutritional intake, hormonal regulation, and
   reproductive processes in fish.

Acknowledgments