Abstract

   Carbapenem‐resistant Acinetobacter baumannii (CRAB) has become a major
   threat in the treatment of bacterial infection, and immunotherapy in a
   non‐antibiotic‐dependent manner is an effective way to overcome CRAB
   infection. However, the role of the innate immune response in CRAB
   infection is poorly understood. Here, it is reported that CRAB
   infection induced a cytosolic DNA‐sensing signaling pathway and
   significant IFN‐β production in mice post‐CRAB infection. The knockout
   of STING reduced bacterial burden, the production of inflammatory
   cytokines, and lung injury in mice post CRAB infection. The cytosolic
   DNA sensor cyclic GMP‐AMP synthase (cGAS) and the adaptor protein
   stimulator of interferon genes (STING) are required for CRAB‐induced
   IFN‐β expression in macrophages. Intriguingly, CRAB utilized outer
   membrane vesicles (OMVs) to transport outer membrane protein 38 (OMP38)
   into mitochondria, triggering mitochondrial DNA (mtDNA) release into
   the cytosol through the mitochondrial permeability transition pore
   (mPTP) and activating the cGAS‐STING signaling. Finally,
   epigallocatechin gallate (EGCG) is demonstrated to block the activation
   of the cGAS‐STING pathway and ameliorate CRAB‐induced excessive
   inflammatory response. These results demonstrated that the early innate
   immune response to CRAB infection is activated in a
   cGAS‐STING‐dependent manner, which could be a potential therapeutic
   target for CRAB infection.

   Keywords: Acinetobacter baumannii, carbapenem‐resistant, cGAS‐STING,
   mitochondrial DNA, outer membrane protein 38
     __________________________________________________________________

   In article, Lin Wei, Zeyi Liu, Jian‐an Huang and co‐workers reveal a
   new way to combat carbapenem‐resistant Acinetobacter baumannii (CRAB).
   CRAB uses OMVs to transport virulence factor OMP38, triggering
   mitochondrial DNA release and activating the cGAS‐STING pathway for
   inflammation. Epigallocatechin gallate (EGCG) blocks this pathway,
   suggesting a new strategy against antibiotic resistance.

   graphic file with name ADVS-12-2408292-g002.jpg

1. Introduction

   Carbapenem‐resistant Acinetobacter baumannii (CRAB) has emerged as a
   prominent cause of nosocomial infections, with a rising impact on
   critically ill individuals, yet no potential drugs have been identified
   in clinical studies to consistently reduce mortality risk or improve
   patient outcomes.^[ [38]^1 ^] Indeed, CRAB has been listed by the World
   Health Organization (WHO) as one of the three top‐priority pathogens
   (Priority 1: Critical) for which the discovery and development of novel
   antibiotics are urgently needed.^[ [39]^2 ^] Globally, the proportion
   of CRAB varies from 30% to 80%, with the highest proportion in Asia.^[
   [40]^3 , [41]^4 ^] With the high mortality rates associated with CRAB
   infection, the lack of antimicrobial agents in the development
   pipeline, and the common association between carbapenem resistance and
   genes encoding oxacillinase (OXA) carbapenemases, such as OXA‐23 and
   OXA‐24/40, the development of novel antimicrobial agents and
   alternative therapeutic approaches are critically needed.^[ [42]^5 ^]

   The host's innate immune system serves as the first line of host
   defence and recognizes A. baumannii within hours of infection, which
   determines the outcome of the infection.^[ [43]^6 ^] The recruitment
   and activation of innate immune cells are key features of host defence
   against A. baumannii infection, and alveolar macrophages have been
   found to play a significant role in A. baumannii clearance.^[ [44]^7 ^]
   Although few studies have focused on the interaction between CRAB and
   the innate immune system, the innate immune response may provide
   potential therapeutic targets for developing new strategies to combat
   CRAB infection.

   The innate immune system uses pattern recognition receptors (PRRs) to
   detect pathogen‐associated molecular patterns (PAMPs) (e.g.,
   lipopolysaccharide (LPS), and capsules) and damage‐associated molecular
   patterns (DAMPs) (host cell components released during
   infection‐induced cell damage or death).^[ [45]^8 ^] The combined
   findings from polymorphism analysis in patients, in vitro human and
   murine cell culture, and animal models have validated TLR4 as the
   primary PRR for the initial interaction between A. baumannii and host
   cells.^[ [46]^9 ^] However, research suggests that TLR2 plays distinct
   roles in the host‐A. baumannii interaction. TLR function is influenced
   by various parameters, including infection route, stage, and severity.
   Intracellular immune sensing and signaling molecules such as TLR9 and
   NOD2 play crucial roles in the immune response to A. baumannii.^[
   [47]^10 , [48]^11 ^] However, the mechanism by which these PRRs respond
   to CRAB needs further study.

   Cytosolic dsDNA sensing, mediated by the cyclic‐GMP‐AMP (cGAMP)
   synthase (cGAS)‐stimulator of interferon genes (STING) pathway, has
   recently been considered an essential component for linking dsDNA
   (originating from DNA viruses, reverse‐transcription of RNA viruses,
   bacteria, parasites, mitochondria, and extracellular vesicles)
   detection to the initiation of the host's innate immune defence
   response.^[ [49]^12 ^] Increasing research has shown that the
   cGAS‐STING pathway is critical for inducing a type I IFN response upon
   infection by a variety of intracellular bacterial pathogens. cGAS
   detects the bacterial dsDNA of Mycobacterium tuberculosis,^[ [50]^13 ^]
   Chlamydia trachomatis,^[ [51]^14 ^] Francisella,^[ [52]^15 ^]
   Pseudomonas aeruginosa,^[ [53]^16 ^] and Listeria monocytogenes.^[
   [54]^17 ^] In addition, mitochondrial DNA release triggers the
   cGAS‐STING pathway to induce a type I interferon response during
   Salmonella typhimurium ^[ [55]^18 ^] and Pseudomonas aeruginosa ^[
   [56]^19 ^] infections. Whether the cGAS‐STING pathway contributes to
   the CRAB‐induced host innate immune response is still unknown.

   In this study, we explored the role of the cGAS‐STING pathway during
   CRAB infection by performing transcriptomic analysis and using STING
   knockout mice. Our results revealed that CRAB activated the cytosolic
   DNA‐sensing pathway and type I IFN response, which was suppressed by
   cGAS and STING deficiency. Interestingly, OMP38 of CRAB was localized
   to the mitochondria via OMVs and the cGAS‐STING pathway was activated
   by CRAB‐induced mitochondrial DNA release through the mitochondrial
   permeability transition pore (mPTP). Furthermore, epigallocatechin
   gallate (EGCG) specifically blocked cGAS activation to support the host
   defence against CRAB infection. In conclusion, we demonstrated that
   CRAB triggers mtDNA release to induce cGAS‐STING pathway activation,
   resulting in inflammatory injury to the lung. This is the first
   investigation of the role of the cGAS‐STING pathway in CRAB infection,
   providing a new perspective on the innate immune response to CRAB and a
   potential therapeutic strategy for treating CRAB infection.

2. Results

2.1. CRAB Infection Induces Type I IFN Response

   Macrophages initiate a strong innate immune response to control
   bacterial infection by recognizing pathogen‐associated molecular
   patterns (PAMPs) through pattern recognition receptors (PRRSs) in the
   early stage of infection. To explore the role of the innate immune
   response during CRAB infection, mice were infected with 1 × 10^7 CFU of
   CRAB through intranasal inoculation. At 6 h post‐infection, lung
   tissues were collected for high‐throughput RNA sequencing. Compared to
   the uninfected mice, 844 genes were found to be differentially
   expressed (≥2‐fold) with a false discovery rate (FDR) cut‐off of 0.05.
   Among them, 718 genes were upregulated, and 126 genes were
   downregulated (Figure [57] 1A,B). To validate the RNA‐seq results, the
   upregulated genes, including TNF‐α, IL‐6, IL‐1β, and CXCL10, were
   further confirmed by qRT‐PCR (Figure [58]S1A, Supporting Information).
   In particular, series of pro‐inflammatory cytokines and chemokines were
   upregulated in the lung of CRAB‐infected mice (Figure [59]1C).

Figure 1.

   Figure 1
   [60]Open in a new tab

   CRAB infection induces a type I IFN response in mice. A) Schematic
   diagram of the experiment in which mice were left uninfected or
   infected with 1 × 10^7 CFU of CRAB for 6 h (n = 3). B) Volcano plot
   showing gene expression analysis of lung tissues; each group had three
   biological replicates. Differentially expressed genes were those with a
   false discovery rate (FDR) cut‐off of 0.05 and a fold change of ≥±2. C)
   Heatmap of the RNA‐seq data. D) Ingenuity pathway analysis of
   upregulated gene expression changes. E) ELISA analysis of IFN‐β
   production in lung tissues of uninfected mice or mice infected with 1 ×
   10^7 CFU CRAB for 6 h (n = 5). F) ELISA analysis of IFN‐β production in
   mouse peritoneal macrophages uninfected or infected with CRAB for 1, 2,
   4, 6, or 8 h at an MOI of 10 (n = 3). G) ELISA analysis of cGAMP in
   mouse peritoneal macrophages uninfected or infected with CRAB for 2 h
   at an MOI of 0.01, 0.1, 1, 10 (n = 3). H) qRT‐PCR analysis of IFN‐β
   expression in TLR4 knockout iBMDMs generated by CRISPR‐Cas9 and treated
   with CRAB for 4 h at an MOI of 10 (n = 3). The data are expressed as
   the mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

   KEGG pathway enrichment analysis of the differentially expressed genes
   (DEGs) revealed that the upregulated genes were involved in
   cytokine‒cytokine receptor interaction, the NF‐κB signaling pathway,
   the MAPK signaling pathway, and the cytosolic DNA‐sensing pathway
   (Figure [61]1D). The involvement of cytosolic DNA‐sensing pathway
   indicated the activation of the IFN pathway post‐CRAB infection. As
   expected, IFN‐β was significantly increased in the lung of
   CRAB‐infected mice and mainly observed in lung macrophages
   (Figure [62]1E; Figure [63]S1B, Supporting Information). Furthermore,
   IFN‐β and cGAMP was obviously up‐regulated in mouse macrophages upon
   CRAB stimulation (Figure [64]1F,G; Figure [65]S1C, Supporting
   Information). It has been reported that A. baumannii induced IFN
   response via a surface innate immune receptor (TLR4).^[ [66]^20 ^]
   However, it is worthy to note that a slight but statistically
   significant upregulated the expression of IFN‐β was detected in
   CRAB‐infected TLR4 knockout macrophages (Figure [67]1H; Figure [68]S1D,
   Supporting Information). Overall, we demonstrated that CRAB activated
   the type I IFN response in a TLR4‐independent manner.

2.2. STING Knockout Inhibits CRAB Infection in Mice

   To confirm the role of the cGAS‐STING pathway during CRAB infection,
   STING knockout (STING^−/−) mice were infected with CRAB, and the
   bacterial load of WT and STING^−/‐ mice were examined at 24 h
   post‐infection. Compared to WT mice, the bacterial burden, wet/dry
   ratio of lung, inflammatory injury in lung, and production of
   pro‐inflammatory cytokines in the lung were significantly decreased in
   STING^−/− mice (Figure [69] 2A–D). Next, WT and STING^−/− mice were
   intragastrically infected with 1×10^8 CFU of CRAB, and survival rate
   was monitored. As shown in Figure [70]2E, STING knockout significantly
   increased the survival rate of mice post‐CRAB infection as compared to
   WT mice. Upon CRAB challenge, the survival rate of WT mice was just
   20%, while the survival rate was significantly increased to 70% after
   STING^−/− knockout. Taken together, these results indicated that the
   cGAS‐STING pathway was involved in CRAB infection.

Figure 2.

   Figure 2
   [71]Open in a new tab

   Activation of the cGAS‐STING pathway is associated with CRAB‐induced
   lung injury in mice. A) WT and STING^−/− mice were uninfected or
   infected with 1 × 10^7 CFU of CRAB for 24 h (n = 5). Lung tissues
   homogenates were plated to determine the bacterial CFU per gram. B) Wet
   weight and dry weight of lung tissues were determined (n = 5). C)
   Pathological histological analysis of lung sections stained with H&E.
   Scale bar: 250 µm. D) ELISA analysis of TNF‐α, IL‐1β, and IL‐6 cytokine
   levels in lung tissues (n = 5). E) WT and STING^−/− mice were left
   uninfected or infected with 1 × 10^8 CFU of CRAB (n = 10). The survival
   rate of the mice was monitored for up to 5 days. The data are expressed
   as the mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

2.3. The CRAB‐Induced Inflammatory Response is Associated with Activation of
the cGAS‐STING Pathway

   Innate immune cells recognize A. baumannii and initiate the production
   of pro‐inflammatory cytokines and chemokines, which largely determine
   the fate of the infection.^[ [72]^6 ^] Macrophages, the main immune
   cell population of the alveolar airspace, are endowed with cytosolic
   and membrane receptors, and are critical for anti‐infective immune
   response upon many respiratory bacterial infection.^[ [73]^21 ^]
   Therefore, we further evaluated the role of the cGAS‐STING pathway in
   CRAB‐infected macrophages. CRAB induced the phosphorylation of STING,
   TBK1, IRF3, p38, ERK, and NF‐κB p65 in macrophages in a dose‐ and
   time‐dependent manner. CRAB infection did not affect the expression of
   cGAS or STING (Figure [74] 3A,B; Figure [75]S2, Supporting
   Information), but CRAB infection induced the translocation of STING to
   the Golgi apparatus (Figure [76]3C).

Figure 3.

   Figure 3
   [77]Open in a new tab

   The CRAB‐induced type I IFN response is associated with activation of
   the cGAS‐STING pathway. A) Immunoblot analysis of protein expression in
   peritoneal macrophages treated with CRAB for 2 h at MOI of 0.01, 0.1,
   1, and 10 (n = 3). B) Immunoblot analysis of protein expression in
   peritoneal macrophages treated with CRAB for 0.5, 1, 2, or 4 h at an
   MOI of 10 (n = 3). C) Immunofluorescence staining analysis of the Golgi
   apparatus translocation of STING in peritoneal macrophages treated with
   CRAB for 1 h at an MOI of 10. Scale bar: 25 µm. The data are expressed
   as the mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

   CRISPR‐Cas9 gene editing was used to create a complete deletion of cGAS
   in iBMDMs. As shown in Figure [78] 4A, cGAS deficiency significantly
   reduced the phosphorylation of STING, TBK1, IRF3, NF‐κB p65, p38, and
   ERK induced by CRAB infection. We next confirm this finding in
   macrophages derived from STING^−/− mice. Consistent with the results
   observed in the cGAS^−/− iBMDMs, STING deficiency suppressed the
   phosphorylation of STING, TBK1, IRF3, NF‐κB p65, p38, and ERK induced
   by CRAB infection, and inhibited the up‐regulation of type I IFN
   (IFN‐β, ISG15, and CXCL10) and pro‐inflammatory cytokines (TNF‐α and
   IL‐1β) induced by CRAB infection (Figure [79]4B,C). BX975, a specific
   inhibitor of TBK1, was used to verify these findings.^[ [80]^22 ^]
   After BX975 treatment, the up‐regulation of IFN‐β, ISG15, CXCL10,
   TNF‐α, and IL‐1β induced by CRAB infection was significantly decreased
   in macrophages (Figure [81]4D; Figure [82]S3, Supporting Information).
   Collectively, these results demonstrated that CRAB infection elicited a
   robust type I IFN response through the cGAS‐STING signaling pathway.

Figure 4.

   Figure 4
   [83]Open in a new tab

   cGAS‐STING‐TBK1 contributes to CRAB‐induced type I IFN response. A)
   Immunoblot analysis of protein expression in cGAS knockout iBMDMs
   generated by CRISPR‐Cas9 and treated with CRAB for 2 h at an MOI of 10
   (n = 3). B) Immunoblot analysis of protein expression in WT and
   STING^−/− mouse‐derived peritoneal macrophages treated with CRAB for
   2 h at an MOI of 10 (n = 3). C) qRT‐PCR analysis of gene expression in
   WT and STING^−/− mouse‐derived peritoneal macrophages treated with CRAB
   for 4 h at an MOI of 10 (n = 3). D) qRT‐PCR analysis of gene expression
   in peritoneal macrophages untreated or pretreated with BX795 (2 µm) for
   2 h and infected with CRAB for 4 h at an MOI of 10 (n = 3). The data
   are expressed as the mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001,
   ****p < 0.0001.

2.4. CRAB Triggers mtDNA Release to Induce cGAS‐STING Pathway Activation

   To elucidate the mechanism of cGAS‐STING pathway activation, we further
   tested the level of mtDNA in the cytoplasm, which is the critical
   initial factor for triggering cGAS‐STING.^[ [84]^23 ^] CRAB infection
   increased the level of mitochondrial genes in the cytosolic fractions,
   indicating that CRAB infection resulted in the release of mtDNA to
   cytoplasm (Figure [85] 5A). To clarify the relationship between
   cGAS‐STING pathway activation and mtDNA leakage into the cell cytosol
   during CRAB infection, we depleted the mtDNA using ethidium bromide
   (EB) in mouse macrophages.^[ [86]^24 ^] mtDNA depletion suppressed the
   phosphorylation of STING, TBK1, IRF3, NF‐κB p65, p38, and ERK induced
   by CRAB infection, and inhibited the up‐regulation of type I IFN
   (IFN‐β, ISG15, and CXCL10) and pro‐inflammatory cytokines (TNF‐α and
   IL‐1β) induced by CRAB infection (Figure [87]5B,C). These results
   indicated that CRAB infection induced the release of mtDNA into the
   cytosol to activate the cGAS‐STING pathway, and mtDNA acted as a danger
   signal to induce a type I IFN response.

Figure 5.

   Figure 5
   [88]Open in a new tab

   CRAB triggers mtDNA release to induce cGAS‐STING pathway activation. A)
   qRT‐PCR analysis of mtDNA in the cytosol of peritoneal macrophages
   infected with CRAB for 4 h at an MOI of 10 (n = 3). B) Immunoblot
   analysis of protein expression in EB‐treated and untreated peritoneal
   macrophages infected with CRAB for 2 h at an MOI of 10 (n = 3). C)
   qRT‐PCR analysis of gene expression in untreated and EB‐treated
   peritoneal macrophages infected with CRAB for 4 h at an MOI of 10 (n =
   3). The data are expressed as the mean ± SD; *p < 0.05, **p < 0.01,
   ***p < 0.001, ****p < 0.0001.

2.5. Mitochondrial Dysfunction Mediates mtDNA Release and cGAS‐STING Pathway
Activation During CRAB Infection

   Increased mitochondrial permeability mediated by the mPTP leads to the
   release of mtDNA.^[ [89]^25 ^] To further explore how CRAB induces
   mtDNA release into the cytoplasm, morphological changes in mitochondria
   were determined by transmission electron microscopy (TEM). CRAB induced
   the loss of mitochondrial cristae and swelling of mitochondria in
   macrophages (Figure [90] 6A). Furthermore, macrophages infected with
   CRAB showed hyperpolarization of the mitochondrial membrane potential
   (shown by TMRE), an increase in mPTP levels (shown by calcein AM) and
   increased mitochondrial Ca^2+ levels (shown by Rhod‐2 AM)
   (Figure [91]6B–D). Collectively, these results indicated that CRAB
   infection induced mitochondrial dysfunction and mtDNA release. To
   confirm the role of the mPTP in the activation of the cGAS‐STING
   pathway, the mPTP inhibitor cyclosporin A (CsA) was used to block the
   mPTP opening.^[ [92]^26 ^] CsA reversed CRAB‐induced mPTP opening.
   Furthermore, CsA treatment decreased the phosphorylation of STING,
   TBK1, IRF3, NF‐κB p65, p38, and ERK induced by CRAB infection,
   inhibited the up‐regulation of type I IFN (IFN‐β, ISG15, and CXCL10)
   and pro‐inflammatory cytokines (TNF‐α and IL‐1β) induced by CRAB
   infection (Figure [93]6E,F). Taken together, our results demonstrated
   that cGAS‐STING pathway activation in CRAB infection was initiated by
   mPTP opening‐mediated mtDNA leakage.

Figure 6.

   Figure 6
   [94]Open in a new tab

   Mitochondrial dysfunction mediates mtDNA release and cGAS‐STING pathway
   activation during CRAB infection. A) Transmission electron microscopy
   images of peritoneal macrophages infected with CRAB for 4 h at an MOI
   of 10. Scale bar: 5 µm and 1 µm. B) Representative fluorescence
   micrographs of mitochondrial membrane potential by assessing TMRE in
   peritoneal macrophages uninfected or infected with CRAB for 4 h at an
   MOI of 10. Scale bar: 50 µm. The mean fluorescence index (MFI) of the
   mPTP level C) and the mitochondrial Ca^2+ concentration D) in
   peritoneal macrophages uninfected or infected with CRAB for 4 h at an
   MOI of 10 were measured by flow cytometry (n = 3). E) Immunoblot
   analysis of protein expression in untreated or CsA‐treated peritoneal
   macrophages infected with CRAB for 2 h at an MOI of 10 (n = 3). F)
   qRT‐PCR analysis of gene expression in untreated and CsA‐treated
   peritoneal macrophages infected with CRAB for 4 h at an MOI of 10 (n =
   3). The data are expressed as the mean ± SD; *p < 0.05, **p < 0.01,
   ***p < 0.001, ****p < 0.0001.

2.6. CRAB Delivers OMP38 via OMVs into Mitochondria to Activate the
cGAS‐STING Pathway

   Pathogenic bacteria induce mitochondrial dysfunction by delivering
   toxins via OMVs.^[ [95]^27 ^] The OMVs were isolated from CRAB and
   characterized using transmission electron microscopy (TEM) and
   nanoparticle tracking analysis (NTA) (Figure [96]S4, Supporting
   Information). To elucidate the mechanism of CRAB‐induced mitochondrial
   dysfunction, OMVs from CRAB were isolated and the phosphorylation of
   STING, TBK1, IRF3, NF‐κB p65, p38, and ERK and type I IFN (IFN‐β,
   ISG15, and CXCL10) and pro‐inflammatory cytokines (TNF‐α) were
   upregulated in OMVs treated‐macrophages (Figure [97] 7A,B). Mass
   spectrometry‐based high‐throughput proteomics analysis of CRAB‐derived
   OMVs showed that OMP38 is the most enriched virulence factor
   (Figure [98]7C,D). OMP38 was high expressed in CRAB‐derived OMVs and
   localized to the mitochondria during CRAB infection (Figure [99]7E,F).
   Recombinant A. baumannii OMP38 treatment upregulated the
   phosphorylation of STING, TBK1, IRF3, NF‐κB p65, p38 and ERK,
   upregulated type I IFN (IFN‐β, ISG15, and CXCL10) and pro‐inflammatory
   cytokines (TNF‐α) (Figure [100]7G,H). These results indicated that CRAB
   delivered OMP38 to mitochondria via OMVs to induce the cGAS‐STING
   pathway activation.

Figure 7.

   Figure 7
   [101]Open in a new tab

   CRAB delivers OMP38 via OMVs into mitochondria to activate the
   cGAS‐STING pathway. A) Immunoblot analysis of protein expression in
   untreated or OMVs (20 µg mL^−1)‐treated peritoneal macrophages for 2 h
   (n = 3). (B) qRT‐PCR analysis of gene expression in untreated or OMVs
   (20 µg mL^−1)‐treated peritoneal macrophages for 4 h (n = 3). C) Ranked
   protein abundances in CRAB‐derived OMVs. D) Top 4 proteins based on
   rank abundance. E) Immunoblot analysis of protein expression in CRAB
   and CRAB‐derived OMVs. F) Representative fluorescence micrographs of
   peritoneal macrophages untreated or OMVs for 1 h and stained with DAPI
   (blue), MitoTracker (green), and OMP38 (red). Scale bar: 25 µm. G)
   Immunoblot analysis of protein expression in untreated or OMP38 (10
   µg mL^−1)‐treated peritoneal macrophages for 2 h (n = 3). H) qRT‐PCR
   analysis of gene expression in untreated or OMP38 (10 µg mL^−1)‐treated
   peritoneal macrophages for 4 h (n = 3). The data are expressed as the
   mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

2.7. EGCG Blocks Activation of the cGAS‐STING Pathway and Ameliorates
CRAB‐Induced Inflammatory Lung Injury

   To further explore the role of the cGAS‐STING pathway in CRAB
   infection, we screened three cGAS inhibitors: EGCG,^[ [102]^28 ^] G140,
   and RU.521.^[ [103]^29 ^] The results showed that EGCG, G140, and
   RU.521 could all inhibit the phosphorylation levels of STING, TBK1,
   IRF3, NF‐κB p65, p38, and ERK induced by CRAB infection (Figure [104]
   8A; Figure [105]S5A,B, Supporting Information). Notably, at comparable
   molar concentrations, EGCG exhibited a more pronounced inhibitory
   effect. Additionally, inhibition of all three cGAS inhibitors
   suppressed CRAB‐induced inflammatory cytokine expression, with EGCG
   showed superior safety (Figure [106]8B; Figure [107]S5C–E, Supporting
   Information). Furthermore, EGCG suppressed CRAB‐induced STING
   translocation to the Golgi apparatus (Figure [108]8C). To test whether
   EGCG was effective in restraining the activation of the cGAS‐STING
   pathway in vivo, mice were intraperitoneally injected with EGCG (40
   mg kg^−1) 24 h, 8 h, or 4 h before the intranasal injection of 10^7 CFU
   of CRAB. Treatment with EGCG robustly suppressed bacterial load,
   pathological injury, and inflammatory cytokines (TNF‐α, IL‐1β, and
   IL‐6) (Figure [109]8D–F). In addition, EGCG was intraperitoneally
   injected (40 mg kg^−1) 8 h before the intranasal instillation of 10^8
   CFU of CRAB, which significantly decreased lethality (Figure [110]8G).
   Taken together, the results indicated that EGCG was effective in
   treating CRAB infection by blocking activation of the cGAS‐STING
   pathway.

Figure 8.

   Figure 8
   [111]Open in a new tab

   EGCG blocks activation of the cGAS‐STING pathway and ameliorates
   CRAB‐induced inflammatory lung injury. A) Immunoblot analysis of
   protein expression in peritoneal macrophages pretreated with EGCG (10,
   20, 40 µg mL^−1) and infected with CRAB for 2 h at an MOI of 10 (n =
   3). B) qRT‐PCR analysis of gene expression in peritoneal macrophages
   pretreated with EGCG (10, 20, 40 µg mL^−1) and infected with CRAB for
   4 h at an MOI of 10 (n = 3). C) Immunofluorescence staining analysis of
   the Golgi apparatus translocation of STING in peritoneal macrophages
   pretreated with EGCG (40 µg mL^−1) and treated with CRAB for 1 h at an
   MOI of 10. Scale bar: 25 µm. C57BL6 mice were pretreated with EGCG for
   4, 8, or 24 h and then left uninfected or infected with 1 × 10^7 CFU of
   CRAB for 24 h (n = 5). D) Homogenates of the lung tissues were plated
   to determine the bacterial CFUs per gram. E) Pathological histological
   analysis of lung sections stained with H&E. Scale bar: 250 µm. F) ELISA
   analysis of TNF‐α, IL‐1β, and IL‐6 cytokine levels in lung tissues (n =
   5). G) C57BL6 mice were pretreated with EGCG for 8 h and then left
   uninfected or infected with 1 × 10^8 CFU of CRAB (n = 10). The survival
   rate of the mice was monitored for up to 5 days. The data are expressed
   as the mean ± SD; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3. Conclusion

   An alarming increase in antibiotic resistance in A. baumannii has been
   shown over the last 50 years, making effective therapies more difficult
   to implement and necessitating the development of new strategies.^[
   [112]^30 ^] A. baumannii clearance and infection resolution depend not
   only on the effect of antibiotic drugs but also on the host immune
   response.^[ [113]^31 ^] To explore the role of the early innate immune
   system response to CRAB, mice were infected with CRAB for 6 h, and lung
   tissues were subjected to transcriptomic analysis by high‐throughput
   RNA sequencing. The results showed that CRAB activated the cGAS‐STING
   pathway and induced IFN‐β in lung tissue and macrophages. However, the
   details of the role of the early innate immune response in CRAB
   infection remain unknown. In this study, we demonstrated that the
   cGAS‐STING pathway was critically involved in CRAB infection and that
   STING deficiency alleviated CRAB‐induced lung injury in mice.

   Alveolar macrophages (AMs) are the first line of defence of innate
   immune cells in the distal respiratory tract that are capable of
   efficient phagocytosis and killing of A. baumannii to limit initial
   replication and secrete proinflammatory cytokines and chemokines for
   the rapid recruitment of other innate immune cells.^[ [114]^32 ^] In an
   in vitro macrophage CRAB infection model, CRAB induced STING
   translocation to the Golgi apparatus to activate the cGAS‐STING pathway
   and upregulated the levels of p‐TBK1, p‐IRF3, p‐p65, p‐p38 and p‐ERK.
   cGAS or STING deficiency or TBK1 inhibition significantly decreased the
   activation of the cGAS‐STING pathway and the IFN response. These
   results further showed that CRAB infection elicits a robust IFN‐I
   response through the cGAS‐STING pathway. It is important to note that
   previous studies have demonstrated that A. baumannii can induce type I
   IFN production through a TRIF‐dependent manner.^[ [115]^33 ^] However,
   our study reveals a distinct pathway for type I IFN induction. On the
   other hand, the cGAS‐STING pathway influences the phosphorylation of
   p65, p38, and ERK and the expression of inflammatory cytokines (TNF‐α,
   IL‐1β and IL‐6), indicating that NF‐κB (p65), MAPK (p38) and ERK
   participate in the cGAS‐STING pathway.

   Mitochondrial DNA within the cytosol is one of the factors that
   activates the cGAS‐STING pathway.^[ [116]^34 ^] The internalized
   bacterial endotoxin lipopolysaccharide (LPS) induces mtDNA release into
   the cytosol by activating gasdermin D to form mitochondrial pores.^[
   [117]^35 ^] CRAB induced mitochondrial DNA translocation into the
   cytosol and activated the cGAS‐STING pathway, which was alleviated by
   the inhibition of mtDNA translocation into the cytosol. However, we
   failed to verify the binding of mtDNA to cGAS by immunoprecipitation or
   immunofluorescence staining, making it difficult to directly visualize
   the interaction between mtDNA and cGAS; further investigations are
   needed.

   Mitochondrial homeostasis, including mitochondrial ultrastructure,
   mitochondrial reactive oxygen species (mtROS), alterations in oxidative
   metabolism, the tricarboxylic acid (TCA) cycle, and membrane potential,
   is vital for macrophage activation^[ [118]^36 ^] and the macrophage
   response to bacterial pathogens.^[ [119]^37 ^] CRAB altered the
   mitochondrial morphology and the mitochondrial calcium levels and
   depolarized the mitochondrial membrane potential and mPTP opening.
   Therefore, we further explored the contribution of the mPTP to the
   promotion of mtDNA release and activation of the cGAS‐STING pathway.
   mPTP opening during CRAB infection and inhibition of mPTP opening
   downregulated the cGAS‐STING pathway. These results indicated that CRAB
   induced mtDNA leakage through the mPTP.

   OMVs are critical in facilitating host‐pathogen interactions during
   bacterial infection and deliver virulence factors to distant sites.^[
   [120]^38 ^] To investigate the mechanism by which CRAB induces
   mitochondrial dysfunction, CRAB‐derived OMVs were isolated. The results
   showed that CRAB‐derived OMVs can strongly activate the cGAS‐STING
   pathway. OMP38 is the most abundant A. baumannii outer membrane protein
   and one of the most well‐characterized virulence factors, our results
   demonstrated that CRAB‐derived OMVs contain high expressed OMP38, which
   localized to the mitochondria during CRAB infection. Based on these
   results, we further found that recombinant A. baumannii OMP38 induced
   the cGAS‐STING pathway activation.

   By defining the role of the cGAS‐STING pathway in CRAB infection, we
   further explored how to apply this finding for the clinical treatment
   of CRAB infection. Our results showed that inhibition of the cGAS‐STING
   pathway using EGCG, G140, and RU.521 effectively suppressed
   CRAB‐induced inflammation and EGCG showed the strongest inhibitory
   effect and superior safety profile. In vivo, EGCG treatment
   significantly decreased bacterial load, pathological damage, and
   inflammatory cytokines. These results suggest that targeting the
   cGAS‐STING pathway with EGCG could be developed as adjunctive therapies
   to mitigate the harmful inflammatory responses associated with CRAB
   infection.

   In summary, we demonstrated that CRAB infection induced mitochondrial
   dysfunction and mPTP opening to release mtDNA into the cytosol. cGAS
   sensed cytoplasmic mtDNA to induce STING translocation and induced the
   phosphorylation of TBK1 and IFN‐β and the expression of inflammatory
   cytokines. Moreover, EGCG effectively suppressed cGAS activation to
   ameliorate CRAB‐induced inflammatory lung injury. Our findings suggest
   that targeting the cGAS‐STING pathway can potentially be used to treat
   CRAB infection and effectively prevent the development of drug
   resistance.

4. Experimental Section

Mice

   C57BL/6 mice were purchased from Shanghai Slac Animal Inc. (Shanghai,
   China), and STING^−/− mice were purchased from the Model Animal
   Research Center of Nanjing University. Female (18–20 g) WT or STING^−/‐
   mice were used for the experiments. All mice were housed in a specific
   pathogen‐free facility with a standard environment. All mouse
   experimental procedures were performed in accordance with the
   Institutional Animal Care and Use Committee of Soochow University, and
   all research protocols were approved by the Animal Ethical Committee of
   Soochow University.

CRAB Infection

   CRAB was purchased from Biobw Co., Ltd. (Beijing, China) and cultured
   in LB overnight at 37 °C. The following day, the bacteria were pelleted
   by centrifugation at 4000 × g and washed with sterile PBS three times.
   For RNA sequencing of lung tissue, each mouse was intranasally infected
   with 1 × 10^7 CFU of CRAB for 6 h, and lung tissue was collected in
   TRIzol. For detection of the bacterial load in the lung tissue, the
   mice were intranasally infected with 1 × 10^7 CFU of CRAB for 24 h, and
   the lung tissue was weighed, homogenized in PBS, serially diluted, and
   plated on LB plates. For survival assays, mice were intranasally
   infected with 1 × 10^8 CFU of CRAB, and daily survival was recorded for
   5 days to calculate the survival rate of the different groups.

Cell Culture

   Peritoneal macrophages were isolated from WT C57BL/6 and STING^−/−
   mice.^[ [121]^39 ^] Mice were intraperitoneally injected with sterile
   thioglycollate medium (4%, 2 mL). At 4 days post‐injection, the
   peritoneal macrophages were collected by flushing with RPMI 1640
   medium. The iBMDMs were cultured in Dulbecco's modified Eagle's medium
   supplemented with 10% FCS and 2 mM glutamine. The cells were maintained
   at 37 °C in a humidified atmosphere of 5% CO[2].

RNA‐Sequencing Analysis

   Whole‐transcriptome sequencing was performed at MetWare Biotechnology
   (Wuhan, China). C57BL/6 mice were infected with 1 × 10^7 CFU of CRAB
   for 6 h and total RNA was extracted from lung tissues, The mRNA was
   fragmented with fragmentation buffer, and short RNA fragments were used
   as templates for synthesizing the first strand of cDNA with random
   hexamer primers. The second strand of cDNA was then synthesized using
   buffer, dNTPs (dTTP, dATP, dGTP, and dCTP), and DNA polymerase I. The
   double‐stranded cDNA was purified with DNA purification beads, followed
   by end‐repair, A‐tailing, and ligation with sequencing adapters. After
   selecting fragments of the appropriate size using DNA purification
   beads, the final cDNA library was enriched via PCR. Sequencing steps
   were performed following RNA‐seq protocols on the Illumina HiSeq
   platform. Data analysis was carried out using the Ensembl database,
   referencing the genome annotated as Mus_musculus. GRCm39.109. Each
   group consisted of three independent samples, with tissue collected
   from three separate mice.

ELISA

   Mouse IFN‐β production was assessed with a Mouse IFN‐β ELISA Kit (MULTI
   SCIENCE, #EK2236), mouse cGAMP was assessed with a cGAMP ELISA Kit
   (Cayman, #501700), and inflammatory cytokines were assessed via a Mouse
   TNF‐α ELISA Kit (Invitrogen, #88‐7324‐22), Mouse IL‐1β ELISA Kit
   (Invitrogen, #88‐7013‐88) and Mouse IL‐6 ELISA Kit (Invitrogen, #
   88‐7064‐88) according to the manufacturers’ instructions.

Western Blot Analysis

   The cells were lysed for resolving by SDS‐PAGE and transferred onto
   PVDF membranes (Millipore). The membrane was blocked with 5% BSA for
   2 h and incubated with primary antibodies at 4 °C overnight. The
   membrane was washed three times in TBST buffer (50 mm Tris, 150 mm
   NaCl, 0.05% Tween 20, pH 7.4) and incubated with HRP‐conjugated
   secondary antibodies for 1.5 h at room temperature, after which the
   signal was detected by using an enhanced chemiluminescence (ECL) kit
   (Invitrogen) following the manufacturer's specific protocol.

RNA Extraction and qRT‐PCR Analysis

   Total RNA from macrophages was extracted with TRIzol lysis reagent
   (A&G) according to the manufacturer's instructions, and the
   concentration and quality of the RNA were determined with a Nandrop One
   (Thermo Fisher Scientific). Reverse transcription of RNA to cDNA and
   qRT‒PCR were carried out. Relative expression levels were calculated by
   the 2^−ΔΔCT method.

Cytosolic DNA Isolation

   Cytosolic DNA was extracted as previously described.^[ [122]^24 ^]
   Peritoneal macrophages were lysed in 500 µL of digitonin buffer (150 mm
   NaCl, 50 mm HEPES (pH 7.4), 40 µg mL^−1 digitonin, protease, and
   phosphatase inhibitors) on a shaker for 10 min and centrifuged at 2000
   × g for 10 min at 4 °C. The supernatants were transferred to new fresh
   tubes and centrifuged at 20 000 × g for 20 min at 4 °C. The
   supernatants were the cytosolic fractions, and the remained pellets
   were nuclear fractions and DNA was extracted using a DNA isolation kit
   (Tiangen). Real‐time PCR was used to quantify the mitochondrial DNA,
   and the RPS18 (ribosomal protein S18) was quantified for normalization.

Immunofluorescence Staining

   Macrophages seeded in glass‐bottom cell culture dishes were fixed in 4%
   paraformaldehyde and permeabilized with 0.1% Triton X‐100 for 10 min.
   After being blocked with 5% bovine serum albumin (BSA) for 1 h, the
   cells were incubated with specific primary antibodies overnight at 4
   °C. The cells were then incubated with appropriate Alexa Fluor
   647/FITC‐conjugated secondary antibodies for 1 h at room temperature.
   The cell nuclei were counterstained with DAPI. Images were obtained
   with a Leica TCS SP8 confocal microscope.

Generation of TLR4 and cGAS Knockout Cell Lines

   The lentiCRISPR V2 plasmid was used to construct TLR4 and cGAS KO
   cells, and the following RNA sequences were used: TLR4 sg1: 5′‐
   TAATATTACCTACCAATGCA‐3′; TLR4 sg2: 5′‐ TGAGTTTCTGATCCAT‐GCAT’; cGAS
   sg1: 5′‐CACCGTGTTTAAACTGGAAGTCCCC‐3′; cGAS sg2:
   5′‐CACCGATTCTTGTAGCTC‐AATCCTG‐3′. The TLR4 and cGAS lentiCRISPR V2
   plasmid and packaging plasmids pVSVg and psPAX2 were transfected into
   HEK293T cells. The lentiviruses were collected, and TLR4 and cGAS KO
   cells were selected with 2.5 µg mL^−1 puromycin for 7 days.

Transmission Electron Microscopy

   The macrophages were immobilized in a solution containing 2.5%
   glutaraldehyde and 150 mm sodium cacodylate (pH 7.4) overnight at 4 °C.
   Next, the cells were fixed with 1% OsO[4], stained with uranyl acetate,
   dehydrated with ethanol, and ultimately encased in epoxy resin. The
   sections were then treated with uranyl acetate and placed on
   Formvar‐coated grids. The visual representations were captured by a
   Hitachi HT‐7800 transmission electron microscope.

Isolation of OMVs

   The OMVs were isolated from CRAB culture supernatants according to
   previous studies.^[ [123]^40 ^] The bacterial culture supernatants were
   collected and filtered through a 0.22‐µm sterile filter. After
   filtration, supernatants were further ultracentrifuged at 150 000 × g
   for 2 h at 4 °C using a 70 Ti rotor (Beckman Coulter, USA). The OMVs
   were collected and resuspended in phosphate‐buffered saline.

Characteristics of OMVs

   For morphological analysis, OMVs were placed on a copper grid for 5
   min, stained with 2% uranyl acetate, and visualized using transmission
   electron microscopy (TEM) (Hitachi, Japan). For nanoparticle tracking
   analysis, the particle concentration and size distribution of OMVs were
   measured using a Zeta‐View Particle Metrix system (Particle Metrix,
   Germany).

Statistical Analysis

   Statistical analysis of the experimental data was performed by using
   GraphPad Prism 8 (GraphPad Software, California, USA). Statistically
   significant differences were determined by unpaired two‐tailed
   Student's t‐tests. p values were determined by the log‐rank
   (Mantel–Cox) test and indicated differences in survival rates between
   mice from different groups. The error bars represent ± SD.

Conflict of Interest

   The authors have no conflicts of interest.

Ethics Approval

   All animal experimental procedures received ethical approval from the
   Ethics Committee of the First Affiliated Hospital of Soochow University
   (approval no. 2023–462).

Author Contributions

   Y.Y. performed the experiments and edited the manuscript. Y.Y.Z.,
   J.J.Z., J.J.L., and L.G. participated in the data collection and
   analysis. L.W. was involved in the investigation and writing. Z.Y.L.
   and J.A.H. were responsible for funding acquisition and finalizing the
   manuscript. Correspondence and requests for materials should be
   addressed to Z.L.

Supporting information

   Supporting Information
   [124]ADVS-12-2408292-s001.docx^ (9.9MB, docx)

Acknowledgements