Abstract

Background

   Peritoneal fibrosis (PF) is a serious complication commonly associated
   with prolonged peritoneal dialysis. Mesenchymal stem cells (MSCs) and
   their exosomes (Exo) have shown significant therapeutic promise in
   treating fibrotic conditions. Danshensu (DSS), a bioactive compound
   from the traditional Chinese herb Danshen reverses fibrosis. This study
   aims to investigate a novel strategy to enhance the therapeutic
   efficacy against PF by DSS preconditioning MSCs-derived exosomes
   (DSS-Exo).

Methods

   The in vitro studies included the effects of DSS duration on MSCs, and
   the characterization of DSS-Exo and Exo, followed by the assessment of
   RNA and protein expression levels of peritoneal fibrosis markers and
   inflammatory cytokines levels after treating human peritoneal
   mesothelial (HMrSV5) cells. In vivo experiments were conducted on a PF
   mouse model to observe cell morphology, collagen deposition, fibrosis
   localization, and to evaluate peritoneal functions such as filtration
   rate, urea nitrogen clearance, peritoneal thickness, and protein
   leakage. Mechanistic insights were gained through the analysis of the
   STAT3/HIF-1α/VEGF signaling pathway, tissue dual-fluorescence
   localization,chromatin immunoprecipitation sequencing (ChIP-seq), and
   dual-luciferase reporter (DLR) assays. Additionally, the differential
   expression of miRNAs between DSS-Exo and Exo was explored and
   validation of key miRNA.

Results

   DSS-Exo significantly upregulated E-cadherin, downregulated VEGFA,
   α-SMA, CTGF and Fibronectin expression in HMrSV5 cells compared to
   untreated Exo. In vivo studies revealed that DSS-Exo enhanced the
   ability of Exo to improve peritoneal function,such as the peritoneal
   filtration rate and urea nitrogen, glucose clearance, while reducing
   peritoneal thickness and protein leakage, and cell morphology, reduce
   collagen deposition, and decrease the degree of fibrosis.
   Mechanistically, these exosomes inhibited the STAT3/HIF-1α/VEGF
   signaling pathway within peritoneal mesothelial tissues. Furthermore,
   ChIP-seq and DLR demonstrated that DSS-Exo affected STAT3 directly
   binds to SHANK2 promoter regions, forming hydrogen bonds between 5 key
   amino acids such as GLN-344, HIS-332 and 6 key bases such as DG-258,
   DG-261. miRNA profiling identified DSS-Exo increased hsa-miR-27a-5p_R-1
   to regulated STAT3-SHANK2 and modulating the EMT.

Conclusion

   This study highlighted the innovative use of Danshensu in enhancing
   MSC-derived exosome therapy for PF. The identification of the
   hsa-miR-27a-5p_R-1-STAT3-SHANK2 axis may reveal new molecular
   mechanisms underlying fibrosis, further research is needed to fully
   elucidate its impact on PF. The integration of Danshensu from
   traditional Chinese medicine into modern MSC exosome therapy represents
   a promising frontier in the development of novel treatments for
   fibrotic diseases.

Supplementary Information

   The online version contains supplementary material available at
   10.1186/s13287-025-04181-0.

   Keywords: Mesenchymal stem cell exosomes, STAT3, HIF, VEGFA, EMT,
   Fibrosis

Introduction

   Currently, there are over 3 million end-stage renal disease patients
   worldwide, and nearly 10% of them require peritoneal dialysis (PD)
   treatment. PD is a more convenient and cost-effective method compared
   to hemodialysis. The application of PD helps alleviate the
   socioeconomic burden and family expenses [[46]1]. However, the
   peritoneal dialysis fluid, which contains a high concentration of
   glucose, can lead to structural and functional changes in peritoneal
   mesothelial cells, resulting in peritonitis and neovascularization,
   ultimately leading to PF [[47]2]. Extensive research evidence has
   confirmed that EMT played a crucial role in the process of peritoneal
   fibrosis, characterized by the loss of peritoneal mesothelial cells,
   abnormal growth of α-SMA-positive myofibroblasts, thickening of the
   submesothelial stroma, and neovascularization [[48]3]. PF is the main
   reason for discontinuing PD treatment [[49]4]. At present, there are no
   definite preventive and therapeutic measures.

   Research has shown that MSCs have unquestionable efficacy in treating
   fibrotic diseases such as liver fibrosis, pulmonary fibrosis, and renal
   fibrosis. MSCs are multipotent adult stem cells derived from bone
   marrow, adipose tissue, and umbilical cord, and they have immense
   clinical potential due to their extensive immunoregulatory,
   anti-fibrotic, and anti-inflammatory effects [[50]5–[51]7]. Two recent
   studies have found that intraperitoneal injection of human MSCs can
   improve glucose chlorhexidine-induced PF in rats, and serum-free
   culture conditions could enhance the anti-peritoneal fibrosis
   capability of MSCs, providing new evidence for the prevention and
   reversal of PF by MSCs [[52]8, [53]9]. Another study also suggested
   that human MSCs-derived exosomes may be more effective in reducing
   liver fibrosis than MSCs, with lower potential for host reactions
   [[54]10, [55]11] . The mechanism of action of MSCs is associated with
   paracrine secretion rather than transdifferentiation [[56]12–[57]15].

   Exosomes are membrane-bound vesicles with a diameter of approximately
   30–150 nm that are generated from multivesicular bodies within cells.
   They can be generated by most of human cell types and are distributed
   across tissues, intercellular spaces, and body fluids. Typically, there
   are approximately 1 × 10^12 exosomes in 1 ml of blood. Exosomes carry
   proteins, miRNA, lncRNA, circRNA, mRNA, and their degradation
   fragments, which play important regulatory roles in intracellular
   signaling pathways and cellular activities. They have shown promising
   potential as a novel therapeutic approach for various diseases,
   including tumor metastasis, disease development and immune disorders.

   Salvia miltiorrhiza, a traditional Chinese medicine with
   blood-activating and stasis-resolving properties, is derived from the
   dried root and rhizome of Salvia miltiorrhiza Bge, a plant belonging to
   the Lamiaceae family. Modern pharmacological studies have demonstrated
   that Salvia miltiorrhiza possesses significant effects in lowering
   blood pressure, reducing blood lipids, and exhibiting anti-inflammatory
   and anticoagulant properties. Furthermore, current research has
   confirmed that DSS extracts and its main monomers have strong
   antifibrotic effects [[58]16, [59]17]. Previous studies in our
   laboratory found that treatment with DSS alleviates peritoneal fibrosis
   induced by 4.25% peritoneal dialysis solution in human peritoneal
   mesothelial cells and mice, with STAT3 identified as the key target for
   the disease and the drug [[60]18]. STAT3 and HIF expression are
   involved in the metabolism, proliferation, and migration processes of
   various cells to maintain cellular homeostasis. Consistent with this,
   the expression of histone deacetylase 8 was increased in PD effluent
   from long-term PD patients, and histone deacetylase 8 promotes EMT in
   peritoneal fibrosis through the activation of STAT3/HIF-1α [[61]19].
   The expression of VEGF and HIF-1α could also be abolished by inhibiting
   STAT3 activation.

   Against this background, we investigated whether exosomes derived from
   DSS-preconditioned human mesenchymal stem cells could enhance the
   antifibrotic effects of regular exosomes and further elucidated the
   potential mechanisms underlying their differential effects. This study
   proposes a novel application of active components from herb, providing
   a reference for clinical development (flow chart as follow).[62]
   graphic file with name 13287_2025_4181_Figa_HTML.jpg

   This flowchart outlines the comprehensive research process from exosome
   characterization to in vitro, in vivo, and mechanistic studies.

Material

Animals

   C57BL/6 J mice, weighted 30 g ± 5 g, aged 10–12 weeks, half male and
   half female, were purchased from Guangzhou Reagent Biotech Co., Ltd.
   (Guangzhou, China). The mice were housed in a specific pathogen-free
   animal facility at Guangzhou Yungnovo Biotechnology Co., Ltd.
   (Guangzhou, China) with controlled lighting and temperature, and had
   free access to food and water. All experimental protocols
   (IACUC-AEWC-F2211019) were approved by the Guangzhou Forevergen
   Biosciences for Laboratory Animal Welfare and Ethical review board, and
   the study was conducted in accordance with the national guidelines for
   the use of laboratory animals.

Exosome and HMrSV5 cells

   The human umbilical cord MSCs were purchased from the Guangdong Cord
   Blood Bank (Guangzhou, China). These cells were derived from umbilical
   cord tissue donated by healthy pregnant women, with written informed
   consent signed by the donors or their legal representatives permitting
   the use of the umbilical cords for scientific research. The cells used
   in the experiment were at passage 4. After purchase, the MSCs were
   identified by the Guangdong Cord Blood Bank to meet the standard
   phenotype of human mesenchymal stem cells, ensuring their purity and
   quality. MSCs were cultured in 10% low glucose DMEM medium until the
   third passage, and then the culture medium was replaced with fresh
   serum-free medium. After an additional 48 h of incubation, the
   supernatant was collected. HMrSV5 cells at passage 4 was purchased from
   Guangzhou Jennio Biotech Co., Ltd (Guangzhou, China). This cell line is
   internationally recognized as an immortalized human peritoneal
   mesothelial cell line used for research experiments. HMrSV5 cells were
   cultured in 10% DMEM complete culture medium and incubated at 37 °C
   with 5% CO2 in a CO2 incubator. The fresh culture medium was replaced
   every 2 days. The overall research project, including the use of human
   cells, was approved by the Ethics Committee of the Affiliated Panyu
   Central Hospital of Guangzhou Medical University on November 23, 2020
   (PYRC-2020-016).

Reagent

   Glucose peritoneal dialysis including 1.5%, 2.5%, and 4.25%
   concentrations were sourced from Baxter Healthcare Ltd. (Guangzhou,
   China). Danshensu (HPLC purity > 98%, CAS:76,822-21-4, molecular
   weight: 198.17) was purchased from Selleck Chemicals LLC (USA).
   Standard fetal bovine serum, DMEM culture medium, penicillin and
   streptomycin, and 0.25% trypsin were purchased from Gibco (USA).
   Dimethyl Sulphoxide was obtained from Sigma (USA). Trizol reagent was
   purchased from Thermo Fisher Scientific (Carlsbad, USA). RNA extraction
   auxiliary reagent (chloroform substitute) was sourced from ECOTOP
   Science Company (Guangzhou). Hifair® II 1st Strand cDNA Synthesis Kit
   was purchased from Yeasen Biotechnology Co., Ltd. (Shanghai, China).
   PrimeScript RT Kit and AceQ qPCR SYBR Green Master Mix (Low ROX) were
   obtained from Vazyme Biotech Co., Ltd. (Nanjing, China). CCK8 assay kit
   was purchased from Dojindo Chemical Corporation (Japan). Whole protein
   extraction reagent and BCA protein assay kit were sourced from KGI
   (Jiangsu, China). E-cadherin, VEGF-A (BS6496), STAT3 (BS1336), p-STAT3
   (S727) (AP0248), p-STAT3 (T705) (AP0247), CTGF, FN, and HIF-1A rabbit
   monoclonal antibodies were purchased from Santa Cruz Biotechnology.
   High-sensitivity chemiluminescent detection solution was obtained from
   Amersham Life Sciences (Buckinghamshire, UK). CD14, CD29, CD34, CD44,
   CD73, CD45, CD90, CD105, and HLA-DR, along with FITC and PE isotype
   controls, were purchased from BioLegend (USA). The ELISA kit of IL-2,
   IL-6 and IL-8 was purchased from Jiangsu Meimian Industrial Co., Ltd.
   The inhibitor NC and hsa-miR-27a-5p_R-1 inhibitor were custom and
   synthesized by Huzhou Hippo Biotechnology Co., Ltd. The instruments
   used include a full-wavelength multifunctional microplate reader
   (Thermo, Varioskan LUX), a cell constant-temperature incubator (Thermo
   Scientific), a tabletop refrigerated centrifuge (Eppendorf, 5804R,
   5418R), an inverted optical microscope (Leica, DM1000 LED), an
   automatic incubator (Bioworld, China), and a Bio-Rad ChemiDoc XRS
   system (Bio-Rad, USA).

Method

Cell viability

   MSCs treated with 200 μM DSS were seeded into a 96-well plate. After
   incubation for 0 h, 24 h, 48 h, and 72 h, 10 μL of CCK8 solution was
   added to each well and incubated for 2 h. The optical density (OD) was
   measured using a microplate reader. CCK8 assays were performed after
   treating MSCs with 0-400 μM DSS for 48 h. Exo were collected after
   treating MSCs with 200 μM DSS for 48 h. HMrSV5 cells were incubated in
   a CO[2] incubator for 24 h. The old culture medium was aspirated, and
   10% DMEM complete medium containing 0 μg/mL, 1 μg/mL, 3 μg/mL, or
   5 μg/mL of DSS-Exo and Exo were added to each group with 3 replicates.
   After treatment for 48 h, CCK8 solution was added to each well for 2 h.
   The OD at 450 nm was measured. All experiments were performed at least
   three biological times.

Flow cytometry analysis

   Cells were seeded into 6-well plates, and at 0 h, 24 h, 48 h, and 72 h,
   cell morphology, density, and adhesion status were observed using an
   inverted microscope. Cells were then collected at each time point,
   washed twice with PBS, and adjusted to a concentration of 1 × 10⁶
   cells/mL. Fluorescently labeled antibodies were used, including CD29
   (303,003), CD44 (397,517), CD73 (344,015), CD90 (328,109), CD105
   (323,203), CD14 (325,603), CD34 (303,103), CD45 (304,006), HLA-DR
   (980,402), and isotype controls FITC (403,507) and PE (403,503). Cells
   were incubated with the antibodies at 4 °C in the dark for 30 min,
   followed by washing with PBS to remove unbound antibodies. Flow
   cytometry was performed, with at least 10,000 events collected per
   sample.

Enzyme-linked immunosorbent assay (ELISA)

   ELISA was used to measure the concentrations of inflammatory cytokines
   (IL-2, IL-6, and IL-8). Samples were added to 96-well plates pre-coated
   with capture antibodies, followed by incubation with detection
   antibodies and streptavidin-HRP. After substrate development and
   stopping with sulfuric acid, absorbance was measured at 450 nm, and
   calculated the concentration. All measurements were performed in
   triplicate.

Quantitative real-time reverse transcription PCR (qRT-PCR)

   HMrSV5 cells were cultured to 80% confluence and treated with 4.25%
   peritoneal dialysis fluid along with complete medium containing
   0 μg/mL, 1 μg/mL, 3 μg/mL, or 5 μg/mL of DSS-Exo and Exo. After 48 h,
   RNA was extracted using the Trizol method, followed by cDNA synthesis
   and qRT-PCR experiments to observe the expression of VEGF-A,
   E-cadherin, and FN mRNA. The primers were synthesized by Bgi Genomics
   Co., Ltd. (Table [63]1). Human GAPDH gene was used as an internal
   reference gene. ΔΔCt = (target gene Ct value—reference gene Ct
   value)—(control target gene Ct value—reference gene Ct value); relative
   mRNA expression = 2^(-ΔΔCt) × 100%. All experiments were performed at
   least three biological times.

Table 1.

   Primer sequences
   Genes      Forward primer          Reverse primer
   VEGFA      TTGCCTTGCTGCTCTACCTCCA  GATGGCAGTAGCTGCGCTGATA
   GAPDH      AGAAGGCTGGGGCTCATTTG    GCAGGAGGCATTGCTGATGAT
   FN         ACAACACCGAGGTGACTGAGAC  GGACACAACGATGCTTCCTGAG
   E-cadherin GCCTCCTGAAAAGAGAGTGGAAG TGGCAGTGTCTCTCCAAATCCG
   [64]Open in a new tab

Characterization and concentration determination

Extraction

   Resuscitate MSCs in a 10 cm culture dish. Once the cells are confluent,
   digest and count them, then seed 1 × 10^7 cells in a bioreactor
   containing 200 mL of complete culture medium with 20 microcarriers.
   Culture in a 37 °C, 5% CO[2] incubator for 3D culture. After 48 h, add
   200 mL of medium to the Exo group and 200 mL of medium (IMMOCELL,
   IMP-H122-1) containing 200 μM DSS to the DSS-Exo group. Continue
   culturing for another 48 h, then remove the bioreactor, let it stand to
   allow the microcarriers and cells to settle, and collect the
   supernatant. Repeat this process to collect enough supernatant. The
   collected supernatant was added to an ultrafiltration centrifuge tube
   and centrifuged at 2000 × g, 4 °C for 30 min. The supernatant was then
   collected and centrifuged again at 10,000 × g, 4 °C for 45 min to
   remove larger vesicles. The supernatant was collected and filtered
   through a 0.45 μm filter membrane to collect the filtrate. The filtrate
   was transferred to a new centrifuge tube and centrifuged at 4 °C,
   100,000 × g for 70 min. After removing the supernatant, the pellet was
   resuspended in 10 mL of pre-chilled PBS, and centrifuged again at 4 °C,
   100,000 × g for 70 min at high speed. The supernatant was removed, and
   the pellet was resuspended in 100 μL of pre-chilled PBS. Then, 20 μL
   was used for electron microscopy, 10 μL for particle size analysis, and
   the remaining exosomes were stored at − 80 °C.

Characterization

   The exosomes were observed for their overall morphology using
   transmission electron microscopy. Around 10 μL of the exosome
   suspension mentioned above was dropped onto a carbon-coated copper grid
   with a mesh size of 200, placed in a clean bench for 15 min, followed
   by adding 1% uranyl acetate for negative staining for 5 min. Excess
   negative staining solution was removed using sterile filter paper, and
   the grid was air-dried at room temperature for 30 min. The morphology
   and size of the exosomes were observed using transmission electron
   microscopy, and the concentration was preliminarily estimated.

Nanoparticle tracking analysis

   10 μL of the exosomes were removed and diluted to 30μL. Exsome samples
   after instrument performance test with standard. The particle size
   distribution range of exosome membranes were measured using the
   ParticleMetrix nanoparticle tracking analysis instrument.

Markers of exosomes by western blot

   The exosomes concentration was determined using the BCA assay kit
   following the protocol. Cells were lysed with RIPA buffer containing
   protease inhibitors, phosphatase inhibitors, and PMSF. The collected
   protein samples were electrophoresed on a 10% sodium dodecyl
   sulfate–polyacrylamide gel, transferred onto a polyvinylidene fluoride
   membrane, and blocked with 5% skim milk at room temperature. The
   membrane was then incubated with primary antibodies against GAPDH, CD9,
   CD81 and CD63 (1:1000) overnight at 4 °C, followed by washing and
   incubation with horseradish peroxidase-conjugated goat anti-rabbit
   secondary antibody (1:3000) at room temperature for 1 h. The protein
   expression was detected using chemiluminescence substrate on a gel
   imaging system. All experiments were performed at least three
   biological times.

Animal and experimental design

   After one week of adaptation to appropriate temperature, water, and
   food conditions, three mice per cage, 24 mice were randomly divided
   into four groups (n = 6). The mice were placed in an induction chamber
   and anesthetized with 3–5% isoflurane, followed by maintenance of
   anesthesia at 1–3% isoflurane via a face mask, while continuously
   monitoring their vital signs. The treatments were applied according to
   the following groups: (1) NC group (equal volume of normal saline [NS],
   intraperitoneal injection); (2) PF group (3 ml of 4.25% peritoneal
   dialysis [PD] + NS, intraperitoneal injection); (3) Exo group
   (15 μg/day + PD, intraperitoneal injection); (4) DSS-Exo group
   (15 μg/day + PD, intraperitoneal injection). To reduce the potential
   risks of peritoneal infection and mechanical injury caused by multiple
   injections, a mixture of exosomes and PD was administered
   simultaneously every day for four weeks, followed by subsequent
   sampling and experimentation. At the end of the experiment, the mice
   were euthanized by exsanguination following anesthesia. The daily
   treatment regimen and timing were consistent. The experimental design
   was conducted by HWC and CH, with injections performed daily using the
   JY method. Sampling and measurements were conducted by FHL. Data
   analysis was performed using JXH software. Our preliminary experiments
   indicated that intraperitoneal injection of 4.25% PD for four weeks
   induced PF. Mice that survived without infection at the end of four
   weeks were included in further experiments. If they died or were lost,
   the missing data were treated as the average for the entire group. If
   more than three data points were missing, new mice and molds were
   created. The sample size for all experiments was predetermined based on
   calculations from our experience. No samples were excluded in this
   study. All animals were allocated using simple randomization. Data
   analysis was conducted single-blind, with researchers unaware of group
   assignments during both the experiments and the assessment of results.
   The work has been reported in line with the ARRIVE guidelines 2.0.

Peritoneal equilibrium test

Measurement of peritoneal dialysis ultrafiltration and drain fluid protein
concentration

   Each group of mice were injected with 2.5 mL of 4.25% peritoneal
   dialysis solution intraperitoneally. After retaining the solution in
   the peritoneal cavity for one dialysis cycle (120 min), a size 4.5
   medical syringe needle was used to puncture the lower left abdomen of
   the mice to drain the peritoneal dialysis fluid. The abdominal wall was
   then cut along the midline, and the abdominal fluid was absorbed and
   weighed using sterile gauze. The weight of the dry gauze was subtracted
   to calculate the ultrafiltration volume (UF), and the protein
   concentration in the drain fluid was measured. UF = (weight of absorbed
   water by gauze—weight of gauze) × 1 mL·mg -1 + drain volume—2.5 mL.

Measurement of urea nitrogen and glucose clearance

   Mice blood specimens and peritoneal fluid were collected from the mice.
   The peritoneal permeability was assessed by the ratio of blood urea
   nitrogen (BUN) in the dialysis fluid and blood (D/P) and the absorption
   of glucose in the dialysis fluid, i.e., the ratio of glucose in the
   120-min dialysis fluid to the 0-min dialysis fluid (D/D0). The blood
   specimens were centrifuged at 3000 rpm for 10 min, and the peritoneal
   dialysis fluid specimens were centrifuged at 1500 rpm for 5 min. The
   concentrations of BUN and glucose in plasma and dialysis fluid were
   measured using an automated biochemical analyzer.

Masson, HE and Sirius Red staining

   Performed HE and Masson staining to observe peritoneal mesothelial cell
   morphology and measure thickness. Fixed the parietal peritoneum with 4%
   paraformaldehyde, dehydrated, and embedded it in paraffin. Measured ten
   high-power fields per slide, averaging for thickness determination.
   Deparaffinized sections in xylene and ethanol, then rehydrated. For
   Masson's staining, used hematoxylin, Light Green, and Aniline Blue,
   while HE staining used hematoxylin and eosin. Applied a 0.1% Sirius Red
   solution in saturated picric acid for additional staining. Dehydrated,
   cleared, mounted, acquired, and analyzed images to observe cell
   morphology, peritoneal thickness, and interstitial vascular condition.
   Each section contained two tissue pieces, with eight high-power fields
   measured per piece to determine parietal peritoneum thickness.

Immunohistochemical (IHC) analysis

   Performed IHC analysis on paraffin-embedded sections to observe the
   expression of specific proteins. The following primary antibodies were
   used: Rabbit polyclonal VEGFA (19,003-1-AP; Proteintech), α-SMA
   (14,395-1-AP; Proteintech), HIF-1α (20,960-1-AP; Proteintech),
   E-cadherin (20,874-1-AP; Proteintech), STAT3 (10,253-2-AP;
   Proteintech), and p-STAT3 (AP0705; ABclonal). Capture and measure
   images of the microsections.

Immunofluorescence (IF)

   Paraffin sections underwent 60-min room temperature incubation, xylene
   immersion, ethanol rehydration. Sequential treatment: 3% H2O2, 5% BSA,
   3% blocking serum (in PBS) for blocking. Incubated overnight at 4 °C
   with primary antibodies (in 3% BSA in PBS). Fluorescent secondary
   antibodies added, 1-h room temperature incubation in the dark
   (species-specific, concentrations: Alexa488/Alexa555 1:500, Cy3/FITC
   1:200; foil-wrapped, light-protected). Hoechst: Dilute 1000 × in PBS,
   50ul/slide, 10-min dark staining. Mount with Mounting Medium, invert,
   and capture microscope images after solidification.

Western blot (WB) analysis

   Total protein was extracted using a lysis buffer. The protein
   concentration was determined using a BCA protein assay kit. SDS-PAGE
   gel electrophoresis was performed to separate the proteins, followed by
   transfer onto a membrane. After blocking with 5% skimmed milk for 1 h,
   the membrane was incubated with specific primary antibodies, including
   STAT3, p-STAT3, p-STAT3, HIF-1α, VEGFA, and α-SMA, CTGF diluted at a
   1:1000 concentration. GAPDH was diluted at 1:2000, and the
   corresponding secondary antibodies were diluted at 1:5000. Band density
   was observed using ECL chemiluminescent reagent and the Bio-Rad
   ChemidOC XRS system (Bio-Rad, USA). The protein band densities were
   converted to grayscale values, and the relative expression levels were
   normalized to the grayscale values of GAPDH. All experiments were
   performed at least three biological times.

   To investigate the relationship between treatment and STAT3/HIF-1α/VEGF
   signaling and epithelial-mesenchymal transition markers, we separately
   treated fibrotic HMrSV5 cells with the STAT3 inhibitor Stattic (MCE,
   HY-13818), HIF-1α inhibitor LW6 (MCE, HY-13671), STAT3 activator
   Colivelin (Selleck, s9664), and HIF-1α activator Fenbendazole-d3 (MCE,
   HY-[65]B04135). All experiments were performed at least three
   biological times.

   Due to the similar size of the target proteins, it could not display
   all bands on a single membrane. For clarity and simplicity, the
   manuscript showed cropped gels and imprints. Full-length blots were
   presented in Supplementary Figure S1.

ChIP-seq and bioinformatics analysis

   We performed experiments using the Chromatin Immunoprecipitation Kit
   (BersinBio) and STAT3 antibody (Santa Cruz Biotechnology, sc-8019) in
   Exo and DSS-Exo on fibroblastic HMrSV5 cells. The immunoprecipitated
   DNA was quantified using the Qubit 3.0 Fluorometer (Invitrogen) and
   validated by GeneEngine Biotech (Shanghai) Co., Ltd.

   The distribution of identified peaks on the genome was statistically
   analyzed. The computeMatrix tool in deepTools was used to calculate the
   distribution of peaks in the upstream and downstream regions of gene
   features, such as transcript start site (TSS). Based on the genomic
   annotation information, ChIP peaks were annotated by the nearest gene
   position, and the distribution of peaks on gene elements was counted.
   Motif prediction was performed using the software MEME. Gene ontology
   (GO), eukaryotic orthologous groups (KOG) and kyoto encyclopedia of
   genes and genomes (KEGG) functional enrichment analysis was analyzed.

Dual-Luciferase reporter assays

   We used 293 T cells for this assay, purchased from Guangzhou Jennio
   Biotech Co., Ltd (Guangzhou, China). Cells were seeded at 2 × 10^5 per
   well in antibiotic-free medium until 80% confluence. Using
   Lipofectamine 2000, cells were transfected and the medium was replaced
   after 4–6 h, followed by an additional 48 h of cultivation. RNA was
   extracted using the Trizol method to check STAT3 overexpression. After
   transfection, cells were washed twice with PBS and lysed in 1 × Cell
   Lysis Buffer at room temperature for 10 min. The lysate was transferred
   to an opaque 96-well plate. 100 µL of Luciferase Reaction Reagent was
   added to the plate, followed by 20 µL of the lysate. After mixing,
   firefly luciferase activity was measured using a luminometer. Next, 100
   µL of Luciferase Reaction Reagent II was added to measure Renilla
   luciferase activity. The assay included a STAT3 overexpression plasmid
   and control plasmids (pGL4 and RL-TK). Plasmid details are shown in
   Table [66]2.

Table 2.

   Plasmid information
   Start End Gene Length (bp) Annotation Genestart Geneend distancetotss
   Sequence(5'-3') (Accession number/Gene ID) Vector
   1–1 SHANK2 70,501,694 70,502,570 877 Promoter (< = 1kb) 70,469,435
   70,502,859 289 Supplementary Material Table S1 [67]GPL4-Basic
   1–2 SHANK2 70,662,309 70,662,572 264 Promoter (< = 1kb) 70,467,856
   70,662,197 − 112 Supplementary Material Table S1 [68]GPL4-Basic
   1–3 SHANK2 70,826,550 70,826,863 314 Promoter (< = 1kb) 70,667,839
   70,826,757 0 Supplementary Material Table S1 [69]GPL4-Basic
   1–4 SHANK2 71,091,166 71,091,396 231 Promoter (1-2kb) 70,896,385
   71,092,477 1081 Supplementary Material Table S1 [70]GPL4-Basic
   STAT3-homo 2313 [71]NM_139276.3 pcDNA3.1( +)
   RL-TK(empty vector) [72]GPL4-RL
   [73]Open in a new tab

MicroRNA sequencing analysis

   MicroRNA (18–30 nt) were extracted from DSS-Exo and Exo. The RNAs were
   then amplified via RT-PCR, libraries were constructed, and sequencing
   was performed. For expression quantification and differential
   expression analysis, the expression levels of each miRNA in different
   samples were calculated, and differential expression analysis was
   conducted with selection criteria set to |log2FC|> 1 and P < 0.05.
   miRNA target gene annotation was performed to predict the potential
   target genes of miRNAs and their binding sites by using TargetScan
   (v5.0) and miRanda (v3.3a). The threshold for selecting target genes
   was set as TargetScan_score ≥ 50 and miranda_Energy < -10. The
   interaction networks of differentially expressed miRNAs with SHANK2 and
   STAT3 were constructed using Cytoscape (v3.9.1)A comprehensive
   gene-protein-miRNA network was created using STRING data, with
   visualization and analysis through Cytoscape plugins like ClueGO and
   CytoHubba. The hsa-miR-27a-5p_R-1 inhibitor were applied to further
   investigate the role of this miRNA in PF and its effects on STAT3 and
   SHANK2. Four groups were established: NC (normal HMrSV5), PF (4.25% PD
   induced HMrSV5), PF + DSS-Exo-hsa-miR-27a-5p_R-1inhibitor NC, and
   PF + DSS-Exo-hsa-miR-27a-5p_R-1 inhibitor, with treatments applied for
   48 h. Protein levels of fibrosis markers (FN, α-SMA, E-Cadherin, VEGFA)
   and key therapeutic targets (SHANK2, p-STAT3, STAT3) were evaluated.

Statistical analysis

   Statistical analysis was performed using SPSS 26.0 and GraphPad Prism
   9. Data are presented as mean ± SEM. Unless otherwise stated, all
   experiments were independently performed three times. Non-parametric
   Mann–Whitney U test was employed. The significance level was set at
   α = 0.05.

Results

DSS-Exo improves fibrosis in HMrSV5 cells

   CCK8 assays showed that cell viability gradually increased over time,
   with a significant proliferation trend observed at 48 h and 72 h
   (P < 0.05) (Fig. [74]1A). Microscopic images revealed that MSCs
   maintained a stable morphology at different time points (0 h, 24 h,
   48 h, and 72 h), consistently exhibiting a typical spindle-shaped
   structure. No significant effect of DSS treatment on cell morphology
   was observed. Meanwhile, cell density gradually increased over time,
   indicating continuous cell proliferation (Fig. [75]1B). Flow cytometry
   results demonstrated that the duration of DSS treatment had no
   significant effect on the expression of MSC markers (CD29, CD44, CD73,
   CD90, and CD105), which remained highly expressed at all time points.
   In contrast, non-mesenchymal markers, including CD14, CD34, CD45, and
   HLA-DR, were consistently expressed at low levels throughout the
   experiment, suggesting that DSS did not affect the phenotypic stability
   of MSCs (Fig. [76]1C). CCK8 assays showed no significant effect on MSCs
   viability after 48 h treatments of 0, 50, and 100 μM DSS (P > 0.05),
   while 200 and 400 μM DSS significantly increased MSCs viability after
   48 h (P < 0.01). Our preliminary research found that 200 μM DSS had the
   best effect on reducing peritoneal fibrosis, so we used this
   concentration for MSCs treatment in subsequent experiments. Therefore,
   exosomes were collected from MSCs treated with 200 μM DSS for 48 h
   (Fig. [77]1D).

Fig. 1.

   [78]Fig. 1
   [79]Open in a new tab

   DSS-Exo Improves Fibrosis in HMrSV5 Cells. A Cell viability of 200 μM
   DSS treated MSCs on 0 h, 24 h, 48 h, 72 h; B MSCs Cell morphology and
   density at different time points treated by DSS; C MSCs and non-MSCs
   markers analyzed by flow cytometry; D Cell viability of 0–400 μM
   treated MSCs; E Nanoparticle tracking analysis; F Markers of exosomes
   by western blot; G The morphology and size of the exosomes in
   transmission electron microscopy; H Concentration toxicity by CCK8; I–K
   Effective concentration by RT-PCR; L, M Biomarkers of fibrosis by
   western blot; N Inflammatory cytokines concentrations by ELISA. ns:
   P > 0.05; *: P < 0.05; **: P < 0.01; ***: P < 0.001; #: P < 0.0001

   Exosomes were isolated using ultracentrifugation. Nanoparticle tracking
   analysis showed exosome diameters ranged from 30 to 150 nm, peaking at
   72.75 nm and 57.24 nm (Fig. [80]1E). Electron microscopy confirmed
   their uniform cup-shaped morphology (Fig. [81]1G). The exosomes tested
   positive for surface markers CD81, CD63, and CD9 (Fig. [82]1F),
   confirming successful extraction [[83]20].

   Using CCK8 assays, we tested different concentrations (0, 1, 3,
   5 μg/mL) of DSS-Exo and Exo on HMrSV5 cell viability at 24 and 48 h. At
   24 h, no significant effects on cell viability were observed
   (Fig. [84]1H). However, at 48 h, both DSS-Exo and Exo significantly
   increased cell viability at all concentrations (P < 0.05), with no
   significant difference between the two (P > 0.05) (Fig. [85]1H).

   Compared to the NC group, the PF group showed a significant increase in
   fibronectin and VEGFA mRNA and a significant decrease in E-Cadherin
   mRNA. Compared to the PF group, Exo intervention reduced fibronectin
   mRNA expression levels (P < 0.05) and significantly decreased VEGFA
   mRNA and increased E-Cadherin mRNA expression at a concentration of
   5 μg/mL (P < 0.05). DSS-Exo intervention improved the changes induced
   by peritoneal dialysis. At 5 μg/mL and 48 h, both DSS-Exo and Exo
   significantly reduced mRNA levels of fibrosis markers fibronectin and
   VEGFA, and increased E-cadherin levels (P < 0.05). And DSS-Exo was more
   effective than Exo (P < 0.05) (F[86]igs. [87]1I–K). Protein levels of
   CTGF, VEGFA, and α-SMA were also reduced after 48 h of treatment, with
   DSS-Exo showing greater improvement in HMrSV5 cell fibrosis
   (Figs. [88]1L, [89]M). Additionally, immunotropic cytokines IL-2,
   multifunctional cytokine IL-6, chemokines IL-8 across all groups
   revealed no significant differences (Fig. [90]1N), indicating that this
   study may capture the early stages of EMT improvement by DSS-Exo and
   Exo, when the role of inflammatory cytokines is not yet significant
   (Fig. [91]1K). Therefore, we chose 4.25% PD with 5 μg/mL DSS-Exo and
   Exo treated HMrSV5 for 48 h for further experiments.

DSS-Exo improves function and morphology of the peritoneum

   Based on the in vitro findings, DSS-Exo and Exo showed antifibrotic
   potential by regulating EMT-related markers at both mRNA and protein
   levels. These results suggested that DSS-Exo and Exo may improve EMT in
   peritoneal dialysis-induced cell damage. To confirm these findings, we
   further evaluated their effects on peritoneal structure and function in
   an in vivo model.

   Under light microscopy, normal peritoneal tissue exhibited a dense,
   intact layer of flat mesothelial cells, with a thin basement membrane
   connected to the connective tissue (Fig. [92]2C). After treatment with
   4.25% glucose peritoneal dialysis solution, mice peritoneal tissue
   showed thickening of the wall layer, discontinuity, and detachment of
   surface mesothelial cells, thickening of the submesothelial dense
   layer, and infiltration of inflammatory factors. Compared to the PF
   group, Exo and DSS-Exo treatments reduced nuclear density, with DSS-Exo
   showing the most significant reduction, indicating decreased
   inflammation or fibrosis (Fig. [93]2D). Masson staining revealed
   significant collagen deposition in the peritoneal wall layer of the PF
   group, indicated by intense blue staining (Fig. [94]2A). After exosome
   treatment, collagen deposition was reduced, with DSS-Exo showing
   slightly better effects than Exo (Fig. [95]2B). Sirius Red staining
   showed extensive fibrosis and significant collagen deposition in the PF
   group, as evidenced by intense red staining in the peritoneal layer
   (Fig. [96]2E). Exo and DSS-Exo treatments significantly reduced the
   collagen area percentage compared to PF, with DSS-Exo being the most
   effective (Fig. [97]2F).

Fig. 2.

   [98]Fig. 2
   [99]Open in a new tab

   Function and morphology of peritoneal. A Masson staining for collagen
   (blue); B Collagen area percentage (Masson); C HE staining for general
   tissue morphology; D Nuclear counting (HE); E Sirius Red staining for
   collagen (red); F Collagen area percentage (Sirius Red); G Peritoneal
   thickness; H Ultrafiltration volume; I BUN clearance rate; J Glucose
   clearance rate; K Fibronectin concentration; L–Q Immunohistochemical
   analysis; L, M α-SMA expression; N, O E-Cadherin expression; P, Q VEGFA
   expression. Ns: P > 0.05; *:P < 0.05; **:P < 0.01; ***:P < 0.001;
   #:P < 0.0001

   Masson staining measured the peritoneum thickness as (23.49 ± 2.12) μm
   in the NC group and (38.41 ± 1.65) μm in the PF group. Compared with
   the NC group, the peritoneal fibrous tissue significantly increased
   after peritoneal dialysis fluid treatment (P < 0.05). The peritoneum
   thickness in the DSS-Exo group was (27.72 ± 0.28) μm and in the Exo
   group was (29.29 ± 1.70) μm. Compared with the PF group, exosome
   intervention significantly reduced fibrous tissue and collagen
   deposition in the submesothelial layer of the peritoneal wall in mice
   (P < 0.05), with the DSS-Exo group showing even more significant
   improvement (P < 0.05) (Fig. [100]2G).

   Peritoneal ultrafiltration volume, drained protein concentration, BUN,
   and glucose clearance rate all reflect the peritoneal dialysis capacity
   of the mice. Compared with the NC group, mice undergoing 4 weeks of
   peritoneal dialysis showed a significant decrease in peritoneal
   ultrafiltration volume, BUN clearance rate, and glucose clearance rate,
   and a significant increase in drained protein concentration in the
   dialysate (P < 0.05). Compared with the PF group, intervention with
   DSS-Exo and Exo increased peritoneal ultrafiltration volume
   (Fig. [101]2H), BUN clearance rate (F[102]ig. [103]2I), and glucose
   clearance rate (Fig. [104]2J), and decreased drained protein
   concentration in the dialysate (Fig. [105]2K) (P < 0.05). The DSS-Exo
   group showed better improvement than the Exo group.

   IHC showed that compared with the NC group, the PF group had
   significantly increased expression of α-SMA and VEGFA and significantly
   decreased expression of E-cadherin (P < 0.05) (Fig. [106]2L–Q). After
   DSS-Exo and Exo treatment, the positive areas of α-SMA and VEGFA were
   significantly reduced, and E-cadherin expression significantly
   increased (P < 0.05), with DSS-Exo showing more significant improvement
   than Exo (P < 0.05). This indicates that DSS can enhance the effect of
   Exo in alleviating structural and morphological changes and improving
   peritoneal dialysis capacity in peritoneal tissue caused by peritoneal
   fibrosis.

DSS-Exo reduces the expression of STAT3, p-STAT3, and HIF-1α in vivo

   STAT3 has been implicated in the development of peritoneal fibrosis.
   IHC analysis revealed that DSS-Exo and Exo significantly reduced the
   increased expression of STAT3, p-STAT3, and HIF-1α induced by 4.25% PD
   (P < 0.05), as shown in Fig. [107]3A–F.

Fig. 3.

   Fig. 3
   [108]Open in a new tab

   The expression of STAT3, HIF-1α and VEGFA in vivo. A–F
   Immunohistochemical analysis of tissue sections; A STAT3 expression, C
   p-STAT3 expression, E HIF-1α expression; B, D, F Quantitative analysis
   of mean density (IOD value) for STAT3, STAT3 (S727), and HIF-1α,
   respectively; G–I Immunofluorescence, G DAPI (nuclei, blue), STAT3
   (green), VEGFA (red), and overlay images; H DAPI (nuclei, blue), HIF-1α
   (green), STAT3 (red), and overlay images; I DAPI (nuclei, blue), HIF-1α
   (green), VEGFA (red), and overlay images. Ns: P > 0.05; *: P < 0.05;
   **: P < 0.01; ***: P < 0.001; #: P < 0.0001

   HIF-1α is commonly believed to be downstream of STAT3 and upstream of
   VEGFA. We primarily observed the correlation of these three biomarkers
   in the peritoneal layer. Using IF co-expression experiments, we
   observed significant expression of STAT3 and VEGFA in both the
   peritoneal and muscle layers, while HIF-1α was primarily expressed in
   the muscle layer and less so in the peritoneal layer. The co-expression
   pattern of STAT3 and VEGFA was similar. Compared with the PF group, the
   DSS-Exo and Exo groups significantly reduced the expression levels of
   STAT3, HIF-1α, and VEGFA in the peritoneal layer, with DSS-Exo showing
   a more significant reduction than the Exo group (F[109]ig. [110]3G–I).

STAT3 is a key target for DSS-Exo in ameliorating PF

   Our in vivo experiments demonstrated that DSS-Exo could improve
   peritoneal function and ameliorate PF better than Exo. To further
   investigate whether DSS-Exo improves PF by regulating the
   STAT3/HIF-1α/VEGF pathway, we performed in rescue experiments on HMrSV5
   cells using DSS-Exo.

   PD-induced HMrSV5 cells were treated with DSS-Exo, the STAT3 activator
   Colivelin, the HIF-1α activator Fenbendazole-d3, and their combination
   for 48 h. The results showed that the protein expression levels of
   VEGFA, HIF-1α, STAT3 (T721), and STAT3 (S727) were significantly higher
   in the PF group compared with the NC group (P < 0.05) (Fig. [111]4 Aa,
   Ab, Fa, Fb). Treatment with DSS-Exo significantly reduced the
   expression of these proteins (P < 0.05) (Fig. [112]4 Ab, Ac, Fb, Fc).
   This indicates that DSS-Exo can reduce STAT3 (T721), HIF-1α, and VEGFA
   expression to improve PF, likely not through the activation of p-STAT3
   (S727) (Fig. [113]4A–E). Activating STAT3 can affect HIF-1α expression,
   but activating HIF-1α does not affect STAT3 expression.

Fig. 4.

   [114]Fig. 4
   [115]Open in a new tab

   The expression of STAT3/HIF-1α/VEGFA in vitro. A Western blot images
   for STAT3 (T721 and S727), HIF-1α, VEGFA expression with different
   treatments: (a) Control, (b) PD, (c) PD + DSS-Exo, (d)
   PD + DSS-Exo + Colivelin, (e) PD + Colivelin, (f)
   PD + DSS-Exo + Fenbendazole-d3, (g) PD + Fenbendazole-d3, (h)
   PD + DSS-Exo + Colivelin + Fenbendazole-d3, (i)
   PD + Colivelin + Fenbendazole-d3. B–E Quantitative analysis of the
   relative expression levels of proteins: B STAT3 (T721), C STAT3 (S727),
   D HIF-1α, E VEGFA. F Western blot images for STAT3 (T721 and S727),
   HIF-1α, and VEGFA expression with different treatments: (a) Control,
   (b) PD, (c) PD + DSS-Exo, (d) PD + DSS-Exo + Stattic + LW6, (e)
   PD + Stattic + LW6, (f) PD + DSS-Exo + Stattic, (g) PD + Stattic, (h)
   PD + DSS-Exo + LW6, (i) PD + LW6. G–J Quantitative analysis of the
   relative expression levels of proteins: G STAT3 (T721), H STAT3 (S727),
   I HIF-1α, J VEGFA. ns:P > 0.05; *:P < 0.05; **:P < 0.01;***:P < 0.001;
   #:P < 0.0001

   Next, PD-induced fibrotic HMrSV5 cells were treated with DSS-Exo, the
   STAT3 inhibitor Stattic, the HIF-1α inhibitor LW6, and their
   combination for 48 h. Inhibition of STAT3 affected HIF-1α expression,
   but not vice versa. These findings suggest that DSS-Exo primarily
   improves PF through key targets of STAT3. In addition to inhibiting the
   STAT3/HIF-1α signaling pathway, DSS-Exo likely engages other signaling
   pathways to reduce VEGFA expression (Fig. [116]4F–J).

STAT3 binding sites and association with transmembrane transporters and gated
channel activity in HMrSV5 cells

   To identify the STAT3 binding sites in HMrSV5 cells after DSS-Exo and
   Exo interventions in PF, we conducted STAT3 ChIP-seq analysis to
   pinpoint the direct targets of STAT3. Model-based analysis of ChIP-seq
   (MACS) was used to identify peaks. We identified 45 STAT3 binding sites
   in Exo-treated PF HMrSV5 cells and 23,851 sites in DSS-Exo-treated
   cells, suggesting that DSS-Exo treatment directly regulates more genes
   via STAT3 compared to Exo treatment after 48 h. The specific numbers
   and overall distribution of binding sites on chromosomes are shown in
   Fig. [117]5A, [118]B. Among these binding sites, 5,522 (23.15%) and
   9,109 (38.19%) were located in intronic or intergenic regions, and
   1,185 (4.97%) and 6,154 (25.8%) were situated at transcription start
   sites (TSS) and promoter regions, respectively, after DSS-Exo
   treatment, indicating that STAT3 may regulate genes by directly binding
   to promoters. In contrast, only 2.22% of binding sites were located in
   promoter regions after Exo treatment (Fig. [119]5C).

Fig. 5.

   [120]Fig. 5
   [121]Open in a new tab

   ChIP-sequencing analysis and validation. A Histogram of the number of
   peaks on the chromosome; B Circos graph of the overall distribution of
   the peak on the genome; C Pie chart of peak distribution on gene
   elements; D Heatmap of the signal distribution near the peak; E Peak
   figure of differential sites; F GO functional enrichmen; G KEGG pathway
   enrichmen; H Peak Motif calculate; I Alignment of the DNA-binding
   sequences; J Dual-Luciferase Reporter Assay; L Molecular Docking

   We noted differences between the DSS-Exo and Exo groups, with only 17
   intersecting genes. We chose the union genes for subsequent functional
   analysis (Fig. [122]5D). Further analysis revealed that 31.3% and 33%
   of STAT3 binding sites were within 10 kb upstream or downstream of the
   TSS in DSS-Exo PF HMrSV5 cells (Fig. [123]5E). Functional annotation of
   5,681 genes showed significant enrichment of terms related to
   transmembrane transporters and gated channel activity (Fig. [124]5F).
   Major pathways included Glutamatergic synapse, Calcium signaling
   pathway, Cholinergic synapse, and Axon guidance (Fig. [125]5G).

   Additionally, de novo motif analysis using HOMER on all STAT3 binding
   peaks showed highly conserved STAT3 homodimer motifs in DSS-Exo and Exo
   PF HMrSV5 cells, with top-ranking motifs from the KLF family, including
   KLF1, KLF2, KLF7, KLF9, KLF14, and KLF10 (Fig. [126]5H). The KLF
   family, as transcription factors, may play a synergistic role in
   transcription in this experiment. No clear peaks of the STAT3 gene
   promoter itself were found in DSS-Exo and Exo-treated cells
   (F[127]ig. [128]5I), suggesting that STAT3 protein is negatively
   regulated, consistent with our previous results (Figs. [129]3, [130]4).
   This indicated that DSS-Exo and Exo treatments may regulate
   transmembrane transporter and gated channel activity in HMrSV5 cells
   via a negative feedback loop, thereby improving the transport of
   glucose or small molecule metabolites across the peritoneum.

   Among all binding sites, we found 135 STAT3 binding sites with SHANK2.
   We selected four sequences in the promoter region for DLR assays, which
   showed that overexpressing STAT3 in 293 T cells significantly increased
   SHANK2 luciferase expression, indicating that STAT3 binds to and
   promotes transcription of SHANK2 promoter regions 1–3 and 1–4
   (Fig. [131]5J,K). To further understand the interaction between STAT3
   and SHANK2, we performed molecular docking of the DNA sequence of the
   1–3 SHANK2 promoter. As shown in Fig. [132]5L, hydrogen bonds form
   during the STAT3-DNA complex formation, with interactions between
   GLN-344, HIS-332, LYS-340, ASN-466, GLN-469 on the STAT3 protein, and
   DG-258, DG-261, DG-262, DG-263, DT-253, DC-252 on the DNA. These
   hydrogen bonds are the main forces of interaction between STAT3 protein
   and SHANK2 promoter DNA, indicating a strong STAT3-SHANK2 binding.

DSS-Exo regulates PF by hsa-miR-27a-5p_R-1-STAT3-SHANK2 axis

   To explore the potential mechanisms by which DSS-Exo enhances the
   therapeutic effect of Exo on PF through molecular biological processes,
   we performed microRNA sequencing on the contents of exosomes from both
   groups. The aim was to more comprehensively elucidate the mechanisms by
   which DSS enhances exosome therapy. Annotation using Rfam
   ([133]https://rfam.org/) revealed that both exosomes predominantly
   contain more than 50% ribosomal RNA (rRNA), with DSS-Exo having nearly
   twice the proportion of transfer RNA (tRNA) compared to Exo
   (Fig. [134]6A). We excluded other non-miRNA RNAs from the analysis.
   After differential analysis of miRNAs, clustering analysis and
   visualization were performed (Fig. [135]6C). Among the top 10
   differentially expressed miRNAs, hsa-miR-126-3p_R-1, hsa-miR-223-3p,
   hsa-miR-122-5p_R-1, mmu-mir-6236-p5_1ss4CG_1, mmu-mir-6236-p5_1ss4CG_3,
   mmu-mir-6236-p5_1ss4CG_2, and hsa-miR-26a-5p were significantly
   downregulated, while bta-miR-1246_L-1R + 3, hsa-miR-889-3p, and
   hsa-miR-27a-5p_R-1 were significantly upregulated (Fig. [136]6D,
   [137]E). Annotation revealed 466 common genes between DSS-Exo and Exo
   (Fig. [138]6B). KEGG pathway enrichment analysis of these common genes
   indicated significant enrichment in metabolic pathways (such as glucose
   metabolism and purine metabolism), suggesting their crucial roles in
   the study. An interaction network between the SHANK2 gene and all
   differentially expressed miRNAs revealed associations with three top 10
   miRNAs: hsa-miR-27a-5p_R-1, hsa-miR-122-5p_R-1, and hsa-miR-26a-5p
   (Fig. [139]6G). Similarly, the network for the STAT3 protein identified
   an association with hsa-miR-27a-5p_R-1 (F[140]ig. [141]6I). Further
   analysis of hsa-miR-27a-5p_R-1 enriched 102 genes, with the top 30,
   which included STAT3, shown in Fig. [142]6J. Finally, we developed a
   gene-protein-differential miRNA interaction network, further supporting
   the observation that hsa-miR-27a-5p_R-1 as a key mediator in the
   regulatory network involving STAT3 and SHANK2, influencing processes
   like EMT and fibrosis. GO functional enrichment analysis highlighted
   metabolic pathways and protein binding (Fig. [143]6K), consistent with
   our previous findings.

Fig. 6.

   [144]Fig. 6
   [145]Open in a new tab

   miRNA-sequencing analysis and network analysis. A Annotation of Rfam; B
   Gene Venn diagram of the differential miRNA; C Cluster analysis of the
   differential miRNA; D Volcano plot of RNA expression differences; E
   Correlation analysis of RNA expression; F KEGG pathway enrichment
   analysis; G hsa-miR-27a-5p_R-1-SHANK2 network; H
   hsa-miR-27a-5p_R-1-target gene interaction network; I
   hsa-miR-27a-5p_R-1-STAT3 network; J miRNA-gene-protein network; K GO
   enrichment analysis; L Western blot results of targets and EMT-related
   proteins, STAT3, p-STAT3, SHANK2, FN, α-SMA, VEGFA, E-cadherin; M
   Quantification of protein expression from panel L. P < 0.05, P < 0.01,
   P < 0.001, P < 0.0001

   We applied hsa-miR-27a-5p_R-1 inhibitor to DSS-treated MSC, using
   inhibitor NC as the control group. Compared to the NC group, the
   protein expression levels of p-STAT3, SHANK2, FN, α-SMA, and VEGFA were
   significantly increased in the PF group, while the expression level of
   E-cadherin was decreased. After intervention with
   DSS-Exo-hsa-miR-27a-5p_R-1 inhibitor NC, these trends were reversed,
   indicating the antifibrotic effect of the DSS-Exo. However, when the
   hsa-miR-27a-5p_R-1 inhibitor was applied, the antifibrotic effect of
   the DSS-Exo was partially attenuated (Fig. [146]6L, [147]M), suggesting
   that hsa-miR-27a-5p_R-1 played a critical role in the exosome-mediated
   reversal of EMT and improvement of fibrosis through the STAT3-SHANK2
   axis.

   The mechanism diagram highlights the potential mechanisms of
   DSS-pretreated MSC exosomes, emphasizing the
   hsa-miR-27a-5p_R-1-STAT3-SHANK2 axis. miRNAs such as hsa-miR-27a-5p_R-1
   in exosomes regulate STAT3 gene expression, subsequently influencing
   the activity of the SHANK2 promoter region. This regulatory axis is
   crucial in biological processes like EMT, fibrosis, adhesion, and
   glucose metabolism. Through this pathway, hsa-miR-27a-5p_R-1 indirectly
   affects the expression of various target genes and proteins, such as
   α-SMA, CTGF, E-cadherin, fibronectin, VEGFA, and HIF-1α, thereby
   modulating cellular functions and disease states (Fig. [148]7).

Fig. 7.

   [149]Fig. 7
   [150]Open in a new tab

   Mechanism diagram. Annotation: Specific miRNAs upregulated or
   downregulated by DSS-Exo include hsa-miR-126-3p_R-1, hsa-miR-223-3p,
   hsa-miR-122-5p_R-1, among others, which modulate genes related to
   fibrosis such as α-SMA, CTGF, E-cadherin, Fibronectin, VEGFA, and
   HIF-1α. DSS-Exo modulate the STAT3 transcription factor, which binds to
   the SHANK2 promoter, influencing gene transcription

Discussion

   PF is a pathological change in the peritoneum caused by mechanical
   injury, chronic inflammation, and long-term incompatible peritoneal
   dialysis. During the process of peritoneal fibrosis, peritoneal cells
   undergo EMT, losing epithelial cell markers and acquiring mesenchymal
   cell markers [[151]21, [152]22]. Organ fibrosis was regulated by a
   complex signaling network controlling their expression. Most
   impressively, inhibition of HIF-1 or STAT3 could treat and reverse
   fibrotic diseases and has become a promising therapeutic target
   [[153]23], such as renal fibrosis [[154]24], and pulmonary fibrosis
   [[155]25]. Compared with new PD patients, p-STAT3 expression was
   significantly increased in chronic PD effluent, considered associated
   with STAT3 phosphorylation [[156]26], tyrosine phosphorylation of STAT3
   at tyrosine705 was activated, p-STAT3 forms a dimer and then
   translocated to the nucleus, which directly binds to DNA sequence and
   regulates the expression of target genes.

   Our study demonstrated that DSS-Exo offer significant therapeutic
   advantages over regular Exo in treating PF. This effect is likely due
   to modulation of the STAT3/HIF-1α/VEGFA signaling pathway, crucial in
   PF pathophysiology [[157]27]. STAT3 is highly expressed in peritoneal
   mesothelial cells exposed to high-glucose PD. Its downstream targets,
   such as HIF and VEGFA, contribute to angiogenesis, EMT, and PF
   [[158]26, [159]28, [160]29]. In vivo experiments showed that DSS-Exo
   and Exo improved the fibrotic peritoneum's structure and restored
   peritoneal filtration function. Double immunofluorescence staining
   revealed positive correlations between STAT3 and HIF, VEGF expression,
   aligning with previous research [[161]30]. Using STAT3 and HIF-1α
   agonists and inhibitors, we observed changes in downstream targets and
   EMT markers, suggesting STAT3 as a key therapeutic target. STAT3
   ChIP-seq analysis identified key gene sequences related to hMSC-Exosome
   therapy, including SHANK2, TYK2, and FKL, which associated with
   transmembrane transporters and gated channel activity. miRNA-seq
   analysis of exosome identified that hsa-miR-126-3p_R-1, hsa-miR-223-3p,
   hsa-miR-122-5p_R-1, mmu-mir-6236-p5_1ss4CG_1 and hsa-miR-26a-5p were
   significantly downregulated, while bta-miR-1246_L-1R + 3,
   hsa-miR-889-3p, and hsa-miR-27a-5p_R-1 were significantly upregulated.
   By regulating the STAT3-SHANK2 axis, hsa-miR-27a-5p_R-1 indirectly
   affects the expression of various target genes and proteins, such as
   α-SMA, CTGF, E-cadherin, FN, VEGFA, and HIF-1α, thereby modulating
   cellular functions and disease states.

   Previous studies have shown that mesenchymal stem cell-derived exosomes
   prevent liver fibrosis by delivering miR-148a to macrophages through
   the KLF6/STAT3 pathway [[162]31] and alleviate steatotic scar fibrosis
   through the miR-192-5p/IL-17RA/Smad axis [[163]32]. Additionally,
   miR-21a-5p attenuates glycolysis and reduces renal fibrosis by
   targeting PFKM [[164]33]. Inhalation of alveolar epithelial
   cell-derived exosomes promotes lung repair in pulmonary fibrosis
   [[165]34]. Our study further elucidated the STAT3/HIF-1α/VEGFA
   signaling pathway involved in mesenchymal stem cell-derived exosome
   therapy for peritoneal fibrosis. Interestingly, we observed contrasting
   results to two studies that utilized mesenchymal stem cells or modified
   exosomes in fibrosis treatment, where VEGFA expression was upregulated
   [[166]35, [167]36]. We believed that the effects of exosomes may be
   mediated by multiple miRNAs working synergistically and reaching a
   balanced state. In other words, exosomes may promote angiogenesis in
   the early stages of the disease and inhibit angiogenesis in later
   stages, or the role of the same exosomes in fibrosis in different
   organs may vary.

   Our results revealed the molecular mechanism of DSS-Exo treatment for
   PF. Among these, hsa-miR-27a-5p_R-1 emerged as a critical regulator.
   hsa-miR-27a-5p_R-1 was found to influence STAT3 expression, which in
   turn affects SHANK2 promoter activity. The miR-27 family includes
   microRNA precursors found in animals and humans [[168]37]. The mature
   miR-27 plays a role in cholesterol and fatty acid metabolism [[169]38].
   When overexpressed, it blocks fat cell development by inhibiting key
   regulators [[170]39]. miR-27a and miR-27b specifically reduce fat cell
   differentiation by targeting PPARγ and C/EBP alpha [[171]40], acting as
   inhibitors of fat formation and contributing to obesity [[172]39].
   miR-27 also activates the Wnt signaling pathway, which helps stem cells
   become bone cells [[173]41]. It targets and reduces the APC protein,
   affecting bone cell differentiation. This pathway is activated when
   β-catenin builds up in the nucleus, which happens when miR-27 inhibits
   the β-catenin destruction complex through APC suppression [[174]41].
   SHANK2 is a protein encoded by the human SHANK2 gene, and it exists in
   two different splice variants [[175]42]. Mutations in SHANK2 are
   primarily associated with autism spectrum disorder and schizophrenia.
   It plays a role in synapse formation by linking metabotropic glutamate
   receptors to NMDA receptor pools through PSD-95 and HOMER1 [[176]42].
   SHANK2 also interacts with ARHGEF7 [[177]43], Cortactin [[178]44], DLG4
   [[179]45, [180]46], DLGAP1 [[181]45, [182]46] and DNM2 [[183]47]. Our
   study is the first to identify the relationship between STAT3 and
   SHANK2, providing novel insights into the regulation of SHANK2 by STAT3
   in the context of fibrosis. Complements the knowledge of human SHANK2
   genes and lays the foundation for future targeted drug development.

   Research has explored the potential of MSCs in reducing fibrosis in
   organs like the liver, lungs, and kidneys [[184]48–[185]51]. However,
   there are only three clinical trials using MSCs for treating PF. Jiang
   et al. [[186]52] reported that MSCs treatment significantly increased
   hemoglobin, erythropoietin, and albumin levels in CAPD patients. Alatab
   et al. [[187]53] found MSCs therapy feasible for CAPD patients with no
   adverse events, and Ahmadi et al. [[188]8] noted slight improvements in
   UF capacity and peritoneal function. Challenges persist, such as dosage
   discrepancies between animal and clinical trials leading to varied
   outcomes [[189]54], unique extraction methods required for different
   MSC sources, and a lack of standardized guidelines. Additionally, MSC
   storage and transport conditions can affect their clinical efficacy.
   Given these issues, MSC-derived exosomes present a promising
   alternative for treating PF. Initially, it was thought MSCs repaired
   tissue by differentiating into various cells [[190]55–[191]59], but
   recent studies show their primary action is through paracrine signaling
   and direct interactions. For instance, Jiao et al. [[192]60]
   demonstrated that MSC-conditioned media can inhibit EMT in HPMCs,
   possibly by regulating PTEN gene inhibition through lnc-CDHR and
   miR-3149 binding. Our study shows that Danshensu enhances the
   anti-fibrotic effects of exosomes, offering new insights into their
   clinical application. This underscores the potential of exosome-based
   therapies as viable alternatives in clinical settings.

   DSS, a major active compound extracted from Salvia miltiorrhiza, has
   been traditionally used in Chinese medicine for its blood-activating
   and stasis-resolving properties. Modern pharmacological studies have
   demonstrated its significant effects in lowering blood pressure,
   reducing blood lipids, and exhibiting anti-inflammatory and
   anticoagulant properties [[193]61, [194]62]. However, the clinical
   application of DSS and other traditional chinese medicine (TCM)
   monomers in humans is often limited by concerns about bioavailability,
   toxicity, and the lack of comprehensive clinical trials. Our study
   highlights a novel application of DSS, showing its potential in
   enhancing the therapeutic properties of MSC-derived exosomes. This
   underscores the importance of TCM as a rich source of bioactive
   compounds with potential applications in modern medical therapies. By
   integrating TCM with advanced stem cell technologies, we can develop
   innovative treatments that leverage the best of both worlds. The
   innovative aspect of our research is that it utilizes TCM monomers
   without involving ethical issues typically associated with direct human
   clinical trials, thus providing a viable pathway for the clinical
   application of these compounds in a safe and ethical manner.

   Our study has several limitations. First, while our in vitro and in
   vivo models provide valuable insights, they may not fully replicate the
   complex environment of human PF. Future independent studies are still
   needed to conduct pharmacokinetic and pharmacodynamic research on
   exosomes in the abdomen to evaluate the absorption, distribution,
   metabolism, and excretion of DSS-Exo. Second, investigate the long-term
   effects and safety profile of DSS-Exo in various models of fibrosis to
   ensure its potential for clinical application. Finally, we had at least
   3 biological replicates per group, which might lead to insufficient
   statistical power. We recommend increasing the sample size in future
   studies to validate the current results.

   Additionally, the reduction trend in IL-6 and IL-8 levels in the
   DSS-Exo treatment group, though not statistically significant. We
   acknowledge that inflammatory responses are dynamic and may require
   more time points or additional markers to fully capture the effects of
   DSS-Exo. Future studies with a broader range of biomarkers and more
   experimental conditions are necessary to clarify these effects. This
   study selected HMrSV5 cells as the in vitro model due to their key role
   in the early stages of peritoneal fibrosis. As the primary peritoneal
   cells, mesothelial cells drive fibrosis through EMT, generating
   fibroblast-like cells and secreting extracellular matrix. Single-cell
   models simplify experimental conditions, making them ideal for initial
   studies on fibrosis mechanisms. While co-culturing mesothelial cells
   with fibroblasts and immune cells better replicates the complex
   microenvironment of later fibrosis stages, future experiments can adopt
   such systems to examine cell interactions further. Immune cell
   profiling in the peritoneal microenvironment is also crucial for
   understanding the broader therapeutic effects of DSS-Exo. Immune cells,
   such as macrophages and lymphocytes, play pivotal roles in tissue
   repair and fibrosis modulation, with exosomes known to influence
   macrophage polarization and lymphocyte infiltration. The expression
   profiles of key subsets, such as macrophages (CD68, CD206, CD86) and
   lymphocytes (CD3, CD4, CD8), provide a promising approach for future
   research to understand comprehensively how DSS-Exo regulate immune
   responses to ameliorate peritoneal fibrosis.

Conclusion

   Our study highlights the therapeutic potential of DSS-MSC-Exo in
   treating PF, providing a potential mechanism of regulating the
   hsa-miR-27a-5p_R-1-STAT3-SHANK2 axis and a foundation for future
   clinical investigations. This is the first study to reveal the STAT3
   and SHANK2 relationship, expanding our understanding of their roles in
   fibrosis and suggesting new avenues for targeted therapies.
   Additionally, using Danshensu from TCM to enhance MSC exosome therapy
   underscores the potential of integrating traditional and modern medical
   practices for innovative treatments.

Supplementary Information

   [195]Additional file 1.^ (4.7MB, pdf)
   [196]Additional file 2.^ (12.2KB, docx)

Acknowledgements