Abstract

   B-phycoerythrin (B-PE), a pigment protein, has found extensive
   applications in the food, pharmaceutical, and cosmetic industries.
   However, the effects and potential mechanisms of B-PE on colitis and
   colitis-associated bone loss remain unclear. Thus, the aim of this
   study was to investigate the pharmacological mechanisms of B-PE against
   colitis and colitis-associated bone loss using network pharmacology
   analysis, molecular docking, and experimental validation. Based on
   public databases, 99 common targets of B-PE against inflammatory bowel
   disease and osteoporosis were predicted. The protein-protein
   interaction network identified 16 core targets, including TNF, AKT1,
   EGFR, etc., as hub targets. Additionally, functional enrichment
   analyses and molecular docking results revealed that the PI3K/AKT
   signaling pathway may serve as a potential signaling pathway for B-PE
   in the treatment of colitis and colitis-associated bone loss.
   Furthermore, pharmacological experiments indicated that B-PE not only
   reversed the elevated expression of TNF-α, IL-1β, MMP9, and CXCL8a, and
   the reduced expression of ZO-1, E-cadherin, COL1A1, and RUNX2 in the
   DSS-induced colitis zebrafish model, but also enhanced the
   phosphorylation of PI3K and AKT, thereby mitigating inflammatory
   response and promoting osteogenesis. In conclusion, this study provides
   a theoretical basis for considering B-PE as a promising candidate for
   the treatment of colitis and colitis-associated bone loss.

Supplementary Information

   The online version contains supplementary material available at
   10.1038/s41598-025-90011-5.

   Keywords: B-phycoerythrin, Inflammatory bowel disease, Osteoporosis,
   Network pharmacology, Molecular docking, PI3K/AKT signaling pathway

   Subject terms: Natural products, Proteins, Osteoimmunology,
   Gastrointestinal diseases
     __________________________________________________________________

   Inflammatory bowel disease (IBD), which encompasses Crohn’s disease
   (CD) and ulcerative colitis (UC), is a chronic, relapsing, and
   intractable inflammatory condition of the gastrointestinal tract. It is
   characterized by symptoms such as abdominal pain, diarrhea, bloody
   stool, fatigue, and weight loss^[40]1,[41]2. In recent years, the
   incidence of IBD has not only remained high in the United States and
   Europe but has also rapidly increased in developing countries,
   including those in Asia and Africa^[42]3. Recurrent and prolonged
   illnesses significantly impact the quality of life for patients with
   IBD and impose a socio-economic burden on the healthcare system^[43]4.
   Although the precise pathogenesis of IBD remains unclear, the
   prevailing perspective suggests that it is influenced by genetic
   susceptibility, immune system dysregulation, alterations in intestinal
   mucosal permeability, environmental factors, and dietary
   habits^[44]5,[45]6. Currently, mesalazine, aminosalicylates,
   glucocorticoids, and immunosuppressants are widely utilized in the
   treatment of IBD^[46]7,[47]8.

   Osteoporosis is characterized by low bone mass and the
   microarchitectural deterioration of bone tissue^[48]9,[49]10. Emerging
   evidence has demonstrated that IBD is frequently associated with
   osteoporosis^[50]11,[51]12. In patients with IBD, the prevalence of
   osteoporosis can reach as high as 50%. Moreover, the relative risk of
   fractures in individuals with IBD increases to approximately 1.3 to 1.4
   times that of the general population^[52]13,[53]14. Clinically,
   osteoporosis induced by IBD is primarily managed with anti-resorptive
   agents, such as bisphosphonates, selective estrogen receptor
   modulators, and anti-RANKL monoclonal antibodies, as well as anabolic
   agents like human parathyroid hormone analogs and anti-sclerostin
   monoclonal antibodies^[54]15,[55]16. However, the efficacy of these
   medications for IBD and osteoporosis is often limited, and they
   frequently come with serious side effects^[56]17,[57]18. Consequently,
   it is essential to identify safer and more effective natural bioactive
   compounds for the prevention and treatment of colitis and
   colitis-associated bone loss.

   Phycobiliproteins (PBPs) are a class of natural, nontoxic,
   water-soluble pigment proteins found in red algae, cyanobacteria, and
   cryptophytes^[58]19. Based on their spectral properties, PBPs are
   typically categorized into four classes: phycoerythrin (PE),
   phycocyanin (PC), allophycocyanin (APC), and phycoerythrocyanin
   (PEC)^[59]20. Notably, PE and PC have garnered significant attention in
   recent years due to their extensive applications in the food,
   pharmaceutical, and cosmetic industries^[60]21. PC is a naturally
   occurring chromoprotein primarily extracted from Spirulina platensis,
   comprising α and β subunits^[61]22. It has been reported that PC
   exhibits a wide range of bioactivities, including anti-inflammatory,
   anti-osteoporotic, antioxidant, and anti-tumour
   properties^[62]23,[63]24. For instance, Guo et al. demonstrated that PC
   alleviated colitis in mice via phycocyanobilin-dependent antioxidant
   and anti-inflammatory mechanisms that protected the intestinal
   epithelial barrier^[64]25. Furthermore, AlQranei et al. reported that
   C-phycocyanin (C-PC) reduced RANKL-induced osteoclastogenesis and bone
   resorption in vitro by inhibiting ROS levels, NFATc1, and NF-κB
   activation^[65]26. PE, another pigment protein, consists of α, β, and γ
   subunits and can be categorized into three types: R-phycoerythrin
   (R-PE), C-phycoerythrin (C-PE), and B-phycoerythrin (B-PE), based on
   their absorption spectra^[66]27. Among them, B-PE, the major
   phycobiliprotein of the Porphyridium species, exhibits two absorption
   peaks at approximately 545 and 565 nm, along with a shoulder peak at
   around 498 nm, and a fluorescence emission maximum at 580 nm^[67]19.
   Our previous study has demonstrated that high-purity B-PE can be
   recovered from a low concentration of phycobilin in wastewater using a
   chitosan-based flocculation method, but the bioactivity of B-PE has not
   yet been evaluated^[68]28.

   While previous studies have reported that PC can reduce inflammation
   and improve bone mass, the effects of B-PE on IBD or osteoporosis have
   yet to be investigated. Data obtained through network pharmacology and
   molecular docking indicated that B-PE might ameliorate DSS-induced
   colitis and colitis-associated bone loss by modulating the PI3K/AKT
   signaling pathway. Therefore, the objective of this study was to
   explore the potential therapeutic effects of B-PE on DSS-induced
   colitis and colitis-associated bone loss, as well as its interaction
   with the PI3K/AKT signaling pathway. The results showed that B-PE had
   the potential to attenuate DSS-induced colitis and colitis-associated
   bone loss by mitigating the inflammatory response, enhancing intestinal
   barrier function, and stimulating bone formation through the activation
   of the PI3K/AKT signaling pathway. Collectively, this study provides a
   theoretical basis for the use of B-PE as a natural bioactive compound
   to ameliorate colitis and colitis-associated bone loss.

Materials and methods

Materials and reagents

   High-purity B-PE was prepared using the method described in our
   previous study^[69]28. Dextran Sulfate Sodium Salt (DSS, molecular
   weight: 36–50 kDa) was purchased from Yeasen Biotechnology Co., Ltd.
   (Shanghai, China). Calcein and tricaine were procured from
   Sigma-Aldrich (St. Louis, USA). Hematoxylin and eosin were provided by
   Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). The
   BCA assay kit, RIPA Lysis Buffer, and fat-free powdered milk were
   obtained from Beyotime Biotech Co., Ltd (Shanghai, China). Primary
   (GAPDH, ZO-1, E-cadherin, COL1A1, RUNX2, PI3K, p-PI3K, AKT, and p-AKT)
   and secondary antibodies were purchased from Abcam, Inc. (Shanghai,
   China). Adult wild-type AB-strain zebrafish were obtained from the Type
   AB Zebrafish Platform Center of the Guangdong Medical University
   Affiliated Hospital (Zhanjiang, China). The transgenic zebrafish (Tg,
   lyz: DsRed) were acquired from the Guangdong Laboratory Animal
   Monitoring Institute. All other chemicals and reagents were of
   analytical grade.

Animals and experimental grouping

   In this study, zebrafish and their eggs were obtained from the Type AB
   Zebrafish Platform Center at the Affiliated Hospital of Guangdong
   Medical University. The zebrafish embryos and larvae were cultured
   according to our previously described method^[70]29. Embryos at early
   larval stages were utilized prior to the determination of sex,
   resulting in the inclusion of both male and female embryos in the
   study. After 3 days post-fertilization (dpf), the synchronized embryos
   were maintained in 24-well plates. Subsequently, the zebrafish larvae
   were randomly divided into four groups: a control group, a model group
   (DSS), and two experimental groups (DSS + B-PE 25 µg/mL and DSS + B-PE
   100 µg/mL). The control group consisted of zebrafish larvae treated
   with egg water, while the model group was exposed to 0.5% DSS to induce
   colitis. Animals in the experimental groups received treatment with
   0.5% DSS along with varying concentrations of B-PE (25 and 100 µg/mL).
   Zebrafish larvae at 9 dpf were collected and then anesthetized with
   tricaine. Thereafter, changes in zebrafish gut morphology and length
   were assessed using a spinning disk confocal microscope (SDCM) (Spin
   SR10, Olympus, Japan). Additionally, the distribution of neutrophils in
   the intestines of transgenic zebrafish (Tg, lyz: DsRed) was observed
   using SDCM, and ImageJ was employed for quantitative image analysis.
   All animal procedures were conducted in accordance with the National
   Research Council’s Guide for the Care and Use of Laboratory Animals
   Science, which complied with the ARRIVE guidelines and U.S. National
   Institutes of Health (NIH) Guide for the Care and Use of Laboratory
   Animals. All experiments were approved by the Institutional Animal Care
   and Use Committee (IACUC) of the Guangdong Laboratory Animals
   Monitoring Institute (Guangzhou, China, NO. A-IACUC2023104).

Hematoxylin and eosin (H&E) staining

   Zebrafish larvae were anesthetized using 0.02% tricain and then
   executed under cryogenic conditions with liquid nitrogen. Subsequently,
   the larvae, embedded in optimal cutting temperature (OCT) medium, were
   cut into 8 µm slices using a Leica CM1950 microtome and adhered to
   glass slides. Standard hematoxylin and eosin (H&E) staining of the
   paraffin-embedded samples was performed as previously described^[71]30.
   Images were captured using a spinning disk confocal microscope (SDCM)
   (Spin SR10, Olympus, Japan).

Calcein staining

   Zebrafish larvae at 9 dpf were collected and then immersed in a 0.2%
   calcein solution for 15 min. Subsequently, the larvae were thoroughly
   rinsed with egg water three times, with each wash lasting 10 min. The
   larvae were then anesthetized using a 0.02% tricaine solution, executed
   under cryogenic conditions with liquid nitrogen, and subsequently
   mounted on a depression slide. The zebrafish skulls were scanned using
   a spinning disk confocal microscope (SDCM) (Spin SR10, Olympus, Japan),
   while ImageJ was employed for the quantitative analysis of fluorescence
   images.

qRT-PCR analysis

   Zebrafish were anesthetized using 0.02% tricaine and subsequently
   euthanized under cryogenic conditions with liquid nitrogen. Total RNA
   was extracted from zebrafish colon tissues using the reagent of Trizol,
   chloroform, isopropanol, and 75% ethanol. The cDNA synthesis kit
   (Vazyme Biotech, Nanjing, China) was used to configure the reverse
   transcription system in accordance with a previous study^[72]31. All
   primer sequences were obtained from Sangon Biotech Co., Ltd (Shanghai,
   China) and were listed in Table [73]1. Moreover, the relative changes
   in target gene expression were calculated using the 2^−△△Ct method and
   normalized to GAPDH.

Table 1.

   Primer sequences used for qRT-PCR analysis.
   Gene name NCBI gene accession no. Primers sequence
   GAPDH     [74]NM_001115114.1      Forward GTTGTGGAGTCTACTGGTGTCTT
                                     Reverse CAGTGCTCATAAGACCTTCAACG
   MMP9      [75]NM_213123.1         Forward GCTCAACCACCGCAGACTAT
                                     Reverse GTGCTTCATTGCTGTTCCCG
   CXCL8a    [76]XM_009306855.3      Forward TGTTTTCCTGGCATTTCTGACC
                                     Reverse TTTACAGTGTGGGCTTGGAGGG
   IL-1β     [77]XM_051908150.1      Forward GGCTGTGTGTTTGGGAATCT
                                     Reverse TGATAAACCAACCGGGACA
   TNF-α     [78]NM_212859.2         Forward CAGGGCAATCAACAAGATGG
                                     Reverse TGGTCCTGGTCATCTCTCCA
   [79]Open in a new tab

Western blot assay

   Zebrafish were anesthetized with 0.02% tricaine and subsequently
   euthanized under cryogenic conditions using liquid nitrogen. Proteins
   were extracted from zebrafish colon tissues utilizing a lysis buffer at
   12,000 rpm for 30 min at 4 °C and quantified employing a BCA protein
   assay kit. Equal amounts of protein were mixed with SDS–PAGE loading
   buffer. After quantifying to 40 µg, the samples were separated by 10%
   SDS–PAGE, and transferred onto PVDF membranes. Following a 2 h blocking
   period with 5% fat-free milk, the membranes were incubated overnight at
   4 °C with primary antibodies (GAPDH, ZO-1, E-cadherin, COL1A1, RUNX2,
   PI3K, p-PI3K, AKT, and p-AKT). The membranes were then incubated with
   secondary antibodies for 2 h at room temperature in TBST. Lastly, the
   protein bands were visualized using the ECL detection system (Beyotime
   Biotech Co., Ltd, Shanghai, China), and the density of each protein
   band was quantified using ImageJ software.

Immunofluorescence assay

   Colon tissue sections were fixed in acetone for 10 min and subsequently
   washed three times with PBS. Following this, the sections were blocked
   with 5% bovine serum albumin (BSA) for 1 h at room temperature and then
   incubated with primary antibodies (ZO-1 and E-cadherin) overnight at
   4 °C. After a 2 h incubation with secondary antibodies at room
   temperature, the sections were stained with DAPI at room temperature
   and protected from light for 15 min. The stained sections were observed
   using SDCM (Spin SR10, Olympus, Japan), and the images were analyzed
   using ImageJ software.

Network pharmacology analysis

   The B-PE targets were obtained from the Swiss Target Prediction
   database ([80]http://www.swisstargetprediction.ch/) and the PharmMapper
   database ([81]http://www.lilab-ecust.cn/pharmmapper/). Moreover, the
   targets associated with IBD and OP were sourced from the GeneCards
   ([82]https://www.genecards.org/), OMIM ([83]https://omim.org/), and CTD
   ([84]http://ctdbase.org/) databases using “Osteoporosis” and
   “Inflammatory bowel disease” as search keywords. Subsequently, all
   targets related to B-PE, IBD, and OP were imported into a web tool
   ([85]http://bioinformatics.psb.ugent.be/webtools/Venn/) to construct a
   Venn diagram and identify common targets, which were considered
   potential targets of B-PE in the treatment of IBD and OP. These targets
   were then input into the STRING database, with the species set to “Homo
   sapiens”. The Protein-Protein Interaction (PPI) network of common
   targets was visualized using Cytoscape 3.9.1 software. Finally, Gene
   Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG)
   pathway enrichment analyses^[86]32–[87]34 were conducted using the
   DAVID platform ([88]https://davidbioinformatics.nih.gov/). The
   significantly enriched items were subsequently imported into a
   bioinformatics online platform ([89]http://www.bioinformatics.com.cn/)
   for visual analysis, and the data were presented as a bubble chart and
   a histogram.

Molecular docking

   Molecular docking can simulate the binding process between components
   and target proteins, predicting their binding patterns and
   affinities^[90]35. In this study, molecular docking was conducted
   between B-PE and two key proteins in the PI3K/Akt signaling pathway:
   PI3K and AKT1. The 3D structure of B-PE (3V57) was retrieved from the
   UniProt database ([91]https://www.uniprot.org), while the X-ray crystal
   structures of PI3K (7R9V) and AKT1 (5KCV) were obtained from the RCSB
   Protein Data Bank (PDB). Subsequently, water molecules and small
   molecule ligands within the structures were removed prior to the
   addition of hydrogen atoms. The molecular docking of B-PE with PI3K and
   AKT1 was performed using Discovery Studio2019, and the docking energies
   were calculated. Finally, the results of the molecular docking were
   visualized using PyMOL version 2.5.

Statistical analysis

   All statistical values were calculated using GraphPad Prism 8.0, and
   the data were presented as mean value ± standard deviation (SD). The
   data were analyzed using Student’s t-tests or one-way analysis of
   variance (ANOVA). P < 0.05 was considered statistically significant.

Results

B-PE attenuates DSS-induced colitis symptoms in zebrafish

   Colon length is a widely recognized indicator of the severity of acute
   colitis in zebrafish. As shown in Fig. [92]1A and B, the colonic length
   was significantly reduced following DSS treatment when compared to the
   control group. However, B-PE treatment significantly inhibited this
   decrease in colon length. Moreover, H&E staining results demonstrated
   that DSS treatment disrupted the crypt structure and exacerbated
   inflammatory cell infiltration relative to the control group, whereas
   B-PE treatment significantly attenuated DSS-induced crypt distortion
   and inflammation (Fig. [93]1C). Additionally, as presented in
   Fig. [94]1D and E, the number of intestinal neutrophil cells showed a
   significant increase after DSS treatment compared to the control group,
   while B-PE treatment significantly reduced the aggregation of
   intestinal neutrophil cells. These results indicated that B-PE
   alleviated the symptoms of DSS-induced colitis in zebrafish.

Fig. 1.

   [95]Fig. 1
   [96]Open in a new tab

   (A) Representative images of the zebrafish colon for each group. (B)
   The colon length of zebrafish across the different groups. (C)
   Representative H&E staining of zebrafish from each group. (D)
   Representative images of intestinal neutrophil cells in zebrafish from
   each group. (E) The quantification of intestinal neutrophil cells in
   zebrafish for each group. Data are presented as mean ± SD. ^#P < 0.05
   and ^##P < 0.01 versus the control group. ^*P < 0.05 and ^**P < 0.01
   versus the model group.

B-PE improves colitis-associated bone loss in zebrafish

   Calcein is a fluorescent dye that binds to the calcified bone matrix
   and is frequently employed for staining the entire skeleton of
   zebrafish^[97]36. As illustrated in Fig. [98]2A and D, the number of
   mineralized tissue stains in the zebrafish skull was significantly
   reduced by DSS compared to the control group. In contrast, B-PE
   treatment resulted in a significant increase in the number of
   mineralized tissue stains. Furthermore, the relative fluorescence
   intensity and area of the zebrafish skulls were quantified, as shown in
   Fig. [99]2E and F. The groups treated with B-PE displayed a significant
   dose-dependent increase in both the relative fluorescence intensity and
   the area of the zebrafish skulls. These findings indicated that B-PE
   effectively promoted osteogenic mineralization, thereby ameliorating
   colitis-associated bone loss. Collectively, the above results suggested
   that B-PE had the potential to improve colitis and colitis-associated
   bone loss in DSS-induced colitis zebrafish.

Fig. 2.

   [100]Fig. 2
   [101]Open in a new tab

   (A[1]–D[1]) Fluorescence images depicting the entire zebrafish skeleton
   at 4× magnification. (A[2]–D[2]) Fluorescence intensity images of
   zebrafish skulls at 20× magnification. (E) Quantification of the
   relative fluorescence intensity of zebrafish skulls. (F) Quantification
   of the fluorescence area of zebrafish skulls. Data are presented as
   mean ± SD. ^#P < 0.05 versus the control group. ^*P < 0.05 and
   ^**P < 0.01 versus the model group.

Network pharmacology analysis and molecular docking

   To explore the potential mechanisms by which B-PE may treat colitis and
   colitis-associated bone loss, we conducted a network pharmacology
   analysis. After eliminating duplicates, we identified a total of 286
   targets associated with B-PE from the Swiss Target Prediction and
   PharmMapper databases. Additionally, we collected 3908 targets related
   to OP and 3499 targets associated with IBD from the GeneCards, OMIM,
   and CTD databases after eliminating duplicates, respectively.
   Consequently, Venny analysis, as illustrated in Fig. [102]3A, revealed
   99 common targets. These common targets were subsequently imported into
   the STRING database to construct the PPI network. Visualization of the
   PPI network was performed using Cytoscape 3.9.1 software, which
   highlighted the top 10 most significant targets based on degree value:
   TNF, AKT1, EGFR, CASP3, ESR1, MMP9, MAPK3, SRC, MMP2, and MTOR, as
   shown in Fig. [103]3B.

Fig. 3.

   [104]Fig. 3
   [105]Open in a new tab

   Network pharmacology analysis of B-PE against OP and IBD. (A) Common
   targets of B-PE, OP, and IBD. (B) PPI network of common targets. (C) GO
   enrichment analysis of common targets. (D) KEGG enrichment analysis of
   common targets.

   To evaluate the potential influence of B-PE on common target-related
   signaling pathways, the Metascape database was used for GO and KEGG
   enrichment analyses of 99 common targets. As shown in Fig. [106]3C, the
   biological progress (BP) primarily encompassed protein phosphorylation,
   positive regulation of protein kinase B signaling, insulin receptor
   signaling pathway, extracellular matrix disassembly, and cellular
   response to reactive oxygen species. The cellular components (CC)
   predominantly included the cytoplasm, plasma membrane, extracellular
   region, cell surface, and macromolecular complex. Moreover, the
   enrichment terms for molecular functions (MF) were chiefly associated
   with protein tyrosine kinase activity, enzyme binding, ATP binding,
   protein kinase activity, and protein binding. Results from the KEGG
   enrichment analysis suggested that the signaling pathways implicated in
   the treatment of colitis and colitis-associated bone loss by B-PE
   primarily included the PI3K/Akt signaling pathway, Chemokine signaling
   pathway, MAPK signaling pathway, Relaxin signaling pathway, and
   Endocrine resistance (Fig. [107]3D). Given the significant enrichment
   of the PI3K/AKT signaling pathway and the identification of AKT1 as a
   common target, we propose that B-PE could potentially ameliorate
   DSS-induced colitis and colitis-associated bone loss through modulation
   of the PI3K/AKT signaling pathway.

   Subsequently, molecular docking was conducted to investigate the
   potential interactions between B-PE and PI3K, as well as AKT1
   (Fig. [108]4). The binding energy was calculated to assess the affinity
   between the compound and target proteins, with lower binding energy
   indicating a stronger affinity. The results of the molecular docking
   revealed binding energies of -20.72 kcal/mol for B-PE with PI3K and
   − 15.46 kcal/mol with AKT1, demonstrating a good affinity between B-PE
   and both proteins. Collectively, these findings suggested that B-PE may
   exert its therapeutic effects on colitis and colitis-associated bone
   loss via the PI3K/AKT signaling pathway.

Fig. 4.

   [109]Fig. 4
   [110]Open in a new tab

   Molecular docking of B-PE with PI3K (A) and AKT1 (B).

B-PE reduces inflammatory response in DSS-induced colitis zebrafish

   Pro-inflammatory cytokines, such as interleukin-1β (IL-1β) and tumor
   necrosis factor α (TNF-α), play a crucial role in DSS-induced colitis,
   with the majority being produced by macrophages^[111]37. To investigate
   the effects of B-PE on pro-inflammatory cytokines in DSS-induced
   colitis, the mRNA levels of TNF-α and IL-1β in colon tissues were
   evaluated using qRT-PCR. In this study, significantly elevated levels
   of TNF-α and IL-1β were observed in the DSS-treated model group
   compared to the control group, whereas B-PE treatment significantly
   decreased the mRNA levels of TNF-α (Fig. [112]5A) and IL-1β
   (Fig. [113]5B) in a dose-dependent manner. Matrix metalloproteinase-9
   (MMP9), a member of the MMP family, has been reported to be closely
   associated with inflammation-related diseases^[114]38,[115]39. As shown
   in Fig. [116]5C, following DSS induction, the mRNA level of MMP9 was
   significantly higher compared to the control group. However, B-PE
   treatment significantly down-regulated the mRNA level of MMP9 in a
   dose-dependent manner. CXCL8a, also known as interleukin-8 (IL-8), is
   an important inflammatory CXC chemokine that plays a key role in
   inflammation and the immune response by attracting neutrophils to sites
   of inflammation^[117]40,[118]41. As depicted in Fig. [119]5D, DSS
   significantly increased the mRNA level of CXCL8a compared to the
   control group, while B-PE treatment significantly reversed the
   up-regulation of CXCL8a induced by DSS. Collectively, these results
   demonstrated that B-PE had the potential to be a potent
   anti-inflammatory agent, ameliorating the inflammatory response in
   DSS-induced colitis.

Fig. 5.

   [120]Fig. 5
   [121]Open in a new tab

   The relative mRNA levels of TNF-α (A), IL-1β (B), MMP9 (C), and CXCL8a
   (D) were quantified using qRT-PCR. Data are presented as mean ± SD.
   ^#P < 0.05, ^##P < 0.01, ^###P < 0.001, and ^####P < 0.0001 versus the
   control group. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001, and
   ^****P < 0.0001 versus the model group.

B-PE enhances the intestinal barrier function in DSS-induced colitis
zebrafish

   Tight junction proteins and adherens junction proteins, including
   zonula occluden-1 (ZO-1) and E-cadherin, are essential for maintaining
   the intestinal epithelial barrier function^[122]42,[123]43. To further
   evaluate the effects of B-PE on the intestinal barrier in DSS-induced
   colitis, the expressions of ZO-1 and E-cadherin were quantified using a
   western blot assay. As illustrated in Fig. [124]6A and B, DSS
   significantly down-regulated the expression of ZO-1 and E-cadherin in
   colon tissues compared to the control group. Conversely, the B-PE
   treatment groups exhibited a dose-dependent increase in the expressions
   of ZO-1 and E-cadherin relative to the model group. Additionally, the
   results from the immunofluorescence assay showed that B-PE treatment
   significantly up-regulated the expressions of ZO-1 and E-cadherin in a
   dose-dependent manner when compared to the model group (Fig. [125]6C
   and D). These findings suggested that B-PE improved DSS-induced
   impairment of intestinal epithelial barrier function in zebrafish.

Fig. 6.

   [126]Fig. 6
   [127]Open in a new tab

   (A) Western blot analysis of ZO-1 and E-cadherin proteins expressions.
   (B) Quantification of ZO-1 and E-cadherin proteins expressions levels.
   (C) Images of immunofluorescence staining in zebrafish colon tissues.
   (D) Quantification of the relative fluorescence intensity of ZO-1 and
   E-cadherin. Data are presented as mean ± SD. ^##P < 0.01 and
   ^####P < 0.0001 versus the control group. ^*P < 0.05, ^**P < 0.01, and
   ^****P < 0.0001 versus the model group.

B-PE up-regulates the expression levels of osteogenesis-related proteins

   To evaluate the effects of B-PE on colitis-associated bone loss in
   zebrafish, the expression of osteogenesis-related proteins (COL1A1 and
   RUNX2) was assessed using a western blot assay. As shown in
   Fig. [128]7, the expression levels of COL1A1 and RUNX2 were reduced in
   the DSS model groups compared to the control group. However, B-PE
   treatment significantly up-regulated the expression levels of COL1A1
   and RUNX2 in a dose-dependent manner relative to the model group. Thus,
   these data indicated that B-PE improved colitis-associated bone loss by
   stimulating bone formation.

Fig. 7.

   [129]Fig. 7
   [130]Open in a new tab

   (A) Western blot analysis of COL1A1 and RUNX2 proteins expressions. (B)
   Quantification of COL1A1 protein expression level. (C) Quantification
   of RUNX2 protein expression level. Data are presented as mean ± SD.
   ^####P < 0.0001 versus the control group. ^**P < 0.01, ^***P < 0.001,
   and ^****P < 0.0001 versus the model group.

B-PE ameliorates DSS-induced colitis and colitis-associated bone loss by
activating the PI3K/AKT signaling pathway

   Based on the results of network pharmacology analysis and KEGG pathway
   enrichment, we further investigated the potential mechanism by which
   B-PE ameliorated DSS-induced colitis and colitis-associated bone loss
   via the PI3K/AKT signaling pathway, utilizing a western blot assay. As
   shown in Fig. [131]8, the levels of phosphorylated PI3K and AKT
   (p-PI3K/PI3K and p-AKT/AKT) in the model group were significantly lower
   compared to the control group. In contrast, treatment with B-PE
   markedly increased the expression levels of phosphorylated PI3K and AKT
   (p-PI3K/PI3K and p-AKT/AKT) when compared to the model group. These
   results indicated that B-PE could alleviate DSS-induced colitis and
   colitis-associated bone loss by activating the PI3K-AKT signaling
   pathway.

Fig. 8.

   [132]Fig. 8
   [133]Open in a new tab

   (A) Western blot analysis of p-PI3K, PI3K, p-AKT, and AKT proteins
   expressions. (B) Quantification of p-PI3K protein expression level
   normalized by PI3K. (C) Quantification of p-AKT protein expression
   level normalized by AKT. Data are presented as mean ± SD. ^#P < 0.05
   and ^####P < 0.0001 versus the control group. ^*P < 0.05,
   ^***P < 0.001, and ^****P < 0.0001 versus the model group.

Discussion

   IBD is a disorder that affects the gastrointestinal tract and
   encompasses both CD and UC^[134]44. Research indicates a significant
   correlation between IBD and OP, with up to 50% of IBD patients affected
   by OP^[135]12,[136]14. Furthermore, the relative risk of fracture in
   these patients is elevated by approximately 1.3 to 1.4 times, which
   poses substantial economic and healthcare challenges for
   society^[137]14. Currently, limited therapeutic options are available
   for both IBD and OP, and some medications carry potential serious side
   effects associated with long-term use. Therefore, there is a critical
   need to explore new therapeutic approaches for IBD and OP. Recent
   studies have demonstrated that PC, a pigment protein, exhibits
   anti-colitis effects through its antioxidant and anti-inflammatory
   mechanisms^[138]25. Additionally, PC has been shown to inhibit
   RANKL-induced osteoclastogenesis by suppressing the activation of
   NFATc1 and c-Fos^[139]26. However, the effects of B-PE, another pigment
   protein, on colitis and colitis-associated bone loss, as well as its
   underlying mechanisms, remain unclear. In this study, the colitis
   zebrafish model was induced using DSS. Subsequently, we found that DSS
   exacerbated inflammatory cell infiltration and increased intestinal
   neutrophil aggregation, whereas B-PE significantly reversed these
   alterations. Moreover, DSS treatment resulted in bone loss in
   zebrafish, while B-PE administration promoted osteogenic
   mineralization. The above results implied that B-PE could ameliorate
   DSS-induced colitis and colitis-associated bone loss.

   Network pharmacology analysis is an emerging interdisciplinary approach
   that examines the interactions among drugs, targets, and diseases,
   thereby providing insights into the underlying molecular mechanisms by
   which drugs treat diseases^[140]45. Molecular docking is a powerful
   tool for investigating molecular interactions and has been extensively
   utilized in drug discovery. A lower binding energy indicates that less
   energy is required for the docking structure, suggesting a higher
   likelihood and stability of the compound binding to the
   target^[141]46,[142]47. To explore the potential mechanism of B-PE on
   colitis and colitis-associated bone loss, network pharmacology analysis
   and molecular docking were performed, resulting in the identification
   of 99 common targets of B-PE against IBD and OP. PPI network analysis
   suggested that B-PE may improve colitis and colitis-associated bone
   loss by regulating TNF, AKT1, EGFR, CASP3, ESR1, MMP9, MAPK3, SRC,
   MMP2, and MTOR. GO enrichment analysis indicated that the biological
   processes enriched in the common targets primarily included protein
   phosphorylation and positive regulation of protein kinase B signaling.
   Furthermore, the molecular function enrichment terms were predominantly
   associated with protein tyrosine kinase activity, protein kinase
   activity, and protein binding. Additionally, KEGG pathway enrichment
   analysis demonstrated that B-PE may play a crucial role in modulating
   the PI3K/AKT signaling pathway. Subsequent molecular docking results
   revealed that B-PE exhibited good affinity for both PI3K and AKT1, with
   binding energies of -20.72 kcal/mol and − 15.46 kcal/mol, respectively.
   Collectively, these results demonstrated that the PI3K/AKT signaling
   pathway may represent a potential signaling pathway for B-PE in the
   treatment of colitis and colitis-associated bone loss.

   The PI3K/AKT signaling pathway regulates various cellular biological
   processes, including cell proliferation, survival, apoptosis, and
   metabolism, through the activation of PI3K and subsequent
   phosphorylation of AKT^[143]48,[144]49. Studies have shown that the
   PI3K/AKT signaling pathway plays a crucial role in the development of
   OP and IBD^[145]50,[146]51. Chen et al. discovered that
   andrographolide, a diterpenoid lactone extracted from Andrographis
   paniculata Nees, promoted bone formation and inhibited bone loss in
   glucocorticoid-induced osteoporosis by activating the PI3K/AKT
   signaling pathway^[147]52. Moreover, luteolin, a flavonoid, has been
   reported to stimulate the osteogenic differentiation of bone marrow
   mesenchymal stem cells (BMSCs) through the activation of PI3K/AKT
   signaling pathway, thereby exerting an anti-OP effect^[148]53. In this
   study, we observed that the levels of p-PI3K and p-AKT decreased
   following DSS treatment, whereas B-PE significantly activated the
   PI3K/AKT signaling pathway. Furthermore, B-PE markedly increased the
   expression of osteogenic markers COL1A1 and RUNX2. Previous research
   has indicated that the overexpression of RUNX2 enhanced the osteogenic
   potential of BMSCs^[149]54. Consequently, RUNX2 is recognized as a
   major regulator of bone formation and osteogenic differentiation.
   During the process of osteoblast differentiation, RUNX2 modulates the
   expression of various osteogenesis-related proteins, including RUNX2,
   COL1A1, and OCN, thereby promoting osteogenic differentiation^[150]55.
   Collectively, our results indicated that B-PE treatment significantly
   enhanced osteogenesis through the activation of the PI3K/AKT signaling
   pathway. Additionally, prior studies have demonstrated that the
   activation of the PI3K/AKT signaling pathway can inhibit NF-κB
   activation, resulting in decreased expression of pro-inflammatory
   cytokines such as IL-1β and TNF-α, ultimately leading to a reduction in
   the inflammatory response^[151]49,[152]51. Consistent with these
   findings, our results revealed that B-PE dose-dependently reduced the
   mRNA levels of TNF-α, IL-1β, MMP9, and CXCL8a via the activation of the
   PI3K/AKT signaling pathway. Moreover, ZO-1 and E-cadherin are essential
   for maintaining intestinal barrier function. Studies have shown that
   increasing the expression levels of ZO-1 and E-cadherin can enhance
   this function^[153]56,[154]57. In the present study, we found that B-PE
   significantly increased the expression of ZO-1 and E-cadherin in a
   dose-dependent manner, leading to improved intestinal barrier function.

Conclusion

   In summary, to investigate the potential mechanism of B-PE in treating
   colitis and colitis-associated bone loss, we conducted a combination of
   network pharmacology analysis, molecular docking, and experimental
   validation. The findings suggested that B-PE could attenuate colitis
   and colitis-associated bone loss by reducing the inflammatory response,
   protecting intestinal barrier function, and promoting bone formation
   through the activation of the PI3K/AKT signaling pathway. Taken
   together, this study provides valuable evidence supporting the use of
   B-PE as a promising therapeutic candidate for the treatment of colitis
   and colitis-associated bone loss. Future investigations should
   prioritize the validation of other relevant targets and signaling
   pathways predicted by network pharmacology in the treatment of OP and
   IBD with B-PE.

Electronic supplementary material

   Below is the link to the electronic supplementary material.
   [155]Supplementary Material 1^ (10.4KB, xlsx)
   [156]Supplementary Material 2^ (66.8KB, xlsx)
   [157]Supplementary Material 3^ (75.5KB, xls)
   [158]Supplementary Material 4^ (3.9MB, xlsx)
   [159]Supplementary Material 5^ (2.8MB, xlsx)
   [160]Supplementary Material 6^ (77.8KB, xlsx)
   [161]Supplementary Material 7^ (218.4KB, pdf)

Acknowledgements