Abstract

Purpose

   Hyperandrogenism is a leading cause of developmental retardation in
   ovarian granulosa cells. Previous studies have indicated that curcumin
   significantly improves follicular dysplasia, a characteristic of the
   polycystic ovary syndrome. Our purpose was to explore the signaling
   pathways which enable curcumin to protect the development of
   hyperandrogen-induced granulosa cells.

Methods

   Ovarian granulosa cells treated with or without curcumin at different
   dihydrotestosterone (DHT) levels, were screened for cell viability,
   reactive oxygen species production, and apoptosis. RNA sequencing
   (transcriptome sequencing) was used to determine global gene expression
   in DHT-induced granulosa cells treated with curcumin.

Results

   24 hours of combined curcumin and DHT treatment inhibited granulosa
   cell viability in a dose-dependent manner. Curcumin upregulated
   estrogen synthesis-related enzymes, downregulated lipid
   metabolism-related genes and the glucuronic acid process, inhibited
   androgen receptor (AR) activity, significantly improved cell viability,
   and corrected granulosa cell development. Gene set enrichment and
   genome transcriptome pathway analyses revealed the potential role
   played by curcumin in protecting granulosa cell development.

Conclusion

   High androgen levels may disrupt steroid hormone synthesis and lipid
   metabolism pathways associated with granulosa cell development, thereby
   activating AR and inhibiting estrogen biosynthesis. Curcumin restores
   granulosa cell development by correcting abnormal steroid gene
   expression and disordered lipid fatty acid metabolism.

   Keywords: hyperandrogen, granulosa cells, polycystic ovary syndrome,
   curcumin, RNA sequencing

Graphical Abstract

   By Figdraw.

   [33]graphic file with name fendo-16-1522269-g008.jpg

1. Introduction

   The follicle is composed of the germ, granulosa, and follicular
   membrane stromal cells. The growth and development of granulosa cells
   are key to follicle development. Gonadotropins regulate the
   proliferation and differentiation of granulosa cells into granulosa
   cell groups which exhibit different degrees of differentiation. These
   granulosa cell groups regulate the growth and maturation of oocytes via
   paracrine and gap junction communication ([34]1, [35]2).

   Androgens exist in many biologically active forms, such as testosterone
   (T) and dihydrotestosterone (DHT). The enzyme, 5-α reductase converts T
   into DHT, which shows higher bioactivity and affinity for androgen
   receptors than T. Androgens activate androgen signaling by binding to
   androgen receptors (ARs), following which they enter the nucleus and
   interact with the cis-acting enhancer sequences of the androgen
   response (AR) element on target genes to regulate gene expression at
   the transcriptional level, thereby participating in a variety of
   important physiological functions. Ovarian granulosa cells express AR.
   The androgen signaling pathway regulates early follicle growth,
   development, and follicle atresia ([36]3, [37]4). Studies have shown
   that both ovarian granulosa cell division and proliferation are
   inhibited in women with PCOS ([38]5–[39]8), while their apoptosis is
   significantly increased. In general, arrested granulosa cell
   development is closely associated with follicular dysplasia in PCOS,
   while a long-term continuous hyperandrogenic environment facilitates
   the development of granulosa cells. Thus, we investigated the effect of
   DHT on granulosa cells, with the intention of providing an experimental
   basis for further exploration of DHT-based regulation of follicular
   growth and development as well as the effects of androgens on the
   ovarian reserve.

   Curcumin, which is a lipophilic polyphenolic compound extracted from
   the rhizomes of the Zingiberaceae family, easily permeates the cell
   membrane. Its molecular formula is C[21]H[20]O[6], and its relative
   molecular weight is 368.38. It exhibits potent biological and
   pharmacological activities ([40]9, [41]10). Many studies have treated
   PCOS with curcumin. Curcumin significantly reduces androgen levels,
   corrects sex hormone disorders, reduces waist-hip ratios, body mass
   indexes, triglycerides, total cholesterol contents, and ovarian
   indexes, and improves the estrous cycle, regulates blood glucose, and
   reduces inflammatory factors in patients with PCOS ([42]11–[43]14). In
   addition, a pervious study of ours indicated that in vitro treatment
   with curcumin significantly reduced ROS levels in DHT-induced granulosa
   cells, increased mitochondrial membrane potential, down-regulated the
   expression of p-IRE1α and XBP1s and their proteins, and inhibited the
   apoptosis of granulosa cells ([44]15). However, another study reported
   that T induces only a slight increase in apoptosis rates and ovarian
   granulosa cell related signaling. Because DHT is a steroid hormone, and
   the production of T is induced by 5-α reductase, we speculated that the
   reason for apoptosis in granulosa cells induced by T being so
   insignificantly low may be attributed to the abnormal intracellular 5-α
   reductase levels seen in ovarian granulosa cells ([45]16). The
   production of steroid hormones is regulated by many genes, including
   those encoding cytochrome P450 aromatase. Aromatase (CYP19) is a
   rate-limiting enzyme that converts androgens to estrogen during the
   final stage of steroid production. It is found in the ovaries, the
   placenta, and other tissues. A decrease in the expression or activity
   of CYP19A1 leads to increased levels of ovarian androgens. In vitro
   studies have shown that high androgen exposure inhibits the
   transcription of CYP19A1 and CYP11A1 in human ovarian granulosa cells
   (KGN), thereby affecting follicular development. However, few studies
   have investigated the direct effects of curcumin on primary granulosa
   cells, and those studies that did do so generally used KGN or animal
   models ([46]17–[47]19). In this study, we applied RNA sequencing to
   elucidate the genome-wide expression of primary granulosa cell
   development affected by high androgen levels, as well as the effects of
   curcumin on intracellular steroid hormone biosynthesis and lipid
   metabolism, and to explore the potential mechanisms underlying these
   processes.

   Sequencing has revolutionized biology and medicine in recent years,
   providing single-base-level precision for high-throughput understanding
   of nucleic acid sequences ([48]20). The current study used
   transcriptomic analysis to investigate the potential mechanism(s)
   underlying the effects of curcumin treatment on granulosa cells induced
   by DHT.

2. Materials and methods

2.1. Animals

   Specific pathogen-free (SPF), 21day old Sprague Dawley^® (SD) female
   rats were obtained from the Shanghai Xipuer-Bikai Laboratory Animal
   Co., Ltd. (Shanghai, China). The animals were housed under conditions
   involving controlled standard temperatures (22 ± 2°C) and light (12:12
   h, light: dark). All experiments were performed with the permission of
   the Institutional Animal Care and Use Committee (IACUC) and approved by
   the Institutional Research Animal Committee of Jiaxing University.

2.2. Chemical drugs

   Curcumin, a natural polyphenol with a purity of 99%, was purchased from
   Sigma (Sigma-Aldrich, St. Louis, Massachusetts, USA). Curcumin powder
   was dissolved in DMSO to obtain a 50 mM reserve solution, which was
   then diluted into a 50 µM working solution using cell culture medium. A
   gradient concentration (5, 10, 15, 20, 25, 30, 50 µM) was utilized to
   detect the effect of curcumin on the viability of granulosa cells.
   Finally, optimal therapeutic concentrations were determined. Granulosa
   cells were treated with different concentrations of DHT (Selleck,
   Shanghai, China) (0.1, 0.2, 0.3, 0.4, 0.5 and 1 µM). Previous studies
   found that granulosa cells induced using 0.5 µM DHT exhibited the
   highest activity ([49]4, [50]21).

2.3. Primary cell cultures and treatments

   The rats were injected with pregnant maternal serum gonadotropin (PMSG)
   (20IU) 48 h in advance ([51]22). All rats were euthanized via cervical
   dislocation. Following immersion in 75% alcohol and disinfection for 20
   min, the ovaries were rapidly dissected on a clean bench under aseptic
   conditions and placed in pre-cooled sterile PBS to remove surrounding
   tissues and surface capsules. After washing with PBS, the ovaries were
   placed in pre-cooled DMEM/F12 (Gibco, USA). Subsequently, the follicles
   were punctured under an anatomical microscope with a 25-gauge needle to
   release granulosa cells into DMEM/F12 medium supplemented with 10%
   fetal bovine serum (Gibco, Grand Island, NY, USA) and 1%
   penicillin-streptomycin (Gibco). 200 mesh stainless steel cell sieve
   filtration. Centrifuged at 1000r/min for 5 min and washed, following
   which the supernatant was discarded, and the cells collected. A
   single-cell suspension was prepared by adding DMEM/F12 supplemented
   with 10% fetal bovine serum and 1% penicillin-streptomycin to the loose
   cell mass deposited at the bottom of a centrifuge tube. The cells were
   diluted to produce a 1.0 x 10^5/mL cell suspension and inoculated in a
   culture flask. After 24 h of culture in a 5% CO[2] incubator at 37°C,
   the culture medium was changed once to remove non-adherent cells.

   The experimental groups were as follows: the control group (Control);
   the model group (DHT); and the curcumin treatment group (DHT + CUR).
   Treatment details were as follows: the control group (DMSO); the model
   group (treated with 0.5 μM DHT for 48 h); and the curcumin treatment
   group (treated with 0.5 μM DHT, gently mixed and then treated with CUR
   for 48 h).

2.4. CCK8 assay

   Granulosa cells were seeded in 96-well plates at a density of 1 ×
   10^5/mL and then treated with different concentrations of DHT (0, 0.1,
   0.2, 0.3, 0.4, 0.5 and 1 μM) or a concentration gradient of curcumin
   (5, 10, 15, 20, 30 and 50 µM) for 24h. Then, granulosa cells were
   optimally induced by treating with DHT (0.5 μM), following which 20 μM
   curcumin was added for 48 h. A cell counting kit-8 (CCK-8) solution (10
   μL; A311-02-AA, Vazyme Biotech, Nanjing, China) was added to each well,
   followed by incubation for 4 h at 37°C. The absorbance of each sample
   was measured at 450 nm using a microplate reader.

2.5. ELISA

   Cell incubation supernatant was collected and its Anti-müllerian
   hormone (AMH) and Progesterone content were detected using the ELISA
   kit (Elabscience Biotechnology). The ELISA ranges were 62.5-4000 pg/mL
   and 0.31-20 ng/mL, and the sensitivities were 37.5pg/mL and 0.15 ng/mL,
   respectively. According to the manufacturer’s instructions, 450 nm was
   selected as the most suitable wavelength for measuring absorbance.

2.6. Immunofluorescence

   Cell climbing tablets were fixed with 4% paraformaldehyde at 24°C for
   30 min and blocked with 5% bovine serum albumin (Boster) for 30 min.
   Sections were then incubated overnight at 4°C with primary antibodies
   against 3β-HSD (1:200, sc-100466, SantaCruz, California, USA), StAR
   (1:200, 12225-1-AP, Proteintech, Chicago, USA), and AR (1:200, ab52615,
   Abcam, Cambridge, UK). The fluorescently labeled secondary antibodies
   were then incubated at 24°C for 2 h. Nuclei were counterstained with
   4′,6-diamidino-2-phenylindole (C1002, Beyotime, Shanghai, China) at a
   dilution of 1:2000 for 30 min. Images were captured using an Olympus
   laser-scanning confocal microscope (FV3000; Tokyo, Japan).

2.7. RNA extraction and RT-PCR analysis

   Total RNA was extracted from DHT- and curcumin-treated granulosa cells
   using an RNA Miniprep kit, as described by the manufacturer (Vazyme
   Biotech), while a reverse transcription kit (R223-01, Vazyme Biotech,
   China) was used for cDNA synthesis. The primer sequences are listed
   ([52] Table 1 ) Quantitative RT-PCR was performed via an ABI ViiA 7
   Real-Time PCR system (ABI, USA) using SYBR Green PCR Master Mix
   (Q441-02, Vazyme, China). Expression levels were calculated using the
   2^-ΔΔCT method.

Table 1.

   Primers of the genes used in the study.
   Genes
   3β-HSD    F GTACATTTATGGGGAGAGAAG TCC
             R CCAGGCCACATTGCCTACATA
   CYP19A1   F AACCCGAGCCTTTGGAGAA
             R GGCCCGTCAGAGCTTTCA
   CYP11A1   F GGATGCGTCGATACTCTTCTCA
             R GGACGATTCGGTCTTTCTTCCA
   StAR      F CCCCGTGACTTTGTGAGC
             R CGTAAGTTTGGTCTTAGAGGGA
   AKR1C3    F GGGATCTCAACGAGACAAACG
             R AAAGGACTGGGTCCTCCAAGA
   UGT2B4    F TCGAGAGACTTAGACACAAG
             R CCAATAGGATCTAATAAGCC
   PKC       F GCTGCTGGGGAGTTTACTGG
             R GATGCCATCTGTTCTCCCGTG
   Cyclin D1 F AGAGGCGGATGAGAACAAGC
             R CCTTGTTTAGCCAGAGGCCG
   ACS       F GTCACAGAAGTGGACGGAGTG
             R CAAATTAACCATATACCCGTCGA
   SCD-1     F CCTTATGTCTCTGCTACACTTGGG
             R ATGAGCTCCTGCTGTTATGCC
   β-Actin   F GTGCTATGTTGCTCTAGACTTCG
             R ATGCCACAGGATTCCATACC
   [53]Open in a new tab

2.8. RNA- seq data analysis

   An NGS analysis was performed on a BGISEQ- 500 platform by oeBiotech
   Genomic Services, generating, on average, approximately 6.86G reads per
   sample. After filtering, clean HISAT reads were mapped to the reference
   genome. On average, 90.73% of reads were mapped, and clean reads were
   mapped to reference transcripts using Bowtie2 (v2.2.5); then the level
   of gene expression for each sample was measured via RSEM (v1.2.12).
   Next, we used Interferome 2.0, and EnrichR to annotate transcripts;
   clustered image maps (CIMs) were rendered using CIMminer. NGS data were
   deposited in the NCBI for Biotechnology Information Gene Expression
   Omnibus database. Sequence outcomes for each transcript were obtained
   as FPKM (fragments per kilobase of exons per million reads).

2.9. Statistical analysis

   Experiments were performed in a blinded and randomized manner. All data
   were expressed as mean ± SD. Differences between mean values were
   determined using the t-test in GraphPad Prism 7. Statistical
   significance was set at p<0.05.

3. Results

3.1. Effect of curcumin on DHT-induced granulosa cells viability

   The concentration ranges of DHT (0, 0.1, 0.2, 0.3, 0.4, 0.5 and 1 μM)
   and curcumin (5, 10, 15, 20, 25, 30 and 50µM) were set according to a
   previous experiment ([54]15, [55]23). We detected granulose cell
   viability, the cells were treated with Curcumin with or without DHT for
   24 h via the CCK-8 method (10 μL; A311-02-AA, Vazyme Biotech, Nanjing,
   China). The results showed that the inhibitory effect of DHT on cell
   viability increased with increasing DHT concentration. The optimal
   concentration of curcumin which rescued DHT-induced decline in
   granulosa cell activity was 20µM ([56] Figures 1A–C ).

Figure 1.

   [57]Figure 1
   [58]Open in a new tab

   The effects of curcumin on the cellular viability and the transcriptome
   profile of granulosa cells. Primary granulosa cells were treated with
   curcumin with or without DHT. (A–C) Cell viability of granulosa cells
   treated with tunicamycin was analyzed using CCK-8 kits. (D–G) The
   results showed that 20µM curcumin may significantly increase
   DHT-induced decrease in cell viability. Data are presented as mean ±
   SD; ^* p < 0.05, ^** p < 0.01, ^**** p < 0.0001. (D-G) Transcriptome
   profiles of curcumin-treated granulosa cells were verified via Cluster
   analysis, Box-whisker Plot, and differential gene distribution.

3.2. General analysis of comparative transcriptome

   To determine the effects of curcumin on granulosa cells, we performed
   RNA sequencing of curcumin- and DHT-treated primary granulosa cells.
   Principal component analysis (PCA) revealed that the samples from
   DHT-induced granulosa cells clustered separately from those from
   untreated granulosa cells as well as those from curcumin-and DHT
   co-processed granulosa cells. Differential expression analysis was
   performed to identify changes. First, we compared the gene expression
   profiles of the control group with those of DHT alone group, and then
   compared those of the DHT alone group with those of the DHT-curcumin
   group, including the number of upregulated and downregulated genes. The
   transcriptome profiles of DHT-induced granulosa cells treated with
   curcumin were verified via cluster analysis, box-whisker plots, and
   differential gene distribution ([59] Figures 1D–G ).

3.3. Transcriptomic profile of DHT-induced granulosa cells vs Control

   In total, 500 DEGs were identified in DHT-induced granulosa cells, of
   which 403 were upregulated and 97 were downregulated in the heat map
   ([60] Figure 2A ). Next, we performed volcano plot analysis for all
   DEGs, which showed 158 upregulated and 22 downregulated genes ([61]
   Figure 2B ). Gene Ontology (GO) enrichment analysis was used to
   classify the functions of these DEGs, resulting in them being
   classified into three categories: biological processes; cellular
   components; and molecular functions ([62] Figure 2C ). KEGG pathway
   enrichment analysis was used to identify the DEGs involved in major
   biochemical and signal transduction pathways. Enrichment analysis of
   DEGs in DHT-induced group versus control group was performed using the
   KEGG database ([63] Figure 3A ). This indicated that the DEGs were
   enriched in gastric acid secretion (rno04971), the PPAR signaling
   pathway (rno03320), bile secretion (rno04976), aldosterone synthesis
   and secretion (rno04925), and protein digestion and absorption
   (rno04974), as well as the Hippo signaling pathway (rno04390) and
   several other pathway categories ([64] Figure 3B ).

Figure 2.

   [65]Figure 2
   [66]Open in a new tab

   High-throughput RNA sequencing enrichment analysis of DEGs in granulosa
   cells treated with or without DHT. (A) Heat map showing the relative
   transcript levels of differential genes in granulosa cells showing
   expression pattern changes. (B) Volcano plot showing considerably
   downregulated (green dots) and upregulated (red dots) genes. (C) DHT vs
   Control, the top30 GO enrichment analysis entries (GO entries with more
   than 2 corresponding differential genes in the three classifications
   were screened, and 10 entries were ranked from largest to smallest
   according to the -log10p-value corresponding to each entry), including
   biological process, cellular component and molecular functions, are
   shown in the bar chart.

Figure 3.

   [67]Figure 3
   [68]Open in a new tab

   KEGG pathway enrichment analysis of significant DEGs and the top20 KEGG
   enriched bubbles. (A) DHT vs Control KEGG pathway enrichment analysis
   of significant DEGs. (B) KEGG enriched top20 bubbles. In the figure,
   horizontal axis represents the enrichment score. Entries with larger
   bubbles contain more different-protein coding genes with bubble color
   varying from purple-blue-green-red. The smaller the enrichment p-value,
   the greater the significance. Compared with those in the control group,
   the pathways enriched in differentially expressed genes in the model
   group were gastric acid secretion and PPAR signaling pathway.

3.4. Transcriptome profile alteration under curcumin treatment

   We investigated the protective effects exerted by curcumin on granulosa
   cells exposed to high androgen levels. We used transcriptomic profile
   analysis and identified 380 DEGs compared to the DHT-induced treatment,
   where these included 151 upregulated and 230 downregulated genes ([69]
   Figure 4A ). Volcano plot analysis of all screened DEGs showed 32
   upregulated and 68 downregulated genes ([70] Figure 4B ). As mentioned
   above, the DEGs were classified into three categories: biological
   processes; cellular components; and molecular functions ([71] Figure 4C
   ). Enrichment analysis of DEGs in curcumin- and DHT-treated granulosa
   cells was performed using the KEGG database ([72] Figure 5A ). These
   showed that PI3K-Akt signaling pathway (rno04153), steroid hormone
   biosynthesis (rno00140), retinol metabolism (rno00830), JAK-STAT
   signaling pathway (rno04630) and Hippo signaling pathway (rno04390) and
   several other pathway categories were enriched in DEGs ([73] Figure 5B
   ). These enrichment pathways were highly similar to the pharmacological
   mechanisms of curcumin (rno00140). In addition, DEG enrichment was
   associated with steroid hormone biosynthesis, suggesting that curcumin
   treatment may correct the abnormal expression of steroid
   hormone-related genes in granulosa cells.

Figure 4.

   [74]Figure 4
   [75]Open in a new tab

   High-throughput RNA sequencing enrichment analysis of DEGs in granulosa
   cells treated with DHT and curcumin. (A) Heat map showing the relative
   transcript levels of the differential genes in granulosa cells showing
   changes in expression patterns. (B) Volcano plot showing considerably
   downregulated (green dots) and up-regulated (red dots) genes. (C) CUR
   vs DHT, the top30 GO enrichment analysis including biological process,
   cellular component and molecular functions, are shown in the bar chart.

Figure 5.

   [76]Figure 5
   [77]Open in a new tab

   KEGG pathway enrichment analysis of significant DEGs and the top20 KEGG
   enriched bubbles. (A) CUR vs DHT, KEGG pathway enrichment analysis of
   significant DEGs. (B) Top20 KEGG enriched bubbles. Compared with those
   in the model group (DHT group), the pathways enriched in differentially
   expressed genes in the medication group (CUR group) were the PI3K-Akt
   signaling pathway and steroid hormone biosynthesis.

3.5. Changes in genes associated with classical granulosa cells developmental
functions involving steroid hormones

   AMH expression is limited to gonads and secreted by granulosa cells of
   presinus and sinusoid follicles. AMH reduces the sensitivity of
   follicles to FSH and thereby inhibits follicular growth. The occurrence
   and development of PCOS are closely associated with AMH levels ([78]24,
   [79]25). In this study, the ELISA kit were used to detect AMH and
   Progesterone secretion in DHT-induced granulosa cells treated with
   curcumin (the optimal treatment was 20 μM), while an immunofluorescence
   assay was used to detect the expression of 3β-HSD and StAR. The results
   showed that curcumin significantly decreased AMH and Progesterone
   secretion by DHT-induced granulosa cells ([80] Figures 6A, B ); 3β-HSD
   level was also reduced, and StAR level was significantly increased
   ([81] Figures 6C–F ). The differences were statistically significant.
   In addition, we verified whether curcumin affects AR activity in
   granulosa cells. Immunofluorescence assays revealed that curcumin had
   significantly inhibited AR expression ([82] Figures 7A, B ).

Figure 6.

   [83]Figure 6
   [84]Open in a new tab

   Expression levels of steroid hormone related factors changed by
   curcumin-related effects in granulosa cells. (A, B) AMH and
   Progesterone production in the cell incubation supernatant were
   measured. (C–F) The expression of 3β-HSD and StAR were detected and
   quantified by immunofluorescence. Results are presented as mean ± SD;
   ^* p < 0.05, ^** p < 0.01, ^*** p < 0.001.

Figure 7.

   [85]Figure 7
   [86]Open in a new tab

   The expression of steroid-related genes, lipid fatty acid metabolism
   and cell cycle related factors after curcumin intervention in granulosa
   cells. (A, B) The expression of AR was detected and quantified via
   immunofluorescence. (C–L) mRNA was extracted from granulosa cells and
   the expression levels of 3β-HSD, AKR1C3, CYP11A1, CYP19A1, StAR, SCD-1,
   UGT2B4, ACS, PKC and Cyclin D1 were detected via RT-qPCR. Data are
   expressed as the mean ± SD; ^* p < 0.05, ^** p < 0.01, ^*** p < 0.001,
   ^**** p < 0.0001.

3.6. Validation of DEGs and signaling pathway activation in curcumin and DHT
treated granulosa cells

   To verify transcriptome data, we used by Q-PCR to further analyze the
   DEGs and the activation of signal transduction pathways in control,
   DHT- and curcumin-treated macrophages. We performed validation against
   9 of the overlapping genes and found that the results were consistent
   with RNA-Seq results ([87] Figures 7C–L ). CYP11A1, CYP11A1 and StAR
   mRNA levels were most significantly downregulated, while UGT2B4, 3β-HSD
   and PKC mRNA levels were upregulated. In summary, the transcriptomic
   data provided further clues regarding the effects exerted by curcumin
   on steroid metabolism and granulosa cell function.

4. Discussion

   Cytokines secreted by granulosa cells participate in the selection of
   dominant follicles as well as the regulation of follicle atresia, via
   complex signal transduction ([88]26, [89]27). FSH receptors as well as
   LH receptors, present on the surface of granulosa cells, specifically
   express 17β-hydroxysteroid dehydrogenase-1 and cytochrome P450
   (P450arom) aromatase. During the later stages of follicle development,
   granule cells catalyze the conversion of androstenedione (A4) and T to
   estrone (E1) and estradiol (E2) under the action of P450 aromatase,
   thereby promoting follicle development and dominant follicle formation
   ([90]28–[91]30). However, excessive androgens in women affect the
   balance between androgens, AMH, and the follicle-stimulating hormone
   (FSH), which in turn enhances FHS activity in granulosa cells, promotes
   AMH expression in presinus follicles and small antral follicles, and
   inhibits granulosa cell proliferation and follicle maturation, leading
   to follicular developmental disorders ([92]31). In this study, we found
   that the AMH level of the supernatant in the DHT-induced model group
   was significantly increased compared to that in the control group. In
   addition to affecting follicular development, excessive androgen levels
   may lead to metabolic disorders ([93]32). We used RNA sequencing to
   compare the transcriptional responses of primary cultured granulosa
   cells following hyperandrogen induction and curcumin treatment. We
   identified the DHT-mediated transcriptional signatures of granulosa
   cells with DEGs to understand the pathogenesis of hyperandrogen
   induction, which may help prevent PCOS. The results of this experiment
   showed that compared with hyperandrogen-induced granulosa cells,
   primary follicular granulosa cells in the normal control group showed
   180 different genes, 38 types of refining functions, and 20
   significantly different signaling pathways, including steroid hormone
   synthesis, lipid metabolism, cell proliferation, and energy metabolism.
   To verify the sequencing results, we screened five genes associated
   with follicular development. Compared with those of control primary
   granulosa cells, CYP11A1, CYP19A1, StAR and AKR1C3 were downregulated,
   while AR, 3β-HSD and UGT2B4 genes were upregulated in DHT-induced
   dysplastic granulosa cells. These results may provide a theoretical
   basis for further analyses of molecular mechanisms underlying
   GD-induced follicular atresia caused by granulosa cell dysplasia.

   Previous studies of ours revealed that hyperandrogens induces
   significant follicular fibrosis in the ovaries of PCOS-like rats and
   that such fibrosis is associated with mitochondrial damage and
   oxidative stress (OS) in follicular granule cells. Hyperandrogenism
   activates the NLRP3 inflammasome in granulosa cells leading to
   pyroptosis ([94]4, [95]22). Furthermore, endoplasmic reticulum stress,
   induced by hyperandrogens resulting in the apoptosis of granulosa cells
   via the IRE1α-XBP1 pathway, plays an important role in the PCOS-related
   follicle development disorder ([96]15, [97]23). Therefore,
   identification of factors and interventions that affect the functioning
   of granulosa cells may help elucidate the pathogenesis of PCOS. In this
   study, granulosa cells were co-treated with curcumin and DHT for 24 h.
   DHT inhibited granulosa cell viability in a dose-dependent manner and
   also increased apoptosis. Similarly, we have previously reported that
   DHT treatment reduced the viability of rat primary follicular granulosa
   cells ([98]33). However, another study reported that T had induced a
   slight, and not significant, increase in the rate of apoptosis of
   ovarian granulosa cells ([99]16). This may be attributed to the complex
   effects of abnormal granulosa cell development in androgen-rich
   environments. Some reports have indicated that gastric parietal cells
   synthesize and secrete large amounts of estrogen into the portal vein
   of both male and female rats ([100]34, [101]35). However, the detailed
   functioning of gastric estrogen remains unclear. Thus, further studies
   aimed at elucidating the role of gastric estrogens in the liver and
   ovaries, the regulatory factors modulating gastric estrogens, the
   association between E2 and PCOS, and the feasibility of clinical
   applications are required. Studies have shown that pioglitazone
   significantly improves lipid droplet deposition, triglyceride (TG) and
   total cholesterol (TC) levels, and liver weight in PCOS-IR rats
   ([102]36, [103]37). These findings may shed light on substances that
   may be useful as potential targets in the treatment of PCOS associated
   with metabolic disorders.

   The top 20 bubbles enriched by KEGG showed that, compared to the
   control group, the pathways in the DHT group that were enriched in DEGS
   were mainly gastric acid secretion and the peroxisome
   proliferators-activated receptors (PPARs) signaling pathways. PPARs are
   members of the nuclear receptor superfamily. PPAR agonists improve
   insulin sensitivity in several ways, including the regulation of
   glycolipid metabolism and anti-inflammatory effects, and indirect
   improvement of OS states. PPARs, expressed in the ovaries, plays an
   important role in the female reproductive tract and affects fertility.
   Most studies have reported the expression levels of PPARγ (and PGC-1α)
   in women with PCOS. Although some studies have shown the hypothesis
   that there is no difference in PPARγ expression between PCOS patients
   and controls, certain researchers reported significant upregulation,
   whereas several study teams suggested significantly lower expression
   levels ([104]38). It has been reported that AMPK/PPAR-γ/SIRT1 pathway
   is involved in the anti-inflammatory and antioxidant capacity of
   granulosa cells ([105]39). Study indicates that PPAR-α may have an
   inhibitory effect on DHEA-induced ferroptosis in granulosa cells
   ([106]40). So far, natural medicines have been reported to have an
   effect on PPAR expression in PCOS. Arandomized, double-blind,
   placebo-controlled trial to evaluate the effect of curcumin in women
   suffering from PCOS and revealed PPARγ upregulation after curcumin
   administration ([107]41). Analogously, Heshmati et al. carried out a
   randomized placebo-controlled clinical trial and treated 36 PCOS
   patients with the biologically active phytochemical ingredient
   curcumin, which significantly increased gene expression of PGC-1a
   ([108]13). A study demonstrates that curcumin effectively restores
   ovarian morphology, hormone levels, and estrous cycles in PCOS rats.
   These effects may be linked to its ability to reduce oxidative stress
   in ovaries via the upregulation of PPAR-γ ([109]42). In conclusion,
   further and more consistent studies on the role of PPAR in PCOS are
   still needed.

   Curcumin is a free radical scavenger, as well as a reducing agent and
   an inhibitor of DNA damage ([110]43, [111]44). Curcumin treatment
   reduces the ovarian index as well as the number of primordial follicles
   and the corpus luteum, alleviates disorders of the estrus cycle and sex
   hormone levels, regulates blood sugar levels, and reduces the
   expression of inflammatory factors in serum and tissues ([112]45). OS
   is a leading cause of apoptosis and follicular atresia in granulosa
   cells ([113]46). In follicles, the immune system plays an important
   role as an antioxidant. Curcumin is an important antioxidant and
   apoptotic compound. Based on a previous study, we treated DHT-induced
   primary granulosa cells with the optimal therapeutic concentration of
   curcumin ([114]15, [115]23). RNA sequencing and KEGG enrichment
   analysis revealed significantly different pathways including the
   PI3K-Akt signaling pathway, steroid hormone biosynthesis, retinol
   metabolism, JAK/STAT signaling pathway and cytokine receptor
   interaction. The PI3K-Akt mediated pathway plays an important role in
   regulating cell proliferation and survival as well as the balance
   between primordial follicle stasis and follicle-activated development
   in the ovary ([116]47); enzymes that catalyze steroid hormone
   biosynthesis are closely associated with ovarian function and granulosa
   cell development. This pathway, which includes functional genes
   encoding anabolic steroids, such as CYP19A1, CYP11A1, StAR and 3β-HSD,
   directly or indirectly participates in the synthesis of ovarian steroid
   hormones and AMH. The JAK/STAT pathway represents a major mechanism
   utilized by cytokines and growth factors for signaling. Studies have
   reported that both JAK1/3 and STAT1/3 are expressed in granulosa cells,
   suggesting that the protective effects exerted by curcumin on granulosa
   cell development may be mediated via the JAK/STAT pathway ([117]48,
   [118]49). Previous studies have reported that polyphenols and alkaloids
   are multitarget natural products that may be used to exert
   neuroprotective effects via the modulation of JAK/STAT and IRS/PI3K
   signaling pathways ([119]50). However, only a few studies have
   investigated the possibility of using curcumin to target the JAK/STAT
   pathway as a means of regulating granulosa cells and follicle
   development. Therefore, further investigations into the role played by
   this pathway in the functioning of follicular granulosa cells appear to
   be warranted. Curcumin maybe could represent great therapeutic
   alternatives for patients who suffer from severe PCOS symptoms but
   remain skeptical about standard hormonal therapy.

   In conclusion, we studied the protective effects exerted by curcumin on
   DHT-induced primary granulosa cells using transcriptomic analysis. We
   utilized RNA sequencing to identify potentially relevant genes
   (CYP11A1, CYP19A1, StAR, AKR1C3, 3-β-HSD, and UGT2B4) as well as
   pathways of action involved in steroid hormone synthesis and granulosa
   cell functioning, such as the PPAR signaling pathway and the PI3K/AKT
   signaling pathway. These findings not only explain the effects exerted
   by high androgen DHT on the developmental function of primary granulosa
   cells, but also the mechanism possibly underlying it. Moreover, our
   findings may provide a theoretical basis for the process by which
   curcumin protects follicular granulosa cells and reveal possible
   pathways associated with such a process.

Funding Statement

   The author(s) declare financial support was received for the research,
   authorship, and/or publication of this article. This research was
   supported by the Public welfare research project of Jiaxing City
   (2024AD10048).

Data availability statement

   All relevant data is contained within the article: The
   original contributions presented in the study are included in
   the article material, further inquiries can be directed to the
   corresponding author.

Ethics statement

   All animal experiments were performed in accordance with the principles
   and guidelines of the Institutional Animal Care and approved by the
   Institutional Research Animal Committee of Jiaxing University.

Author contributions

   DC: Conceptualization, Writing – original draft. QY: Methodology,
   Writing – original draft. SS: Methodology, Writing – original draft.
   LC: Software, Writing – original draft. JZ: Formal analysis, Data
   curation, Writing – original draft. YZ: Funding acquisition, Resources,
   Writing – review & editing.

Conflict of interest

   The authors declare that the research was conducted in the absence of
   any commercial or financial relationships that could be construed as a
   potential conflict of interest.

Generative AI statement

   The author(s) declare that no Generative AI was used in the creation of
   this manuscript.

Publisher’s note

   All claims expressed in this article are solely those of the authors
   and do not necessarily represent those of their affiliated
   organizations, or those of the publisher, the editors and the
   reviewers. Any product that may be evaluated in this article, or claim
   that may be made by its manufacturer, is not guaranteed or endorsed by
   the publisher.

References