Abstract

Purpose

   Allergic rhinitis (AR), a chronic inflammatory disease of nasal mucosa,
   is considered as a classic Th2-mediated disease. We aimed to elucidate
   the molecular mechanisms and therapeutic potential of microRNAs
   (miRNAs) in AR.

Methods

   Nasal mucosa was collected from patients with mite-sensitized AR and
   non-allergic controls for miRNA and mRNA sequencing. miRNA expression
   was profiled. GO and KEGG enrichment analyses were conducted.
   Luciferase reporter assay was implemented to identify potential targets
   of candidate miRNAs. An AR cell model was established through
   lipopolysaccharide (LPS) exposure. miR-6089 was overexpressed or
   downregulated to characterize its roles in the proliferation and
   apoptosis of human nasal epithelial cells (HNEpC). The relationship
   between miR-6089 and toll-like receptor 4 (TLR4) was described. PCR and
   ELISA were applied to quantify the expression levels of miRNAs and
   mRNAs.

Results

   A total of 28 miRNAs and 172 mRNAs were identified to be differently
   expressed in the nasal mucosa of patients with AR compared to controls.
   The KEGG enrichment analysis showed that TLR signaling pathway, NF-κB
   signaling pathway, IL-17 signaling pathway and other pathways were
   significantly enriched in these differentially expressed RNAs. As shown
   by PCR results, the expression of miR-6089 decreased, and that of TLR4,
   IL-6, IL-8, and TSLP increased significantly in the nasal mucosa from
   patients with AR. Dual-luciferase reporter assay showed that miR-6089
   directly bound to TLR4. miR-6089 could increase the viability, inhibit
   apoptosis, and relieve inflammatory response in LPS-induced HNEpC.
   Furthermore, miR-6089 could regulate the expression of TLR4, IL-6,
   IL-8, and TSLP in the LPS-induced HNEpC.

Conclusion

   miR-6089 can alleviate LPS-induced inflammatory response via targeting
   TLR4 and may serve as a therapeutic target in the treatment of
   mite-sensitized AR.

   Keywords: allergic rhinitis, inflammation, lipopolysaccharides,
   microRNAs, miR-6089, toll-like receptor 4

Introduction

   Allergic rhinitis (AR) develops as allergens stimulate the interaction
   between Th2 cytokines and B cells, production of allergen-specific IgE,
   and inflammatory chain reaction.[42]^1 AR seriously affects the quality
   of life of patients and brings them with a great economic burden.[43]^2
   At present, AR is commonly treated with pharmacotherapy and
   immunotherapy. However, these treatments are challenged by long
   courses, weak effects and adverse events. Therefore, new targeted
   therapy has become a research hotspot in the treatment of AR.

   Many newly reported molecules act as drivers in AR.[44]^3 As
   representative recognition receptors, toll-like receptors (TLRs) are
   involved in either non-specific or specific immunity in the
   pathogenesis of allergic airway diseases.[45]^4 There are 10 types of
   TLRs in humans. Nuclear factor-κB (NF-κB) and interferon signals can be
   induced by TLR responses.[46]^4 TLR4 recognizes lipopolysaccharides
   (LPS) or bacterial endotoxins to mediate innate immunity and the
   release of inflammatory factors. TLR4 undertakes a critical role in the
   development of AR.[47]^5^,[48]^6 The expression level of TLR4 increases
   in the nasal mucosal epithelial cells of patients with AR, but this
   increase is not observed in all patients.[49]^7–9 Bergougnan et
   al[50]^9 have reported that TLR4 expression decreases significantly in
   seasonal AR patients. We have found that the expression levels of TLR4,
   IL-6 and IL-8 are significantly higher in patients with persistent AR
   compared to control subjects, and TLR4 is mainly localized in nasal
   epithelium, subepithelial glands and capillary endothelial cells, and
   immune cells.[51]^7 Allergens increase reactive oxygen species (ROS)
   levels in airway epithelial cells to cause airway inflammation. The ROS
   production induced by house dust mites (HDM) requires the signaling of
   LPS/TLR4, and overproduced ROS upregulates TLR4 surface expression and
   lipid raft transport to epithelial cells in the allergic airway.[52]^10
   These data support that TLR4 may regulate HDM-induced oxidative stress
   response to activate innate immunity and type 2 inflammation in AR.

   Growing evidence implies that microRNAs (miRNAs) are powerful
   regulators in AR.[53]^11^,[54]^12 Therefore, we investigated the
   effects of certain miRNAs on TLR4-mediated inflammatory responses in
   AR. miRNAs, a group of short non-coding RNAs with a length of 20–24
   nucleotides, can regulate the stability and/or translation of mRNAs at
   the post-transcriptional level. In this light, miRNAs have been widely
   exploited for the treatment of many diseases.[55]^13^,[56]^14 We have
   found a set of differentially expressed (DE) miRNAs in AR nasal
   mucosa.[57]^11 Previous research has shown that exosome-encapsulated
   miR-6089 can target TLR4-mediated inflammatory response to regulate
   LPS-induced cell proliferation in rheumatoid arthritis.[58]^15
   Therefore, we infer that miR-6089 may rely on the TLR4 signal pathway
   to modulate type 2 inflammation.

   In this study, we profiled the expression patterns of miRNAs and mRNAs
   in the nasal mucosa of patients with mite-sensitized AR by
   high-throughput sequencing analysis, and screened aberrantly expressed
   miRNAs that might regulate TLR signaling. LPS causes pathological
   changes associated with allergic airway diseases, such as eosinophil
   recruitment, subepithelial fibrosis, mucus cell metaplasia, and smooth
   muscle hypertrophy. Given that LPS has been widely accepted in the
   creation of AR models[59]^16^,[60]^17 and has the ability to activate
   the TLR4 receptor, we stimulated nasal epithelial cells with LPS in
   order to construct our AR model. This study aimed to elucidate the role
   of miR-6089, a DEmiRNA, in TLR4-mediated inflammation in AR. The
   findings may provide promising therapeutic targets for the treatment of
   AR, a common allergic disease.

Methods

Study Subjects

   Patients with AR (n = 10) and non-allergic controls (n = 10) were
   recruited between August 2019 and January 2020. AR was diagnosed
   according to the clinical guidelines.[61]^1 The nasal mucosa tissues
   were collected during endoscopic septoplasty. Serum total IgE and
   allergen-specific IgE were measured by the Automated Immuno-Strip
   Analysis System (LG Life Sciences Ltd., Korea) in all the subjects.
   Patients with AR enrolled were sensitized mainly by HDM ([62]Table
   1).[63]^11 The non-allergic controls had negative IgE test results. All
   subjects had treatment with glucocorticoids, antihistamines,
   antileukotrienes, and other immunomodulating drugs in the 4 weeks prior
   to surgery, as well as those with an immune deficiency, upper
   respiratory tract infection, chronic rhinosinusitis, nasal polyps,
   sinonasal neoplasms, a history of nasal and sinus surgery or allergen
   immunotherapy were excluded. Our study was approved by the Ethics
   Committee of the First Affiliated Hospital of Nanjing Medical
   University (2019-SR-023). All participants provided written informed
   consent before all experiments.

Table 1.

   Clinical Characteristics of Patients with AR and Control Subjects
                              AR (n=10)        Control (n=10)    p-value^c
   Age (years)^a          32.50 (22.00–43.5) 26.50 (21.00–37.50) > 0.05
   Gender (male/female)   6/4                7/3                 > 0.05
   Total IgE (IU/mL)      > 100              ≤ 100               < 0.0001
   Specific IgE (kU[A]/L)
    Df^b                  3.14 ± 0.76        0                   0.0006
    Dp^b                  6.58 ± 2.15        0                   0.0066
   Co-sensitization       2                  0
   Asthma co-morbidity    No                 No
   [64]Open in a new tab

   Notes: ^aMedian (interquartile range); ^bmean ± standard deviation
   (SD); ^cAR vs control.

   Abbreviations: AR, allergic rhinitis; IgE, immunoglobulin E; Df,
   Dermatophagoides farinae; Dp, Dermatophagoides pteronyssinus.

RNA Sequencing

   Total RNA was extracted from nasal mucosa samples, collected from three
   patients with AR and three controls, using TRIzol reagent (Life
   Technologies, California, United States). The quantity and quality of
   the extracted RNA were assessed with a NanoDrop ND-1000 (Delaware,
   United States). Raw miRNA reads were acquired through the Illumina
   HiSeq 2500 platform (California, United States). Following the removal
   of splice sequences, small RNA sequences of different lengths were
   obtained. Clean reads were then aligned and annotated against the Rfam,
   cDNA, species repeat sequence, and miRBase databases. This process
   aimed to eliminate as many small RNAs like tRNA, snRNA, and rRNA as
   possible. The remaining sequences were matched against the miRBase
   database to conduct statistics on known miRNAs. Additionally, the
   miRDeep2 software was utilized for novel miRNA prediction using the
   unannotated sequences. Based on the identified known miRNAs and the
   newly predicted miRNAs, the expression level of each miRNA was computed
   using the transcripts per million (TPM) metric. The TPM calculation
   formula is: TPM = (N/M) × 10^6, where N represents the number of reads
   aligned to each miRNA, and M denotes the total number of reads in the
   sample.

   The transcriptome sequencing was performed by Illumina (California,
   United States). The raw data underwent preprocessing with Trimmomatic
   software, and a statistical summary of the number of reads was
   maintained throughout the quality control process. Clean reads were
   then sequentially aligned with the designated reference genome using
   hisat2, revealing their location on the reference genome or gene, along
   with the sequenced sample’s distinct sequence features. By referencing
   known gene sequences and annotation files, the expression abundance of
   each protein-coding gene in each sample was determined through sequence
   similarity comparison. Htseq-count software tallied the number of reads
   linked to protein-coding genes in each sample, while cufflinks software
   computed the FPKM expression of these genes. The FPKM calculation
   formula is: FPKM (A) = N/(M×K) × 10^9, where N signifies the number of
   fragments mapped to gene A, M denotes the total fragments mapped to all
   genes, and K represents the length of gene A. The high-throughput
   sequencing and analysis were conducted by Shanghai OE Biotech Co., Ltd
   (Shanghai, China).

Quantitative Real-Time PCR (qRT-PCR)

   Total RNAs were isolated from nasal mucosa tissues (collected from 10
   patients with AR and 10 controls) or human nasal epithelial cells
   (HNEpC) using TRIzol reagent (Invitrogen, California, United States)
   following the manufacturer’s protocol. Reverse transcription was
   performed using miRNA specific stemloop primers and mRNA primers
   (Tsingke Biotechnology Co., Ltd, Beijing, China). The qRT-PCR was
   carried out using SYBR Green Master Mixture (Vazyme Biotech Co., Ltd,
   Nanjing, China) reagent. U6 and GAPDH were used as internal controls.
   The primer sequences were shown as follows: U6: forward:
   CGCTTCGGCAGCACATATAC, reverse: AAATATGGAACGCTTCACGA; GAPDH: forward:
   CACCCACTCCTCCACCTTTG, reverse: CCACCACCCTGTTGCTGTAG; miR-6089: forward:
   CGCACTGGATACGACCCGCCCCG, reverse: TGCGCGGAGGCCGGGGTGGGGCG; TLR4:
   forward: TGAGCAGTCGTGCTGGTATC, reverse: CAGGGCTTTTCTGAGTCGTC; IL-6:
   forward: AGGAGACTTGCCTGGTGAAA, reverse: CAGGGGTGGTTATTGCATCT; IL-8:
   forward: GACATACTCCAAACCTTTCCACCCC, reverse: CAAAAACTTCTCCACAACCCTCTGC;
   TSLP: forward: TGGGACCAAAAGTACCGAGT, reverse: TGGGCACCAGATAGCTAAGG. The
   relative expression of miR-6089 and TLR4, IL-6, IL-8, and TSLP mRNA was
   shown as the fold change in relative to U6 and GAPDH.

Cell Culture and Transfection

   HNEpC cells were obtained from Shanghai Yingwan Biological Technology
   Co., Ltd (Shanghai, China) and cultured in RPMI 1640 medium
   supplemented with 10% fetal bovine serum (ExCell Bio., Suzhou, China)
   and 1% pen-strep at 37°C in a humidified atmosphere with 5% CO[2]. The
   miR-6089 mimics, mimics negative control (mimics NC), miR-6089
   inhibitors, and inhibitors NC were bought from Han Heng Biotechnology
   Co., Ltd (Shanghai, China). The transfection was performed by cationic
   liposome method in accordance with the specification of Lipofectamine
   2000 (Invitrogen, California, United States). After 5h, the medium
   containing lipofectamine 2000 was sucked out and replaced with normal
   medium and cultured at 37°C in 5% CO[2] incubator for 24h. The
   transfection efficiency of mimic and inhibitor labeled by FAM was
   observed under inverted fluorescence microscope.

MTT Assay

   MTT assay (MedChemexpress, New Jersey, United States) was used to
   detect cell activity. After the cells were cultured for indicated time,
   10 μL of MTT was added to each well, and cultured at 37°C for 4 h.
   Then, the medium was aspirated, and 150 μL of DMSO was added and shaken
   for 10 min. The absorbance at OD568 was measured with a microplate
   reader (BioTek Instruments, Inc., Vermont, United States).

Apoptosis Assay

   HNEpC cells, stimulated by LPS and transfected with miR-6089 mimic or
   inhibitor, stained with Annexin V-fluorescein isothio-cyanate/propidium
   iodide (KeyGen Biotech Co., Ltd, Nanjing, China) for 15 min at room
   temperature in the dark (negative control was also set). Cell apoptosis
   was then detected using a flow cytometry at 488 nm.

Detection of Oxidative Stress Indexes

   The supernatant was obtained from LPS-induced HNEpC transfected with
   miR-6089 mimics or inhibitors. The levels of malondialdehyde (MDA), ROS
   and glutathione (GSH) in each supernatant sample were determined using
   detection kits provided by Nanjing Jiancheng Bioengineering Institute
   (Nanjing, China).

Dual-Luciferase Reporter Assay

   The targeting binding of miR-6089 and TLR4 were predicted by TargetScan
   V7.2. The predicted and mutated sequences targeting the 3’UTR of TLR4
   were amplified and cloned into the luciferase vector pmirGLO (YouBio
   Co., Ltd, Changsha, China). pmirGLO-TLR4-3’UTR wild-type (Wt) and
   pmirGLO-TLR4-3’UTR mutated (Mut) were synthesized for the luciferase
   reporter assay. HNEpC cells were co-transfected with the luciferase
   reporter vectors and miR-6089 mimics or corresponding negative control,
   using Lipofectamine 2000 reagent. After 24 h of incubation, luciferase
   activity was analyzed using the Dual-Luciferase Reporter Assay System
   (Promega E1910, Madison, Wisconsin, United States) according to the
   manufacturer’s protocol. In TLR4 3’UTR mutation analysis, the focus was
   on the 6-nucleotide (6-nt) target site, which was the sequence CCGGAG,
   and its complementary strand GGCCTC.

Enzyme-Linked Immunosorbent Assay

   ELISA kits for the detection of IL-6, IL-8, and TSLP protein levels
   were obtained from Elabscience Biotechnology Co., Ltd (Wuhan, China).
   The levels of IL-6, IL-8, and TSLP in the culture supernatant of cells
   were analyzed with ELISA kits according to the manufacturer’s
   instructions. Each experiment was independently triplicated.

Statistical Analysis

   Data were presented as mean ± SEM. Statistical analysis was performed
   on SPSS 21.0 software (IBM SPSS Inc., Chicago, Illinois, United
   States). Between-group differences were analyzed using Student’s
   t-tests. Significance levels were denoted as *p < 0.05, **p < 0.01,
   ***p < 0.001.

Results

miRNA and mRNA Expression Profiles in Nasal Mucosa from AR Patients

   The expression patterns of miRNAs and mRNAs in the nasal mucosa of
   patients with AR were profiled by RNA sequencing analysis. A total of
   1,784 miRNAs and 2,030 mRNAs were screened in nasal mucosa from three
   patients with AR and compared with those from three non-allergic
   controls. Box-whisker plots were generated to visualize whether the
   symmetry of miRNA data, as well as the degree of dispersion in the
   distribution ([65]Figure 1A). The density distribution of TPM reflected
   the miRNA expression pattern in each sample ([66]Figure 1B). The
   overall distribution of DE miRNAs was shown by a volcano map
   ([67]Figure 1C). A total of 13 DEmiRNAs were upregulated, 15 DEmiRNAs
   downregulated, 93 DEmRNAs upregulated, and 79 DEmRNAs downregulated
   ([68]Figure 1D).

Figure 1.

   [69]Figure 1
   [70]Open in a new tab

   miRNA expression profiling in the nasal mucosa from patients with AR.
   (A) Box whisker plot for the degree of dispersion in the distribution.
   (B) The density distribution of TPM reflected the miRNA expression
   patterns in each sample. (C) The volcano map for the overall
   distribution of DEmiRNAs. (D) The distribution of DEmiRNAs and DEmRNAs
   by RNA sequencing (> 1.5-fold change, p < 0.05). n = 3 each group.

   Abbreviations: AR, allergic rhinitis; DE, differentially expressed;
   miRNAs, microRNAs; TPM, transcripts per million.

Enrichment Analysis

   To identify the functions of DEmiRNAs and mRNAs, 172 DEmRNAs were
   subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and
   Genomes (KEGG) analyses. The top 30 GO terms related to Biological
   Processes (BPs), Molecular Functions (MFs), and Cellular Components
   (CCs) were screened at p < 0.05 ([71]Figure 2A). BP terms were enriched
   in immune response and immune cell activity; MF terms in molecular
   binding, cytokine activity; CC terms in secretory granule and multiple
   extracellular components. KEGG pathway enrichment analysis showed the
   top 20 pathways enriched in toll-like receptor signaling pathway, NF-κB
   signaling pathway, IL-17 signaling pathway and other pathways
   ([72]Figure 2B).

Figure 2.

   [73]Figure 2
   [74]Open in a new tab

   GO functional annotation and KEGG pathway enrichment analyses for
   DEmRNAs. (A) Top 30 GO items enriched in all DEmRNAs. (B) Top 20 KEGG
   pathways enriched in DEmRNAs screened by mRNA sequencing (> 1.5-fold
   change, p < 0.05).

   Abbreviations: DE, differentially expressed; GO, Gene Ontology; KEGG,
   Kyoto Encyclopedia of Genes and Genomes.

Expression of miR-6089, TLR4 and Its Downstream Pathway in AR

   Our previous studies have found that TLR4 acts on the pathogenesis of
   AR through the NF-κB pathway. Our sequencing data indicated that the
   content of miR-6089 was reduced in AR ([75]Figure 3A), and
   bioinformatics analysis showed that miR-6089 could target TLR4. qRT-PCR
   revealed that the expression of miR-6089 was downregulated ([76]Figure
   3B), and TLR4 and its downstream effectors (IL-6, IL-8, and TSLP) were
   upregulated in AR ([77]Figure 3C–F).

Figure 3.

   [78]Figure 3
   [79]Open in a new tab

   Validation of miRNAs and mRNAs in patients with AR (n=10) versus
   controls (n=10). (A) Sequencing data revealed that the expression of
   miR-6089 was downregulated. (B) The expression level of miR-6089 was
   decreased by qRT-PCR. (C–F) The expression levels of TLR4 (C), IL-6
   (D), IL-8 (E), and TSLP (F) were increased by qRT-PCR. n = 10 each
   group. *p < 0.05, **p < 0.01, ***p < 0.001.

   Abbreviations: AR, allergic rhinitis; Ctr, control; IL, interleukin;
   miRNAs, microRNAs; qRT-PCR, quantitative real-time polymerase chain
   reaction; TLR, toll-like receptor; TSLP, thymic stromal lymphopoietin.

Inhibition of miR-6089 on LPS-Induced Apoptosis and Inflammation

   To further investigate the role of miR-6089 in AR, HNEpC cells were
   treated with 1 µg/mL LPS and transfected with miR-6089
   mimics/inhibitors or miR-6089-NC. Under an inverted fluorescence
   microscope, the transfection efficiencies of FAM-miR-6089 mimic-NC,
   miR-6089 mimic, miR-6089 inhibitor-NC, and miR-6089 inhibitor were
   observed to be remarkably high, with rates of 82.84%, 85.19%, 86.46%,
   and 83.84%, respectively ([80]Figure 4A–D). Compared with the control
   group, the HNEpC in the LPS group showed evident inflammatory changes.
   The results showed that transfection with miR-6089 mimics inhibited the
   apoptosis and increased the activity of HNEpC after LPS treatment, and
   miR-6089 inhibitors weaken this effect ([81]Figure 4E–L). miR-6089
   mimics downregulated the expression of ROS and MDA, upregulated that of
   GSH, whereas miR-6089 inhibitors reversed these effects ([82]Figure
   5A–C).

Figure 4.

   [83]Figure 4
   [84]Open in a new tab

   miR-6089 suppressed the apoptosis and promoted the growth of
   LPS-treated HNEpC. HNEpC cells were treated with LPS (1 µg/mL) for
   24 h, and then transfected with miR-6089 mimics/inhibitors or
   miR-6089-NC for 24 h. The cells and cell supernatants were used for
   further analysis. The transfection efficiencies of FAM-miR-6089
   mimic-NC, miR-6089 mimic, miR-6089 inhibitor-NC, and miR-6089 inhibitor
   were observed to be remarkably high, with rates of 82.84%, 85.19%,
   86.46%, and 83.84%, respectively (A–D). Compared to Ctr (E),
   stimulation with LPS (F) and LPS + mimics-NC (G) and inhibitors-NC (I)
   promoted cell apoptosis significantly (K). Transfection with miR-6089
   mimics inhibited cell apoptosis significantly (H, K). Transfection with
   miR-6089 inhibitors promoted cell apoptosis significantly (J, K). MTT
   assay demonstrated that the proliferation of cells was promoted
   following transfection with miR-6089 mimics, and inhibited following
   transfection with miR-6089 inhibitors (L). n = 3 each group. *p < 0.05,
   **p < 0.01, ***p < 0.001.

   Abbreviations: Ctr, control; HNEpC, human nasal epithelial cells; LPS,
   lipopolysaccharide; miR, microRNA; NC, negative control.

Figure 5.

   [85]Figure 5
   [86]Open in a new tab

   miR-6089 inhibited oxidative stress in LPS-treated HNEpC. ROS, MAD and
   GSH levels in HNEpC were detected using the kit. (A) The levels of ROS
   in LPS-treated HNEpC cells treated with miR-6089 mimics/inhibitors. (B
   and C) The expression levels of MDA and GSH in LPS-treated HNEpC cells
   treated with miR-6089 mimics/inhibitors. n = 3 each group. *p < 0.05,
   **p < 0.01, ***p< 0.001.

   Abbreviations: Ctr, control; GSH, glutathione; HNEpC, human nasal
   epithelial cells; LPS, lipopolysaccharide; MDA, malondialdehyde; miR,
   microRNA; NC, negative control; ROS, reactive oxygen species.

Effect of miR-6089 on AR Inflammation by Targeting TLR4 Signal Pathway

   The binding site of miR-6089 with TLR4 in human predicted by TargetScan
   is shown in [87]Figure 6A. To verify whether miR-6089 directly binds to
   TLR4, a dual luciferase reporter assay was performed. It was observed
   that miR-6089 overexpression decreased the relative luciferase activity
   in the presence of the Wt 3’UTR. Similarly, no significant change in
   luciferase activity was observed when the targeted sequence of TLR4 was
   mutated in the miR-6089-binding site ([88]Figure 6B). We further
   confirmed that TLR4 was negatively regulated by miR-6089, using an AR
   cell model. LPS treatment decreased the level of miR-6089 and increased
   the levels of TLR4 and its downstream signaling effectors (IL-6, IL-8,
   and TSLP); however, this effect was reversed by transfection with
   miR-6089 mimics. In contrast, miR-6089 inhibitors enhanced the effect
   of LPS in decreasing the levels of miR-6089 and increasing the levels
   TLR4 and its downstream effectors, suggesting that miR-6089 also
   negatively regulated the expression of TLR4 in LPS-induced HNEpC
   ([89]Figure 6C–G). Given that TLR4 signaling is associated with
   inflammation in AR, miR-6089 might protect against LPS-induced
   inflammation by targeting TLR4.

Figure 6.

   [90]Figure 6
   [91]Open in a new tab

   miR-6089 inhibited AR inflammation by targeting the TLR4 signal
   pathway. (A) The binding site of miR-6089 with TLR4 in human predicted
   by TargetScan. (B) Luciferase assay of HNEpC co-transfected with
   firefly luciferase constructs containing TLR4 wild-type (Wt) or mutated
   (Mut) 3’UTRs, miR-6089 mimics, and mimics NC. qRT-PCR to detect the
   expression of miR-6089 (C) and mRNA expression of TLR4 (D). ELISA to
   detect the protein expression of IL-6 (E), IL-8 (F), and TSLP (G). n =
   3 each group. **p < 0.01, ***p < 0.001.

   Abbreviations: AR, allergic rhinitis; Ctr, control; HNEpC, human nasal
   epithelial cells; IL, interleukin; LPS, lipopolysaccharide; miR,
   microRNA; NC, negative control; qRT-PCR, quantitative real-time
   polymerase chain reaction; TLR, toll-like receptor; TSLP, thymic
   stromal lymphopoietin; UTR, untranslated region.

Discussion

   Over the past decades, the efficacy of many natural or synthetic TLR4
   inhibitors for inflammatory diseases has been evaluated in clinical
   trials.[92]^18–21 For example, TAK-242, a TLR4 antagonist, ameliorates
   combined AR and asthma syndrome by reducing inflammatory monocyte
   infiltration in a mouse model.[93]^22 Dong et al[94]^23 have found that
   luteolin ameliorates inflammation and reconstructs Th1/Th2 balance via
   regulating the TLR4/NF-κB pathway in AR rats. LPS, a key ligand for
   TLR4, initiates a signaling cascade upon binding to TLR4. This
   interaction activates the MyD88/NF-κB pathway, which in turn triggers
   the transcription of genes crucial for immune-inflammatory responses.
   Once activated, this pathway sets off a cascade of pro-inflammatory
   cytokine production, specifically including IL-6, IL-8, and
   TSLP.[95]^24^,[96]^25 Furthermore, the generation of ROS is contingent
   upon the presence of a functional TLR4, highlighting the intricate
   interplay between TLR4 signaling and ROS in modulating inflammatory
   pathways. Therefore, new specific and targeted treatments are still
   needed for the treatment of AR.

   Increasing evidence has indicated the implication of miRNAs in the
   pathogenesis of AR.[97]^11^,[98]^26^,[99]^27 Jia et al[100]^28 have
   uncovered that miR-126 drives AR by regulating the expression of
   regulatory T cells (Treg), Th1 and Th2 cytokines. Chen et al[101]^29
   have found that miR-466a-3p negatively regulates GATA-3 expression, and
   that intra-articular injection of lentiviral miR-466a-3p can turn the
   condition of AR mice similar to that of normal mice. In this study, we
   uncovered that miR-6089 suppressed the inflammatory response and
   apoptosis through an inhibition of TLR4 activation, highlighting the
   possibility of using miR-6089 to counter TLR4 synthesis and AR.
   Previous studies have shown that miR-6089 can inhibit the proliferation
   and induce the apoptosis of fibroblast-like synoviocytes by targeting
   CCR4,[102]^30 and regulate the generation of IL-6, IL-29, and TNF-α by
   targeting the TLR4/NF-κB pathway in rheumatoid arthritis.[103]^15

   In the present study, we first found that miR-6089 was significantly
   downregulated in the nasal mucosa tissues from patients with AR induced
   by HDM, suggesting that miR-6089 may be involved in the pathogenesis of
   AR. Second, miR-6089 overexpression protected against AR through
   increasing cell activity and suppressing oxidative stress response in
   LPS-induced HNEpC. Finally, miR-6089 could negatively regulate the TLR4
   pathway in the LPS-induced HNEpC. miR-6089 could regulate the
   expression of TLR4, providing preliminary evidence that miR-6089
   influences the occurrence and development of AR through modulating the
   TLR4-ROS pathway. TLR4 plays an active role in the arousal of
   inflammation and the release of inflammatory cytokine (such as TSLP,
   IL-6 and IL-8).[104]^31^,[105]^32 Some studies have demonstrated that
   miR-182-5p, miR-224-5p and miR-345-5p alleviate nasal symptoms and type
   2 inflammation in AR mice by regulating the TLR4/NF-κB
   pathway.[106]^33–35 Xu et al[107]^15 have reported that the miR-6089
   poses a protective effect by directly targeting TLR4 in an LPS-induced
   rheumatoid arthritis model. To the best of our knowledge, no other data
   have been released to characterize the roles of miR-6089 in the
   inflammatory responses associated with AR. Unprecedentedly, our results
   demonstrated that miR-6089 counteracts AR-related inflammation via
   targeting the TLR4 pathway, suggesting that the miR-6089/TLR4 axis may
   represent a novel and promising target for the treatment of AR.

   There are some limitations in the present study. First, we did not
   conduct an animal model experiment to validate the therapeutic efficacy
   of miR-6089 on AR. The second aspect is that we did not investigate the
   downstream regulatory pathway of TLR4. The ongoing implementation of
   these studies will be necessary in the future.

Conclusions

   miR-6089 plays an important role in AR pathogenesis. It can evoke the
   anti-inflammatory cascade by damping the expression of TLR4 and
   proinflammatory cytokines, as well as LPS-mediated HNEpC cell apoptosis
   and oxidative stress response. However, more studies, particularly in
   vivo studies on TLR4 and its downstream effectors, are required to
   warrant the underlying molecular mechanisms of miR-6089 in pathogenesis
   and progression of mite-sensitized AR. These molecules may serve as
   novel therapeutic biomarkers for AR.

Acknowledgments