Abstract

   Melanoma is among the 10 most prevalent malignant tumors, posing a
   significant threat to human health. A detailed understanding of the
   molecular mechanisms driving its progression is crucial for advancing
   treatment strategies and outcomes. Based on bioinformatic analysis and
   experimental validation, this study identified mitochondrial carrier
   homolog 2 (MTCH2) as a key regulator of melanoma proliferation.
   Mechanistically, MTCH2 enhanced the expression and nuclear
   translocation of nuclear factor (erythroid-derived-2)-like 2 (NRF2),
   which up-regulated ribonucleotide reductase subunit M1 (RRM1)
   expression, thereby promoting melanoma cell proliferation. Targeting
   RRM1 in combination with dacarbazine significantly inhibited tumor
   growth in nude mouse xenograft models. These findings elucidate a
   mechanistic link between MTCH2 and the NRF2-RRM1 axis in melanoma
   proliferation and highlight potential therapeutic targets for
   intervention.

   Subject terms: Melanoma, Cancer therapeutic resistance

Introduction

   Melanoma exhibits a high metastatic potential, a high mortality rate,
   and resistance to radiotherapy and chemotherapy [[48]1]. Given these
   clinical challenges, elucidating the molecular mechanisms that drive
   melanoma progression is crucial for improving clinical efficacy. To
   sustain its rapid proliferation, melanoma cells maintain an expanded
   nucleotide pool by enhancing nucleotide biosynthesis while suppressing
   nucleotide degradation [[49]2]. Ribonucleotide reductase subunit M1
   (RRM1) is a key enzyme responsible for converting ribonucleotide
   diphosphate to deoxyribonucleotide diphosphate, a crucial step in DNA
   synthesis [[50]3, [51]4]. In gastric cancer, RRM1 overexpression is
   associated with poor prognosis in advanced-stage patients [[52]5],
   whereas in thyroid cancer, RRM1 promotes DNA synthesis and tumor cell
   proliferation, migration, and invasion [[53]6]. To date, however, its
   role in melanoma has yet to be elucidated.

   Dacarbazine, a first-line chemotherapeutic agent for melanoma, exerts
   cytotoxic effects by inducing DNA damage during replication [[54]7].
   Drug resistance, particularly to dacarbazine, is a major contributor to
   the low cure rates in melanoma. Studies have indicated that melanoma
   cells exhibit reduced sensitivity to dacarbazine in the presence of
   deoxyribonucleotides [[55]8], suggesting a link between drug
   sensitivity and DNA metabolism. Understanding the regulatory mechanisms
   governing nucleotide synthesis may therefore provide insights into
   therapeutic vulnerabilities in melanoma.

   Nuclear factor (erythroid-derived-2)-like 2 (NRF2) plays a central role
   in cellular redox homeostasis and transcriptional regulation. Under
   physiological conditions, NRF2 is primarily localized in cytoplasm, but
   translocates to the nucleus upon activation, where it regulates gene
   expression [[56]9]. Our previous research demonstrated that NRF2
   promotes melanoma progression by targeting phosphoribosyl pyrophosphate
   synthase 1, an enzyme that catalyzes the conversion of
   ribose-5-phosphate to 5-phosphoribosyl-1-phosphate, a key rate-limiting
   step in purine nucleotide biosynthesis [[57]10]. NRF2 has also been
   implicated in nucleotide metabolism and cancer recurrence [[58]11]. In
   head and neck squamous cell carcinoma, NRF2 enhances nucleotide
   biogenesis by up-regulating glucose-6-phosphate dehydrogenase and
   transketolase, thereby facilitating malignant progression [[59]12].
   However, the role of NRF2 in regulating RRM1 expression in melanoma
   remains unexplored.

   Mitochondrial carrier homolog 2 (MTCH2), an outer mitochondrial
   membrane protein, is involved in apoptotic regulation [[60]13]. MTCH2
   deficiency has been shown to disrupt mitochondrial structure and
   function, leading to fragmentation and elevated oxidative stress
   [[61]14, [62]15]. Abnormal MTCH2 expression has also been linked to
   tumorigenesis. In malignant gliomas, MTCH2 knockdown weakens tumor
   invasiveness and increases sensitivity to temozolomide [[63]16]. In
   breast cancer, MTCH2 promotes proliferation and cell cycle progression
   via the PI3K/Akt pathway [[64]17]. Furthermore, apolipoprotein C1
   (APOC1) has been shown to drive osteosarcoma progression through
   MTCH2-dependent mechanisms [[65]18]. However, the role of MTCH2 in
   melanoma remains undefined.

   Based on this background, we hypothesized the following: (1) MTCH2
   regulates NRF2 expression, while NRF2 transcriptionally activates RRM1
   to promote melanoma proliferation; and (2) elevated RRM1 expression
   reduces melanoma sensitivity to dacarbazine. This study aimed to
   elucidate the molecular mechanisms underlying melanoma progression and
   provide a theoretical foundation for the development of novel
   therapeutic strategies.

Materials and methods

Drugs

   ML385 (HY-100523, Med Chem Express), sulforaphane (HY-13755, Med Chem
   Express), and dacarbazine (HY-B0078, Med Chem Express) were dissolved
   in dimethylsulfoxide (DMSO, D8371, Solarbio Life Sciences) at a
   concentration of 10 mM.

Cell culture

   Melanoma cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)
   (with L-glutamine) supplemented with 10% fetal bovine serum (FBS) and
   1% penicillin/streptomycin. Cells were maintained in a 37 °C incubator
   with 5% CO[2], with passaging every 2 days. The melanoma cells were
   purchased from the Cell Bank of the Chinese Academy of Sciences.

Cell transfection

   A375 and SK-MEL-21 cells were transfected with overexpression or
   knockdown vectors, with CON335 and CON313 serving as corresponding
   controls. In brief, when cell density reached 60% confluency in a
   6-well plate, the corresponding viral constructs were introduced. After
   48 h, transfected cells were selected using 5 μg/mL puromycin, ensuring
   the elimination of non-transfected populations. Selection was
   maintained through serial passaging with continued puromycin exposure
   until over 95% of cells exhibited green fluorescent protein (GFP)
   fluorescence under a microscope. Successful transfection was confirmed
   by western blotting and quantitative polymerase chain reaction (qPCR).

RNA preparation and quantitative real-time PCR

   Cells were harvested and lysed in 1 mL of TRIzol reagent, followed by
   thorough mixing. After incubation on ice for 5 min, 200 µL of
   chloroform was added and briefly mixed. Phase separation was achieved
   by centrifugation at 4 °C for 10 min, with the resulting supernatant
   mixed with an equal volume of isopropanol. Following centrifugation at
   4 °C for an additional 10 min, the supernatant was discarded, and the
   RNA pellet was resuspended in DEPC-treated water. The extracted RNA was
   stored at −20 °C until further use. cDNA synthesis was performed using
   a reverse transcription kit (K1622, Thermo Fisher Scientific). Gene
   expression levels were quantified via qPCR using SYBR Green (Roche AG,
   Switzerland). The primer pairs used for amplifying target genes are
   shown in Table [66]1.

Table 1.

   Primer sequences used for qPCR.
   Gene              Primer
   MTCH2 F: 5′-3′: GGTCTTGTTCCTCGCCTTCT
         R: 5′-3′: TGGTAGAAACCCCACTGTCC
   RRM1  F:5′-3′: CGCCTGTCAGTCTGTGAGGC
         R:5′-3′: CCGTGACGCACAAAGGGGC
   U6    F:5′-3′: CTCGCTTCGGCAGCACA
         R:5′-3′: AACGCTTCACGAATTTGCGT
   [67]Open in a new tab

Cell proliferation assay

   Cell proliferation was assessed using an MTS assay. Cells were seeded
   in a 96-well plate at a density of approximately 5000 cells per well.
   After incubation, proliferation was measured using an MTS assay kit
   (PF0004, Proteintech). Absorbance was recorded at 490 nm using an
   enzyme linked immunosorbent assay (ELISA) reader (51119200, Thermo
   Fisher Scientific).

EdU assay

   To evaluate DNA synthesis and cell proliferation, the EdU assay was
   performed. In brief, cells were seeded overnight and subsequently
   incubated with 1× EdU working solution for 2 h. Cells were then fixed
   with 4% paraformaldehyde at room temperature for 10 min, followed by
   permeabilization with 0.1% Triton X-100. EdU incorporation was detected
   using the Click-iT reaction system, with each well incubated with
   100 µL of Click reaction solution for 30 min in the dark. Fluorescence
   imaging was performed using a Leica DM4B fluorescence microscope (×200
   magnification). The assay was conducted using the BeyClick EdU reagent
   kit (#C0075S, Beyotime).

Western blot analysis

   Cells were harvested and lysed on ice for 30 min in RIPA lysis buffer
   (R0020, Solarbio Life Sciences). Lysates were centrifuged at 4 °C for
   10 min, and protein concentrations were quantified using the BCA^TM
   protein detection kit (P1511, Applegen). Equal amounts of protein were
   separated by 8–15% sodium dodecyl-sulfate polyacrylamide gel
   electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride
   (PVDF) membranes (IPVH00010, Millipore). Subsequently, the membranes
   were blocked with 5% skim milk at room temperature for 2 h before
   incubation with primary antibodies overnight at 4 °C. After washing,
   the membranes were incubated with secondary antibodies at room
   temperature for 2 h. The chemiluminescence signal was amplified using
   an enhanced chemiluminescence (ECL) kit (K-12045-D50, Advansia), and
   high-quality images were obtained using the Bio Rad ChemiDoc XRS system
   (BioRad). β-actin was used as a reference control. All experiments were
   repeated at least three times. The primary antibodies used included
   anti-β-actin (66009-1-Ig, Proteintech), anti-MTCH2 (16888-1-AP,
   Proteintech), anti-RRM1 (10526-1-AP, Proteintech), anti-CDK2
   (10122-1-AP, Proteintech), anti-cyclin E1 (115544-1-AP, Proteintech),
   and anti-NRF2 (16396-1-AP, Proteintech).

Immunofluorescence

   Cells were seeded onto glass coverslips and fixed with paraformaldehyde
   for 10 min. Following three phosphate-buffered saline (PBS) washes, the
   cells were incubated with 1% sodium citrate for 10 min and washed again
   with PBS three times. Permeabilization was performed using 0.1% Triton
   X-100 (T-8200, Solarbio Life Sciences, Beijing, China) for 10 min,
   followed by three additional PBS washes. Cells were then blocked with
   5% goat serum at room temperature for 2 h before incubation with
   primary antibodies overnight at 4 °C. After three washes with PBST, the
   slides were incubated with secondary antibodies at 37 °C for 2 h.
   Nuclear staining was performed using 4′,6-diamidino-2-phenylindole
   (DAPI). The primary antibodies used included anti-RRM1 (10526-1-AP,
   Proteintech) and anti-NRF2 (16396-1-AP, Proteintech), while secondary
   antibodies included Alexa Fluor™ 647 and Alexa Fluor™ 488.

Melanoma xenograft model

   To establish a melanoma xenograft model, 40 male BALB/c nude mice (6 to
   8 weeks old) were obtained from the Department of Experimental Animals,
   Kunming Medical University (China). The mice were housed in a
   temperature- and humidity-controlled room under a 12-h light/dark
   cycle, with free access to food and water. Each mouse was
   subcutaneously injected with 100 µL of PBS containing 1 × 10^7 melanoma
   cells into one side of the armpit. Tumors were collected 20 days
   post-inoculation. For chemotherapy experiments, mice were randomly
   assigned to four groups. The control group received intraperitoneal
   injections of physiological saline, while the experimental group
   received intraperitoneal injections of 20 mg/kg dacarbazine. Tumor
   volume was measured every two days using a vernier caliper, and samples
   were harvested after 20 days. All animal experiments were approved by
   the Institutional Animal Care and Use Commission of Kunming Medical
   University (Approval number: KMMUD2025041).

Flow cytometry

   Cell cycle distribution was analyzed by flow cytometry. Cells were
   fixed in 95% ethanol at 4 °C for 24 h, washed with PBS, and stained
   with propidium iodide (PI, BD, 550825) for 15 min. Samples were then
   analyzed using a BD FACS Celesta™ flow cytometer.

   For apoptosis assessment, 1 × 10^6 cells were collected and stained
   with an Annexin V PE/7-AAD staining kit (Abcam, BA00207). The
   percentage of apoptotic cells was quantified by flow cytometry.

Chromatin immunoprecipitation (ChIP) assay

   ChIP assays were performed using a commercially available kit
   (Cambridge Abcam, USA) following the manufacturer’s protocols. Briefly,
   cells were harvested and crosslinked with formaldehyde at room
   temperature for 10 min to preserve protein-DNA interactions. The
   crosslinking reaction was terminated by the addition of glycine,
   followed by cell lysis in the presence of protease inhibitors.
   Chromatin was fragmented by sonication, and lysates were centrifuged at
   4 °C for 10 min to collect the supernatant. A 20 µL aliquot was
   reserved as input control and stored at −20 °C, while the remaining
   lysate was evenly divided into three fractions and incubated overnight
   at 4 °C with antibodies against H3, IgG, and NRF2. The next day,
   antibody-bound chromatin complexes were captured using protein A/G
   magnetic beads and incubated overnight at 4 °C on a rotating mixer. On
   the third day, immunoprecipitated DNA was purified and centrifuged at
   1400014000 g for 1 min at room temperature. The supernatant was
   collected and stored at −20 °C for subsequent analysis by qPCR. The PCR
   primer sequences used for target amplification are listed in Table
   [68]2.

Table 2.

   Primer sequences used for qPCR.
  NRF2 binding position (Accession number: 4780)             Primer
  Position 1 (1758–1768)                         F: 5′-3′: CAGCGGGCTAGGTGCTCA
                                                 R: 5′-3′: TACCATGTTTTGTGTGGGCAA
  Position 2 (1861–1871)                         F:5′-3′: GCGGACGGCAGTGTTTAGTAT
                                                 R:5′-3′: CAAAACCTAACCGGCGGGAA
   [69]Open in a new tab

Dual-luciferase reporter assay

   To assess NRF2-mediated transcriptional regulation of RRM1, the RRM1
   promoter sequence was cloned into a luciferase reporter plasmid. A
   mutant construct was generated by introducing site-specific mutations
   at the NRF2 binding site. The dual-luciferase reporter vector was
   obtained from Wuhan Genetic Engineering (China). HEK293T cells were
   seeded in 24-well plates and transfected with either wild-type or
   mutant plasmids once they reached approximately 60% confluency. After
   24 h, an NRF2 agonist was added. Cells were then harvested, and
   luciferase activity was measured using a dual-luciferase reporter assay
   kit (T002, Vigorous) following the manufacturer’s protocols.
   Luminescence was detected using a multi-mode functional measuring
   instrument (CA95051, Agilent Technologies).

Tissue microarray and immunohistochemical analysis

   The tissue microarray (MME1004i) was purchased from Taibosi
   Biotechnology. Protein expression levels were detected by
   immunohistochemical analysis. Briefly, antigen retrieval was performed
   using 1% sodium citrate, followed by peroxidase removal with hydrogen
   peroxide. Permeabilization was achieved with 0.1% Triton X-100, and
   nonspecific binding was blocked with 5% goat serum. Tissue sections
   were incubated with primary antibodies overnight at 4 °C, followed by
   incubation with secondary antibodies at room temperature for 30 min.
   Protein detection was visualized using DAB staining (Biosharp,
   #BL732A). Samples were mounted with neutral resin, and images were
   acquired using a slide scanner (Teksqray, #SQS-1000). The primary
   antibodies used were anti-MTCH2 (16888-1-AP, Proteintech) and anti-RRM1
   (10526-1-AP, Proteintech).

Nuclear and cytoplasmic separation

   Nuclear and cytoplasmic protein separation was performed using a
   nuclear protein extraction kit (Solarbio, EX1470). Collected cells were
   first resuspended in extraction solution A, mixed thoroughly, and
   incubated on a shaker at 4 °C for 30 min. The lysate was centrifuged,
   and the supernatant was collected as the cytoplasmic protein fraction.
   The remaining pellet was resuspended in extraction solution B,
   incubated under the same conditions and centrifuged to obtain the
   nuclear protein fraction.

Bioinformatics analysis

   Bioinformatics analysis and data mining were conducted to investigate
   the expression patterns and regulatory mechanisms of MTCH2, NRF2, and
   RRM1 in melanoma. The GEPIA database ([70]http://gepia2.cancer-pku.cn/)
   was utilized to compare the expression levels of these genes between
   melanoma and normal tissues, providing insights into their differential
   expression profiles. Functional associations of RRM1 in melanoma were
   byexplored using the CancerSEA database
   ([71]http://biocc.hrbmu.edu.cn/CancerSEA/), allowing for the assessment
   of its involvement in various cellular processes. To examine potential
   transcriptional regulation, the JASPAR database
   ([72]https://jaspar.genereg.net/) was employed to predict NRF2 binding
   sites within the RRM1 promoter region, as well as to aid in the design
   of primers for chromatin immunoprecipitation (ChIP) assays. These
   analyses facilitated a comprehensive understanding of the roles of
   MTCH2, NRF2, and RRM1 in melanoma progression.

Statistical analysis

   All statistical analyses were conducted using SPSS v26.0. Experimental
   data were obtained from at least three independent replicates,
   presented as mean ± standard deviation (SD). Prior to statistical
   tests, homogeneity of variance across groups was evaluated. Independent
   sample t-tests were used to compare differences between two groups,
   while one-way analysis of variance (ANOVA) was applied for comparisons
   among multiple groups. Multifactor ANOVA was used to compare
   differences between two or more treatment factors. A P-value < 0.05 was
   considered statistically significant. Additionally, sample size
   estimation was performed based on a literature review using G Power
   v3.1.9.7 software.

Results

MTCH2 is up-regulated in melanoma and correlates with tumor malignancy

   To determine whether MTCH2 plays a role in melanoma progression, its
   expression and prognostic significance were analyzed in melanoma
   patients using the GEPIA database. Results demonstrated a significant
   up-regulation of MTCH2 in melanoma tissues compared to normal controls
   (Fig. [73]1A), with higher MTCH2 expression associated with poorer
   survival outcomes (Fig. [74]1B). Western blot and qPCR analyses further
   confirmed that MTCH2 expression at both the protein and mRNA levels was
   markedly elevated in melanoma cell lines compared to human epidermal
   melanocytes (HEM) (Fig. [75]1C, D). To extend these findings to
   clinical samples, a tissue microarray was employed to evaluate MTCH2
   expression in normal and melanoma tissues. Representative images of
   immunohistochemical staining are shown in Fig. [76]1E. The tissue
   microarray included 80 melanoma cases, including 63 primary melanoma
   and 17 metastatic melanoma patients. The positive detection rates for
   MTCH2 in normal, primary melanoma, and metastatic melanoma tissues were
   30%, 77%, and 65%, respectively (Fig. [77]1F, G). Additionally, MTCH2
   expression scores were significantly higher in melanoma tissues than in
   normal tissues (Fig. [78]1H).

Fig. 1. MTCH2 is highly expressed in melanoma and is related to the degree of
malignancy of melanoma.

   [79]Fig. 1
   [80]Open in a new tab

   A The expression of MTCH2 in normal tissue and melanoma tissue based on
   GEPIA database. B The relationship of MTCH2 with survival rate in
   melanoma based on TCGA data. C, D The mRNA and protein expression of
   MTCH2 in HEM cell and melanoma cells were analyzed by qPCR (C) and
   western blotting analysis (D). E–H Representative images of MTCH2
   expression in the melanoma and the normal tissue microarray are shown.
   Scale bars = 50 μm (E). Immunohistochemical results of MTCH2 expression
   in melanoma tissue microarray (F). The percentage of high and low
   expression of MTCH2 in normal tissues, primary, and metastatic melanoma
   (G). MTCH2 score (H). I–L The stable MTCH2 knockdown and overexpression
   in A375 and SK-MEL-21 cells were established. The expression of MTCH2
   were measured by western blotting (I, J) and qPCR (K, L) analysis. The
   data represent three independent experiments. The data as indicated the
   mean ± SD and was analyzed by Student’s t test. (*p < 0.05; **p < 0.01;
   ***p < 0.001).

   To further explore the functional role of MTCH2 in melanoma, stable
   MTCH2 knockdown (KD) and overexpression (OE) cell lines were
   successfully established in A375 and SK-MEL-21 cells. Changes in MTCH2
   expression levels in these stably transfected cells were validated by
   western blotting (Fig. [81]1I, J, Supplementary Fig. [82]1A) and qPCR
   analyses (Fig. [83]1K, L, Supplementary Fig. [84]1A).

   Overall, these findings indicate that MTCH2 is overexpressed in
   melanoma and correlates with tumor malignancy, providing a potential
   target for therapeutic intervention.

MTCH2 promotes melanoma cell proliferation

   To further investigate the role of MTCH2 in melanoma proliferation, in
   vitro MTS assays and EdU staining assays were performed. The MTS assay
   results revealed that MTCH2 knockdown markedly reduced the
   proliferative capacity of A375 and SK-MEL-21 cells (Fig. [85]2A).
   Conversely, stable overexpression of MTCH2 significantly enhanced
   melanoma cell proliferation (Fig. [86]2B). Consistent with these
   findings, EdU staining demonstrated that MTCH2-overexpressing cells
   exhibited a significantly increased rate of DNA synthesis, while
   MTCH2-knockdown cells displayed a pronounced reduction in proliferative
   activity (Fig. [87]2C).

Fig. 2. MTCH2 promotes melanoma cells proliferation in vitro and vivo.

   [88]Fig. 2
   [89]Open in a new tab

   A, B The proliferation rate of MTCH2 knockdown or MTCH2 overexpressing
   A375, SK-MEL-21 and the corresponding control cells were detected by
   MTS assay. C EdU was used to evaluate the proliferation of MTCH2
   knockdown or MTCH2 overexpressing A375 and SK-MEL-21 cells. Scale
   bars = 200 μm. D The phase distribution of MTCH2 knockdown or MTCH2
   overexpressing A375 and the corresponding control cells cell cycle were
   detected by flow cytometry. E Western blot was used to detect the
   protein expression of Cyclin E1 and CDK2 in MTCH2 knockdown or MTCH2
   overexpressing A375 and SK-MEL-21 cells. F BALB/c nude mice were
   injected with MTCH2 knockdown or MTCH2 overexpressing A375 cells and
   the control cells. Measure tumor volume. (n = 4). G Morphological
   feature of each xenograft tumor group by HE staining and IHC. Scale
   bars = 50 μm. The data represent three independent experiments. Each
   bar represents mean ± SD. p values were calculated using a Student’s t
   test (*p < 0.05, **p < 0.01, ***p < 0.001 vs. each control).

   To further assess the impact of MTCH2 on cell cycle progression, flow
   cytometry was performed. Results indicated that MTCH2 knockdown led to
   an increase in the percentage of S phase cells and a decrease in the
   proportion of G0/G1 phase cells, while MTCH2 overexpression resulted in
   the opposite trend, with a decrease in S phase cells and an increase in
   G0/G1 phase cells (Fig. [90]2D). At the molecular level, Western blot
   analysis revealed that MTCH2 overexpression was associated with reduced
   levels of key cell cycle regulators, cyclin E1 and CDK2, while MTCH2
   knockdown led to their up-regulation in A375 and SK-MEL-21 cells (Fig.
   [91]2E). These findings suggest that MTCH2 plays a pivotal role in
   driving melanoma cell cycle progression and proliferation.

   To evaluate the effects of MTCH2 on tumor growth in vivo, A375 cells
   with stable MTCH2 overexpression or knockdown, alongside control cells,
   were subcutaneously implanted into BALB/c nude mice, and tumor growth
   was monitored. Results demonstrated that MTCH2 overexpression in A375
   cells significantly accelerated tumor growth, whereas MTCH2 knockdown
   led to a marked reduction in tumorigenicity (Fig. [92]2F). In addition,
   hematoxylin and eosin (H&E) and immunohistochemical staining were
   performed to assess morphology and MTCH2 expression in excised tumor
   tissues (Fig. [93]2G).

   Collectively, these findings demonstrate that MTCH2 promotes melanoma
   cell proliferation by regulating cell cycle progression and tumor
   growth.

MTCH2 knockdown promotes melanoma cell apoptosis

   To further elucidate the role of MTCH2 in melanoma, its impact on cell
   apoptosis was assessed via flow cytometry. Results indicated that MTCH2
   knockdown significantly promoted apoptosis, while MTCH2 overexpression
   reduced apoptotic rates (Fig. [94]3A, B). Further analysis revealed
   that MTCH2 knockdown led to a substantial up-regulation of the
   pro-apoptotic factors Bax and cleaved Caspase-3 (Cl-Caspase-3), as well
   as a marked down-regulation in the anti-apoptotic protein Bcl-2.
   Conversely, MTCH2 overexpression resulted in the opposite trend (Fig.
   [95]3C, D).

Fig. 3. MTCH2 inhibits apoptosis in melanoma.

   [96]Fig. 3
   [97]Open in a new tab

   A, B Anti-apoptotic ability of MTCH2 knockdown or MTCH2 overexpressing
   A375, SK-MEL-21 and the control cells were evaluated by flow cytometry.
   C, D The expressions of apoptosis related factors Bcl2, Bax and
   Cl-Caspase3 in MTCH2 knockdown or MTCH2 overexpressing A375 and
   SK-MEL-21. The data represent three independent experiments. Each bar
   represents mean ± SD. p values were calculated using a Student’s t test
   (*p < 0.05, **p < 0.01, ***p < 0.001 vs. each control).

   Overall, these results indicate that MTCH2 inhibits melanoma cell
   apoptosis, thereby contributing to tumor survival and progression.

MTCH2 regulates NRF2 and RRM1 expression

   To further explore the mechanisms by which MTCH2 regulates melanoma
   progression, KEGG pathway enrichment analysis was performed. Results
   revealed that MTCH2 was primarily enriched in the cell cycle (Fig.
   [98]4A). Additionally, single-cell transcriptomic analysis of data from
   the CancerSEA database was used to explore the functional relevance of
   RRM1 in melanoma. Notably, t-SNE visualization demonstrated that RRM1
   was associated with cell cycle regulation, proliferation, and DNA
   damage repair (Fig. [99]4B, C), suggesting a potential regulatory
   relationship between MTCH2 and RRM1. To validate this hypothesis, GEPIA
   database analysis was conducted, revealing a significant positive
   correlation between the transcriptional expression of MTCH2 and RRM1
   (Fig. [100]4D). Further analysis confirmed positive correlations
   between RRM1 and NRF2, as well as between NRF2 and MTCH2 (Fig. [101]4E,
   F). To experimentally confirm these relationships, immunofluorescence
   staining (Fig. [102]5A, B) and Western blot analysis (Fig. [103]5C, D)
   were performed to assess NRF2 and RRM1 expression in
   MTCH2-overexpressing and knockdown melanoma cells. Results indicated
   that MTCH2 overexpression led to significant up-regulation of NRF2 and
   RRM1 protein levels, where MTCH2 knockdown resulted in their
   substantial down-regulation. Additionally, Western blot analysis of
   nuclear and cytoplasmic fractions revealed that NRF2 was primarily
   localized in the nucleus of MTCH2-overexpressing A375 and SK-MEL-21
   cells, while whereas the opposite trend was observed in MTCH2-knockdown
   cells (Fig. [104]5E, F).

Fig. 4. MTCH2 is positively correlated with NRF2 and RRM1 expression in
melanoma.

   [105]Fig. 4
   [106]Open in a new tab

   A Bioinformatics was used to detect the enrichment of MTCH2 in various
   cell processes. B, C Correlation of RRM1 with the function of 307
   single cells from 3 melanoma cell lines were analyzed by t-SNE
   downscaled visualization. D–F Spearman correlation analysis of MTCH2 or
   RRM1 and NRF2.

Fig. 5. MTCH2 regulates the expression of RRM1 and NRF2.

   [107]Fig. 5
   [108]Open in a new tab

   A, B Immunofluorescence analysis was used to analyze the expression of
   NRF2 and RRM1 in MTCH2 knockdown or MTCH2 overexpressing A375,
   SK-MEL-21 and the control cells. Scale bars = 20 μm. C, D The protein
   level of RRM1 and NRF2 were analyzed in the stably MTCH2 knockdown or
   MTCH2 overexpressing A375, SK-MEL-21 and that the control cells. E, F
   NRF2 expression in nucleus and cytoplasm of MTCH2 knockdown or MTCH2
   overexpressing A375 and SK-MEL-21 cells. The data represent three
   independent experiments. Each bar represents mean ± SD. p values were
   calculated using a Student’s t test (*p < 0.05, **p < 0.01,
   ***p < 0.001 vs. each control).

   Collectively, these findings suggest that MTCH2 promotes melanoma
   proliferation by regulating the NRF2 and RRM1 signaling axis, providing
   a mechanistic link between MTCH2 expression and melanoma progression.

NRF2 targets and regulates RRM1 transcription

   To validate the regulatory relationship between NRF2 and RRM1, A375 and
   SK-MEL-21 melanoma cells were treated with sulforaphane (an NRF2
   activator) and ML385 (an NRF2 inhibitor). Results confirmed that NRF2
   inhibition significantly reduced both RRM1 protein (Fig. [109]6A, B)
   and mRNA levels (Fig. [110]6C, D), whereas NRF2 activation led to a
   marked increase in RRM1 expression. Additionally, rescue experiments
   demonstrated that RRM1 knockdown (Supplementary Fig. [111]1B)
   significantly reduced melanoma cell proliferation and RRM1 protein
   levels. However, treatment of RRM1-deficient cells with sulforaphane
   partially restored both RRM1 expression (Fig. [112]6E, F) and
   proliferation capacity (Fig. [113]6G, H). These findings indicate that
   NRF2 plays a crucial role in regulating RRM1 expression and melanoma
   cell proliferation.

Fig. 6. NRF2 is a transcription factor of RRM1-mediated malignant progression
of melanoma.

   [114]Fig. 6
   [115]Open in a new tab

   A–D Western blot and qPCR were used to detect the RRM1 expression
   levels in A375 and SK-MEL-21 cells treated with ML385 (NRF2 inhibitor)
   and Sulforaphane (NRF2 activator) for 24 h, then compared with the RRM1
   protein (A, B) and mRNA levels in control cells (C, D). E, F Rescue to
   verify the interaction between RRM1 and NRF2 in A375 and SK-MEL-21
   cells by using Western blot. G, H The cell proliferation rate was
   detected by MTS assay. I Consensus binding sites for NRF2 on the RRM1
   promoter was analyzed by JASPAR database. J ChIP assay using NRF2
   antibody and quantification of the enrichment of NRF2 binding to RRM1
   promoter in A375 cells. K Design of luciferase reporter vector
   containing RRM1 promoter with a NRF2 binding site or a mutant NRF2
   binding site. The red indicates mutant bases. L Luciferase reporter
   assay of NRF2 binding to RRM1 promoter. (The NRF2 group is treated with
   agonists). The data represent three independent experiments. Each bar
   represents mean ± SD. p values were calculated using a Student’s t test
   and multivariate analysis Of Variance (*p < 0.05, **p < 0.01,
   ***p < 0.001 vs. each control).

   To elucidate the mechanism by which NRF2 regulates RRM1, we analyzed
   the JASPAR database and identified two putative NRF2-binding sites
   within the RRM1 promoter region (Fig. [116]6I). ChIP-qPCR analysis
   further confirmed that NRF2 was recruited to both binding site 1
   (positions 1758–1768) and binding site 2 (positions 1861–1871) of the
   RRM1 promoter (Fig. [117]6J), providing direct evidence of NRF2 binding
   to RRM1 regulatory elements. Further validation was obtained through
   dual-luciferase reporter assays, which revealed that mutation of these
   NRF2 binding sites significantly reduced luciferase activity in
   plasmid-transfected HEK293T cells, confirming the functional relevance
   of NRF2-mediated transcriptional regulation of RRM1 (Fig. [118]6K, L).

   Together, these results establish that NRF2 directly binds to and
   regulates the transcriptional expression of RRM1, thereby influencing
   melanoma cell proliferation.

RRM1 expression is associated with the anti-tumor activity of dacarbazine

   Dacarbazine, a non-specific alkylating chemotherapeutic agent, is
   widely used in melanoma treatment, primarily exerting its cytotoxic
   effects by disrupting DNA synthesis and replication in cancer cells
   [[119]19]. To determine whether RRM1 expression influences melanoma
   sensitivity to dacarbazine, a melanoma cell line with stable RRM1
   knockdown was generated (Supplementary Fig. [120]1B). MTS assays were
   then performed to assess cell viability at various dacarbazine
   concentrations. The half-maximal inhibitory concentration (IC50) was
   determined for melanoma cells with stable MTCH2 knockdown (Fig.
   [121]7A, B), MTCH2 overexpression (Fig. [122]7C, D), and RRM1 knockdown
   (Fig. [123]7E, F). The results revealed that RRM1 or MTCH2 knockdown
   enhanced melanoma sensitivity to dacarbazine, whereas MTCH2
   overexpression reduced drug susceptibility.

Fig. 7. Targeting RRM1 promoted the antitumor activity of dacarbazine in
vitro and in vivo.

   [124]Fig. 7
   [125]Open in a new tab

   A–F Relative cell viability of A375 and SK-MEL-21 cells with MTCH2
   knockdown (A, B), MTCH2 overexpressing (C, D) and RRM1 knockdown (E, F)
   treated with different concentrations of dacarbazine for 24 h. G BALB/c
   nude mice were injected with A375 cell that were stably transfected
   with RRM1 knockdown and the control. After one week of tumor injection,
   start treatment with dacarbazine. Representative images of mice with
   RRM1 control and knockdown xenograft tumors. The tumor volume (H) and
   the tumor weight (I) were measured. (n = 5/group). J Morphological
   feature of each xenograft tumor group by HE staining and IHC. The data
   represent three independent experiments. Scale bars = 50 μm. The data
   represent three independent experiments. The data related to tumor
   volume and weight, IHC were statistically analyzed by two-way ANOVA
   (*p < 0.05, **p < 0.01, ***p < 0.001).

   To further investigate whether low RRM1 expression impacts melanoma
   proliferation and dacarbazine sensitivity in vivo, A375 cells with
   stable RRM1 knockdown were subcutaneously implanted into BALB/c nude
   mice, and tumor growth was monitored. Results indicated that tumors
   formed by RRM1-knockdown cells were notably smaller and lighter than
   controls, indicating a suppression of tumorigenic potential. Moreover,
   combining dacarbazine treatment with RRM1 knockdown further reduced
   tumor growth rates and tumor sizes compared to dacarbazine treatment
   alone (Fig. [126]7G–I). In addition, H&E and immunohistochemical
   staining were performed to evaluate cell morphology and RRM1 expression
   levels in excised tissues (Fig. [127]7J).

   These findings indicate that RRM1 plays a critical role in regulating
   melanoma cell sensitivity to dacarbazine, highlighting RRM1 as a
   potential therapeutic target to enhance the efficacy of this
   chemotherapeutic agent.

Discussion

   Our study demonstrated that elevated MTCH2 expression promoted melanoma
   proliferation by up-regulating NRF2 expression and nuclear
   translocation. NRF2, in turn, directly targeted RRM1 transcription,
   ultimately driving tumor cell proliferation. Notably, increased RRM1
   levels reduced melanoma sensitivity to dacarbazine, highlighting a
   potential mechanism of chemoresistance (Fig. [128]8).

Fig. 8. Mechanism summary diagram.

   [129]Fig. 8
   [130]Open in a new tab

   When MTCH2 expression is defective (MTCH2 knockdown), the amount of
   NRF2 entering the nucleus is reduced, leading to decreased RRM1
   transcription. Consequently, the sensitivity of melanoma cells to
   Dacarbazine is enhanced, effectively inhibiting their proliferation.

   RRM1 is a key enzyme in deoxyribonucleotide biosynthesis, catalyzing
   the conversion of ribonucleoside diphosphate into deoxyribonucleoside
   diphosphate, a crucial step in generating deoxyribonucleoside
   triphosphates (dNTPs) for DNA synthesis [[131]20]. The high metabolic
   demand of rapidly proliferating tumor cells necessitates increased dNTP
   production, making RRM1 a critical factor in tumor progression. Prior
   studies have shown that RRM1 knockdown significantly suppresses bladder
   cancer growth [[132]4], while inhibiting RRM1 in non-small cell lung
   cancer reduces cell viability and induces apoptosis [[133]21].
   Similarly, RRM1 up-regulation in colorectal cancer has been linked to
   enhanced tumor progression [[134]22]. Consistent with these findings,
   our study showed that RRM1 promoted melanoma proliferation, while its
   inhibition reduced tumor cell viability. Beyond its role in DNA
   synthesis, RRM1 is also involved in DNA damage and repair, accumulating
   at DNA damage sites and facilitating dNTP supply [[135]23]. In
   pancreatic cancer, gemcitabine-induced DNA damage triggers RRM1
   up-regulation [[136]24], suggesting that RRM1 not only participates
   directly in DNA repair but also indirectly supports repair processes by
   maintaining nucleotide pools. Given that dacarbazine exerts its
   antitumor effects by inducing DNA damage [[137]7], the rapid
   restoration of damaged DNA via RRM1-mediated dNTP synthesis may
   underlie melanoma insensitivity to dacarbazine [[138]25]. Furthermore,
   previous studies have demonstrated that increased intracellular
   deoxyribonucleotide levels contribute to dacarbazine resistance,
   further supporting the inverse relationship between RRM1 expression and
   chemotherapy efficacy. Our findings reinforce this notion, as reducing
   RRM1 expression significantly enhanced dacarbazine sensitivity, whereas
   high RRM1 levels conferred resistance.

   NRF2 is widely recognized as a key driver of tumor development
   [[139]26]. In cervical cancer, NRF2 promotes metastasis by modulating
   epithelial-mesenchymal transition (EMT)-related factors [[140]27],
   while in breast cancer, it enhances proliferation and metastasis
   through activation of the RhoA/ROCK signaling pathway [[141]28]. In
   non-small cell lung cancer, NRF2 facilitates tumor progression by
   inducing autophagy [[142]29]. In melanoma, it has been shown to support
   tumor growth and lung metastasis [[143]30] and promote invasive
   phenotypes in BRAF-mutant melanoma cells [[144]31]. Our study showed
   that NRF2 directly regulated RRM1 transcription, revealing a previously
   uncharacterized mechanism by which NRF2 drives melanoma proliferation.
   These findings provide new evidence for the role of NRF2 in nucleotide
   metabolism regulation, further implicating it in melanoma progression.

   MTCH2, a mitochondrial outer membrane carrier protein, plays a pivotal
   role in apoptosis regulation by influencing mitochondrial permeability
   [[145]32]. Studies have shown that MTCH2 deficiency in hematopoietic
   stem cells (HSCs) enhances mitochondrial oxidative phosphorylation
   (OXPHOS) [[146]33], while MTCH2 knockdown in glioma cells promotes
   OXPHOS-induced oxidative damage [[147]16]. These findings suggest that
   MTCH2 is a critical regulator of OXPHOS, which may underpin its effects
   on NRF2 expression and nuclear translocation. MTCH2 has been shown to
   promote tumor progression in multiple cancers, including glioma,
   osteosarcoma, and breast cancer [[148]16–[149]18]. Our study extended
   these findings to melanoma, demonstrating that MTCH2 overexpression
   promoted cell proliferation and altered cell cycle distribution by
   up-regulating cyclin E1 and CDK2 expression. Concurrently, MTCH2
   inhibited cell apoptosis, up-regulated anti-apoptotic factor, and
   down-regulated pro-apoptotic factors Bax and Cl-Caspase-3 via the
   NRF2-RRM1 axis. Future studies should explore how MTCH2 influences
   oxidative phosphorylation in melanoma, which could provide deeper
   insights into its role in tumor metabolism and therapeutic resistance.

Conclusions

   This study identified MTCH2 as a key oncogenic driver in melanoma,
   demonstrating its role in enhancing proliferation while inhibiting
   apoptosis. These findings establish a foundation for targeting MTCH2 as
   a potential therapeutic strategy to inhibit melanoma progression.
   Mechanistic analysis revealed that MTCH2 regulates NRF2, which, in
   turn, transcriptionally activates RRM1, driving melanoma growth.
   Notably, aberrant RRM1 expression was shown to contribute to melanoma
   insensitivity to dacarbazine, offering critical insights into the
   mechanisms underlying chemotherapy insensitivity. These findings not
   only enhance the understanding of melanoma pathogenesis but also
   provide a theoretical basis for optimizing clinical treatment
   strategies. Our study highlights RRM1 as a potential predictive
   biomarker for dacarbazine sensitivity, paving the way for personalized
   therapeutic strategies in melanoma management.

Supplementary information

   [150]Supplementary Figure1^ (400.1KB, docx)
   [151]WB original figure^ (1.2MB, pdf)

Author contributions

   Conceptualization, XDZ, QZ, BQS, and YCZ; Formal analysis, EJL; Funding
   acquisition, YCZ; Investigation, YLG, ZYW, YH, JZN, SY, and YF;
   Supervision, KYM, BQS YCZ, QZ, and ZY; Writing–original draft, XDZ.

Funding

   This work was supported by the National Natural Science Foundation of
   China (31960200, 82160540) and Xing Dian Talent Support Program to
   Educate Talents (YNWR-JXMS-2024-037).

Data availability

   The original contributions presented in the study are included in the
   article and supplementary material. Further inquiries can be directed
   to the corresponding authors.

Competing interests

   The authors declare no competing interests.

Ethics approval

   All animal procedures were conducted in accordance with the National
   Institutes of Health Guide for the Care and Use of Laboratory Animals
   and were approved by the Animal Care and Use Commission of Kunming
   Medical University (Approval number: KMMUD2025041).

Footnotes

   Edited by Flavie Strappazzon

   Publisher’s note Springer Nature remains neutral with regard to
   jurisdictional claims in published maps and institutional affiliations.

   These authors contributed equally: Xuedan Zhang, Enjiang Li, Yingmin
   Kuang.

Contributor Information

   Buqing Sai, Email: saibuqing@kmmu.edu.cn.

   Yuechun Zhu, Email: zhuyuechun@kmmu.edu.cn.

Supplementary information

   The online version contains supplementary material available at
   10.1038/s41419-025-07618-9.

References