Abstract

Purpose

   Derivation of Qingchang Huashi formula, named Qingchang Huashi Jianpi
   Bushen (QCHS_JPBS) formula, has shown significant therapeutic effect on
   patients with ulcerative colitis (UC). In this study, the potential
   mechanism of QCHS_JPBS formula in repairing mucosal damage was explored
   from the perspective of intestinal stem cell (ISCs) differentiation,
   and potential targets of the QCHS_JPBS formula to improve UC were
   predicted using network pharmacology analysis.

Methods

   The therapeutic efficacy of QCHS_JPBS formula was evaluated in a mouse
   model of 2.5% dextran sulfate sodium (DSS) induced colitis. The effect
   of this formula on the ISC differentiation was evaluated using tissue
   transmission electron microscopy, immunofluorescence, and RT-qPCR. The
   cecal contents were subjected to 16s RNA sequencing analysis and
   non-target metabolomics analysis using LC-MS/MS. The fecal microbiota
   transplantation method verified the essential role of gut microbiota in
   promoting ISC differentiation and repairing mucosal damage.

Results

   The results indicated that QCHS_JPBS formula suppressed the
   inflammatory response and repaired the damaged intestinal epithelial
   barrier in DSS-induced colitis mice. QCHS_JPBS formula promoted ISC
   differentiation, particularly in the direction of goblet cells.
   QCHS_JPBS formula restored gut dysbiosis and regulated metabolic
   disorders in DSS-induced colitis mice. And then, the results of fecal
   microbiota transplantation indicated that QCHS_JPBS formula promoted
   differentiation of intestinal stem cells to repair mucosal damage
   through gut microbiota. Finally, a total of 79 active ingredients of
   QCHS_JPBS formula were identified based on LC-MS analysis and EGFR,
   STAT3, SRC, AKT1, and HSP90AA1 were considered as potential therapeutic
   UC targets of QCHS_JPBS formula based on network pharmacology analysis.

Conclusion

   The present study demonstrated that QCHS_JPBS formula promoted the
   differentiation of ISCs through gut microbiota to repair the damaged
   intestinal epithelial barrier in UC mice.

   Keywords: qingchang huashi jianpi bushen formula, ulcerative colitis,
   intestinal stem cells, epithelial barrier, gut microbiota, network
   pharmacology

Introduction

   Ulcerative colitis (UC), classified as an inflammatory bowel disease,
   is a chronic relapsing inflammatory disease characterized by
   uncontrolled inflammation and destruction of the epithelial structure
   of the intestine.[44]^1 Nevertheless, the mechanisms involved in the
   pathogenesis of UC are unknown, which may involve environmental
   factors, genetic susceptibility, immune dysfunction, and microbial
   imbalance.[45]^2 Currently, the primary drugs used clinically for the
   therapy of UC include salicylates, corticosteroids, and immune and
   biological agents. However, due to the side effects of these drugs,
   their use is limited.[46]^3 Consequently, the discovery of new drugs
   that are safe, well-utilized, and effective in the treatment of UC is
   critical.

   Intestinal barrier dysfunction is central to the pathogenesis of UC.
   Mucin MUC2 secreted by goblet cells is significantly reduced in UC
   patients, making the mucus layer thinner and leading to pathogen and
   antigen translocation.[47]^4 At the same time, the expression of
   intestinal epithelial tight junction proteins (such as ZO-1, Occludin
   and Claudin4) is down-regulated, resulting in an abnormal increase in
   permeability.[48]^5 In addition, the translocated pathogenic molecules
   activate immune cells in turn, prompting the massive release of
   pro-inflammatory factors such as IL-6 and TNF-α, exacerbating
   intestinal barrier damage.[49]^6 Therefore, the focus of UC treatment
   is to achieve repair of the intestinal barrier.[50]^7

   Intestinal stem cells (ISCs) represent an important type of adult stem
   cells that facilitate the daily renewal of intestinal epithelium via
   ongoing self-renewal, proliferation, and differentiation.[51]^8 When
   injury occurs in the intestine, ISCs supplement the damaged epithelial
   cells and produce specific kinds of cells, such as secretory goblet
   cells and Paneth cells, to maintain the intestinal mucus layer
   integrity. This process is the core link in the repair of damaged
   intestinal epithelium in UC.[52]^9 The gut microbiota and metabolites,
   as important components of the ISCs microenvironment, have a
   prospective impact on the ISCs’ self-renewal function.[53]^10

   Classic traditional Chinese medicine (TCM) formulas made from various
   herbs have provided medical assistance to UC patients and are often
   used as alternative treatment strategies.[54]^11 Qingchang Huashi
   Jianpi Bushen (QCHS_JPBS) formula (Patent number: ZL201510151805.0) is
   derived from the Qingchang Huashi formula, which has been clinically
   used to alleviate the symptoms in UC patients.[55]^12 QCHS_JPBS formula
   is composed of 9 Chinese medicine: Astragalus mongholicus Bunge
   (Chinese name Huangqi), Cullen corylifolium (L). Medik. (Chinese name
   Buguzhi), Atractylodes macrocephala Koidz. (Chinese name Baizhu),
   Alpinia oxyphylla Miq. (Chinese name Yizhiren), Scutellaria baicalensis
   Georgi (Chinese name Huangqin), Coptis chinensis Franch. (Chinese name
   Huanglian), Aucklandia lappa DC. (Chinese name Muxiang), Sanguisorba
   officinalis L. (Chinese name Diyu), and Glycyrrhiza glabra L. (Chinese
   name Gancao). Furthermore, our previous study demonstrated that the
   QCHS_JPBS formula ameliorated inflammation response in dextran sulfate
   sodium (DSS)-induced colitis mice.[56]^13 Nevertheless, the potential
   molecular mechanisms of the QCHS_JPBS formula in treating UC need to be
   explained urgently.

   Despite the multi-target effects, low side effects, and high efficacy
   of TCM, the components in TCM prescriptions are extraordinarily
   complex, which makes it difficult to elucidate the molecular mechanisms
   underlying TCM prescriptions.[57]^14 Notably, network pharmacology is a
   prospective approach for revealing the active ingredients, targets, and
   even drug-target-disease relationships of drugs used in TCM.[58]^15
   Network pharmacological approaches have been widely used in the
   treatment of UC with Chinese medicines.[59]^16 This approach provides
   new macroscopic insights into the treatment of UC with complex herbal
   medicines and offers scientific and technical support for clinical
   applications. In addition, an integrated strategy based on network
   pharmacology and experimental validation may significantly facilitate
   the discovery and development of anti-UC drugs.[60]^17

   In this study, integration of multi-omics and network pharmacology
   analysis were applied to investigate the active components and
   potential molecular mechanisms of the QCHS_JPBS formula for the
   therapeutic amelioration of DSS-induced colitis. The results showed
   QCHS_JPBS formula promoted the differentiation of ISCs through gut
   microbiota to repair the intestinal epithelial barrier in UC mice, and
   potential targets for therapeutic UC with the QCHS_JPBS formulation
   involved EGFR, STAT3, SRC, AKT1, and HSP90AA1.

Materials and Methods

Preparation and Component Analysis of QCHS_JPBS Formula

   QCHS_JPBS formula is composed of nine crude medicinal plants,
   Astragalus mongholicus Bunge (Chinese name Huangqi, 15 g), Cullen
   corylifolium (L). Medik. (Chinese name Buguzhi, 15 g), Atractylodes
   macrocephala Koidz. (Chinese name Baizhu, 10 g), Alpinia oxyphylla Miq.
   (Chinese name Yizhiren, 15 g), Scutellaria baicalensis Georgi (Chinese
   name Huangqin, 10 g), Coptis chinensis Franch. (Chinese name Huanglian,
   3 g), Aucklandia lappa DC. (Chinese name Muxiang, 6 g), Sanguisorba
   officinalis L. (Chinese name Diyu, 10 g), Glycyrrhiza glabra L.
   (Chinese name Gancao, 3 g). All herbal medicines were purchased from
   the Jiangsu Provincial Hospital of Traditional Chinese Medicine
   (Jiangsu, China). The quality of the drugs is controllable. The plant
   name has been verified with MPNS ([61]http://mpns.kew.org). The herbal
   formula (total weight: 87 g) was soaked in 870 mL of purified water for
   1 h, followed by decoction at 100°C for 40 min. The liquid was
   collected, and the process was repeated with an additional 870 mL of
   purified water under identical conditions. The liquids from the two
   collections were combined and concentrated to 66 mL (storage solution
   concentration of 1.32 g/mL) using a rotary evaporator (60 °C, 70 rpm)
   and stored at 4 °C.

   The compositions of QCHS_JPBS formula were characterized using
   high-performance liquid chromatography (HPLC). An ACQUITY UPLC^® HSS T3
   (2.1 mm × 100 mm, 1.8 mm) was used for chromatographic separation. The
   flow rate and injection volume were set at 0.3 mL/min and 2 μL,
   respectively. For LC-ESI (+)-MS analysis, the mobile phases consisted
   of (B2) 0.1% formic acid in acetonitrile (v/v) and (A2) 0.1% formic
   acid in water (v/v). Separation was conducted under the following
   gradient: 0~1 min, 8% B2; 1~8 min, 8%~98% B2; 8~10 min, 98% B2; 10~10.1
   min, 98%~8% B2; 10.1~12 min, 8% B2. For LC-ESI (-)-MS analysis, the
   analytes were carried out with (B3) acetonitrile and (A3) ammonium
   formate (5mM). Separation was conducted under the following gradient:
   0~1 min, 8% B3; 1~8 min, 8%~98% B3, 8~10 min, 98% B3; 10~10.1 min,
   98%~8% B3, 10.1~12 min, 8% B3. Both positive and negative-modes were
   applied during electrospray ionization (ESI). The ESI source conditions
   were as follows: Spray voltage: 3.8 kV (+) and 3.2 kV (−); Sheath Gas:
   30±; Aux Gas: 5(±); Probe Heater Temp: 350 (±); S-lens RF level: 50.
   QCHS_JPBS formula constituents were identified by matching peak
   information found in Suzhou PANOMIX Co, Ltd’ s in-house secondary mass
   spectrometry database.

Mice

   SPF grade male C57BL/6 mice aged 6–8 weeks (weighting 18–22 g) were
   purchased from Beijing SiPeiFu Biotechnology Co., Ltd (Beijing, China).
   All animal procedures and experiments were assessed and approved by the
   Animal Ethics Committee of Nanjing University of Chinese Medicine
   (Approval NO. 2023DW-029-01) in accordance with the US National
   Institute of Health Guide for Care and Use of Laboratory Animals.

Establishment and Drug Administration of Colitis in Mice

   Mice were exposed to 2.5% DSS (Cat # 160110, MP Biomedicals, USA) in
   drinking water for 7 days and then treated with normal drinking water
   for 7 days to establish colitis. Mice were randomized into five groups
   (n=6): normal, model, low-dose QCHS_JPBS formula, high-dose QCHS_JPBS
   formula, and 5-ASA. According to the dose used in clinical patients (87
   g/60 kg), mice were given QCHS_JPBS at a dose of 7.6 g/kg or 13.2 g/kg,
   and the dose of 5-ASA (Cat # 79809, Sigma-Aldrich, USA) was 100 mg/kg.
   From days 8–14, different concentrations of the drug were given by
   gavage in the drug group, while the normal and Model groups were given
   the same volume of the solvent.

Histological and Immunohistochemical Analyses

   Colon tissues from mice were collected and fixed with 4% formaldehyde.
   Then, the colon tissues were embedded in paraffin and processed for
   histological analysis. The fixed colon tissues were sliced into 5 μm
   size sections and stained with H&E, PAS, AB/PAS.

Quantitative Real-Time PCR

   Total RNA was extracted from colon tissues using TRIzol extraction
   reagent (Cat # 15596026, Invitrogen, USA) according to the
   manufacturer’s instructions. The cDNA was reverse transcribed using a
   Hifair@ III 1st Stand cDNA Synthesis Super Mix (Cat #[62]Q71102,
   Vazyme, China). RT-qPCR analysis was carried out using Hieff@ qPCR SYBR
   green master mix (Cat # [63]R32301, Vazyme, China) on a Roche Light
   Cycler 96 system. The primers used are listed in [64]Table 1.

Table 1.

   Primers Used for Quantitative Real-Time PCR
        Gene                 Primer Sequences (5’-3’)
                          Forward                 Reverse
   Tnf-α          AAGGCCGGGGTGTCCTGGAG    AGGCCAGGTGGGGACAGCTC
   Il-6           CCACTTCACAAGTCGGAGGCTTA AGTGCATCATCGTTGTTCATAC
   Il-1β          GAATGCCACCTTTTGACAGTG   TGGATGCTCTCATCAGGACAG
   Il-10          CTTACTGACTGGCATGAGGATCA GCAGCTCTAGGAGCATGTGG
   Zo-1           GTCCCTGTGAGTCCTTCAGC    TAGGGTCACAGTGTGGCAAG
   Claudin-4      ACGTCATCCGCGACTTCTAC    TTGTCGTTGCTACGAGGTGG
   Lgr5           CCTACTCGAAGACTTACCCAGT  GCATTGGGGTGAATGATAGCA
   Msi-1          TCGGAGGACTCAGTTGGCAGAC  CCCGCATCACCAGACACTCTTTC
   Olfm4          CAGCCACTTTCCAATTTCACTG  GCTGGACATACTCCTTCACCTTA
   Lysozyme       GAGCTGTGAATGCCTGTGGGATC GACAGTGTGCTCGCCATGCC
   Chromogranin A CAGAGACGCAGCAGCAGAAGTG  AAAGCCATCCTGTTGTCCCTTGTC
   β-actin        CTCATGAAGATCCTGACCGAG   AGTCTAGAGCAACATAGCACAG
   [65]Open in a new tab

Western Blot Assay

   Total protein was extracted from colon tissue using RIPA buffer
   containing 1% PMSF. Proteins were then separated by 10–12% SDS-PAGE,
   transferred to polyvinylidene difluoride membranes, blocked with 5%
   skimmed milk in TBST for 1 h at room temperature. The membranes were
   incubated with specific primary antibodies (1:1000, ZO-1 (Cat # 33735,
   Santa Cruz Biotechnology, USA), Claudin-4 (Cat # 53156, Abcam, USA),
   LGR5 (Cat # BM4244, BOSTER, China), Msi-1 (Cat # A05052-1 BOSTER,
   China), Lysozyme (Cat # PB9663, BOSTER, China), Chromogranin A (Cat #
   bs-43559R, BIOSYNTHESIS, China), Actin (Cat # 66009, Proteintech,
   China)) against the membrane overnight at 4°C and appropriate secondary
   antibodies (1:5000, HRP conjugated goat anti-mouse (Cat # 15014,
   Proteintech, China), HRP conjugated goat anti-rabbit (Cat # 15015,
   Proteintech, China)) against the membrane at room temperature for 2 h.
   The bands were visualized with an enhanced chemiluminescent reagent
   using the ChemiDocTM XRS + system (Bio-rad, Hercules, CA, USA). A
   picture of the blot marker used in this experiment was shown in
   [66]Figure 1 of the [67]Supplementary Material, and the raw data of
   Western blot were shown in [68]Figures 2–5 of the [69]Supplementary
   Material, respectively.

Figure 1.

   [70]Figure 1
   [71]Open in a new tab

   QCHS_JPBS formula promotes recovery of DSS-induced colitis in mice.
   Colitis was induced in mice by drinking with 2.5% DSS for 7 days.
   QCHS_JPBS formula (6.6, 13.2 g/kg) was orally administered for
   consecutive 7 days. 5-ASA (100 mg/kg) was used as a positive control.
   (a) Percent body weight change. (b) DAI evaluation. (c and d) Colon
   length. (e and f) H&E staining and pathologic scoring of colon tissue.
   (g) The expression level of inflammation-related factors in colon
   tissue. Data are expressed as the means ± S.E.M., ^##P < 0.01 versus
   Normal, *P < 0.05 and **P < 0.01 versus Model.

Figure 2.

   [72]Figure 2
   [73]Open in a new tab

   QCHS_JPBS formula repairs the intestinal epithelial barrier in
   DSS-induced colitis mice. (a and b) Immunofluorescence staining for
   MUC2 and Occludin in colon tissue. (c and d) The expression levels of
   ZO-1 mRNA and protein in colon tissue. (e and f) The expression levels
   of Claudin4 mRNA and protein in colon tissue. (g) PAS staining of colon
   tissue. Data are expressed as the means ± S.E.M., ^##P < 0.01 versus
   Normal, *P < 0.05 and **P < 0.01 versus Model.

Figure 3.

   [74]Figure 3
   [75]Open in a new tab

   QCHS_JPBS formula promotes ISCs differentiation in DSS induced-colitis
   mice. (a) Colonic crypt structure. (b) The expression levels of LGR5,
   Msi-1 and Olfm4 mRNA in colon tissue. (c) The expression levels of LGR5
   and Msi-1 protein in colon tissue. (d and e) Immunofluorescence
   staining for LGR5 and Msi-1 in colon tissue. Data are expressed as the
   means ± S.E.M., ^##P < 0.01 versus Normal, *P < 0.05 and **P < 0.01
   versus Model.

Figure 4.

   [76]Figure 4
   [77]Open in a new tab

   QCHS_JPBS formula promotes the differentiation of ISCs into goblet
   cells. (a) AB-PAS staining of colon tissue. (b) The expression levels
   of Lysozyme and Chromogranin A mRNA in colon tissue. (c and d)
   Immunofluorescence staining for Lysozyme and Chromogranin A in colon
   tissue. Data are expressed as the means ± S.E.M.

Figure 5.

   [78]Figure 5
   [79]Open in a new tab

   QCHS_JPBS formula restores gut dysbiosis in DSS-induced colitis mice.
   Collect mouse cecal contents for 16S rRNA analysis. (a) The relative
   abundance of each OTU and OTU rank curve. (b) The overlap of OTUs
   across groups was presented using a Venn diagram. (c) Principal
   component analysis (PCA) showed significant differences in gut
   microbiota β diversity. (d and e) The relative bacterial abundance at
   the phylum and genus levels was shown. (f) The relative abundance of
   bacteria in genus level and heatmap clustering analysis. (g) LEfSe
   analysis and the taxonomic cladogram.

16S rRNA Sequencing of Cecal Contents

   Colon fecal contents were snap frozen with liquid nitrogen and stored
   at −80 °C. Genomic DNA was extracted from fecal samples using PF
   Mag-Bind Stool DNA Kit (Omega Bio-tek, Georgia, US) according to the
   manufacturer’s protocols. The hypervariable region V3-V4 of the
   bacterial 16S rRNA gene were amplified with primer pairs 515F
   (5’-GTGCCAGCMGCCGCGG-3’) and 907R (5’- CCGTCAATTCMTTTRAGTTT-3’) by an
   ABI GeneAmp^® 9700 PCR thermocycler (ABI, CA, USA). The PCR product was
   extracted from 2% agarose gel and purified. Then quantified using
   Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in
   equimolar amounts and paired-end sequenced on an Illumina PE250
   platform (Illumina, San Diego,USA) according to the standard protocols
   by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). Raw FASTQ
   files were de-multiplexed using an in-house perl script, and then
   quality-filtered by fastp version 0.19.6 and merged by FLASH version
   1.2.11. Then the optimized sequences were clustered into operational
   taxonomic units (OTUs) using UPARSE 11 with 97% sequence similarity
   level. Bioinformatic analysis of the gut microbiota was carried out
   using the Majorbio Cloud platform ([80]https://cloud.majorbio.com).

Metabolome Analysis of Cecal Contents

   A total of 50 mg sample was added to a 2 mL centrifuge tube and a 6 mm
   diameter grinding bead was added. A total of 400 μL of extraction
   solution (methanol: water = 4:1 (v:v)) containing 0.02 mg/mL of
   internal standard (L-2-chlorophenylalanine) was used for metabolite
   extraction. Samples were ground by the Wonbio-96c (Shanghai wanbo
   biotechnology co., LTD) frozen tissue grinder for 6 min (−10 °C,
   50 hz), followed by low-temperature ultrasonic extraction for 30 min (5
   °C, 40 kHz). The samples were left at −20 °C for 30 min, centrifuged
   for 15 min (4 °C, 13000 g), and the supernatant was transferred to the
   injection vial for LC-MS/MS analysis.

   The intracellular metabolic profile was conducted on a Thermo UHPLC-Q
   Exactive HF-X system equipped with an ACQUITY HSS T3 column (100 mm ×
   2.1 mm i.d., 1.8 μm; Waters, USA) at Majorbio Bio-Pharm Technology Co.
   Ltd. (Shanghai, China). The mobile phases consisted of 0.1% formic acid
   in water: acetonitrile (95:5, v/v) (solvent A) and 0.1% formic acid in
   acetonitrile: isopropanol: water (47.5:47.5:5, v/v) (solvent B). The
   flow rate was 0.40 mL/min and the column temperature was 40 °C. The
   injection volume was 3 μL.

   The mass spectrometric data were collected using a Thermo UHPLC-Q
   Exactive HF-X Mass Spectrometer equipped with an electrospray
   ionization (ESI) source. The scan range was from 100–1000 m/z for
   positive and negative ion mode. The detailed parameters were as
   follows: sheath gas temperature, 325 °C; capillary voltage of 3500 V
   (+) and 3500 V (-). The pretreatment of LC/MS raw data was performed by
   Progenesis QI (Waters Corporation, Milford, USA) software. The data
   matrix obtained by searching database was uploaded to the Majorbio
   cloud platform ([81]https://cloud.majorbio.com) for data analysis.

Fecal Microbiota Transplantation

   The procedure of fecal microbial transplantation (FMT) was carried out
   in accordance with the previous study.[82]^18^,[83]^19 Ten donor mice
   were randomly divided into two groups including Control group and
   QCHS_JPBS group (n=5). Collect feces from mice treated with the
   QCHS_JPBS formula for 14 days or from control mice. A total of 100 mg
   of feces were resuspended in 1 mL of sterile saline solution. The
   solution was vigorously mixed for 15s, then centrifuged at 800×g for 5
   min and the supernatant was collected. Fresh transplant material was
   prepared within 10 min prior to oral administration on the day of
   transplantation to avoid changes in bacterial composition.

   The recipient mice were fed with antibiotic water (500 μg/mL
   ampicillin, 500 μg/mL metronidazole, 250 μg/mL vancomycin, and
   500 μg/mL neomycin) for 10 days to clear the gut microbiota. Recipient
   mice were randomly assigned into three groups (n=6): Control→Control
   group, Control→DSS group, QCHS_JPBS→DSS+QCHS_JPBS group. Each group of
   mice was given transplant material for 10 consecutive days. On the 4th
   day, 2.5% DSS (w/v) was administered to induce enteritis for 7
   consecutive days. Subsequently, the mice were euthanized and colon
   tissue was collected.

Network Pharmacology Analysis

   The mechanism of QCHS_JPBS formula in relieving UC was further explored
   using network pharmacological analysis. The TCMSP database
   ([84]https://www.tcmsp-e.com/) was used to MOL-ID tag the identified
   components. The disease targets of the components were predicted
   ([85]http://www.swisstargetprediction.ch/). The UC therapeutic targets
   were retrieved from the OMIM database ([86]https://omim.org/),
   Genecards database ([87]https://www.genecards.org), TTD database
   ([88]https://db.idrblab.net/ttd/), and Drugbank database
   ([89]https://go.drugbank.com). Target names were converted to gene
   symbols using the UniProKB database ([90]https://www.uniprot.org) and
   subsequently input into the STRING database ([91]https://string-db.org)
   for protein-protein interaction (PPI) analysis. The interaction
   networks were visualized using Cytoscape software
   ([92]https://www.cytoscape.org/). Gene Ontology (GO) enrichment and
   Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment
   analysis were conducted using the Metascape databases
   ([93]https://metascape.org/). The results were imported and visualized
   on a bioinformatics platform ([94]https://www.bioinformatics.com.cn/).

Statistical Analysis

   Statistical analyses were conducted with Prism 8 software (GraphPad
   Software, La Jolla, CA, USA). Data are expressed as the means ± S.E.M.
   One-way ANOVA was used for comparing the mean differences between
   multiple groups. A value of P < 0.05 was defined as a significant.

Results

QCHS_JPBS Formula Promotes Recovery of DSS-Induced Colitis in Mice

   To investigate the therapeutic effect of QCHS_JPBS formula in UC,
   DSS-induced colitis mice were treated with QCHS_JPBS formula, with
   5-ASA as a positive control. The body weight of mice recovered after
   treatment with QCHS_JPBS formula or 5-ASA compared to their starting
   weight ([95]Figure 1a), meanwhile the DAI score was dropped after
   QCHS_JPBS formula or 5-ASA treatment ([96]Figure 1b). In addition,
   there was a significant lengthening trend of colon after QCHS_JPBS
   formula treatment ([97]Figure 1c and [98]d). The results of H&E
   staining revealed that QCHS_JPBS formula or 5-ASA restored the
   DSS-induced damage in colon villous morphology and crypt. The QCHS_JPBS
   formula treatment groups obviously alleviated the pathological
   condition ([99]Figure 1e and [100]f). QCHS_JPBS formula could also
   reduce the expression level of inflammatory factors and promote the
   expression level of anti-inflammatory factors in intestinal tissue
   ([101]Figure 1g). Altogether, these results demonstrated that QCHS_JPBS
   formula therapy improved the symptoms of UC mice.

QCHS_JPBS Formula Repairs the Intestinal Epithelial Barrier in DSS-Induced
Colitis Mice

   Since UC can result in direct damage to the intestinal epithelial
   barrier, the healing of the mucosa has emerged as the latest goal in UC
   treatment. Therefore, whether the QCHS_JPBS formula could repair the
   damaged intestinal epithelial barrier in UC mice has been investigated.
   The results of immunofluorescence showed that QCHS_JPBS formula
   treatment could significantly promote the expression of MUC2 and
   Occludin proteins, thereby reducing intestinal mucosal damage
   ([102]Figure 2a and [103]b). ZO-1 and Claudin4 were improved after
   treatment with QCHS_JPBS formula at both mRNA and protein levels
   ([104]Figure 2c–f). In addition, The PAS staining evaluation results
   showed that QCHS_JPBS formula treatment could increase mucoprotein
   secretion ([105]Figure 2g). These results implied that the
   administration of QCHS_JPBS formula could significantly augment the
   mucosal integrity in DSS-induced colitis.

QCHS_JPBS Formula Promotes ISC Differentiation in DSS Induced-Colitis Mice

   Research shows that the differentiation of ISCs is a core link in the
   repair of UC-damaged intestinal epithelium. Therefore, whether
   QCHS_JPBS formula has an impact on the differentiation of ISCs will be
   further investigated. The structure of the colon crypt was observed
   using transmission electron microscopy, and the results revealed that
   the integrity of the colon crypt structure in mice treated with
   QCHS_JPBS formula was higher compared with the model group ([106]Figure
   3a). The results showed that compared with the DSS group, the mRNA
   expression levels of ISC differentiation markers, such as LGR5, Msi-1
   and Olfm4, were elevated in colon tissues after intervention with
   QCHS_JPBS formula ([107]Figure 3b). In addition, Western blotting and
   immunofluorescence assays also showed that the protein expression
   levels of LGR5 and Mis-1 were significantly increased after the
   intervention of QCHS_JPBS formula ([108]Figure 3c–e). These results
   indicated that QCHS_JPBS formula could promote the differentiation of
   ISCs.

   What’s more, research was conducted on the subtypes of ISC
   differentiation promoted by QCHS_JPBS formula. The results revealed
   that the number of colon goblet cells labeled with AB-PAS staining
   increased after the intervention of QCHS_JPBS formula compared with the
   model group ([109]Figure 4a). Subsequently, the effect of the QCHS_JPBS
   formulation intervention on the differentiation of Paneth cells and
   endocrine cells was assessed using RT-qPCR assays. The results of this
   study showed that the QCHS_JPBS formulation had no significant effect
   on the expression of two cell-specific markers, Lysozyme and
   Chromogranin A, respectively, compared to the model group ([110]Figure
   4b). Furthermore, colon tissue immunofluorescence demonstrated similar
   results ([111]Figure 4c and [112]d). In summary, these results
   suggested that the subtype of ISCs differentiation mainly controlled by
   QCHS_JPBS formula was goblet cells.

QCHS_JPBS Formula Restores Gut Dysbiosis in DSS-Induced Colitis Mice

   As the commensal microbiota in the intestine has a key role in
   sustaining intestinal balance, and dysbiosis of the intestinal
   microbiota has been shown to be closely associated with the onset and
   progression of colitis. Therefore, 16S rRNA sequencing was used to
   detect the structural changes in the gut microbiota of UC mice after
   the intervention of QCHS_JPBS formula. The results showed differences
   in the number and structure of OTUs in the gut microbiota of mice
   between groups ([113]Figure 5a and [114]b). Principal component
   analysis (PCA) showed significant differences in gut microbiota β
   diversity among the normal group, model group, and QCHS_JPBS formula
   group mice. The above results suggested that the intervention of
   QCHS_JPBS formula could alter the intestinal microbiota structure of UC
   model mice ([115]Figure 5c). Subsequently, the differences in the
   relative abundance of gut microbiota among the three groups were
   analyzed. At the phylum level, the abundance of Firmicutes increased,
   while the abundance of Bacteroidetes decreased in the feces of
   DSS-induced colitis mice, and the intervention of QCHS_JPBS formula
   could reverse this change ([116]Figure 5d). At the genus level, the
   relative abundance of Clostridia and Lactobacillus increased, while the
   relative abundance of Faecalibaculum and Muribaculaceae decreased in
   the feces of DSS induced colitis mice, and the intervention of
   QCHS_JPBS formula could reverse this change ([117]Figure 5e). Heat-map
   analysis and linear discriminant analysis effect size (LEfSe) analysis
   indicated that after QCHS_JPBS formula treatment, the abundance of
   dominant bacteria shown an upward trend ([118]Figure 5f and [119]g).
   These results illustrated that QCHS_JPBS formula could modulate the gut
   microbiota to attain a new homeostasis by restoring the abundance of
   dominant bacteria.

QCHS_JPBS Formula Regulates Metabolic Disorders in DSS-Induced Colitis Mice

   Metabolites are important mediators for the gut microbiota to exert
   effects. Therefore, untargeted metabolomics was conducted to
   investigate the effect of QCHS_JPBS formula on the fecal metabolomics
   of DSS-induced colitis mice. The metabolic changes in the three groups
   of mice were investigated using principal component analysis (PCA). The
   results showed significant differences in the metabolic structure of
   feces among the three groups of mice ([120]Figure 6a). In addition,
   OPLS-DA showed metabolites that potentially contributed to the
   classification of the samples ([121]Figure 6b). The Venn diagram
   visually displays the common and unique differential metabolites
   between each group ([122]Figure 6c). The overall differences
   metabolites between the QCHS_JPBS formula groups and model groups were
   demonstrated using volcano and heat maps ([123]Figure 6d and [124]e).
   Pathway analysis of differential metabolites was conducted based on the
   KEGG database. The results showed that signaling pathways such as
   sphingolipids metabolism were enriched ([125]Figure 6f). Together,
   these results provided clear evidence that DSS-induced colitis mice
   exhibited significant metabolic disorders in feces, and QCHS_JPBS
   formula could restore metabolic imbalances in UC mice.

Figure 6.

   [126]Figure 6
   [127]Open in a new tab

   QCHS_JPBS formula regulates metabolic disorders in DSS-induced colitis
   mice. Mouse feces were subjected to non-target metabolomics analysis
   based on UHPLC-MS. (a) The PCA scores plots of samples under positive
   and negative ion mode. (b) The PLS-DA scores plot of samples under
   positive and negative ion modes. (c) The Venn diagram analysis of
   different metabolites among three groups. (d) The volcano plot shown
   significant changes in metabolites between QCHS_JPBS formula and the
   model group, with each point representing a metabolite. (e) The heatmap
   shown the changed concentrations of potential significantly
   differential metabolites. (f) A schematic diagram of metabolic pathways
   displayed based on differential metabolites.

QCHS_JPBS Formula Promotes Intestinal ISCs Through Gut Microbiota

   To further clarify the positive effects of QCHS_JPBS formula mediated
   through the gut microbiota and its effects on intestinal inflammation
   response, the microbiota originating from QCHS_JPBS formula-treated
   mice was transferred to DSS-fed mice, and then assayed for
   colitis-related traits ([128]Figure 7a). The results showed that mice
   receiving the QCHS_JPBS formula-treated donor microbiota recovered
   faster. This result was also demonstrated in body weight recovery and
   DAI decrease compared to DSS-treated recipients of control microbiota
   ([129]Figure 7b and [130]c). Moreover, a statistically significant
   trend was lengthened colon in the recipients of microbiota from
   QCHS_JPBS formula-treated donors compared to the control ([131]Figure
   7d and [132]e). The H&E staining results showed a decrease in
   histopathological scores in the recipients of microbiota from QCHS_JPBS
   formula-treated donors ([133]Figure 7f and [134]g).

Figure 7.

   [135]Figure 7
   [136]Open in a new tab

   QCHS_JPBS formula promotes recovery of DSS-induced colitis in mice
   through gut microbiota. The microbiota of QCHS_JPBS formula-treated
   mice were transferred to DSS-fed mice, and then subjected to
   examination of colitis-related traits. (a) Diagram illustrating the
   mouse model of colitis employed in this study. (b) Percent body weight
   change. (c) DAI evaluation. (d and e) Colon length. (f and g) H&E
   staining and pathologic scoring of colon tissue. Data are expressed as
   the means ± S.E.M., ^##P < 0.01 versus Normal-Trans, **P < 0.01 versus
   DSS-Trans.

   In addition, the mRNA expression levels of ISC differentiation markers,
   such as LGR5, Msi-1 and Olfm4, were elevated in colon tissues after the
   intervention with microbiota from QCHS_JPBS formula-treated donors
   ([137]Figure 8a). What’s more, Western blotting and immunofluorescence
   assays also showed that the protein expression levels of LGR5 and Mis-1
   were significantly increased after the intervention with microbiota
   from QCHS_JPBS formula-treated donors ([138]Figure 8b–d). Finally,
   AB-PAS staining showed that the number of epithelial cells was higher
   in mice treated with QCHS_JPBS-formulated donor microbiota ([139]Figure
   8e). These results suggest that the QCHS_JPBS formula promotes ISC
   integration via the gut microbiota, thereby repairing the mucosal
   barrier in colitis.

Figure 8.

   [140]Figure 8
   [141]Open in a new tab

   QCHS_JPBS formula promotes ISCs through gut microbiota. (a) The
   expression levels of LGR5, Msi-1 and Olfm4 mRNA in colon tissue. (b)
   The expression levels of LGR5 and Msi-1 protein in colon tissue. (c and
   d) Immunofluorescence staining for LGR5 and Msi-1 in colon tissue. (e)
   AB-PAS staining of colon tissue. Data are expressed as the means ±
   S.E.M., ^##P < 0.01 versus Normal-Trans, **P < 0.01 versus DSS-Trans.

Analysis of Potential Anti-Colitis Mechanisms of QCHS_JPBS Formula Using
Network Pharmacology

   The main representative components, such as Astragaloside IV,
   Atractylenolide III, Isopsoralen, Chrysin, Baicalin, Berberine, Gallic
   acid, Costunolide, and Glycyrrhizin, were identified by comparing the
   retention time in QCHS_JPBS formula, which demonstrated that the major
   ingredients of QCHS_JPBS formula had stability and reproducibility. The
   chromatogram and chemical structure of the representative components
   involved in the QCHS_JPBS formula were depicted in [142]Figure 9. In
   addition, a total of 79 active ingredients were identified and listed
   in [143]Table 2.

Figure 9.

   [144]Figure 9
   [145]Open in a new tab

   Identification of representative ingredients in QCHS_JPBS formula using
   UHPLC-MS/MS. (a) The positive mode. (b) The negative mode. (c) The
   chemical structure and extracting ion chromatography (EIC) of
   representative compounds in QCHS_JPBS formula.

Table 2.

   QCHS_JPBS Formula Identified Component Information
   No. Name RT(min) Formula Class Precursor_Type pos/neg Intensity MOL ID
   1 Gallic acid 1.3200 C7H6O5 Phenylpropanoids [M+H]+ pos 105683218.3
   MOL000513
   2 Psoralen 0.5967 C11H6O3 Phenylpropanoids [M+H]+ pos 13854726.2
   MOL001950
   3 Angelicin 6.6100 C11H6O3 Phenylpropanoids [M+H]+ pos 98264223150
   MOL003590
   4 Chrysin 4.6667 C15H10O4 Flavonoids [M+H]+ pos 158026696.7 MOL002560
   5 Salvigenin 5.9200 C18H16O6 Flavonoids [M-H]- neg 16781386.57
   MOL002915
   6 Liquiritin 5.3567 C21H22O9 Flavonoids [M+H]+ pos 167494793.4
   MOL004903
   7 Isorhamnetin 5.5350 C16H12O7 Flavonoids [M-H]- neg 435247362.4
   MOL000354
   8 Formononetin 6.7283 C16H12O4 Flavonoids [M-H]- neg 4571298623
   MOL010586
   9 Lupiwighteone 7.8067 C20H18O5 Flavonoids [M+H]+ pos 107096463
   MOL003656
   10 Costunolide 5.9683 C15H20O2 Terpenoids [M+HCOO]- neg 776729150.2
   MOL010825
   11 Glycyrrhizin 5.0050 C42H62O16 Terpenoids [M-H]- neg 988315071.7
   MOL004876
   12 Berberine 5.3000 [C20H18NO4]+ Alkaloids [M+H]+ pos 4800455169
   MOL001454
   13 Kaempferol 5.5150 C15H10O6 Flavonoids [M+H]+ pos 5041255402
   MOL000422
   14 Palmatine 5.6800 [C21H22NO4]+ Alkaloids [M-NH3+H]+ pos 10984582594
   MOL000785
   15 Wogonin 0.5450 C16H12O5 Flavonoids [M+H]+ pos 67163057.84 MOL000173
   16 Glabranin 8.1300 C20H20O4 Flavonoids [M+H]+ pos 3038143286 MOL004910
   17 (-)-dehydrocostus lactone 5.2283 C15H18O2 Terpenoids [M+H]+ pos
   306314612 MOL001298
   18 Atractylenolide iii 5.9883 C15H20O3 Terpenoids [M+H]+ pos
   788776509.2 MOL000181
   19 Acacetin 5.8733 C16H12O5 Flavonoids [M-H]- neg 6381366350 MOL001689
   20 Quercetin 5.8583 C15H10O7 Flavonoids [M-H]- neg 595853879.3
   MOL000098
   21 Astragaloside iv 6.3150 C41H68O14 Terpenoids [M+HCOO]- neg
   19898885.61 MOL000409
   22 Coptisine 6.1900 C19H14NO4+ Alkaloids [M-NH3-H]- neg 24070705.44
   MOL001458
   23 Naringenin 4.1567 C15H12O5 [M-H2O-H]- neg 65274032.76 MOL004328
   24 Moupinamide 3.9550 C18H19NO4 [M+H]+ pos 42965457.97 MOL008647
   25 Baicalin 3.8950 C21H18O11 [M-H]- neg 355673621.3 MOL002776
   26 Medicarpin 6.9717 C16H14O4 [M+HCOO]- neg 41161804.43 MOL002565
   27 Vestitol 6.7233 C16H16O4 [M+HCOO]- neg 9640128.732 MOL000500
   28 Liquiritigenin 6.5833 C15H12O4 Flavonoids [M+H]+ pos 184934778.1
   MOL001792
   29 Ononin 5.4533 C22H22O9 [M+H]+ pos 978433773.7 MOL000391
   30 Caffeic acid 5.0950 C9H8O4 Phenylpropanoids [M-H2O+H]+ pos
   159036985.3 MOL000414
   31 Vanillic acid 2.1500 C8H8O4 Phenols [M-H2O+H]+ pos 64103985.47
   MOL011357
   32 Emodin 7.1950 C15H10O5 Quinones [M+NH4]+ pos 36059070.69 MOL000472
   33 Oroxindin 4.9283 C22H20O11 Flavonoids [M-H]- neg 27039148638
   MOL013068
   34 Alpinetin 6.3933 C16H14O4 Flavonoids [M+H]+ pos 470157395.2
   MOL000228
   35 Scutellarein 5.2033 C15H10O6 Flavonoids [M-H]- neg 724943912.2
   MOL002737
   36 Luteolinidin 1.0967 C15H11O5+ [2M+H]+ pos 295429705.1 MOL001870
   37 Palmitic acid 6.6000 C16H32O2 Fatty acids [M-H]- neg 267238648.9
   MOL000069
   38 Oleic acid 0.5967 C18H34O2 Organic acid [M+H]+ pos 11293263.45
   MOL000675
   39 Jatrorrhizine 5.3383 [C20H20NO4]+ Alkaloids [M+H]+ pos 420852024.6
   MOL006397
   40 Ferulate 7.3767 C10H10O4 Phenylpropanoids [M+Na]+ pos 66824815.72
   MOL000360
   41 Chlorogenic acid 3.9017 C16H18O9 Phenylpropanoids [M+H]+ pos
   662237138.9 MOL001955
   42 Magnoflorine 7.4050 C20H24NO4+ Alkaloids [M-NH3+H]+ pos 1649353549
   MOL000764
   43 Columbamine 5.2383 C20H20NO4+ Alkaloids [M+H]+ pos 964112673.1
   MOL001457
   44 Secoisolariciresinol 6.5383 C20H26O6 Phenylpropanoids [M-H]- neg
   195722373.2 MOL001938
   45 (+)-lariciresinol 7.4767 C20H24O6 Phenylpropanoids [M+HCOO]- neg
   19426528.25 MOL000416
   46 Luteolin 4.7950 C21H18O12 Flavonoids [M+H]+ pos 1326534085 MOL000006
   47 Scopoletin 5.7900 C10H8O4 Phenylpropanoids [M+H]+ pos 170751598.7
   MOL000040
   48 Syringin 3.8550 C17H24O9 Phenylpropanoids [M+NH4]+ pos 107014113.8
   MOL000347
   49 Myristic acid 7.0950 C14H28O2 Fatty acids [M+H]+ pos 67530221.49
   MOL001393
   50 Apigenin 4.8000 C21H18O11 Flavonoids [2M-H]- neg 451939949.6
   MOL000008
   51 Isobavachin 7.3900 C20H20O4 Flavonoids [2M-H]- neg 215599847.4
   MOL000448
   52 Bergapten 5.4383 C12H8O4 Phenylpropanoids [2M+H]+ pos 29716987.2
   MOL001945
   53 Geranyl acetate 4.8567 C12H20O2 [M+HCO3]- neg 23281640.85 MOL000128
   54 (+)-alpha-pinene 4.5700 C10H16 Terpenoids [M+H]+ pos 332677731.4
   MOL000485
   55 Techtochrysin 4.8517 C16H12O4 Flavonoids [M-H]- neg 145206860.1
   MOL009356
   56 (+)-trans-carveol 4.7333 C10H16O [M+H]+ pos 328650005.1 MOL004709
   57 Tricosanoic acid 7.6533 C23H46O2 Ketones, Aldehydes, Acids [M-H]-
   neg 124610694.9 MOL001993
   58 Ellagic acid 0.5450 C14H6O8 Phenols [M-H]- neg 696303.2103 MOL001002
   59 Cinnamaldehyde 1.4250 C9H8O [M+NH4]+ pos 705637330.3 MOL000991
   60 Hexanal 0.5967 C6H12O [M+NH4]+ pos 9075104.038 MOL000666
   61 Geranylacetone 5.0333 C13H22O [M+H]+ pos 79588506.3 MOL000724
   62 Beta-ionone 6.3317 C13H20O [M+H]+ pos 131838330.9 MOL002363
   63 (+)-beta-phellandrene 5.0667 C10H16 Terpenoids [M+H]+ pos
   46543036.94 MOL002028
   64 Isoliquiritigenin 4.0267 C15H12O4 Flavonoids [M+H]+ pos 113368137
   MOL001789
   65 Glycycoumarin 7.2383 C21H20O6 Flavonoids [M-H]- neg 622309838
   MOL004878
   66 Pinocembrin 4.7950 C15H12O4 Flavonoids [M+H]+ pos 2890567797
   MOL002844
   67 Castanin 8.1350 C17H14O5 Flavonoids [M+H]+ pos 128911808 MOL000467
   68 Liquiritin apioside 5.1833 C26H30O13 Flavonoids [M-H]- neg
   755870710.3 MOL004953
   69 Rutin 1.3583 C27H30O16 Flavonoids [M+HCOO]- neg 55101348.83
   MOL000415
   70 Coumarin 0.7117 C9H6O2 Phenylpropanoids [M-NH3+H]+ pos 451071644
   MOL000431
   71 Daidzein 4.5517 C15H10O4 Flavonoids [2M+H]+ pos 215500252.8
   MOL000390
   72 Nicotinic acid 1.1350 C6H5NO2 Vitamin [M+H]+ pos 659539726.4
   MOL000421
   73 Uridine 1.1817 C9H12N2O6 [M-H]- neg 892498554.8 MOL000059
   74 Eugenol 8.4300 C10H12O2 Phenylpropanoids [M-H2O+H]+ pos 10040138.66
   MOL000254
   75 Salidroside 3.1233 C14H20O7 Phenols [M+NH4]+ pos 31253594.95
   MOL002929
   76 Tyrosol 3.5517 C8H10O2 Phenols [M-H]- neg 5852216651 MOL002930
   77 Hyacinthin 3.7783 C30H27O13+ Flavonoids [M-NH3+H]+ pos 36674561.79
   MOL000714
   78 Pulegone 5.2767 C10H16O [M+Na]+ pos 205202953.1 MOL001972
   79 Danshensu 0.8917 C9H10O5 Phenols [M-OH+H]+ pos 34887585.13 MOL007134
   [146]Open in a new tab

   Network pharmacology analysis was performed to elucidate the underlying
   mechanism of QCHS_JPBS formula anti-colitis. With “ulcerative colitis”
   as the key word, A total of 2983 disease targets were gained from OMIM,
   GeneCards, TTD and Drugbank databases. A total of 752 therapeutic
   target proteins associated with 79 active ingredients of QCHS_JPBS
   formula were predicted. Then, the 362 overlapping targets were retained
   as candidate targets ([147]Figure 10a). To identify targets that have
   direct or indirect interactions, the 362 overlapping genes were
   imported into the STRING database and a PPI network was constructed,
   including 362 nodes and 7945 edges ([148]Figure 10b). For further
   visualization and analysis, above data were processed by Cytoscape
   3.9.1 to construct a novel hub network. Using the CytoNCA plug-in in
   Cytoscape, the core targets were mined according to the values of
   Degree (DC, >30) or, DC>49, Betweenness (BC, >1072) and Closeness (CC,
   >0.46), and then the top 21 were selected to build a network map of
   core targets with Cytoscape ([149]Figure 10c and [150]d). The top five
   targets are EGFR, STAT3, SRC, AKT1, and HSP90AA1, which can be
   considered as key targets in the anti-UC pharmacological mechanism of
   QCHS_JPBS formula. GO enrichment analyses of the 44 intersecting genes
   (DC>30) identified earlier revealed that the targeted genes were
   associated with biological processes (such as response to hormone and
   enzyme-linked receptor protein signaling pathway), cellular components
   (such as membrane raft and perinuclear region of cytoplasm), and
   molecular functions (such as protein kinase binding and
   phosphotransferase activity) ([151]Figure 10e). Finally, the results of
   KEGG found that JAK-STAT signaling pathway, Wnt signaling pathway and
   Calcium signaling pathway were closely related to UC ([152]Figure 10f).
   Based on the network pharmacology analysis, the anti-colitis effect of
   QCHS_JPBS formula may involve the above pathway.

Figure 10.

   [153]Figure 10
   [154]Open in a new tab

   Network pharmacological analysis of the targets and pathways of
   QCHS_JPBS formula action. (a) Venn diagram of common targets of
   QCHS_JPBS formula and UC. (b) The PPI network analysis of core targets.
   (c) Hub-network extracted from the PPI network based on the degree
   value (>30). (d) Hub-network extracted from the PPI network of the top
   21 targets based on the degree (>49), Betweenness (>1072) and Closeness
   (>0.46). (e) GO enrichment analysis for 44 key targets. (f) Sankey
   diagram for KEGG signaling pathway analysis.

Discussion

   Strategies for UC treatment are limited, and the current drug choices
   demonstrate shortcomings such as high recurrence rates and side
   effects, resulting in suboptimal efficacy.[155]^20 These shortcomings
   underscore the urgent need for safer, multi-targeted therapeutic
   alternatives. However, TCM treatment for UC has the advantages of being
   multi-targeted, having fewer side effects, and having stable efficacy.
   QCHS_JPBS formula consists of nine types of Chinese herbal medicines,
   among which single herbs or ingredients (such as Huanglian, berberine)
   can significantly alleviate the symptoms of DSS-induced
   colitis.[156]^21^,[157]^22 In this research, the pharmacological roles
   of QCHS_JPBS formula in improving ulcerative colitis were
   systematically elucidated, which were manifested as weight recovery,
   decreased DAI score, inhibition of colon length reduction, and
   decreased histopathological score. This work not only elucidates the
   pharmacological foundation of QCHS_JPBS formula but also advances its
   translational potential as a clinically viable, multi-faceted
   therapeutic strategy for UC management.

   The disruption of the intestinal epithelial barrier is an important
   pathological characteristic of UC. It is worth noting that the
   differentiation of ISCs is crucial for the repair of the intestinal
   epithelial barrier.[158]^23 Specifically, various types of intestinal
   epithelial cells, such as goblet cells and intestinal endocrine cells,
   are derived from the proliferation and differentiation of ISCs to
   maintain intestinal mucosal regeneration and repair after
   injury.[159]^24 In this study, QCHS_JPBS formula significantly promotes
   the differentiation of intestinal stem cells into goblet cells, which
   can secrete mucin to repair damaged intestinal mucosa. The proposal of
   these conclusions suggests that promoting the differentiation of ISCs
   may be an effective strategy for treating UC.

   Increased evidence suggests that gut microbiota and its metabolites
   play a crucial role in the occurrence and development of UC, including
   regulating immunity, participating in signal transduction, and
   protecting the intestinal mucosal barrier.[160]^25 On the one hand, UC
   patients exhibit characteristic changes in the diversity and abundance
   of gut microbiota compared to healthy individuals. Multiple bacteria
   were found penetrating the mucus layer in the intestinal tissue biopsy
   of UC patients.[161]^26 The reduction of specific beneficial functional
   bacteria (such as Bifidobacterium) and the increase of potential
   pro-inflammatory and harmful pathogenic bacteria (such as Enterococcus)
   lead to dysbiosis of the gut microbiota.[162]^27^,[163]^28 The
   interaction between microbiota and intestinal mucosal immunity jointly
   induces an inflammatory environment in the intestinal cavity, leading
   to impaired intestinal barrier function.[164]^29 In the present study,
   intervention with the QCHS_JPBS formulation reversed the DSS-induced
   increase in the abundance of Clostridia and Lactobacillus and decrease
   in the abundance of Faecalibaculum and Muribaculaceae in the feces of
   colitis mice. It is worth noting that the QCHS_JPBS formula
   intervention was able to elevate the relative abundance of Akkermansia
   genus, which has been shown to repair intestinal barrier function and
   thereby alleviate UC disease symptoms.[165]^30 These results indicated
   that QCHS_JPBS formula was able to modulate gut microbiota disruption
   in DSS-induced colitis mice.

   On the other hand, metabolites of gut microbiota also play an important
   role.[166]^31 UC patients have reduced short-chain fatty acids (SCFAs),
   abnormal tryptophan metabolism, and increased inflammation-associated
   metabolites (such as free arachidonic acid and deoxycholic acid) in the
   gut.[167]^32–34 In the DSS-induced colitis model, gavage administration
   of butyrate or indoleacrylic acid significantly improved UC disease
   symptoms in mice through mechanisms associated with the modulation of
   immunity and reduction of the inflammatory response.[168]^35^,[169]^36
   In the present study, the intervention of QCHS_JPBS formula could
   reduce the relative level of sphingosine 1-phosphate and sphinganine,
   which are mainly related to the sphingolipid metabolism pathway. The
   accumulation of sphingosine-1-phosphate, an important mediator on this
   pathway, can impairs the intestinal barrier function and exacerbate
   colitis.[170]^37 Therefore, QCHS_JPBS formula could restore metabolic
   imbalances in UC mice microbiota, thereby exerting anti-inflammatory
   effects.

   Multiple microbial communities coexist and closely interact with ISCs
   in the intestinal.[171]^38 Notably, metabolites are the bridge between
   the gut microbiota and ISCs interactions. The previously mentioned
   SCFAs have a promoting effect on ISC proliferation by inhibiting
   histone deacetylase activity.[172]^39 Lactate, a bacterial metabolite,
   regulates ISC self-renewal by enhancing target gene expression in the
   Wnt/β-catenin pathway.[173]^40 In addition, tryptophan is readily
   metabolized by the bacteria to a variety of biologically active amino
   acid derivatives. The latter can activate aryl hydrocarbon receptors
   and induce goblet cell differentiation in the gut, which is associated
   with the Notch and Wnt signaling pathways.[174]^41^,[175]^42 In the
   present study, FMT experiments showed that the bacteria intervened by
   the QCHS_JPBS formula promoted ISC differentiation and thus improved
   the symptoms of DSS-induced colitis. However, the metabolites that may
   be involved need to be further investigated.

   Network pharmacology provides new perspectives and methods for the
   study of Chinese medicine compounding, which helps to deeply understand
   the multi-pathway and multi-target action characteristics of Chinese
   medicine.[176]^43 In this study, network pharmacological analyses
   screened potential targets of QCHS_JPBS formula anti-UC, which included
   EGFR, STAT3, SRC, AKT1, and HSP90AA1. In addition, a number of
   signaling pathways were enriched, which included JAK-STAT signaling
   pathway, Wnt signaling pathway and Calcium signaling pathway. A
   multitude of evidence suggests that these targets and signaling
   pathways are closely related to the occurrence and development of
   UC.[177]^44–46 Of course, the importance of the above targets or
   pathways in the anti-UC role of QCHS_JPBS formula should be
   appropriately and divinely examined in future studies, especially in
   the direction of ISC differentiation.

Conclusion

   In summary, QCHS_JPBS formula promoted ISC differentiation,
   particularly in the direction of goblet cells, to repair the intestinal
   epithelial barrier of DSS-induced colitis. QCHS_JPBS formula also
   restored gut dysbiosis and regulated metabolic disorders in DSS-induced
   colitis mice. The conclusion drawn from the above experimental results
   is that QCHS_JPBS formula promotes the differentiation of ISCs through
   gut microbiota to repair the intestinal epithelial barrier in UC mice.

Acknowledgments