Abstract

   Goose parvovirus (GPV) poses a significant threat to the waterfowl
   industry as it results in a high mortality rate and stunted growth in
   surviving goslings, leading to significant economic losses. We used 120
   goslings and goose embryo fibroblasts inoculated with the GPV SYG61
   strain to study the pathogenesis of GPV by pathological and gene
   expression profile changes. Fourteen days after infection with the GPV
   SYG61 strain, goslings showed a mortality rate of 63.33%, along with
   dwarfism, significant weight loss, and severe histopathological lesions
   in the liver and jejunum. Serum analysis revealed a marked increase in
   the levels of immunosuppressive factors such as TGF-β and IL-10
   (p < 0.01 or p < 0.05), while the levels of pro-inflammatory cytokines
   such as IL-4, IFN-γ, TNF-α, and IgG remained unaffected. In addition,
   GPV infection inhibited the proliferation of goose embryo fibroblasts
   and induced apoptosis, as demonstrated by transcriptomic analysis,
   which identified 285 differentially expressed genes (DEGs). These DEGs
   were enriched in pathways involved in the negative regulation of cell
   proliferation (GO: 0008285, 19/276, LogP = −12.62) and skeletal system
   development (GO: 0001501, 25/227, LogP = −12.51), with key genes
   including IL6, CXCL8, PTGDS, PI15, MMP9, MMP13, MMP2, CCN3, and
   FAM180A. Other DEGs were linked to the IL-17 signaling pathway
   (hsa04657) and the regulation of programmed cell death (GO: 0043068).
   Notably, GPV infection activated both apoptosis and ferroptosis through
   the upregulation of key regulatory genes such as PTGS2, TF, and ASCL1
   (p < 0.01). These findings indicated that GPV infection triggers
   inflammatory responses and programmed cell death, leading to high
   mortality in goslings, disturbs the expression of genes related to
   growth and skeletal development, and causes growth retardation and
   dwarfism in infected goslings. This study provides valuable insights
   into the pathogenic mechanisms of GPV and offers potential strategies
   to mitigate its impact and improve the productivity of the waterfowl
   industry.

   Keywords: goose parvovirus, immunosuppression regulator factors,
   RNA-Seq, cell death, growth retardation, dwarfism

Introduction

   Goose parvovirus (GPV) causes gosling plague, which is the most serious
   disease in geese farming, with a range of clinical symptoms such as
   dysentery, liver hemorrhage, intestinal embolism, viremia, delayed
   growth, and death in goslings ([41]1, [42]2). The goose industry is an
   distinctive livestock industries in China. The meat geese output has
   reached approximately 515 million in 2023, accounting for 99% of Asia’s
   output and 94% of the world’s ([43]3). However, the high mortality and
   growth retardation caused by GPV lead to significant economic losses in
   meat production. In addition, GPV infection can be latent in adult
   geese but vertically transmitted to the next generation, thus making
   its prevention and control difficult ([44]4). The virus strain of GPV
   was first isolated by Dingyi Fang in 1961 from Yangzhou and was named
   SYG61 strain. The SYG61 strain was a standard virulent strain which was
   always used in laboratories to evaluate vaccine efficacy and immune
   protection or was attenuated to produce vaccine strains, such as
   SYG26-35 and SYG41-50. In 2015, a novel goose parvovirus (NGPV) that
   causes the short beak and dwarfism syndrome (SBDS) in waterfowl was
   detected in China, with typical clinical symptoms such as short beak,
   tongue protrusion, stubby tibia, lameness, and growth delay ([45]5,
   [46]6). This NGPV detection shows that mutation and recombination in
   GPV have altered the clinical pathogenicity and enhanced the
   pathogenicity of impaired skeletal development, resulting in dwarfism.

   The genomic structure and pathogenic mechanisms of parvovirus have been
   extensively investigated. It is well known that parvoviruses are the
   smallest and simplest single-stranded-DNA viruses that infect animals.
   They infect a broad range of species and can induce persistent, often
   subclinical infections, posing significant challenges to waterfowl
   farming and resulting in significant economic and health burdens
   ([47]7). The parvovirus genome contains two open reading frames (ORFs)
   that encode the non-structural protein Rep and the capsid protein VP,
   which are further translated into functional proteins. Specifically,
   the Rep protein is cleaved into NS1 and NS2, while VP is cleaved into
   VP1, VP2, and VP3 ([48]8).

   NS1 plays a crucial role in viral DNA replication, host gene
   regulation, and apoptosis due to its ATPase and deconjugase activities
   ([49]9, [50]10). NS2 synergizes with NS1 to promote the synthesis of
   viral nucleic acids and proteins ([51]11). Yan et al. showed that the
   goose parvovirus NS1 increases the expression of apoptosis-inducing
   factor (AIF) and reactive oxygen species (ROS), which activates the
   AIF–mitochondrial pathway and induces apoptosis in goose embryo
   fibroblast (GEF) cells ([52]12). This suggests that NS1 directly
   triggers host cell death, potentially promoting viral spread and
   persistence. Similarly, Xu et al. found that the C-terminal
   transactivation domain (TAD2) of the NS1 protein from parvovirus B19
   induces cell cycle arrest at the late S phase and G2 phase by
   activating the ATR–CHK1–CDC25C–CDK1 pathway while also triggering a DNA
   damage response (DDR) to facilitate viral DNA replication in human
   erythroid progenitor cells ([53]13). These findings highlight the
   multifunctional role of NS1 in manipulating host cellular processes and
   promoting viral replication. In addition, canine parvovirus (CPV) NS1
   induces apoptosis in HeLa cells through ROS accumulation and caspase
   activation, which demonstrates the conserved pro-apoptotic function of
   NS1 across parvovirus species ([54]14).

   The capsid protein VP plays a key role in viral virulence and
   pathogenicity, elicits specific antibody responses, and contributes to
   immune evasion ([55]15). Yang et al. reported that the NGPV VP1 protein
   interacts with IRF7, blocks the type I interferon signaling pathway,
   and helps the virus evade the immune system ([56]16). This immune
   evasion strategy allows the virus to establish persistent infections,
   which—though often subclinical—can have long-term impacts on host
   health. Mutations in the capsid protein of CPV affect its binding to
   transferrin receptor type 1 (TfR1), thereby modifying viral infectivity
   and host range ([57]17). VP proteins are also involved in
   immunosuppression, which can lead to long-term latent infections. For
   instance, bovine parvovirus VP1 inhibits IFN-β production via the
   RIG-I-like receptor pathway in bovine turbinate cells, allowing the
   virus to evade immune detection ([58]18). CPV also modifies capsid
   receptor and antibody binding sites, leading to host range switch and
   neutralization escape ([59]19). Although previous studies have shown
   that parvoviruses induce apoptosis in host cells, the specific
   mechanisms by which a GPV infection alters host gene expression to
   activate immune and inflammatory responses, induce apoptosis, and
   inhibit bone development are not well understood.

   To determine the changes induced by a viral infection that are involved
   in growth retardation and viral persistence in the host, we
   investigated the effects of GPV SYG61 strain infection in goslings and
   GEF cells. We analyzed the impact of SYG61 infection on body weight,
   serum inflammatory factor levels, histopathological changes, and
   proliferation and apoptosis of GEF cells. Furthermore, we carried out
   transcriptomic analysis to identify virus-induced changes in host gene
   expression. Our findings provide valuable insights into the mechanisms
   underlying GPV-induced growth retardation and latent infection and
   contribute to a better understanding of how viral factors and host
   responses interact to facilitate persistent infection and developmental
   abnormalities in geese.

Materials and methods

Animals and virus strains

   A total of 120 four-day-old healthy Sichuan white goslings and
   10-day-old goose embryos were acquired from the breeding geese kept in
   isolation facilities in Chongqing Anfu Poultry Research Base; all
   individual goslings were free of GPV and other pathogens (AI, GMPV,
   CoCV, AsTV, AR, etc.). A standard highly virulent GPV SYG61 strain
   maintained at the Poultry Research Institute of Chongqing Academy of
   Animal Sciences was used in this study. This SYG61 strain had a strong
   pathogenicity of 10^6.1ELD[50] /0.2 mL.

Challenge trial

   The goslings were randomly allocated into two groups (infected group
   and control group, 60 goslings per group), housed in four isolators (30
   goslings per isolator) in a BSL-2 laboratory, and fed the same
   commercial broodstock. The infected group was intramuscularly
   inoculated with 0.1 mL of GPV SYG61 allantoic fluid, while the control
   group received an equivalent dose of sterile saline. On days 3, 7, and
   14 postinfection, eight goslings from each group were randomly selected
   for blood collection via the jugular vein. The serum samples were sent
   to Shanghai Hengyuan Biotechnology, Co., for the analysis of
   inflammatory factors [interleukin (IL)-4, IL-6, IL-8, IL-10, INF-γ,
   TGF-β, TNF-α, and IgG], and the body weight of each group was measured
   14 days after infection. Tissues from the liver, spleen, jejunum,
   ileum, and other organs were collected from diseased and deceased
   goslings, fixed in 10% formalin, subjected to paraffin embedding, and
   stained with hematoxylin and eosin (HE). Six goslings from the control
   group were also randomly selected and subjected to autopsy, and the
   corresponding tissues were collected and processed similarly.

Isolation, cultivation, and infection of goose fibroblasts

   GEF cells were isolated from 10-day-old goose embryos following the
   conventional method. Cell density was determined, and the cells were
   inoculated on 12- well and 96-well cell plates, incubated with DMEM/F12
   medium containing 10% fetal bovine serum (FBS), and cultured at 38°C
   and 5% CO[2]. When the cell confluence reached 70%, they were
   inoculated with 10^6 copies and 10^5 copies GPV virus particles/well
   for 1 h [quantified by TaqmanPCR; the standard curve:
   y = −3.0664x + 39.395; R^2 = 0.9901; primer sequences:
   F-5’-GTTCCTTTCCACAGCATGTTC-3′, R-5’-CTGCTGCTGTCTACCTCATT-3′, P-5′-(FAM)
   CAGCCTGTCTAAGTCCTGTGAATGAG C (Eclipse)-3′]. Then, the medium was
   replaced with 5% FBS maintenance medium. The cells were monitored for
   cytopathic effects and harvested 48 h after infection for
   transcriptomic analysis, with five replicates per treatment.

Cell proliferation and apoptosis assay

   Goose fibroblasts were plated on 96-well plates (5 × 10^4 cells/well)
   with DMEM/F12 medium containing 10% FBS and cultured at 38°C and 5%
   CO[2]. Three wells were infected with the SYG61 strain at 70%
   confluence, and three wells received saline and served as controls.
   Cell proliferation was assessed 24 h after infection using the EdU
   assay (RIBOBio Co, Guangzhou, China). The cells were incubated with
   50 μM EdU for 2 h, fixed with 4% paraformaldehyde, stained with Apollo,
   and visualized under a fluorescence microscope (EVOS M5000,
   ThermoFisher, United States). EdU-positive cells were quantified in at
   least three separate fields. Apoptosis of the infected cells was
   measured 48 h after infection using the TUNEL assay (R11059.2, RIBOBio
   Co, Guangzhou, China), following fixation with 4% paraformaldehyde and
   permeabilization with 0.5% Triton-100. The cells were subjected to TdT
   enzyme reaction, followed by Apollo and DNA staining, and were observed
   under the fluorescence microscope.

Transcriptomic sequencing analysis of goose embryo fibroblasts infected with
GPV

   Total RNA was extracted from two groups of fibroblasts (five infected
   wells and five control wells) using Trizol reagent (Invitrogen Life
   Technologies, Carlsbad, CA, United States). RNA quality was assessed
   using RIN values according to the manufacturer’s instructions. cDNA
   libraries of the 10 samples were constructed using Illumina NEBNext^®
   Ultra™ RNA Library Prep Kits (New England Biolabs, NEB, Ipswich, MA,
   United States) according to the manufacturer’s instructions.
   Subsequently, cDNA libraries were purified, evaluated, and sequenced
   using the (Illumina, San Diego, CA, USA), (Beckman Coulter Inc., Brea,
   CA, USA) (Agilent Technologies, Santa Clara, USA) 2,100 system, and
   Illumina platform, respectively. After removing the adaptors,
   low-quality sequences, sequences with uncertain bases, and sequences
   less than 50 bp, the reads were mapped to the Tianfu meat goose genome
   using STAR 2.7.10b and were assembled Cufflinks
   ([60]http://cufflinks.cbcb.umd.edu/) ([61]20, [62]21). Significant DEGs
   were screened (q value< 0.05, fold change ≥2, and false discovery rate
   <0.01) and subjected to GO and KEGG pathway enrichment analysis on the
   Metascape web server.[63]^1 Protein–protein interaction (PPI) network
   analysis was carried out for the top 50 DEGs on the STRING
   database.[64]^2

RT-qPCR for the selected candidate DEGs

   To validate DEGs from the transcriptomic analysis, the RNA obtained
   after transcriptomic sequencing was transcribed into cDNA using
   GoScript™ Reverse Transcriptase (A5001, Promega, United States), and
   qPCR was performed using LightCycler96 (Roche, Swiss) with the GoTaq^®
   qPCR Master Mix (A6001, Promega, United States). GAPDH was selected as
   the endogenous gene. The primers of the candidate genes are presented
   in [65]Supplementary Table S1. The 2^−ΔΔCt method was used to calculate
   the relative mRNA expression level of the candidate genes. All analyses
   and figures were reproduced using (OriginLab, Northampton, MA, USA).

Statistical analysis

   All statistical analyses were conducted using IBM SPSS Statistics (v.
   19.0 IBM Corp., Armonk, NY, United States). The results were expressed
   as mean ± standard error of the mean (SEM), and p values of <0.05,
   <0.01, and <0.001 were considered significant, very significant, and
   extremely significant, respectively. One-way ANOVA and Student’s t test
   were used to determine whether the means of the two treatment groups
   were significantly different.

Results

GPV infection induces high mortality and stunted growth in goslings

   To determine the pathogenic effects of the highly virulent SYG61 strain
   of GPV, we challenged 60 four-day-old Sichuan white goslings with the
   virus via intramuscular injection and compared the effects with a
   control group of 60 goslings. Within 3 days of injection, significant
   clinical symptoms developed in infected goslings, including depression,
   diarrhea, and chilling. The SYG61 strain resulted in the death of 38
   goslings, with a mortality rate of 63.33% in the infected group.
   Fourteen days after infection, the average body weight of the surviving
   goslings was significantly reduced compared with the control group
   (445.51 ± 54.03 g vs. 606.79 ± 51.26 g, p < 0.01; [66]Table 1).
   Notably, 30 days postinfection, four goslings had a body weight of less
   than 800 g and showed visible signs of dwarfism, while the average body
   weight of the remaining surviving goslings and the control group was
   1,398 ± 72.56 g and 1,654 ± 60.44 g, respectively. These findings
   indicate that GPV infection results in severe stunted growth and high
   mortality in goslings.

Table 1.

   Effect of GPV infection on mortality rate, body weight, and cytokines
   of goslings.
   Groups Mortality rate 18-day body weight (g) 34-day body weight (g)
   TGF-β (ng/L) IgG (ng/L) TNF-α (ng/L) INF-γ (ng/L) IL-4 (ng/L) IL-6
   (ng/L) IL-8 (ng/L) IL-10 (ng/L)
   Infected group 0.63 445.51 ± 54.03^A 1,398 ± 72.56 g ^a
   337.89 ± 14.32^A 91.06 ± 6.06 287.14 ± 17.36 93.42 ± 6.53 141.8 ± 10.11
   47.83 ± 3.63 91.15 ± 5.26^A 73.21 ± 6.41^a
   Control group 0.00 606.79 ± 51.26^B 1,654 ± 60.44gb 322.90 ± 14.95^B
   90.94 ± 8.82 292.30 ± 17.4 92.01 ± 7.38 139.23 ± 10.93 47.26 ± 4.17
   82.90 ± 6.37^B 68.16 ± 4.49^b
   [67]Open in a new tab

   Each treatment group has 60 goslings. During the final weight
   measurement, only 22 goslings remained in the infected group and 38
   died. Each treatment group had eight copy samples in the serum
   cytokines level assay. Values with the same superscript letter show
   differences that are not significant (p > 0.05); those with different
   lowercase superscript letters show significant differences (p < 0.05);
   those with different uppercase superscript letters show extremely
   significant differences (p < 0.01).

GPV infection increases serum concentrations of immunosuppressive factors in
goslings

   Fourteen days after GPV infection, we measured serum concentrations of
   TGF-β, IgG, TNF-α, INF-γ, IL-4, IL-6, IL-8, and IL-10 using ELISA. As
   shown in [68]Table 1, the average concentrations of TGF-β and IL-10
   were significantly increased in the infected group (p < 0.01 or
   p < 0.05). Notably, the concentration of inflammatory cytokine IL-8 was
   also significantly increased (p < 0.01) in the infected group, with an
   average concentration of 73.21 ng/L. In contrast, there were no
   significant differences in serum levels of pro-inflammatory cytokines
   TNF-α, INF-γ, and IL-4 between the infected and control groups.
   Similarly, as expected, IgG concentrations remained unchanged. TGF-β, a
   critical immunosuppressive regulator, inhibits the proliferation of
   T-lymphocyte subpopulations and B lymphocytes while suppressing IgG,
   IgM, and TNF-α production ([69]22). IL-10, a cytokine synthesis
   inhibitory factor, also suppresses the production of various
   inflammatory cytokines, including IFN-γ, TNF-α, and IL-6 ([70]23,
   [71]24). These findings indicate that GPV infection significantly
   increases the serum levels of immunosuppressive factors, thereby
   impairing the antiviral response in goslings.

Clinical and histopathological findings following SYG61 strain infection

   Three days after the SYG61 strain injection, the infected goslings
   showed pronounced clinical symptoms, including depression, a fluffy
   coat, diarrhea, and chilling. Autopsy of the deceased goslings revealed
   marked intestinal enlargement, thin-walled structures, and accumulation
   of yellowish mucus ([72]Figure 1A). Histopathological examination of
   liver, spleen, and jejunum tissues from all deceased goslings indicated
   significant lesions. In the liver of the infected goslings, sludge and
   steatotic lesions were prevalent. Examination of the jejunum revealed
   degeneration and detachment of the mucosal epithelium, an increase in
   the number of vacuolated goblet cells, shortened and disintegrated
   intestinal villi, and notable inflammatory cell infiltration. In
   contrast, no microscopic lesions were detected in the control group
   ([73]Figure 1B). The replication of parvovirus depends on the host cell
   DNA replication machinery, which predominantly targets mitotically
   active tissues such as the intestine, reproductive tract, and
   erythrocytes, which elucidates that the severe intestinal lesions and
   resultant sepsis are due to GPV infection. Notably, 30 days after
   infection, several goslings in the infected group showed signs of
   dwarfism ([74]Figure 1C).

Figure 1.

   [75]Figure 1
   [76]Open in a new tab

   Clinical and histopathological observations in goslings infected with
   GPV. (A) SYG61-infected goslings showed depression, diarrhea, and
   death. (B) Results of the histopathological examination of the liver,
   spleen, and jejunum of dead goslings. Sludge and steatotic lesions were
   observed in the liver. Mucosal epithelium, degenerated and detached,
   was observed in the jejunum, the number of vacuolated goblet cells
   increased, the intestinal villi shortened and disintegrated, and the
   inflammatory cells infiltrated. The splenic red pulps were filled with
   a large number of erythrocytes, and the number of white pulp microsomes
   increased. (C) Several postinfection surviving goslings showed
   dwarfism.

Effects of GPV infection on cell proliferation and apoptosis in goose embryo
fibroblasts

   The infection of GEF cells with the SYG61 strain resulted in
   characteristic cytopathic effects. Under normal conditions, GEF cells
   showed a long, spindle-shaped morphology and were neatly arranged.
   However, after GPV infection, they underwent morphological changes,
   becoming rounded, aggregating into clusters, and exhibiting fusion with
   indistinct borders and enhanced refractoriness ([77]Figures 2A,[78]B).
   In addition, cell proliferation assays indicated a significant
   reduction in the number of EdU-positive fibroblasts in the infected
   group compared with the control group, demonstrating the inhibition of
   cell proliferation ([79]Figure 2C). Furthermore, apoptotic signals were
   clearly evident in the infected cells, which appeared to be detaching,
   whereas they were scarcely detectable in the control group ([80]Figure
   2D).

Figure 2.

   [81]Figure 2
   [82]Open in a new tab

   Effects of GPV infection on GEFs. (A) Normal goose fibroblasts were
   long and pike-shaped and neatly arranged. (B) The GPV-infected cells
   became rounded, aggregated into clusters 48 h after infection. (C) The
   number of EdU-positive cells was decreased in the GPV-infected group
   24 h after infection. (D) The apoptotic signal was increased
   significantly in the GPV-infected group 48 h after infection.

Effects of GPV infection on transcriptome in goose embryo fibroblasts

   The size of the transcriptomic data was 8.09–12.71Gb, and clean reads
   were mapped to the goose reference genome. The total mapped rate was
   higher than 88.5% for each sample ([83]Table 2). Analysis of the
   transcriptomic data revealed that GEF cells produced 285 significant
   DEGs (∣log2FC∣ ≥ 1, FDR ≤ 0.01) after GPV infection, of which 176 were
   significantly downregulated and 109 were significantly upregulated.
   These DEGs were primarily enriched in the negative regulation of cell
   population proliferation (GO: 0008285, logP = −12.62), skeletal system
   development (GO: 0001501, logP = −12.51), and IL-17 signaling pathway
   (hsa04657, logP = −12.25); positive regulation of cell migration (GO:
   0030335, logP = −11.11) and programmed cell death (GO: 0043068,
   logP = −9.64); and cellular response to external stimulus (GO: 0071496,
   logP = −8.94; [84]Figures 3A,[85]B). The downregulated DEGs were
   primarily enriched in skeletal system development (GO: 0001501,
   logP = −29.61), growth (GO: 0040007, logP = −12.77), and bone
   development (GO: 0060348, logP = −9.36). However, the most highly
   enriched GO terms of upregulated DEGs that were related to inflammation
   included the IL-17 signaling pathway (hsa04657, logP = −11.50),
   cellular response to cytokine stimulus (GO: 0071345, logP = −11.47),
   and regulation of cellular response to lipids (GO: 0071396,
   logP = −12.25; [86]Supplementary Figure S1). The DEGs were subjected to
   PPI network analysis. As shown in [87]Figure 3C, the close biological
   interactions of candidate DEGs, including C-X-C motif chemokine ligand
   8 (CXCL8), transferrin (TF), prostaglandin-endoperoxide synthase 2
   (PTGS2), matrix metallopeptidase 9 (MMP9), MMP2, IL6, family with
   sequence similarity 180 member A (FAM180A), and peptidase inhibitor 15
   (PI15), showed convergent pathways, including skeletal system
   development, cell proliferation, and inflammation. These findings
   reveal novel insights into the theory that GPV infection impairs
   skeletal development, negatively regulates cell proliferation, and
   accelerates programmed cell death and immunosuppression.

Table 2.

   Characteristics of reads from the transcriptome of goose embryonic
   fibroblast cells with different treatments.
   Samples Paired reads Data size(Gb) Unique reads Uniquely mapped (%)
   Multi-reads Multi-mapped (%) Total mapped (%)
   Blank1 33,581,015 10.0743045 28,926,625 86.14 1,083,847 3.23 89.37
   Blank2 28,044,066 8.4132198 24,782,909 88.37 836,753 2.98 91.35
   Blank3 26,967,596 8.0902788 24,062,042 89.23 780,480 2.89 92.12
   Blank4 34,837,440 10.451232 30,827,635 88.49 1,018,572 2.92 91.41
   Blank5 42,393,288 12.7179864 37,166,876 87.67 1,264,596 2.98 90.65
   GPV1 39,982,698 11.9948094 34,322,378 85.84 1,373,462 3.44 89.28
   GPV2 37,327,658 11.1982974 32,234,697 86.36 1,257,212 3.37 89.73
   GPV3 39,561,102 11.8683306 33,813,599 85.47 1,418,103 3.59 89.06
   GPV4 34,059,710 10.2179113 28,878,563 84.79 1,263,752 3.71 88.5
   GPV5 31,371,602 9.4114806 26,765,695 85.32 1,161,743 3.71 89.03
   [88]Open in a new tab

   Blank1–5 represent the fibroblast cell treatment with saline; GPV1–5
   represent the fibroblast cell treatment with 10^5 copies of the GPV
   SYG61 strain.

Figure 3.

   [89]Figure 3
   [90]Open in a new tab

   Functional enrichment and protein–protein interaction analysis of DEGs
   caused by GPV infection on GEFs. (A) The top 20 enriched pathways were
   listed. p-value cutoff at 0.01, and minimum enrichment at 1.5. (B)
   Heatmap shows the expression of the top 20 DEGs between control and
   GPV-infected groups. (C) The protein–protein interaction results of the
   top 50 DEGs. PPI enrichment p-value < 1.0e^−16.

Validation of DEGs via RT-PCR analysis

   To validate the candidate DEGs associated with GPV infection, we
   conducted an RT-PCR analysis on CXCL8, LTF, PTGS2, MMP9, MMP2, PGDFB,
   EXFABP, acyl-CoA synthetase long-chain family member 1 (ACSL1), CCN3,
   FAM180A, and PI15. It showed that compared with the control group, the
   mRNA levels of CXCL8, TF, PTGS2, MMP9, PGDFB, EXFABP, and ACSL1 were
   significantly increased in response to GPV infection with extremely
   significant upregulation (p < 0.001), whereas the mRNA levels of MMP2,
   CCN3, FAM180A, and PI15 were significantly or extremely significantly
   downregulated (p < 0.05 or p < 0.01, respectively). Notably, the
   relative mRNA level of transferrin (LTF) in infected fibroblasts
   increased more than 1,000-fold ([91]Figure 4C), thus reinforcing the
   transcriptomic data and providing strong evidence for the role of these
   DEGs in the host response to GPV infection.

Figure 4.

   [92]Figure 4
   [93]Open in a new tab

   Validation results of DEGs selected by RT-qPCR. Some candidate DEGs
   that are involved in skeletal development, negative regulation of cell
   proliferation, and cell death acceleration were selected and validated
   by RT-qPCR. *represents that the difference was significant at
   p < 0.05, **represents that the difference was significant at p < 0.01,
   and ***represents that the difference was significant at p < 0.001.

Discussion

   GPV is a small single-stranded-DNA virus with a 5.1-kb genome that is
   incapable of independent replication and relies on the host cell DNA
   replication machinery, which makes it more likely to infect mitotically
   active cells such as intestinal epithelial cells, germinal epithelium,
   and erythrocytes ([94]25). This explains why GPV infection is more
   severe in goslings, which have a high number of dividing cells, while
   causing subclinical infections in adults ([95]26). In the present
   study, the SYG61 stain resulted in a mortality rate of up to 63.33% in
   goslings and significantly suppressed weight gain and growth.
   SYG61-infected goslings had significantly lower body weight compared
   with controls (p < 0.01, [96]Table 1). As widely reported, NGPV causes
   SBDS in geese. Some SYG61-infected geese also showed signs of dwarfism
   ([97]Figure 1C).

   The transcriptomic analysis provided insights into the mechanisms
   underlying dwarfism after GPV infection. DEGs were enriched in pathways
   related to the negative regulation of cell proliferation (GO: 0001501,
   19/276, Log p = −12.62) and skeletal system development (GO:0008285,
   25/227, Log p = −12.51), including IL6, CXCL8, PTGDS, PTGS2, LTF, MGP,
   MMP9, MMP13, CCN3, OGN, TNFRSF11B, SFRP2, TBX15, PI15, FAM180A, and
   GPR68. Previous studies have shown that parvovirus B19 (B19V)
   significantly increases MMP9 activity and enhances the expression of
   TGF-β, NF-κB, IL-6, TNF-α, and IL-1β in skin fibrosis of systemic
   sclerosis ([98]27). The NS1 of B19V acts as a trans-acting
   transcriptional activator on the NF-κB site of the IL-6 promoter
   region, which can induce IL-6 production ([99]28). Consistent with
   these findings, our results showed that GPV infection also increases
   MMP9 and IL-6 mRNA expression and serum TGF-β levels in the infected
   group.

   IL-6 plays a role in inflammation and B-cell maturation and has also
   been shown to be crucial in skeletal development. In IL-6-overexpressed
   transgenic mice, osteopenia, severe alterations in bone
   microarchitecture, increased osteoclastogenesis, and reduced osteoblast
   activity were observed ([100]29). MMP9 is involved in bone resorption
   and regulates citric acid metabolism during the osteogenic
   differentiation of bone marrow mesenchymal stem cells. Increased serum
   levels of MMP9 are an indicator of decreased bone density and
   osteoporosis ([101]30, [102]31). CXCL8/IL8 functions as a major
   chemoattractant to neutrophils, which can induce inflammation and
   sustain the body in the inflammatory state ([103]32). CCN3 is
   associated with thinness due to insulin resistance and is known to
   negatively regulate bone regeneration and maintain bone density
   ([104]33). PI15 regulates cell proliferation and growth and reverses
   skeletal muscle atrophy ([105]34). Although the function of FAM180A is
   not well understood, it has been shown to be downregulated by TGF-β
   signaling, potentially playing a role in tissue regeneration ([106]35).
   In our study, we observed increased serum TGF-β levels and
   downregulated expression of FAM180A. In addition, serum levels of
   TGF-β, IL-8, and IL-10 were significantly increased in the infected
   group ([107]Table 1). TGF-β, an effector cytokine, is involved in
   immunosuppressive functions and regulates Treg and Th17 cell activity,
   as well as inhibiting stimulated T-cell proliferation ([108]22,
   [109]36). Our results showed significantly reduced proliferation of
   fibroblasts infected with GPV ([110]Figure 2C). The significant
   upregulation of CXCL8, IL-6, and MMP9, along with the downregulation of
   CCN3, PI15, and FAM180A, suggests that the impaired skeletal
   development and negative regulation of cell proliferation are key
   contributors to dwarfism in GPV-infected goslings. Furthermore, high
   serum levels of TGF-β and IL-10, along with low levels of IgG and
   pro-inflammatory cytokines (TNF-α, IFN-γ, and IL-4), may contribute to
   immunosuppression and persistent infection.

   GPV infection was also found to induce apoptosis in GEF cells, as
   evidenced by pronounced apoptotic signals in the infected cells
   compared with controls ([111]Figure 2D). Previous studies have shown
   that the NS1 protein of parvoviruses is involved in viral replication,
   induction of cell cycle arrest, DDR, and ultimately cell apoptosis or
   necrosis ([112]26, [113]37). Cyclins and cyclin-dependent kinases
   (CDKs) play a crucial role in controlling the cell cycle. The NS1
   protein of human parvovirus B19V significantly increases CDC2-cyclin B1
   kinase activity by phosphorylating cyclin A, cyclin B1, and CDC2 during
   viral replication ([114]13, [115]38). The NS1 protein of minute virus
   of mice was found to be associated with CDK inhibitors p21CIP1, cyclin
   A, CDK, cyclin E, and CDK2, resulting in S-phase and G2-phase cell
   cycle arrest ([116]39, [117]40). Meanwhile, multiple mechanisms have
   been proposed for parvovirus-induced apoptosis, including increased
   expression of pro-apoptotic genes p53, Bax, and Bad, as well as
   activation of caspase-3 and caspase-9. Transfecting the NS1 of B19V
   into human erythroid cell lines has been shown to increase the
   expression levels of apoptosis-related genes p53, Bax, and Bad and
   activate caspase-3 and caspase-9 ([118]41). The NS1 of CPV2 has been
   shown to increase the BAX/Bcl2 ratio, initiate the destruction of the
   mitochondrial membrane potential, and trigger the aggregation of ROS
   ([119]42, [120]43).

   According to our transcriptomic data, several important DEGs were
   enriched in the positive regulation of programmed cell death (GO:
   0043068, Log p = −9.64), such as FASLG, PTGS2, MMP9, IL6, Bcl2L11,
   ATF4, HMOX1, HOXA5, HTRA1, SFRP2, SLC9A1, and VNN. FASLG binds to FAS
   and initiates apoptosis through the FAS/FASLG signaling pathway, which
   plays a key role in immune regulation, including cytotoxic
   T-cell-induced cell death and activation-induced cell death of T cells
   ([121]44, [122]45). Bcl2L11 is a member of the BCL-2 protein family and
   functions as an apoptotic and ferroptosis activator ([123]46, [124]47).
   Notably, GPV infection also alters transcript levels of some genes
   associated with ferroptosis. Ferroptosis is a non-apoptotic form of
   programmed cell death, which is mainly related to iron metabolism
   disorder, imbalance in the amino acid antioxidant system, and lipid
   peroxide accumulation ([125]48). X.Q. et al. reported that
   ferroptosis-related upregulation of PTGS2, a marker for lipid
   peroxidation, is associated with inflammation and encephalitis caused
   by HSV-1 ([126]49). In our study, PTGS2 was significantly upregulated
   in GPV-infected fibroblasts, as was TF, with more than 1,000-fold
   upregulation. TF transports iron into the cytoplasm, where it can drive
   the Fenton reaction, generating large amounts of ROS that lead to lipid
   peroxidation and ferroptosis ([127]50). In addition, another
   ferroptosis promoter ACSL1 was also significantly upregulated in the
   GPV-infected group. ACSL1 incorporates α-eleostearic acid into specific
   lipid species, including DAGs and TAGs, thus forming a mass of lipid
   droplets and covalent lipid droplet polymers and triggering lipid
   peroxidation and ferroptosis ([128]51). We also observed lipid droplet
   accumulation in the liver of GPV-infected goslings ([129]Figure 1B).
   Overall, GPV infection of GEF cells upregulates genes associated with
   apoptosis and ferroptosis, leading to cell death and lysis. These
   findings underscore the multifaceted impact of GPV on host cellular
   mechanisms, which results in high mortality rates in infected goslings.

   In conclusion, our findings elucidate the detrimental effects of GPV
   infection in goslings and GEF cells, highlighting the virus’s role in
   inducing high mortality, growth retardation, and dwarfism. Furthermore,
   this study provides insights into the underlying mechanisms of these
   clinical symptoms, demonstrating that GPV infection activates apoptosis
   and ferroptosis, inhibits cell proliferation, disrupts skeletal
   development, and induces persistent immunosuppression. These findings
   enhance our understanding of the pathogenic mechanisms of GPV and
   interaction networks between GPV and its host.

Funding Statement

   The author(s) declare that financial support was received for the
   research and/or publication of this article. This research was
   supported by the Natural Science Foundation of Chongqing Project
   [CSTB2022NSCQ-MSX0988], Livestock Science and Technology Research and
   Dissemination Project (Livestock Science and Technology Innovation Team
   Cultivation Project, No.24518C-24), the Chongqing Scientific Research
   Institution Performance incentive project [22527 J], the Key R&D
   Project in Agriculture and Animal Husbandry of Rongchang (22534C-23),
   the Earmarked Fund for China Agriculture Research System (CARS-42-51)
   and the Germplasm Resources Collection, Utilization and Variety Trials
   Project of Chongqing Scientific Research institutions and Enterprises
   Consortium in 2024 (2131123).

Footnotes

   ^1 [130]http://metascape.org/

   ^2 [131]https://cn.string-db.org/

Data availability statement

   The datasets presented in this study can be found in online
   repositories. The names of the repository/repositories and accession
   number(s) can be found at: [132]https://www.ncbi.nlm.nih.gov/,
   PRJNA1175047.

Ethics statement

   All experiments involving animals were complied with the rules of the
   Animal Care and Welfare Committee of Chongqing Academy of Animal
   Sciences (Approval Number: XKY-20240327, Approval Date: March 2024) and
   approved by Laboratory animals- General code of welfare of the People’s
   Republic of China (GB/T 42011-2022).

Author contributions

   KZ: Conceptualization, Data curation, Methodology, Writing – original
   draft, Writing – review & editing. GG: Software, Writing – review &
   editing. ZC: Funding acquisition, Formal analysis, Methodology, Writing
   – review & editing. HZ: Investigation, Methodology, Visualization,
   Writing – review & editing. XZ: Data curation, Investigation, Writing –
   review & editing. QL: Data curation, Supervision, Validation, Writing –
   review & editing. LM: Visualization, Writing – review & editing. LW:
   Data curation, Investigation, Methodology, Writing – review & editing.
   YL: Supervision, Validation, Visualization, Writing – review & editing.
   QW: Conceptualization, Funding acquisition, Writing – review & editing.

Conflict of interest

   The authors declare that the research was conducted in the absence of
   any commercial or financial relationships that could be construed as a
   potential conflict of interest.

Generative AI statement

   The author(s) declare that no Gen AI was used in the creation of this
   manuscript.

Publisher’s note

   All claims expressed in this article are solely those of the authors
   and do not necessarily represent those of their affiliated
   organizations, or those of the publisher, the editors and the
   reviewers. Any product that may be evaluated in this article, or claim
   that may be made by its manufacturer, is not guaranteed or endorsed by
   the publisher.

Supplementary material

   The Supplementary material for this article can be found online at:
   [133]https://www.frontiersin.org/articles/10.3389/fvets.2025.1529978/fu
   ll#supplementary-material
   [134]Image_1.pdf^ (472.8KB, pdf)
   [135]Table_1.docx^ (15.5KB, docx)

References