Abstract

   Finding the molecular targets involved in the severity and drug
   resistance of Colorectal cancer (CRC) and applying targeted treatments
   against them is a promising approach. In this study, some candidate
   oncogenes related to disease severity and mortality were identified by
   extracting bioinformatics data, and the effect of
   Fe[3]O[4]@Glu-Cinnamon NPs on the survival of CRC cells (SW480) and the
   expression of these oncogenes was investigated. The NPs were
   characterized by FT-IR, XRD, DLS and zeta potential measurement, TEM
   and SEM imaging, EDS-mapping and VSM analysis. Cytotoxicity of the NPs
   was evaluated by the MTT assay and a flow cytometry analysis was done
   to investigate cell apoptosis/necrosis levels and cell cycle analysis
   of cancer cells. The Fe[3]O[4]@Glu-Cinnamon NPs with spherical
   morphology were correctly synthesized, containing no elemental
   impurities, with a size range of 26.8–60.2 nm, DLS of 213 nm, zeta
   potential of -15.4mV and maximum magnetization level of 20.33emu/g.
   Treatment of cancer cells with the NPs elevated primary and late
   apoptosis and cell necrosis levels to 20.85, 16.83 and 9.56% and
   treated cells were mainly arrested at the S and G2/M phases. The
   expression level of the oncogenes associated with mortality, SNAI1,
   THBS2 and INHBA reduced to 0.74, 0.66 and 0.7 folds, respectively. The
   magnetic properties of Fe[3]O[4] NPs enable their potential use in
   targeted drug delivery, allowing for site-specific accumulation within
   tumors. This could minimize systemic toxicity while enhancing treatment
   efficacy.

Supplementary Information

   The online version contains supplementary material available at
   10.1038/s41598-025-02189-3.

   Keywords: Colorectal cancer, Cinnamon, Iron oxide nanoparticles,
   Oncogene

   Subject terms: Cancer, Genetics, Molecular biology

Introduction

   Colorectal cancer (CRC) is among the leading causes of morbidity and
   mortality throughout the world as it is the third most common type of
   diagnosed cancer with an estimated 1.88 million new cases and 915,000
   deaths each year^[28]1. With a mortality percentage of ~ 49%, CRC is
   considered a major health problem, and the presentation of new
   diagnostic and treatment approaches to deal with this disease is one of
   the priorities of global health. The disease trend in high-income
   countries varies from region to region, declining, stabilizing, or
   increasing in the different areas. On the other hand, the disease has
   been growing in most developing and low-income countries^[29]2.

   Several contributing factors such as Genetics, lifestyle, age,
   ethnicity, diet, etc. are involved in the initiation and development of
   CRC, among which genetic factors are a main contributing determinant in
   the emergence of CRC. Three main molecular mechanisms have been
   proposed for the initiation and development of CRC, including
   chromosomal instability, CpG island methylator phenotype and
   microsatellite instability. Chromosomal instability, which initiates
   with mutations in the adenomatous polyposis coli, is the most commonly
   known triggering mechanism for CRC that leads to activation of the
   oncogene KRAS and inactivates tumor suppressor protein TP53^[30]3.
   Despite this, the subsequent molecular mechanisms involved in the
   development and virulence of CRC that contribute to the severity of the
   disease and mortality rate are less understood. Therefore, in-depth
   identification and characterization of the molecular mechanism of this
   disease and finding molecular targets for the targeted chemotherapy are
   among the research priorities.

   Early detection and effective treatment methods are two main goals in
   research studies on cancer biology. Nanotechnology provides promising
   results in cancer detection and treatment, aiming to provide molecular
   imaging, drug delivery, targeted therapy, etc^[31]4,[32]5. Accurate
   targeting of cancer tissues using nanoparticles has been associated
   with promising successes. Such an approach can improve the
   effectiveness of the treatment and minimize its side effects^[33]6. For
   this reason, the use of magnetic nanoparticles in the design of
   anti-cancer nanomedicines has attracted the attention of researchers.
   Due to their small size, nanoparticles can easily penetrate the host
   tissues, reach the cancerous tissues and enter the target cells^[34]6.
   Conducting magnetic nanoparticles using magnetic force provides
   efficient drug delivery to cancer cells. In addition to small size and
   magnetic properties, biocompatibility is another influential parameter
   in the use of nanoparticles in biomedical fields, including cancer
   diagnosis and treatment^[35]7. Despite having significant anticancer
   properties, many metal nanoparticles cannot have clinical applications
   due to their toxic properties on biological systems. Iron oxide
   nanoparticles can be considered among the most widely used metal
   nanoparticles in cancer diagnosis and treatment. Due to their magnetic
   properties, iron oxide nanoparticles can be used in the imaging of
   cancerous tumors to improve image contrast. Also, they can be
   considered as drug carriers for drug delivery to tumor tissues^[36]8.
   Moreover, the functionalization of iron oxide nanoparticles provides
   the possibility of controlled and stable drug release, which can
   improve the effectiveness of chemotherapy^[37]9. Besides, iron oxide
   nanoparticles are generally considered biocompatible and biodegradable,
   which makes them suitable for biomedical applications compared to other
   metal nanoparticles.

   Many bioactive compounds such as flavonoids, phenolics and proteins
   with anticancer potential have been identified in plant species^[38]10.
   Cinnamon, a dry substance from the bark of the Cinnamomum plant, has
   many uses in the food industry as a flavoring and aromatic
   substance^[39]11. Previous studies have shown that this substance
   contains a variety of bioactive compounds such as cinnamaldehyde and
   eugenol, which have inhibitory properties on cancer
   cells^[40]11,[41]12. Therefore, the bioactive compounds from
   cinnamaldehyde can be used for drug formulation against cancers.
   However, there are several limitations and challenges regarding its
   application in cancer treatment. Similar to many herbal bioactive
   compounds, the bioavailability of the bioactive compounds from cinnamon
   is relatively low, which means that the therapeutic molecules are not
   adequately absorbed by the tissues and are mainly excreted from the
   body^[42]13. Nanotechnology can be used to improve the bioavailability
   of such compounds. Magnetic nanoparticles can also be considered as
   tools for carrying and delivering such compounds to cancer tissues, a
   process that reduces the rapid clearance of the drug from the body and
   provides gradual drug release, thus improving their bioavailability and
   effectiveness. Studies have reported the biosafety of iron oxide
   nanoparticles and highlighted their potential for safe clinical
   application. Investigations into the long-term effects of iron oxide
   nanoparticles have shown that they can be effectively cleared from the
   body, indicating the promise of iron oxide nanoparticles as
   biocompatible agents in anticancer therapies^[43]14,[44]15.

   Functionalizing magnetic nanoparticles with cinnamon may enhance their
   therapeutic potential by facilitating targeted delivery while
   simultaneously exerting intrinsic anticancer effects. The
   bioavailability of cinnamon-derived compounds can be improved through
   nanoparticle conjugation, ensuring better cellular uptake and sustained
   release. The conjugation of cinnamon with magnetic nanoparticles allows
   for magnetic targeting, ensuring that the therapeutic effects are
   concentrated at the tumor site, and thereby reducing systemic
   toxicity^[45]16. This study has two main objectives; the first is to
   identify oncogenes associated with poor prognosis and mortality in
   colorectal cancer, with a specific focus on the upregulated genes
   SNAI1, THBS2, and INHBA, which were identified through TCGA data
   analysis. These genes were found to be significantly upregulated in
   colorectal cancer samples and are linked to critical malignancy
   pathways such as metastasis, angiogenesis, hypoxia, and inflammation.
   The second aim is to evaluate the effect of magnetic iron oxide
   nanoparticles conjugated with cinnamon extract on the expression of
   these genes in colorectal cancer cell lines.

Materials and methods

Data sources

   The flowchart presented in Fig. [46]1 illustrates the overall steps of
   the study. To identify genes whose expression changes might be
   associated with colorectal cancer malignancy, transcriptomic data from
   colon cancer (TCGA-COAD) were utilized
   ([47]https://portal.gdc.cancer.gov/projects/TCGA-COAD). Initially, raw
   data from this cancer type were downloaded using the TCGAbiolinks
   package
   ([48]https://bioconductor.org/packages/release/bioc/html/TCGAbiolinks.h
   tml). Subsequently, genes with zero or near-zero expression, based on
   the CPM (Count per Million) criteria, where CPM was less than 10 in 70%
   of samples, were removed from the expression matrix using the edgeR
   package
   ([49]https://bioconductor.org/packages/release/bioc/html/edgeR.html).
   Next, data normalization was performed using the TMM (Trimmed Mean of M
   values) method and the data were log-transformed to base 2. The
   resulting expression matrix was used for all analyses, including
   differential expression between groups and the investigation of the
   relationship between gene expression and patient prognosis. The TCGA
   data for colorectal cancer included 480 tumor samples at various stages
   and 41 normal samples. Additionally, the latest clinical data updates
   for TCGA-COAD were downloaded and incorporated into the analysis. For
   further validation, data from the GEO database were used, and raw
   microarray data with the accession number [50]GSE39582 were downloaded.
   This study comprised 566 colorectal tumor samples and 19 normal colon
   samples. Initial preprocessing of these data included background
   correction, normalization based on the RMA method, and log2
   transformation of the data using the limma package. Finally, the
   resulting expression matrix was used to examine differential gene
   expression.

Fig. 1.

   [51]Fig. 1
   [52]Open in a new tab

   The flowchart that illustrates the overall steps of the study.

Preprocessing of clinical and prognostic data

   The clinical data from TCGA-COAD were used to investigate the
   correlation between the expression of candidate genes and patient
   mortality rates in colorectal cancer. Initial preprocessing of the
   clinical data involved excluding samples with survival days recorded as
   0, 1, or NA. Additionally, for deceased samples, only those were
   considered where the death was due to the presence of a tumor and
   cancer was the cause of death. To examine the relationship between the
   expression of candidate genes and patient mortality rates, the
   expression levels of all candidate genes for the samples meeting the
   specified clinical criteria were first extracted. Then, the expression
   of each candidate gene across all samples was standardized to a
   Z-score. The univariate Cox regression test was used to assess the
   association between the expression of the candidate genes and patient
   prognosis. To further validate the results, Kaplan-Meier (K-M) curves
   were employed. For this analysis, the cancer samples were divided into
   two groups—High and Low—based on the median expression of the candidate
   genes, and the relationship between gene expression levels and patient
   mortality rates was examined using the K-M curves.

Databases

   To identify pathways associated with candidate genes, the Enrichr
   database ([53]https://maayanlab.cloud/Enrichr/) and the MSigDB
   repository were utilized. Additionally, for constructing
   protein-protein interaction (PPI) networks, the STRING database
   ([54]https://string-db.org/) was employed.

Synthesis of nanoparticles

   Synthesis of iron oxide (Fe[3]O[4]) nanoparticles (NPs) was performed
   according to the method described by Mahdavi Niyaki et al. (2024) with
   minor modifications^[55]17. In brief, 3.2 g of FeCl[2].4H[2]O and 7.6 g
   of FeCl[3].6H[2]O were dissolved in deionized water and maintained at
   85 °C for 60 min. Next, NH[3] solution was added and the solution was
   kept at 85 °C and low flow N[2] was applied until the formation of
   Fe[3]O[4] NPs. The synthesized NPs were collected and dried and then,
   subjected to functionalization with D- glucose. To functionalize the
   NPs, at first one gram of the synthesized NPs and 500 mg of D-glucose
   were dissolved in deionized water, and sonication was applied for
   30 min to disperse the particles. Next, the mixture was heated at
   180 °C for 3 h. Finally, the functionalized NPs were collected and
   dried at 65 °C. At the final step, the NPs were conjugated to cinnamon
   extract (Sigma-Aldrich, reagent grade: ≥ 95%,). In brief, one gram of
   the functionalized NPs and 100 µL of cinnamon were dissolved in
   distilled water and the mixture was shaken overnight. Then, the
   Fe[3]O[4]@Glu-Cinnamon NPs were collected, washed with distilled water
   and dried at 65 °C.

Physicochemical properties of the NPs

   A Perkin-Elmer spectrum 100 FT-IR instrument was employed to determine
   the functional groups of the synthesized nanoparticles and cinnamon in
   an absorption wavelength range between 500 and 4000 cm^− 1. The crystal
   structure of the Fe[3]O[4]@Glu-Cinnamon NPs was investigated using an
   XRD device (Philips PW1730, (Cu-Kα X-ray tube, λ = 1.54056 A) and at 2θ
   from 10 to 80 degrees. Electron microscopy was done using SEM (TESCAN
   Mira3) and TEM (Zeiss EM900) microscopes to determine the morphological
   features of the NPs. The elemental composition of the NPs was
   determined using Energy-Dispersive X-ray spectroscopy (EDS)(TESCAN
   Mira3). The DLS and zeta potential measurement analysis was also done
   by a HORIBA Scientific SZ-100 zeta sizer. The magnetic properties of
   Fe[3]O[4]@Glu-Cinnamon NPs were investigated using a VSM device
   (Meghnatis Daghigh Kavir company, LBKFB).

Cell lines and cell survival assay

   The studied cell lines, including a colorectal cancer cell line (SW480)
   and a normal human cell line (HEK293), were received from the Pasteur
   Institute of Iran. The cells were cultured in Dulbecco’s modified Eagle
   medium (DMEM) in 25 cm^2 cell culture flasks and after reaching
   confluency of 80%, the cells were harvested, their density was adjusted
   to 1 × 10^5 cell/mL and used for the cell viability assay. To perform
   the assay, at first, 100 µL of cell suspension was added to the wells
   of a 96-well cell culture plate and then, treated with different
   concentrations of cinnamon and Fe[3]O[4]@Glu-Cinnamon NPs (0, 31.25,
   62.5, 125, 250, 500 and 1000 µg/mL). The cells were incubated for 24 h
   after which their survival level was quantified using the MTT
   (2-(4,5-dimethythiazol-2-yl) -2,5-diphenyltetrazolium bromide),
   according to the method described by Esfahani et al.^[56]18. In brief,
   200 µL of 0.5 mg/mL MTT solution was added to the wells and incubated
   for 4 h. Then, the medium was removed and 200 µL of DMSO was added and
   kept at 25 °C for 30 min with shaking at 100 rpm. Finally, the OD at
   570 nm was measured and the effect of cinnamon and
   Fe[3]O[4]@Glu-Cinnamon NPs on the cell viability was calculated as
   follows^[57]19:
   graphic file with name d33e417.gif

Flow cytometry

   Flow cytometry assay was used to evaluate to quantify the population of
   apoptotic, necrotic and healthy cells in nanoparticle-treated and
   control groups. At first, the colorectal cancer cells were treated with
   an IC[50] concentration of the Fe[3]O[4]@Glu-Cinnamon NPs for 24 h.
   Then, the cells were subjected to staining with propidium iodide (PI)
   and Annexin V (BioLegend, USA). Next, the frequency of cell apoptosis
   and necrosis was quantified by a flow cytometry device (ZE5, Bio-Rad,
   USA).

   A Flow cytometry analysis was also performed to analyze the cell cycle
   phases of the treated and control CRC cells. After a 24-hour treatment,
   the cell culture medium was aspirated, 200 µL of cold ethanol was
   added, and after evaporation of ethanol, the cells were stained with PI
   and RNase A. Finally, the DNA content of the cells, which is an
   indicator of the cell cycle phases, was quantified by a flow cytometry
   device.

Hoechst staining

   To investigate the possible nuclear damage in SW480 cells due to
   exposure to Fe[3]O[4]@Glu-Cinnamon NPs, the cells were treated with an
   IC[50] concentration of the NPs for 24 h. Next cell staining was done
   with Hoechst dye for 10 min. Next, the cells were examined under a
   fluorescent microscope and compared with untreated stained
   cells^[58]20.

Real-time PCR

   Based on the bioinformatics investigation, that was described above,
   the effects of the Fe[3]O[4]@Glu-Cinnamon NPs on the expression level
   of the oncogenes SNAI1, THBS2 and INHBA was investigated using a
   real-time PCR assay. The cells were treated with the NPs for 24 h,
   after which their RNA content was extracted using a BioLegend
   commercial kit and cDNA was prepared using the SinaClone kit (Iran).
   The fragments were amplified using specific primers (Table [59]1),
   which were designed using the Gene Runner software (version 6)
   ([60]https://gene-runner.software.informer.com/6.0/) and SYBR-Green
   real-time PCR assay kit (Denazist, Iran) in an ABI 7500 thermocycler
   device. The GAPDH gene was used as the housekeeping gene to normalize
   the real-time PCR data and the relative expression levels of the genes
   were calculated using the 2^−ΔΔCT method, as described by Pfaffl et
   al.^[61]21.

Table 1.

   Sequence of the primers that were used in this work.
   Gene  Sequence (5–3′)                                Product length (bp)
         Forward               Reverse
   SNAI1 TAGCGAGTGGTTCTTCTGCG  AGGGCTGCTGGAAGGTAAAC             164
   THSB  CTCGGTCCGGAACACTGAAA  CACAGAGCCAGCAGGACC               106
   INHBA GCTCAGACAGCTCTTACCACA AAAAGGCCCTGCTTTTCCTCC            172
   GAPDH CCCACTCCTCCACCTTTGAC  CATACCAGGAAATGAGCTTGACAA         75
   [62]Open in a new tab

Statistical analysis and software

   All initial preprocessing of the raw data from TCGA and GEO was
   conducted using the R programming language (version 4.0.2), leveraging
   the latest updates of the aforementioned packages. To analyze
   differential expression between groups, the linear model approach was
   used, and the significance level was determined using the False
   Discovery Rate (FDR) test. For assessing the significance of
   survival-related analyses, the log-rank test was applied. All figures
   and charts were generated using GraphPad Prism software (version 8).
   The experimental assays were done in triplicates and one-way ANOVA was
   used to evaluate significant differences between treatment groups and
   p-values of less than 0.05 was considered as statistically significant.

Results

Expression changes of multiple genes in colorectal cancer and their
association with patient mortality rates

   To identify genes whose expression changes might be associated with the
   malignancy of colorectal cancer, TCGA data were utilized. Differential
   expression analysis revealed that a total of 1,052 genes were
   significantly upregulated in cancer samples compared to normal ones,
   with criteria of logFC > 1 and FDR < 0.01 (Fig. [63]2). Furthermore,
   2,107 genes showed significant downregulation with criteria of logFC <
   -1 and FDR < 0.01 (Fig. [64]3). The relation between the expression of
   these identified genes and patient survival rates was also examined.
   Cox regression analysis indicated that upregulation of 1,726 genes was
   significantly associated with poor prognosis (HR > 1 and
   log-rank < 0.05) (Fig. [65]3A). The overlap between the 1,052
   upregulated genes and the 1,726 genes linked to poor prognosis revealed
   that 53 genes exhibited both characteristics (Fig. [66]3B). Conversely,
   738 genes were found to have increased expression associated with a
   good prognosis (Fig. [67]3A). The overlap analysis of downregulated
   genes and those associated with a good prognosis identified 115 genes
   with both attributes (Fig. [68]3C). Ultimately, 53 genes were
   identified as having both significant upregulation and association with
   poor prognosis, while 115 genes were downregulated and associated with
   a good prognosis. These genes were selected for further analysis. These
   findings suggest that the identified candidate genes might play a role
   in the pathogenesis of colorectal cancer.

Fig. 2.

   [69]Fig. 2
   [70]Open in a new tab

   Differential expression analysis of multiple genes in Colorectal
   Cancer. The results revealed that a total of 1052 genes were
   significantly upregulated in cancer samples compared to normal ones and
   2107 genes showed significant downregulation.

Fig. 3.

   [71]Fig. 3
   [72]Open in a new tab

   Relation between the expression of the identified genes and patient
   survival rates. A total number of 53 genes were identified as having
   both significant upregulation and association with poor prognosis,
   while 115 genes were downregulated and associated with a good
   prognosis.

Association of candidate genes with malignancy pathways

   To gain further insights into the candidate genes, their associated
   pathways were investigated. Enrichment analysis of the 53 upregulated
   genes indicated that many of them are involved in cellular processes
   such as metastasis, angiogenesis, hypoxia, and inflammation
   (Fig. [73]4A). Conversely, the enrichment analysis for the 115
   downregulated genes associated with a good prognosis suggested that
   some are involved in pathways like fatty acid metabolism, propanoate
   metabolism, and the citrate cycle (Fig. [74]4B). These results suggest
   that the candidate genes are linked to pathways associated with
   malignancy, such as metastasis and metabolic alterations. Using the PPI
   network, hub genes were identified. For the 53 upregulated genes
   associated with poor prognosis, 18 genes were found to be
   interconnected (Fig. [75]5). PPI network analysis revealed that among
   these, SERPINE1, SPP1, SNAI1, THBS2, and INHBA1 had the highest degree
   of interaction (degree > 7) and could be considered hub genes for this
   group (supplementary file). Conversely, for the 115 downregulated genes
   associated with a good prognosis, 36 genes were identified as
   interconnected (Fig. [76]6). PPI network analysis showed that ACOX1,
   ACO2, ACSS2, PPARGC1A, and CLCA1 had the most interactions with other
   genes (supplementary file). These findings indicate that these genes
   might play crucial roles in the pathogenesis of colorectal cancer.

Fig. 4.

   [77]Fig. 4
   [78]Open in a new tab

   Association of candidate genes with malignancy pathways. Enrichment
   analysis of the 53 upregulated genes indicated that many of them are
   involved in cellular processes such as metastasis, angiogenesis,
   hypoxia, and inflammation (A) and the 115 downregulated genes
   associated with a good prognosis suggested that some are involved in
   pathways like fatty acid metabolism, propanoate metabolism, and the
   citrate cycle (B).

Fig. 5.

   [79]Fig. 5
   [80]Open in a new tab

   Identification of hub genes using the PPI network for the upregulated
   genes. For the 53 upregulated genes associated with poor prognosis, 18
   genes were found to be interconnected, among which the SERPINE1, SPP1,
   SNAI1, THBS2, and INHBA had the highest degree of interaction
   (degree > 7).

Fig. 6.

   [81]Fig. 6
   [82]Open in a new tab

   Identification of hub genes using the PPI network for the downregulated
   genes. For the 115 downregulated genes associated with a good
   prognosis, 36 genes were identified as interconnected. The PXMP2,
   ACOX1, ACO2, ACSS2, PPARGC1A, and CLCA1 had the most interactions with
   other genes.

Physicochemical properties

   The FT-IR analysis of Fe[3]O[4] indicated sharp absorption peaks at 420
   and 580 cm^− 1 that are due to the Fe-O bond related to the Fe^2+ and
   Fe^3+ ions located at the octagonal phase and Fe^3+ at the tetragonal
   phase that indicate the formation of the Fe[3]O[4] structure^[83]22.
   The FT-IR of cinnamon exhibited absorption peaks at 557, 799 and
   896 cm^− 1 that belong to the C-C, C-H and = CH bonds, respectively.
   The peak at 1385 cm^− 1 is related to the C-C bond of the benzene ring
   of the cinnamon. The peaks at 1608, 1743 and 3431 cm^− 1 are associated
   with the C = O, C = C and –OH bonds of cinnamon. The spectrum c that
   displays the FT-IR pattern of Fe[3]O[4]@Glu-Cinnamon NPs shows a peak
   at 712 cm^− 1, related to the presence of Iron oxide, and several peaks
   at 1165, 1460. 1616 and 1746 indicate the presence of C-O, C-C, C = C
   and C = O bonds. The peaks at 2853, 2937 and 3435 indicate the presence
   of an O-H bond. Considering the presence of peaks related to Fe[3]O[4]
   and cinnamon in the structure of the composite, it can be concluded
   that the composite has been correctly synthesized (Fig. [84]7).

Fig. 7.

   [85]Fig. 7
   [86]Open in a new tab

   FT-IR of Fe[3]O[4] NPs (a), Cinnamon (b) and Fe[3]O[4]@Glu-Cinnamon NPs
   (c).

   The peaks at 2θ of 33.06, 35.61, 54.07 and 62.81 in the XRD spectrum of
   Fe[3]O[4]@Glu-Cinnamon NPs indicate the presence of the Iron oxide NPs
   and comply with the JCPDS card Number 03-0863^[87]18,[88]23. The peaks
   at 2θ of 30.12 may be due to the presence of D-glucose^[89]24. Also,
   due to the amorphous structure of cinnamon, Sharpie peaks can be seen
   at 2θ between 10 and 20° in this spectrum (Fig. [90]8). According to
   the electron microscopy images, the Fe[3]O[4]@Glu-Cinnamon NPs were
   almost spherical and their size ranged from 26.8 to 60.2 nm
   (Fig. [91]9a and b). In addition, the elemental composition of the NPs
   includes Fe (43.3 w%), C (35.2 w%) and O (21.6 w%) atoms that indicate
   the purity of the NPs (Fig. [92]9c). The DLS and zeta potential
   measurement analyses showed that the particle size in an aqueous medium
   was 213 nm and their surface charge was − 15.4 mV (Fig. [93]10a and b).
   Investigation of the magnetic properties of the Fe[3]O[4]@Glu-Cinnamon
   NPs by VSM analysis showed that the maximum magnetization level of the
   NPs was 20.33 emu/g, which was observed at an applied field of 14,000
   Oe (Fig. [94]11).

Fig. 8.

   [95]Fig. 8
   [96]Open in a new tab

   XRD spectrum of Fe[3]O[4]@Glu-Cinnamon NPs.

Fig. 9.

   Fig. 9
   [97]Open in a new tab

   (a) TEM and (b) SEM images and (c) EDS-mapping analysis of
   Fe[3]O[4]@Glu-Cinnamon NPs. The NPs contained no elemental impurity and
   were in a size range of 26.8–60.2 nm.

Fig. 10.

   [98]Fig. 10
   [99]Open in a new tab

   (a) DLS and (b) zeta potential analyses of Fe[3]O[4]@Glu-Cinnamon NPs.
   The surface charge and zeta potential of the NPs were 213 nm and − 15.4
   mV.

Fig. 11.

   [100]Fig. 11
   [101]Open in a new tab

   Magnetization curve of Fe[3]O[4]@Glu-Cinnamon NPs. The maximum
   magnetization level of the NPs was 20.33 emu/g, which was observed at
   an applied field of 14,000 Oe.

Cell survival assay

   Cell viability analysis, performed on the normal human cells, showed
   that Fe[3]O[4]@Glu-Cinnamon NPs significantly reduced cell viability
   levels at all studied concentrations. The IC[50] value of
   Fe[3]O[4]@Glu-Cinnamon NPs for the normal cell line (HEK293) was
   340 µg/mL. The IC[50] value of Fe[3]O[4]@Glu-Cinnamon NPs on the cancer
   cell line (SW480) was 127 µg/mL and the IC[50] value of cinnamon alone
   on cancer the cell line was 362 µg/mL (Fig. [102]12).

Fig. 12.

   [103]Fig. 12
   [104]Open in a new tab

   Cell viability assay. Viability percentage of the normal (a) and CRC
   (b) cell lines treated with different concentrations of
   Fe[3]O[4]@Glu-Cinnamon NPs. (c) Viability of CRC cells treated with
   different concentrations of cinnamon. The IC[50] value of
   Fe[3]O[4]@Glu-Cinnamon NPs for normal and CRC cells were 340 and
   127 µg/mL, respectively and IC[50] value of cinnamon alone for CRC
   cells was 362 µg/mL.

Flow cytometry

   Investigation of the effect of Fe[3]O[4]@Glu-Cinnamon NPs on the cell
   apoptosis/necrosis levels showed that the nanoparticles cause a
   considerable increase in the apoptosis and necrosis levels in the
   colorectal cancer cell line. The percentage of primary and late
   apoptosis in the untreated cells were 0.03 and 0.01%, respectively, but
   increased to 20.85 and 16.83% following the exposure to
   Fe[3]O[4]@Glu-Cinnamon NPs. In addition, the percentage of cell
   necrosis elevated from 3.98% in the control cells to 9.56% in the
   treated group. The results are presented in Fig. [105]13.

Fig. 13.

   Fig. 13
   [106]Open in a new tab

   Flow cytometry analysis of CRC cells. (a) control, (b) Treated with
   Fe[3]O[4]@Glu-Cinnamon NPs. Exposure to the NPs elevated primary and
   late apoptosis and cell necrosis levels. Q1; healthy cells, Q2: cell
   necrosis, Q3; late apoptosis and Q4; primary apoptosis.

   Cell cycle analysis of the control SW480 cell line showed that 62.7,
   21.90 and 14.2% of the cells were at the G0/G1, S and G2/M phases,
   respectively. In contrast, after treatment of the cells with
   Fe[3]O[4]@Glu-Cinnamon NPs, the frequency of the cells at the G0/G1
   phase reduced to 50.3% and 32.0% of the cells were at the S phase. In
   addition, a slight increase in the frequency of the cells at the G2/M
   phase was observed (16.1%) (Fig. [107]14).

Fig. 14.

   Fig. 14
   [108]Open in a new tab

   Cell cycle analysis of CRC cells. (a) control, (b) Treated with
   Fe[3]O[4]@Glu-Cinnamon NPs. Exposure to the NPs caused cell cycle
   arrest mainly at the S and G2/M phases.

Nuclear damage

   Hoechst staining of the SW480 cells showed that the exposure to
   Fe[3]O[4]@Glu-Cinnamon NPs causes severe nuclear damage such as
   chromatin condensation and fragmentation. In addition, apoptotic bodies
   were observed in the treated cells. Figure [109]15 displays Hoechst
   staining of the SW480 cells.

Fig. 15.

   [110]Fig. 15
   [111]Open in a new tab

   Hoechst staining of CRC cells. (a) control, (b) Treated with
   Fe[3]O[4]@Glu-Cinnamon NPs. Exposure to the NPs caused nuclear
   alterations such as chromatin condensation and fragmentation.

Gene expression

   Real-time PCR was employed to quantify the expression levels of the
   SNAI1, THBS2 and INHBA, the oncogenes associated with mortality in
   colorectal cancer. We found that the treatment of the SW480 cells with
   Fe[3]O[4]@Glu-Cinnamon NPs causes a significant reduction in the
   expression levels of all studied oncogenes. The expression level of the
   SNAI1 was reduced to 0.74 folds, and INHBA was downregulated to 0.70
   folds. In addition, a significant reduction was observed in the
   expression level of the THBS2 oncogene (0.66 folds). The results are
   displayed in Fig. [112]16.

Fig. 16.

   [113]Fig. 16
   [114]Open in a new tab

   The mRNA expression levels of the SNAI1, THBS and INHBA oncogenes in
   the CRC cells treated with Fe[3]O[4]@Glu-Cinnamon NPs relative to
   control cells. Exposure to the NPs reduced the mRNA levels of all
   oncogenes.

Discussion

   Colorectal cancer is a frequent disease and among a leading cause of
   mortality in cancer cases. An increasing trend in the mortality of
   colorectal cancer in many parts of the world has been observed. This
   increasing trend is associated with several factors such as changes in
   lifestyle and human diet, as well as late diagnosis and inefficient
   treatment^[115]25. Current treatment interventions include surgical
   removal of tumor tissues and adjuvant chemotherapy, which are
   unsuccessful in treating the disease in many cases. Targeted treatment
   of tumor tissues not only can reduce the side effects of treatment but
   also can improve the effectiveness of chemotherapy^[116]26. Magnetic
   nanoparticles have received attention in cancer chemotherapy as they
   are small enough to penetrate body tissues and can be delivered to the
   tumor tissues using a magnetic force. This approach provides the
   possibility of more effective drug delivery to the target tissues,
   which leads to more effective treatment. In this study, initially, the
   candidate oncogenes associated with mortality in CRC were identified
   using bioinformatic tools, then, the effects of Fe[3]O[4]@Glu-Cinnamon
   NPs on the viability of the colorectal cancer cells and expression of
   the selected candidate genes were characterized.

   Several factors such as the quality of precursor material and variation
   of reaction conditions such as temperature and stirring speed can
   affect the physicochemical and biological properties of the synthesized
   nanoparticles. Standardizing the synthesis protocol can help
   consistency and reduce Batch-to-batch variability in the synthesis of
   NPs^[117]27. The Fe[3]O[4]@Glu-Cinnamon NPs synthesized in this work
   exhibited similar physicochemical features to those synthesized in
   previous studies. Esfahani et al.^[118]18 synthesized
   Fe[3]O[4]@Glu-Cinnamon NPs and reported that the NPs were spherical,
   with a size range of 20–60 nm, and without impurities. In addition, the
   DLS size and zeta potential of the particles were 190 nm and − 14.1 mV,
   respectively, which were similar to our work.

   Cell viability assay indicated that Fe[3]O[4]@Glu-Cinnamon NPs were
   considerably more toxic to cancer cells than normal human cells. This
   observation is an important criterion in selecting potent anticancer
   agents. The higher susceptibility of cancer cells to the NPs may
   contribute to the functionalization of iron oxide NPs with glucose.
   Glucose is the main carbon source for human cells, which is used in
   various anabolic and catabolic pathways in human cells. Therefore,
   sufficient glucose uptake is crucial to guarantee normal metabolism and
   cell proliferation. Cancer cells have generally higher metabolic and
   proliferation rates than normal cells. It was found that high glucose
   levels can promote migration and invasion of colon cancer
   cells^[119]28. For this reason, cancer cells need to absorb larger
   amounts of nutrients from the surrounding environment to produce enough
   energy for their metabolic activities and create the precursors
   required for cell proliferation^[120]29. It seems that
   Fe[3]O[4]@Glu-Cinnamon NPs would have a higher uptake into the cancer
   cells than normal cells due to the functionalization with glucose,
   which leads to more efficient cytotoxic effects of the nanoparticles in
   cancer cells. The inhibitory effects of Fe[3]O[4]@Glu-Cinnamon NPs on
   cancer cells mainly contribute to the cytotoxic action of cinnamon. It
   has been reported that cinnamaldehyde-rich cinnamon induces cell death
   in colon cancer cell lines^[121]11. The IC[50] value of cinnamon alone
   on the cancer cell line was higher compared to the
   Fe[3]O[4]@Glu-Cinnamon NPs. It seems that the reason for this higher
   level is that the NP penetrates the cell more easily, but cinnamon
   cannot enter the cell easily. In agreement with previous studies, we
   found that cinnamon has dose-dependent toxicity in the cancer cell line
   SW480. The cytotoxic properties of cinnamon contribute to its
   cinnamaldehyde contents. Several mechanisms have been proposed for the
   cytotoxic effects of cinnamaldehyde. It was reported that
   cinnamaldehyde can significantly inhibit the proliferation of breast
   cancer cells and induce apoptosis through the peroxisome
   proliferator-activated receptor and PI3K-Akt pathway^[122]30.
   Additionally, it was found that cinnamaldehyde can trigger intrinsic
   apoptosis in the leukemia cell line through the generation of reactive
   oxygen species (ROS)^[123]31.

   Flow cytometry analysis revealed that exposure to
   Fe[3]O[4]@Glu-Cinnamon NPs increased cell apoptosis in CRC cells. This
   finding was in agreement with previous studies, which reported
   cinnamaldehyde can trigger apoptotic pathways in various CRC cell lines
   such as SW480, HT-29 and HCT^[124]32,[125]33. Reports are available
   about the induction of the intrinsic apoptosis in cancer cells by
   cinnamaldehyde, which are in agreement with our report^[126]30.
   Furthermore, we found that treated cells underwent nuclear alterations
   such as fragmented and condensed nuclei which are typical nuclear
   morphological changes that are observed in apoptotic cells. Similar
   apoptotic changes due to the treatment of CRC cells with cinnamaldehyde
   were observed by Li et al.^[127]32 which is in agreement with this
   study. Accordingly, the proapoptotic property of the synthesized NPs
   was found that is possibly associated with cinnamon.

   We also found that treatment with Fe[3]O[4]@Glu-Cinnamon NPs
   dysregulates the cell cycle of the CRC cell line. Previous works showed
   that cinnamaldehyde causes tubulin aggregation and dysregulates cell
   cycle regulatory proteins cdk1 and cdc25C in CRC cells. Exposure to
   cinnamaldehyde can increase the phosphorylation of cdk1 and reduce
   cdc25 levels, which results in an increased level of deactivated
   phosphor-cdk1, resulting in cell cycle arrest, mainly at the G2
   phase^[128]34. Additionally, the formation of cdk1/cyclin B1 complex is
   prohibited following exposure to cinnamaldehyde which would be likely a
   contributing cause of cell cycle arrest in the cells^[129]34. These
   events eventually cause cell cycle arrest in the treated cells and
   result in the initiation of apoptotic cell death.

   Real-time PCR showed that treatment with Fe[3]O[4]@Glu-Cinnamon NPs
   causes downregulation of the SNAI1, THBS2 and INHBA oncogenes in the
   cancer cell line. The SNAI1 gene encodes for a transcriptional factor
   SNAIL, which is typically overexpressed in fibroblast pathological
   conditions and contributes to the differentiation of epithelial cells
   to mesenchymal forms, which is associated to epithelial malignancy,
   invasion and metastasis^[130]35,[131]36. Additionally, overexpression
   of SNAI1 is a contributing mediator of resistance to anticancer drugs
   such as oxaliplatin and cetuximab in patients with CRC^[132]36.
   Additionally, it was found that SNAI1 is associated with the
   suppression of apoptosis and activation of the Wnt/β-catenin pathway
   that can promote the transformation of colorectal fibroblasts and the
   development of colitis-associated CRC^[133]37. In normal cells, SNAI1
   plays a key role in regulating epithelial-to-mesenchymal transition
   (EMT), contributing to cell migration, differentiation, and normal
   tissue development^[134]38. As observed in our study, the SNAI1 is a
   candidate gene associated with mortality from CRC. The attenuation of
   this gene in the cancer cells that were treated with
   Fe[3]O[4]@Glu-Cinnamon NPs suggests the promising inhibitory effects of
   the NPs on CRC cells.

   We found that treatment of the cancer cells with Fe[3]O[4]@Glu-Cinnamon
   NPs downregulated the THBS2 expression to 0.66 folds which is a
   significant reduction in the transcript level of the gene.
   Thrombospondin-2 (THBS2) has various biological effects such as
   involvement in cell adhesion, motility as well as angiogenesis. It was
   found that THBS2 has oncogenic effects, contributing to the
   invasiveness and development of several cancers. It was found that
   silencing of THBS2 contributes to the inhibition of cell proliferation
   and invasion of cancer cells in CRC^[135]38. Wang et al.^[136]39
   reported that THBS2 is highly expressed in CRC and associated with
   aggressiveness and migration of tumor cells through activation of the
   Wnt/β-catenin pathway. In normal cells, THBS2 is involved in
   extracellular matrix remodeling and plays a role in maintaining tissue
   homeostasis, regulating cell adhesion, and tissue repair. Inhibin βA
   (INHBA) is a member of the TGF-β superfamily which is associated with
   cell growth and differentiation through activation of the Smad2/Smad3
   signaling pathway. An association between the overexpression of the
   INHBA gene and the development of various cancers, including CRC, has
   been reported^[137]40. It was found that silencing of INHBA inhibits
   the activation of TGF-β that leads to inhibition of cell proliferation,
   migration and invasiveness^[138]41,[139]42. Therefore, this oncogene
   plays a crucial role in the development and severity of CRC. INHBA
   regulates cellular growth and differentiation through TGF-β signaling
   pathways, contributing to normal tissue homeostasis and repair^[140]43.
   The reduced expression of the SNAI1, INHBA and THBS2 oncogenes suggest
   that Fe[3]O[4]@Glu-Cinnamon NPs can interfere with several signaling
   pathways in the CRC cell line, which reduce cell proliferation and
   invasiveness, and induce cell death through activation of apoptotic
   pathways. Since these oncogenes strongly influence the invasion and
   aggressiveness of CRC and contribute to mortality from this disease,
   this study provides promising results in the treatment of CRC using
   Fe[3]O[4]@Glu-Cinnamon NPs. Although the laboratory study was limited
   to genes associated with poor prognosis, bioinformatics analyses also
   considered genes linked to good prognosis, such as ACO1, ACO2, ACSD2,
   and PPARGC1A. These genes play essential roles in maintaining cellular
   homeostasis and metabolic processes. ACO1 and ACO2 are involved in
   mitochondrial function and energy production, contributing to the
   overall metabolic balance in normal cells^[141]44. ACSD2 regulates
   fatty acid metabolism and membrane integrity, which are crucial for
   maintaining cellular structure and function. Additionally, PPARGC1A is
   a key regulator of mitochondrial biogenesis and oxidative stress
   response, supporting energy production and cellular adaptation to
   stress^[142]45. Future studies could explore these genes in greater
   detail to better understand their role in colorectal cancer progression
   and their potential therapeutic applications. Moreover, to confirm the
   therapeutic potential of Fe[3]O[4]@Glu-Cinnamon, future studies should
   evaluate their efficacy in colorectal cancer animal models.

   While our study demonstrates the downregulation of oncogenes (SNAI1,
   THBS2, and INHBA) and the induction of apoptosis, the exact molecular
   pathways underlying these effects remain to be fully elucidated. Future
   studies will focus on in-depth mechanistic analyses, including
   signaling pathway investigations and transcriptomic/proteomic profiling
   to determine the precise molecular interactions of
   Fe[3]O[4]@Glu-Cinnamon NPs with CRC cells. This was the limitation of
   our manuscript.

Conclusion

   In this study, the candidate oncogenes associated with the mortality of
   CRC were identified and the effect of Fe[3]O[4]@Glu-Cinnamon NPs on the
   survival of CRC cells (SW480) and the expression of these oncogenes was
   investigated. We found that the synthesized NPs reduced the viability
   of the CRC cells more efficiently than normal cells, and induced cell
   apoptosis/necrosis and cell cycle arrest at the S and G2/M phases in
   the CRC cells. In addition, the exposure to the NPs significantly
   reduced the expression of the mortality-associated oncogenes, SNAI1,
   THBS2 and INHBA. Fe[3]O[4]@Glu-Cinnamon NPs showed potent anticancer
   activity against CRC cells through apoptosis induction and attenuation
   of mortality-associated genes. The targeted delivery of cinnamon using
   the glucose-functionalized Fe[3]O[4] NPs provides an innovative
   approach for the treatment of CRC, however, further research
   considering the toxicity effects and stability at in-vitro conditions
   is essential. Conjugation of cinnamon to Fe[3]O[4]@Glu NPs can be
   considered for the development of safer therapeutics, aiming to explore
   these nanoparticles’ efficacy in preclinical models, paving the way for
   eventual clinical trials.

Electronic supplementary material

   Below is the link to the electronic supplementary material.
   [143]Supplementary Material 1^ (10.5KB, xlsx)

Author contributions

   A.S. and M.P.: Conceptualization. A.S. and M.P.: Methodology. A.S. and
   M.P.: Formal analysis and investigation. A.S., M.A.A.CH. and M.P.:
   Writing Original Draft Preparation. M.A.A.CH.: Resources. A.S. and
   M.P.: Supervision.

Funding

   This research received no specific grant from any funding agency in the
   public, commercial, or not-for-profit sectors.

Data availability

   Data is provided within the manuscript.

Declarations

Competing interests

   The authors declare no competing interests.

Footnotes

   Publisher’s note

   Springer Nature remains neutral with regard to jurisdictional claims in
   published maps and institutional affiliations.

References