Abstract

   Background: Tumor-associated macrophages (TAMs) are prevalent in
   advanced ovarian cancer tissues and ascites, significantly influencing
   disease prognosis. However, the mechanisms driving TAM polarization and
   their tumor-promoting effects remain poorly understood. Methods: The
   subcellular distribution of SNX10 in ovarian cancer tissues was
   analyzed using single-cell datasets ([36]GSE147082, [37]GSE58937). The
   Kaplan–Meier Plotter and GEPIA2 databases were used to evaluate SNX10’s
   prognostic relevance. Lentivirus-mediated SNX10 overexpression in THP-1
   cells was employed in tumor cell–macrophage co-culture experiments.
   Transwell assays and flow cytometry assessed SNX10’s effects on ovarian
   cancer cell metastasis and cisplatin-induced apoptosis. RNA sequencing,
   Western blotting, lysosomal pH detection, lipid droplet staining, and
   RT-qPCR were performed to explore SNX10’s molecular mechanisms in TAM
   polarization and immune modulation. Results: SNX10 was specifically
   expressed in TAMs, promoting their polarization into the M2 phenotype.
   This enhanced the migration and invasion of ovarian cancer cell lines
   A2780 and A2780/CP70 while reducing cisplatin-induced apoptosis. SNX10
   decreased lipid droplet content, downregulated p-mTOR1, and impaired
   lysosomal function in TAMs. Additionally, SNX10 differentially
   modulated PD-L1 mRNA expression in platinum-sensitive and
   platinum-resistant ovarian cancer cells. Conclusions: SNX10 regulates
   the mTOR1/lysosome pathway in TAMs, influencing lipid metabolism and
   indirectly modulating ovarian cancer cell metastasis. It also alters
   PD-L1 mRNA expression, suggesting a role in shaping the tumor immune
   microenvironment.

   Keywords: ovarian cancer, tumor associated macrophages, SNX10,
   lysosome, mTOR1

1. Introduction

   Ovarian cancer is one of the poorest prognostic gynecological
   malignancies, with a high recurrence rate and drug resistance
   [[38]1,[39]2]. Widespread peritoneal metastasis and platinum resistance
   are the key treatment challenges in ovarian cancer, and the exploration
   of novel treatment targets is urgently needed. The tumor
   microenvironment (TME) of ovarian cancer is composed of
   tumor-associated macrophages (TAMs), dendritic cells (DCs),
   neutrophils, regulatory T cells (Tregs), and myeloid-derived suppressor
   cells (MDSCs). These immune cells interact with tumor cells through the
   secretion of various cytokines and inflammatory mediators, thereby
   promoting tumor progression and inducing immunosuppression.

   TAMs, as immune cells in the tumor microenvironment, are implicated in
   the spread of many tumors [[40]3]. TAMs exhibit functional plasticity,
   polarizing into two distinct subsets: the classically activated M1
   phenotype and alternatively activated M2 phenotype. M1 macrophages
   predominantly secrete pro-inflammatory cytokines (IL-6, IL-12, TNF-α)
   that drive anti-tumor immunity. Conversely, M2-type macrophages
   primarily release immunosuppressive factors (IL-10, VEGF, Arg-1) that
   facilitate tissue remodeling, promote angiogenesis, and ultimately
   support tumor progression. Recent studies have demonstrated that the
   infiltration density of M2-type macrophages serves as a significant
   prognostic indicator in diverse malignancies.

   In ovarian cancer tissues, macrophages are one of the main invading
   immune cells, predominantly in the M2 phenotype [[41]4,[42]5].
   Macrophages make up the majority of the tumor microenvironment in
   ovarian cancer, implying their role in tumor growth, invasion, immune
   evasion, and treatment resistance [[43]6,[44]7]. M2-type macrophages
   promote epithelial–mesenchymal transition (EMT), proliferation,
   migration, and immune tolerance in ovarian cancer through the secretion
   of TGF-β, Arg-1, CCL17, CCL22, IL-10, and circTMCO3-enriched exosomes
   [[45]8,[46]9,[47]10].

   Although several studies have elucidated key molecular pathways driving
   macrophage polarization toward the M2 phenotype in TAMs and their
   functional implications in ovarian cancer [[48]11,[49]12], further
   exploration is still needed. Identifying molecules that govern the
   interaction of ovarian cancer cells with TAMs could lead to new
   therapeutic options for ovarian cancer metastasis prevention and
   treatment.

   SNX10, a protein with a phox homology domain that binds to
   phosphatidylinositol on membrane structures, is found in endosomes,
   lysosomes, and endoplasmic reticulum. It acts as an adapter protein,
   facilitating signal transduction and intracellular protein trafficking
   [[50]13,[51]14,[52]15,[53]16]. Recent studies have established that
   this gene plays a critical role in regulating macrophage-mediated
   inflammatory responses and lipid metabolism in colitis,
   atherosclerosis, and intestinal cancer [[54]17,[55]18,[56]19]. For
   instance, SNX10 deficiency induces macrophage reprogramming via the
   Lyn-AKT-TFEB signaling axis, attenuating foam cell formation and
   suppressing atherosclerosis progression. This suggests that SNX10 plays
   an important role in regulating macrophage function. However, it is
   unclear whether SNX10 regulates macrophage polarization and influences
   the biological activity of ovarian cancer.

   In this study, we investigated the role of SNX10 in macrophage
   polarization and elucidated the underlying molecular mechanisms.
   Utilizing a co-culture system, we show that SNX10-dependent macrophage
   reprogramming enhances ovarian cancer metastasis, chemoresistance, and
   immune tolerance. These findings provide critical insights into tumor
   immune microenvironment regulation and offer promising therapeutic
   avenues for treating advanced metastatic ovarian cancers.

2. Materials and Methods

2.1. Cell Culture and Co-Culture of Tumor Cells and Macrophages

   Ovarian cancer cell lines A2780 and A2780/CP70 were obtained from the
   Shanghai Key Laboratory of Female Reproduction Endocrine Related
   Diseases, Obstetrics and Gynecology Hospital, Fudan University. Human
   monocytic cell line THP-1 was purchased from Gasser Biotechnology Co.,
   Ltd. (Shanghai, China). The cells were grown in DMEM media (Gibco,
   Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) (Excellbio,
   Suzhou, China) and 1% penicillin–streptomycin (NCM Biotech, Suzhou,
   China). The platinum-resistant A2780/CP70 cell line requires
   maintenance with 5 μM cisplatin to preserve its drug-resistant
   phenotype. The cells were maintained at 37 °C in a humidified incubator
   with 5% CO[2]. The 100 ng/mL phorbol 12-myristate 13-acetate (PMA)
   (HY-18739, MedChemExpress, Monmouth Junction, NJ, USA) was utilized for
   converting THP-1 cells into macrophages for 48 h, and the THP-1 cells
   after PMA stimulation were called M0 macrophages. The co-culture system
   was constructed in 6-well plates by seeding ovarian cancer cells (1 ×
   10^5/well) in the transwell upper chamber, with M0 macrophages (2 ×
   10^5/well) maintained in the lower chamber, in which macrophages and
   tumor cells were plated at a 2:1 ratio.

2.2. Lentivirus Transfection

   Stable SNX10 overexpressing THP-1 cell lines and the negative control
   were generated by using lentiviral transduction and antibiotic
   selection. The SNX10-EO plasmid
   (PGMLV-CMV-H_SNX10-3×Flag-EF1-ZsGreen1-T2A-Puro) and the negative
   control were purchased from Genomeditech Co., Ltd. (Shanghai, China).
   Lentivirus was produced using packaging plasmids (Jiangyuan
   Biotechnology, Nanjing, China) with the following transfection ratio:
   transfer plasmid/psPAX2 (packaging plasmid)/pMD2.G (envelope plasmid) =
   7:5:2, and VigoFect (T001, Vigorous Biotech, Beijing, China) was used
   to transfect plasmids into HEK 293 T cells. After 48 h, the supernatant
   containing lentivirus was added to the THP-1 cells’ plates. After 72 h,
   2 μg/mL puromycin (HY-B1743A, MedChemExpress, NJ, USA) was added for
   SNX10 overexpressing cell selection.

2.3. Flow Cytometry Analysis

   In the transwell co-culture system, ovarian cancer cells were seeded in
   the upper chamber while M0 macrophages were plated in the lower
   chamber. When tumor cells reached 80% confluence, cisplatin was added
   at the IC50 concentration. After 48 h of treatment, cancer cells were
   harvested by trypsinization. Ovarian cancer cells were dyed with
   Annexin V-APC/PI apoptosis kit (Liankebio, Hangzhou, China) for 5 min
   in the dark at room temperature. PI was used to characterize the early
   stage of apoptosis, and APC was the late phase. CytoFLEX flow cytometer
   (Beckman 197 Coulter, Brea, CA, USA) was employed to detect the
   fluorescent-labeled cells, and the rate of apoptosis was measured by
   Flow Jo software (version 10.8.1).

2.4. RNA Sequencing Analysis

   RNA was extracted from the SNX10-EO THP-1 cells, negative control THP-1
   cells, and ovarian cancer cells using TRIZOL (9101, Takara, Kyoto,
   Japan). The mRNA sequencing and differential expression analyses were
   conducted at the Shanghai OE Biotech Co., Ltd. (Shanghai, China). The
   libraries were sequenced on a llumina Novaseq 6000 platform (Illumina,
   San Diego, CA, USA), and 150 bp paired-end reads were generated. About
   50.30M raw reads for each sample were generated. Raw reads of fastq
   format were firstly processed using fastp [[57]20], and the low-quality
   reads were removed to obtain the clean reads. Then, about 48.24M clean
   reads for each sample were retained for subsequent analyses. The clean
   reads were mapped to the reference genome using HISAT2 (V2.2.1)
   [[58]21]. FPKM [[59]22] of each gene was calculated, and the read
   counts of each gene were obtained by HTSeq-count [[60]23].

   Differential expression analysis was performed using the DESeq2
   (v1.40.0) [[61]24]. p value < 0.05 and log2(FC) > 2 or log2(FC) < −2
   were set as the threshold for significantly differential expression
   genes (DEGs). Hierarchical cluster analysis of DEGs was performed using
   R (version 4.2.1) to demonstrate the expression pattern of genes in
   different groups and samples.

   Based on the hypergeometric distribution, GO [[62]25] and KEGG [[63]26]
   pathway enrichment analyses of DEGs were performed to screen the
   significant enriched term using R (version 4.2.1), respectively. R
   (version 4.2.1) was used to draw the lollipop chart of the significant
   enrichment term.

2.5. Western Blotting Assay

   Everolimus (1 ug/mL, HY-10218, MedChemExpress, NJ, USA), Bafilomycin A1
   (500nM, HY-100558, MCE, USA), or PBS (Gibco, Carlsbad, CA, USA) was
   added into the supernatant of THP-1 cells and M0 macrophages for 12 h
   and 24 h when the cell density reached 80–90%. Cells were lysed with
   RIPA buffer (89901, Thermo Fisher Scientific, Waltham, MA, USA) and
   quantified using a BCA protein assay kit (Beyotime Biotechnology,
   Shanghai, China). Protein samples were boiled at 100 °C for 15 min.
   Then, 20 ug of proteins was separated by 10% SDS-PAGE and transferred
   onto PVDF membranes. Membranes were blockaded with 5% defatted milk for
   1 h. The membrane was cultured with primary antibodies at 4 °C
   overnight and subsequently incubated with the secondary antibody
   (7076S, 7074S, Cell Signaling Technology, Danvers, MA, USA) for an
   additional 2 h. Protein bands were detected using an enhanced
   chemiluminescence kit (NCM Biotech, Suzhou, China), and the data were
   analyzed with Image J software (version 2.14.0). The primary antibodies
   used were SNX10 (sc-293380, Santa Cruz Biotechnology, Beijing, China,
   1:1000), mTORC1 (66888-1, Proteintech, Wuhan, China, 1:1000), p-mTORC1
   (5536T, Cell Signaling Technology, USA, 1:1000), and LAMP2A
   (66301-1-Ig, Proteintech, USA, 1:1000), and GAPDH (GB15002-100,
   Servicebio, Wuhan, China, 1:1000) was used as a loading control.

2.6. Cell Viability Assay

   The half maximal inhibitory concentration (IC50) values of cisplatin in
   platinum-sensitive ovarian cancer cell line A2780 and
   platinum-resistant ovarian cancer cell line A2780/CP70 were determined
   by Cell Counting Kit-8 (CCK-8) assay (Beyotime Biotechnology, Shanghai,
   China). Ovarian cancer cells were seeded at a density of 2000 cells per
   well in 96-well plates. When cultures reached approximately 70%
   confluency, cells were treated with cisplatin (HY-17394,
   MedChemExpress, NJ, USA) for 48 h using the concentration gradient
   specified in the [64]Supplementary Data. CCK-8 reagent (C0038, Beyotime
   Biotechnology, Shanghai, China) was added to each well according to the
   manufacturer’s protocol, followed by 3 h of incubation at 37 °C.
   Absorbance was then measured at 450 nm using a microplate reader.

2.7. Real-Time Reverse Transcription–PCR Assay

   Total RNA was extracted from cells using RNA Easy Fast Tissue/Cell Kit
   (DP451, Tiangen Biotech, Beijing, China). RNA concentration was
   measured using a spectrophotometer. Next, 1 µg of RNA was reverse
   transcribed to cDNA using HiScript III RT SuperMix for qPCR (+gDNA
   wiper) (R323, Vazyme, Nanjing, China). Real-time PCR (40 cycles,
   annealing temperature 60 °C) was performed using Taq Pro Universal SYBR
   qPCR Master Mix (Q712, Vazyme, China) on a QuantStudio™ 3 System
   (Thermo Scientific, Waltham, MA, USA). Gene expression was normalized
   to GAPDH as an internal control, and the values were calculated by the
   2^−ΔΔCt method. The primers are shown in [65]Table 1.

Table 1.

   Primers for real-time polymerase chain reaction (PCR).
   Gene Name Primer Sequences (5′ to 3′)
   PD-L1 Forward: GCATTTGCTGAACGCATTTACT
   Reverse: ATTTCCCAGGGAGAGCTGGT
   PD1 Forward: CCAAGGCGCAGATCAAAGAG
   Reverse: TGGCTCCTATTGTCCCTCGTG
   CD80 Forward: GGGGAAATGCGCCTCTCTG
   Reverse: GTGGATTTAGTTTCACAGCTTGC
   iNOS Forward: TCCCGAGTCAGAGTCACCAT
   Reverse: CATGCAGACAACCTTGGGGT
   CD206 Forward: GTGATGGGACCCCTGTAACG
   Reverse: CTGCCCAGTACCCATCCTTG
   IL-12A Forward: AAAGATAAAACCAGCACAGTGGAG
   Reverse: CCAGGCAACTCCCATTAGTTAT
   IL-10 Forward: AGGGCACCCAGTCTGAGAAC
   Reverse: GGCAACCCAGGTAACCCTTAAAGT
   VEGF Forward: TAAGTCCTGGAGCGTTCCCT
   Reverse: ACGCGAGTCTGTGTTTTTGC
   PLIN2 Forward: ACAACCGAGTGTGGTGACTC
   Reverse: TCTTCACACCGTTCTCTGCC
   MMP2 Forward: AAGTATGGGAACGCCGATGG
   Reverse: GCCGTACTTGCCATCCTTCT
   MMP9 Forward: GGACAAGCTCTTCGGCTTCT
   Reverse: TCGCTGGTACAGGTCGAGTA
   GAPDH Forward: TGATGACATCAAGAAGGTGGTGAAG
   Reverse: TCCTTGGAGGCCATGTGGGCCAT
   [66]Open in a new tab

2.8. Transwell Assays

   After co-culturing with M0 macrophages for 48 h, ovarian cancer cells
   (1× 10^5 cells) were collected, resuspended in serum-free medium, and
   seeded into the upper transwell chamber (8 μm pore size; Corning Inc.,
   Corning, NY, USA) coated with or without Matrigel (356234, Corning,
   USA). Media containing 10% FBS were added to the lower chamber.
   Following a 24 h incubation period, the migrated cells in the lower
   chamber were fixed with 4% paraformaldehyde (G1101, Servicebio, Wuhan,
   China) and stained for 15 min with crystal violet dye (G1014,
   Servicebio, China). The number of migrated and invaded cells was
   photographed and recorded under an inverted phase contrast microscope
   (BX63, Olympus, Tokyo, Japan) and counted using ImageJ (version
   2.14.0).

2.9. BODIPY Staining and Oil Red O Staining

   The THP-1 cells were fixed in 4% paraformaldehyde solution and
   incubated in the dark with BODIPY (GP1104, Servicebio, Wuhan, China)
   for 30 min and DAPI (G1012, Servicebio, Wuhan, China) for 10 min and
   recorded under a fluorescence microscope (IX73, Olympus, Tokyo, Japan).
   After adding 1 μg/mL of everolimus (HY-10218, MCE, USA) or PBS to M0
   macrophages for 12 h and 24 h, the cell culture solution was sucked up
   from the 6-well plate, 4% paraformaldehyde fixative (30525-89-4, Hesse,
   Germany) was added for 10 min, and then it was washed twice with PBS.
   Then, 1.5 ml of 60% isopropanol (67-63-0, Aladdin, Beijing, China) was
   added for 15–20 s, it was allowed to dry slightly, and then oil red O
   working solution (mixed with distilled water with 6:4) was added for 30
   min in the dark. Then, 60% isopropanol was added again for 3–5 s, it
   was washed with distilled water 3 times, hematoxylin staining solution
   (C0107, Beyotime Biotechnology, Shanghai, China) was added for cell
   nucleus staining, and then the solution was observed under an inverted
   phase contrast microscope (BX63, Olympus, Tokyo, Japan).

2.10. Lysosome pH Detection

   The function and quantity of lysosomes in the THP-1 cells were detected
   by Lysosomal Acidic pH Detection Kit-Green/Deep Red (L268, DOJINDO,
   Kumamoto Prefecture, Japan). The kit includes two reagents: PHLys Green
   and Lysprime Deep Red. PHLys Green is pH-dependent and can detect the
   function of lysosomes, while Lysprime Deep Red is pH-independent and
   used to detect the number of lysosomes. The SNX10-EO and negative
   control THP-1 cells were washed with HBSS twice, and then PHLys
   Green/Lysprime Deep Red working solution was added. After 30 min of
   incubation, the dyed cells were washed by HBSS twice and observed with
   a fluorescence microscope (IX73, Olympus, Tokyo, Japan).

2.11. Database Analysis

   For online survival analysis and protein analysis, the Kaplan–Meier
   Plotter database
   ([67]https://kmplot.com/analysis/index.php?p=service&cancer=ovar
   (accessed on 4 February 2024)) and the GEPIA2 database
   ([68]http://gepia2.cancer-pku.cn/#index (accessed on 4 February 2024))
   were used. For analyzing the relationship between immune cells and
   ovarian cancer online, TIMER 2.0 ([69]http://timer.cistrome.org) and
   TISIDB ([70]http://cis.hku.hk/TISIDB/index.php (accessed on 4 February
   2024)) were used. We used single-cell datasets [71]GSE147082 and
   [72]GSE158937 to analyze the cell distribution of SNX10 in ovarian
   cancer tissues [[73]27,[74]28].

2.12. Statistical Analysis

   GraphPad Prism software (version 7.0, San Diego, CA, USA) was utilized
   to analyze the data. Data were expressed as means ±SD from three
   individual repeats. Student’s t-test was applied for comparison between
   the two groups. The comparison among multiple groups was analyzed by
   one-way ANOVA. p < 0.05 represented the statistical difference.

3. Results

3.1. SNX10 Is Highly Expressed in Macrophages of Ovarian Cancer Tissue and
Affects Prognosis

   TAMs play a well-established role in modulating tumor cell behavior
   within the tumor microenvironment. After searching the online database
   TIMER2.0 (Tumor Immune Estimation Resource) and TISIDB (an integrated
   repository portal for tumor-immune system interactions), it was
   discovered that the proportion of TAM infiltration is negatively
   correlated with prognosis, whereas CD4+T cells are positively
   correlated with prognosis in ovarian cancer ([75]Figure 1A). SNX10,
   previously implicated in macrophage-related pathologies such as fatty
   liver disease and atherosclerosis [[76]19,[77]29], was found to be
   significantly overexpressed in ovarian cancer. We discovered that SNX10
   expression was positively linked with the infiltration of macrophages,
   neutrophils, dendritic cells, CD4+T cells, and CD8+T cells in ovarian
   tumor tissue ([78]Figure 1B,C). Next, by evaluating the [79]GSE147082
   and [80]GSE158937 ovarian cancer single-cell datasets, it was shown
   that SNX10 is primarily expressed in tumor-associated macrophages
   (TAMs) rather than tumor cells ([81]Figure 1D). Searching the GEPIA2
   and Kaplan–Meier Plotter databases revealed that SNX10 is substantially
   expressed in ovarian cancer and has a negative correlation with
   progression-free survival (PFS) or overall survival (OS) of ovarian
   cancer ([82]Figure 1E). These results indicate that SNX10 is mostly
   expressed in tumor-associated macrophages in ovarian cancer tissue, and
   we hypothesize that SNX10 influences macrophages to regulate tumor cell
   biology.

Figure 1.

   [83]Figure 1
   [84]Open in a new tab

   SNX10 is predominantly expressed in macrophages in ovarian cancer tumor
   tissues and exhibits a negative correlation with ovarian cancer
   prognosis. (A) Using TIMER 2.0 online databases, analyze the
   correlation between immune cell proportion in ovarian cancer tissues
   and prognosis. (B,C) TISIDB online and the TIMER 2.0 database analyze
   the correlation between SNX10 expression level and immune cells in
   ovarian cancer tumor tissues. (D) Analysis of the distribution of SNX10
   in subcellular populations of ovarian cancer tissues using the
   [85]GSE147082 and [86]GSE158937 single-cell datasets. (E) Analysis of
   the link between SNX10 expression in ovarian cancer and
   progression-free survival (PFS) or overall survival (OS) through the
   GEPIA2 database (the red columns = ovarian cancer; the grey columns =
   normal ovary tissue) and Kaplan database. * p < 0.05.

3.2. Overexpression of SNX10 in Macrophages Increases the Migration and
Invasion Ability of Ovarian Cancer Cells

   Based on the finding that SNX10 is mostly expressed in TAMs in ovarian
   cancer, we aim to investigate its functional role in ovarian cancer
   biology via macrophages. First, we overexpressed SNX10 in THP-1 cells
   via lentiviral infection and verified it by Western blotting
   ([87]Figure 2A). Platinum-sensitive ovarian cancer cells A2780 and
   platinum-resistant ovarian cancer cells A2780/CP70 were selected. The
   CCK8 method was used to obtain their cisplatin IC50 value. For
   cisplatin, the IC50 of A2780 is 3.15 μM, while the IC50 of A2780/CP70
   is 46.7 μM ([88]Figure 2B). We examined the migration and invasion
   abilities of ovarian cancer cells after 48 h of co-culturing with M0
   macrophages ([89]Figure 2C). The results revealed that co-culturing
   ovarian cancer cells with M0 macrophages, which SNX10 overexpressed
   (M0-SXN10-EO macrophages), improves their metastatic and invasive
   abilities ([90]Figure 2D). This pro-metastatic phenotype was further
   supported by elevated MMP2/MMP9 expression ([91]Figure 2E). Notably,
   SNX10-overexpressing macrophages also promoted platinum resistance.
   Flow cytometry analysis revealed that co-culturing with M0-SNX10-EO
   macrophages markedly reduced apoptosis in A2780/CP70 cells (vs.
   untreated controls) when exposed to their respective IC50 doses of
   cisplatin for 48 h, while no significant effect was observed in A2780
   cells ([92]Figure 2F). The above data demonstrate that SNX10
   overexpression in macrophages drives ovarian cancer cell aggressiveness
   by enhancing metastatic potential and platinum resistance.

Figure 2.

   [93]Figure 2
   [94]Open in a new tab

   Overexpression of SNX10 in THP-1 cells promotes ovarian cancer cell
   invasion and migration. (A) Establishment of stable overexpression of
   SNX10 in the THP-1 cell line; the column diagrams on the right display
   the statistical differences in protein expression levels in the two
   groups. (B) The CCK8 method was used to detect the cisplatin
   sensitivity of ovarian cancer cell lines A2780 (platinum-sensitive) and
   A2780/CP70 (platinum-resistant) (IC50: 3.15 μM vs. 46.7 μM,
   respectively). (C) The diagrammatic sketch of cell co-culture system.
   (D) Transwell assays were used to assess the migratory and invasive
   properties of A2780 and A2780/CP70 cells co-cultured with M0-control
   and M0-SNX10-EO. (E) RT-qPCR was utilized to evaluate the gene
   expression levels of migration-related markers (MMP2, MMP9) in ovarian
   cancer cells. (F) The apoptotic rate of cisplatin on ovarian cancer
   cells after co-culturing with M0-control and M0-SNX10-EO groups for 48
   h was detected by flow cytometry; the column diagram on the right
   displays the statistical analysis of the apoptosis rate of ovarian
   cancer cells. * p < 0.05; ** p < 0.01; *** p < 0.001. All experiments
   were repeated at least three times.

3.3. SNX10 Overexpression Promotes M2-like Macrophage Polarization

   Because M0-SNX10-EO macrophages increase ovarian cancer invasive
   behavior, we investigated whether SNX10 overexpression impacts
   macrophage differentiation into M1 or M2 types. Using RT-qPCR
   technology, we detected the change in M1 marker (CD80, CD86, il-12,
   iNOS) and M2 marker (CD206, CD200R, Arg-1, il-10) expression in
   M0-SNX10-EO macrophages and M0-control macrophage. Firstly, THP-1 cells
   were treated with PMA for 48 h to induce differentiation into M0
   macrophages. Fluorescence microscopy reveals that M0 macrophages have
   unique antennas ([95]Figure 3A). Compared to the M0-control
   macrophages, CD80 mRNA expression, an M1 macrophage marker, were
   dramatically reduced in M0-SNX10-EO macrophages, but CD86 and il-12
   increased significantly. iNOS decreased but not significantly.
   M2-associated marker mRNA expression (CD206, CD200R, Arg-1) was
   significantly increased except for IL-10 ([96]Figure 3B,C). Moreover,
   PD1 mRNA expression increased in M0-SNX10-EO macrophages ([97]Figure
   3B,C). These results indicate that M0-SNX10-EO macrophages showed an M2
   phenotype, which has a pro-cancer effect.

Figure 3.

   [98]Figure 3
   [99]Open in a new tab

   SNX10 regulates the expression of macrophage markers. (A) Fluorescence
   microscopy was used to detect the cell morphology of THP-1 cells
   differentiated into M0 macrophages after being stimulated by PMA.
   RT-qPCR was utilized to measure the relative mRNA expression levels of
   M1 macrophage markers (CD80, CD86, iL-12, iNOS) (B) and M2 macrophage
   markers (CD206, CD200R, Arg-1, il-10, PD1) (C) in the M0-control and
   M0-SNX10-EO groups. * p < 0.05; ** p < 0.01; **** p < 0.0001. All
   experiments were repeated at least three times.

3.4. SNX10 Regulates Macrophage Polarization Through mTORC1-Mediated Lipid
Metabolic Reprogramming

   To elucidate the mechanism underlying SNX10-mediated macrophage
   polarization, we performed RNA-seq analysis followed by KEGG pathway
   enrichment. The results showed that SNX10 overexpression significantly
   downregulated genes involved in immune response and signal
   transduction, particularly those associated with lipid metabolism and
   the PI3K/Akt pathway ([100]Figure 4A). Consistent with the
   transcriptomic findings, BODIPY staining revealed a marked reduction in
   lipid droplet accumulation in both THP-1 cells and M0 macrophages upon
   SNX10 overexpression ([101]Figure 4B). Mechanistically, SNX10
   overexpression selectively suppressed mTORC1 phosphorylation (p-mTORC1)
   without altering total mTORC1 protein levels ([102]Figure 4C). To
   confirm the link between mTORC1 and lipid droplets, adding everolimus
   (an mTORC1 inhibitor) to M0 macrophage culture medium for 24 h resulted
   in a significant reduction in lipid droplets ([103]Figure 4D,E).
   Furthermore, we found that M0 macrophages differentiated into M2 type
   after being treated with everolimus ([104]Figure 4F). The data above
   demonstrate that SNX10 drives macrophage polarization toward an M2-like
   phenotype by modulating mTORC1-dependent lipid droplet reduction.

Figure 4.

   [105]Figure 4
   [106]Open in a new tab

   SNX10 regulates macrophage polarization through mTORC1-dependent lipid
   metabolic reprogramming. (A) KEGG signaling pathway enrichment analysis
   on downregulated genes (top 20 were listed) in THP-1 cells. (B) Lipid
   droplet contents were examined using BODIPY staining in THP-1 cells.
   (C) The expression of p-mTORC1 proteins in THP-1 cells was assessed by
   Western blotting under conditions with and without SNX10
   overexpression. The column diagram on the right displays the expression
   levels of proteins in each group statistically analyzed by gray
   scanning. (D) Oil red staining was performed to examine lipid droplets
   in M0 macrophages after adding everolimus or PBS for 24 h. (E) The
   expression of p-mTORC1 proteins in M0 macrophages was analyzed by
   Western blotting after adding everolimus or PBS for 24 h; the column
   diagram on the right displays the expression levels of proteins in each
   group statistically analyzed by gray scanning. (F) RT-qPCR was utilized
   to measure the relative mRNA expression levels of M1 macrophage markers
   (CD80, CD86, iNOS) and M2 macrophage markers (CD200R, CD206, Arg-1,
   PD1) in the M0 macrophages after adding everolimus or PBS for 24 h. * p
   < 0.05; ** p < 0.01; *** p < 0.001, **** p < 0.0001. All experiments
   were repeated at least three times.

3.5. Overexpression of SNX10 Decreases the Number of Lysosomes and Induces
Acidification Disorders to Promote M2 Macrophage Polarization

   Previous research has shown that SNX10 regulates lysosomal function in
   both intestinal inflammation and intestinal tumors [[107]18]. Lysosomes
   are involved in the degradation of lipid droplets [[108]30,[109]31].
   The Lysosomal Acidic pH Detection Kit-Green/Deep Red was used to assess
   the function and number of lysosomes in THP-1 cells. The red
   fluorescence represents lysosome number, while the green fluorescence
   shows lysosomal pH. The results showed that when SNX10 was
   overexpressed, both red and green fluorescence dropped, implying that
   the quantity and function of macrophage lysosomes were dramatically
   reduced ([110]Figure 5A). LAMP2A, one of the primary lysosomal membrane
   proteins, did not show any significant alterations when SNX10 was
   overexpressed ([111]Figure 5B). To investigate the link between SNX10,
   mTORC1, and lysosomes, firstly, we found that the pH and quantity of
   lysosomes significantly decreased when adding everolimus for 12 h and
   24 h, but the expression of LAMP2A did not significantly change
   ([112]Figure 5C,D). Next, Bafilomycin A1 (a lysosomal proton pump
   inhibitor) was added to the supernatant of THP-1 cells and incubated
   for 12 h. Western blotting results showed that p-mTORC1 protein
   expression decreased significantly except for SNX10 ([113]Figure 5E).
   Finally, we used RT-qPCR to evaluate changes in M1 and M2 markers of
   M0-type macrophages following the addition of Bafilomycin A1, and the
   results revealed that the macrophages differentiated into M2
   macrophages ([114]Figure 5F). The results above show that mTORC1
   phosphorylation level and lysosomal function interact with one another,
   and SNX10 is positioned upstream of the two.

Figure 5.

   [115]Figure 5
   [116]Open in a new tab

   Overexpression of SNX10 decreases the number of lysosomes and induces
   acidification disorders to promote M2 macrophage polarization. (A) The
   lysosomal pH and amount in THP-1cells with SNX10 overexpressed or
   control were detected using Lysosomal Acidic pH Detection
   Kit-Green/Deep Red with a fluorescence microscope. Green fluorescence
   indicates the pH of lysosomes, while red fluorescence indicates
   lysosomal amount. (B) The expression of LAMP2A proteins in the two
   THP-1 cell groups was analyzed by Western blotting. The column diagram
   on the right displays the expression levels of proteins in each group
   statistically analyzed by gray scanning. (C) Fluorescence microscopy
   was used to detect pH and lysosome amount in THP-1 cells 12 and 24 h
   following the addition of everolimus or PBS, respectively. (D) The
   expression of LAMP2A proteins in the M0 macrophages after the addition
   of everolimus or PBS was analyzed by Western blotting; the column
   diagram on the right displays the expression levels of proteins in each
   group statistically analyzed by gray scanning. (E) After adding
   BafiomycinA1 or PBS for 12 h, the expression of p-mTORC1 proteins in
   THP-1 cells was analyzed by Western blotting. The column diagram on the
   right displays the expression levels of proteins in each group
   statistically analyzed by gray scanning. (F) RT-qPCR was utilized to
   measure the relative mRNA expression levels of M1 macrophage markers
   (CD80, CD86, iNOS) and M2 macrophage markers (CD200R, CD206, Arg-1,
   PD1) in the M0 macrophages after adding BafiomycinA1 or PBS for 12 h. *
   p < 0.05; ** p < 0.01; *** p < 0.001. All experiments were repeated at
   least three times.

3.6. SNX10-Overexpressing Macrophages Modulate PD-L1 Expression and Lipid
Metabolism in Ovarian Cancer Cells

   Given the established role of M2 macrophages in promoting immune
   tolerance, we examined the PD-L1 mRNA level in these cells. The results
   showed that the mRNA expression level of PD-L1 increased in the
   platinum-resistant cell line A2780/CP70 but decreased in the
   platinum-sensitive cell line 2780. Since SNX10 causes macrophage lipid
   metabolism dysfunction, in order to explore whether it also affects the
   lipid content in ovarian cancer cells, the lipid droplet coating
   protein (PLIN2) mRNA expression in tumor cells was investigated. We
   discovered that PLIN2 mRNA levels were higher in both A2780 and
   A2780/cp70 ([117]Figure 6A,B). Analyzing the GEPIA2 database, we
   discovered that PLIN2 expression is positively linked with PD-L1 (R =
   0.34) ([118]Figure 6C). Searching the Kaplan–Meier Plotter database, it
   was found that PLIN2 was negatively correlated with PFS and OS in
   ovarian cancer ([119]Figure 6D).

Figure 6.

   [120]Figure 6
   [121]Open in a new tab

   The effects on the PD-L1 expression in ovarian cancer cells after
   co-culturing with M0-SNX10-EO macrophages. (A,B) RT-qPCR was utilized
   to measure the relative mRNA expression levels of PD-L1 in A2780 and
   A2780/CP70 cells after being co-cultured with M0-control and M0-SNX10
   EO groups. (C) Correlation analysis of mRNA expression levels of PD-L1
   and PLIN2 in ovarian cancer cells by the GEPIA2 database. (D) The
   Kaplan–Meier Plotter database analyzes the relationship between the
   expression of PLIN2 and the prognosis of ovarian cancer patients. * p <
   0.05, ** p < 0.01; **** p < 0.0001.

4. Discussion

   Immune checkpoint inhibitors exhibit significant anti-tumor effects in
   various types of tumors. Ovarian cancer, however, is known as a “cold
   tumor” due to its poor response to immune checkpoint inhibitors. The
   development of single-cell technology has enabled a better
   understanding of the cellular composition of tumor tissues. It has been
   discovered that T cells, macrophages, NK cells, tumor-associated
   fibroblasts, and tumor cells within the tumor microenvironment interact
   with each other, participating in the regulation of immune tolerance in
   tumor cells and influencing tumor growth, invasion, and metastasis
   [[122]32]. Tumor-associated macrophages (TAMs) are categorized into two
   types: M1 TAMs, which have anti-cancer and pro-inflammatory properties,
   and M2 TAMs, which have the opposite impact. By producing cytokines,
   such as interferon, TNF, IL-10, IL-12, and VEGF, controlling the
   PD-1/PD-L1 signaling axis, and suppressing anti-tumor immune responses,
   M2 TAMs attract immunosuppressive cells and cause the depletion of
   cytotoxic T cells [[123]33,[124]34]. Research has shown that M2
   macrophages are one of the primary infiltrators of ovarian cancer
   tissues, and the prognosis of ovarian cancer is inversely connected
   with the amount of infiltrated M2 macrophages [[125]35].
   Tumor-associated macrophages (TAMs) have been identified as one of the
   key immune cells in the tumor microenvironment in ovarian cancer tumor
   tissues and malignant ascites. However, further research is still
   needed to explore how M2 macrophages contribute to ovarian cancer
   cells.

   SNX10 is a membrane-trafficking protein containing a
   phosphoinositide-binding PX domain, localized to endosomes, lysosomes,
   and the endoplasmic reticulum [[126]15]. It has roles in the
   lysosome/endosome pathway, signal transduction, and intracellular
   protein transport and participates in the occurrence and development of
   diseases such as osteolysis, gastroenteritis, atherosclerosis, and
   colorectal cancer [[127]16,[128]19,[129]36], but its function in
   ovarian cancer was previously unknown. Our findings indicate that SNX10
   is highly expressed in epithelial ovarian cancer and negatively
   correlated with prognosis. Single-cell analysis of ovarian cancer tumor
   tissues indicated that SNX10 is mainly expressed in TAMs. This suggests
   that SNX10 influences the prognosis of ovarian cancer via TAMs.

   SNX10 overexpression dramatically increased the expression of the M2
   marker (Arg-1, CD206, CD200R), while for the M1 marker, CD80 mRNA
   expression significantly decreased, and the expression of IL-12 and
   CD86 significantly increased. Although CD86 was previously thought to
   be an M1 marker, it has now been discovered that in the M2b subtype,
   CD86 and CD206 expression increased simultaneously [[130]37].
   Therefore, these findings demonstrate that SNX10 drives M0 macrophages
   toward an M2-dominant polarization state.

   Lipid reprogramming of TMAs regulates their polarization and is closely
   associated with tumor immune suppression [[131]38,[132]39,[133]40]. The
   three main components of lipid metabolism include fatty acids,
   cholesterol, and lipid droplets, and they have biological roles as
   signaling molecules, energy storage facilities, and components of cell
   membranes [[134]41]. It has been reported that M1 TAMs prefer
   glycolysis for energy supply, while M2 TAMs rely on fatty acid
   oxidation for energy. TAMs in various cancers accumulate lipids and
   have increased fatty acid metabolism, which promotes malignancy and
   causes treatment resistance [[135]42,[136]43,[137]44]. However, it has
   been found that the intracellular lipids of TAMs are reduced in some
   cancers. Cholesterol-25-hydroxylase is highly expressed in
   immunosuppressive macrophage subpopulations, promoting cholesterol
   breakdown and reducing cholesterol accumulation, which is negatively
   correlated with the survival rate of patients with various tumors
   [[138]45]. The outward migration of intracellular cholesterol promotes
   the conversion of TAMs into M2 type [[139]46,[140]47,[141]48].

   Recent studies have shown that SNX10 is a critical regulatory protein
   for lipid metabolism in several diseases [[142]19,[143]29]. SNX10
   deficiency enhances the development of alcoholic fatty liver by
   decreasing the degradation of LAMP2A/PLIN2 in the liver [[144]29]. In
   cardiovascular diseases [[145]16,[146]18], increased SNX10 expression
   stimulates lipid accumulation in macrophages via the AKT/TFEB signaling
   pathway, which contributes to atherosclerosis. In our study, SNX10
   overexpression or the addition of the mTORC1 inhibitor everolimus
   significantly reduced p-mTORC1 protein expression and lipid droplet
   content in M0 macrophages, and both of them polarized macrophages to M2
   type, indicating that abnormal SNX10 expression could lead to lipid
   droplet metabolism disorder in macrophages, abnormal transmission of
   the mTORC1 signaling pathway, and regulation of macrophage
   polarization.

   SNX10 regulates generation of endoplasmic reticulum and lysosomal
   function in the occurrence and development of various diseases
   [[147]49,[148]50,[149]51]. Lysosomal pH, which is predominantly
   regulated by vacuolar H+-transporting ATPase (V-ATPase), is critical
   for lysosomal function stability [[150]52,[151]53,[152]54]. mTORC1 is
   recruited to lysosomal membranes and activated through multiple
   pathways, which can regulate intracellular metabolism and autophagy
   [[153]55,[154]56,[155]57]. It has been reported that the V-ATPase
   complex on lysosomes can regulate mTORC1 activity by modulating
   lysosomal pH [[156]58]. The membrane contact between the endoplasmic
   reticulum and lysosomes serves as a hub for activating
   cholesterol-dependent mTORC1 signaling [[157]59]. mTORC1 plays a role
   in lipid metabolism after activation on lysosomes, mainly promoting
   lipid synthesis and inhibiting lipolysis [[158]55]. We speculate that
   there is a link between SNX10, mTORC1, and lysosomes in macrophages.
   The results demonstrated that regardless of whether SNX10 is
   overexpressed or the addition of everolimus (the mTORC1 inhibitor) to
   THP-1 cells, the number and pH value of lysosomes is reduced in THP-1
   cells.

   Lysosome-associated membrane protein 2A (LAMP2A), a crucial protein in
   chaperone-mediated autophagy (CMA), serves as a key indicator of
   lysosomal structural integrity and functional activity
   [[159]60,[160]61]. LAMP2A interacts with the lysosomal cation channel
   TMEM175 to modulate proton conduction, thereby regulating
   intra-lysosomal pH homeostasis [[161]62]. The data indicated that
   LAMP2A protein expression did not change significantly when lysosomal
   pH was disrupted by SNX10 overexpression or by everolimus. When
   Bafiomycin A1 (a lysosomal proton pump inhibitor) was added, M0
   macrophages polarized to M2, and p-mTORC1 expression was drastically
   reduced. According to the above results, we speculate that both mTORC1
   phosphorylation level and lysosomal pH are regulated by SNX10, which
   ultimately affects the content of lipid droplets in macrophages and the
   polarization direction of macrophages but does not affect LAMP2A
   protein expression.

   For tumor cells, we examined their immune tolerance status after
   co-culturing. The data revealed that the expression levels of PD-L1
   mRNA in platinum-resistant ovarian cancer cell A2780/CP70 increased
   significantly, but in platinum-sensitive ovarian cancer cells they
   decreased. High PD-L1 expression is involved in the proliferation and
   spread of ovarian cancer cells, altering the prognosis of ovarian
   cancer, according to previous studies [[162]63]. Platinum-resistant
   ovarian cancer has greater PD-L1 expression levels, which are adversely
   linked with prognosis [[163]64]. Studies have revealed that in
   glioblastoma, TAMs promote tumor progression by transferring lipids to
   cancer cells or secreting cytokines, thereby modulating the lipid
   metabolism of tumor cells [[164]65].

   Studies have found that the short-chain fatty acid acetic acid can
   promote the metabolic reprogramming of tumor cells and upregulate the
   expression of PD-L1 [[165]66]. Itaconic acid, a metabolite of
   macrophages, can prolong the half-life of PD-L1 and enhance its
   stability after being transported to tumor cells [[166]67]. To explore
   whether tumor cells have lipid metabolism disorders after being
   co-cultured with M0-SNX10-EO macrophages, we evaluated PLIN2 mRNA
   levels in the ovarian cancer cells A2780 and A2780/CP70 and observed
   significant upregulation in both cell lines. PLIN2 expression had a
   negative correlation with ovarian cancer prognosis as assessed by the
   Kaplan–Meier Plotter database. The correlation between PLIN2 and PD-L1
   was examined using the online databases GEPIA2, and it was discovered
   that there was a positive correlation (R = 0.34).

   In this study, there are still some shortcomings. For example, the
   specific molecular mechanism underlying the reduction in lipid droplet
   content of macrophages has yet to be explored. It is unknown what
   factors are involved in the signal transmission between TAMs and tumor
   cells. Further studies are required to elucidate how
   SNX10-overexpressing macrophages modulate tumor cell behavior.

   Based on the above data, overexpression of SNX10 promotes macrophage
   polarization to M2 type by the SNX10/mTORC1/lysosome pathway and
   regulates PD-L1 expression in ovarian cancer cells. SNX10 could be
   developed as a promising new biological target for ovarian cancer
   therapy.

5. Conclusions

   In summary, we have demonstrated that SNX10 is specifically expressed
   in tumor-associated macrophages (TAMs) within ovarian cancer tissues.
   Its overexpression promotes the polarization of TAMs into the M2
   phenotype, enhances the metastatic potential of ovarian cancer cells,
   and modulates PD-L1 mRNA expression in tumor cells. Furthermore, our
   research revealed that SNX10 regulates TAM polarization by influencing
   p-mTOR1 expression levels and lysosomal function. These findings
   suggest that the regulatory mechanisms of TAMs in ovarian cancer
   represent a promising new therapeutic target, requiring further
   in-depth research for exploration.

Abbreviations

   The following abbreviations are used in this manuscript:
   TAMs                    Tumor-associated macrophages
   M0 macrophages          THP-1 cells after PMA stimulation
   M0-control macrophages  M0 macrophages with SNX10 control expression
   M0-SNX10-EO macrophages M0 macrophages with SNX10 overexpressed
   [167]Open in a new tab

Supplementary Materials

   The following supporting information can be downloaded at:
   [168]https://www.mdpi.com/article/10.3390/biomedicines13051021/s1,
   Figure S1: High-Magnification Fluorescence Imaging of Lipid Droplets
   and Lysosomal Function; Table S1: Cisplatin administration
   concentration. File S1. WB original data.
   [169]biomedicines-13-01021-s001.zip^ (4.1MB, zip)

Author Contributions

   R.C.: methodology, validation, formal analysis, data curation, and
   writing—original draft; K.Z.: methodology, validation,
   conceptualization, software, and data curation; T.X.: software,
   validation, investigation, and data curation; H.W.: software,
   investigation, and data curation; X.C.: software and formal analysis;
   C.L.: writing—review and editing, project administration, and
   supervision. Y.K.: funding acquisition, writing—review and editing,
   project administration, resources, and supervision. All authors have
   read and agreed to the published version of the manuscript.

Institutional Review Board Statement

   Not applicable.

Informed Consent Statement

   Not applicable.

Data Availability Statement

   The data generated in this study can be obtained from the corresponding
   author upon request.

Conflicts of Interest

   The authors declare that they have no conflicts of interest.

Funding Statement

   This research was funded by the National Key Research and Development
   Program of China, grant number 2022YFC2705004.

Footnotes

   Disclaimer/Publisher’s Note: The statements, opinions and data
   contained in all publications are solely those of the individual
   author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI
   and/or the editor(s) disclaim responsibility for any injury to people
   or property resulting from any ideas, methods, instructions or products
   referred to in the content.

References