Abstract

Background

   Sepsis, a critical organ dysfunction resulting from an aberrant host
   response to infection, remains a leading cause of mortality in ICU
   patients. Recent evidence suggests that angiotensin-converting enzyme 2
   (ACE2) contributes to intestinal barrier function, the mechanism of
   which is yet to be explored. Additionally, alterations in intestinal
   microbiota and microbial metabolites could affect gut homeostasis, thus
   playing a potential role in modulating sepsis progression.

Results

   ACE2 shedding weakens the integrity of the intestinal barrier in
   sepsis. Mice deficient in ACE2 exhibited increased intestinal
   permeability and higher mortality rates post-operation compared to
   their wild-type counterparts. Notably, ACE2 deficiency was associated
   with distinct alterations in gut microbiota composition and reductions
   in protective metabolites, such as 5-methoxytryptophan (5-MTP).
   Supplementing septic mice with 5-MTP ameliorated gut leak through
   enhanced epithelial cell proliferation and repair. The PI3K-AKT-WEE1
   signaling pathway was identified as a key mediator of the beneficial
   effects of 5-MTP administration.

Conclusion

   ACE2 plays a protective role in maintaining intestinal barrier function
   during sepsis, potentially through modulation of the gut microbiota and
   the production of key metabolite 5-MTP. Our study enriched the
   mechanisms by which ACE2 regulates gut homeostasis and shed light on
   further applications.
   Your browser is not supporting the HTML5 <video> element.
   You may download that video as a file and play it with a player of you
   choice.

   [50]Download video stream.
   [51]Download video file^ (47.3MB, mp4)
   [52]Open in a new tab

   Video Abstract

Supplementary Information

   The online version contains supplementary material available at
   10.1186/s40168-025-02128-4.

   Keywords: Gut leak, Sepsis, Bacterial metabolite, 5-methoxytryptophan,
   Angiotensin-converting enzyme 2

Background

   Sepsis is defined as a life-threatening organ dysfunction resulting
   from a dysregulated host response to infection [[53]1]. It is
   considered one of the major public health issues, leading to
   substantial mortality among hospitalized patients and enormous
   healthcare costs [[54]2–[55]4]. As an individualized treatment scheme
   including effective hemodynamic stabilization and immune response
   handling is difficult to access, applicable therapeutic methods are in
   urgent need.

   It is becoming increasingly evident that sepsis has a detrimental
   impact on the intestinal epithelial barrier, which may contribute to
   the development of organ failure. The intestinal epithelial barrier is
   comprised of three distinct layers: a physical barrier, a chemical
   barrier, and a biological barrier. Dysfunction of the intestinal
   barrier may facilitate the translocation of bacteria and endotoxins,
   further aggravating multi-organ failure and systemic inflammation
   [[56]5]. Thus, the control of bacterial translocation has an important
   impact on mortality in sepsis [[57]6]. These observations indicate that
   strategies aimed at maintaining intestinal barrier function may prove
   to be a promising avenue for the prevention and treatment of diseases.

   The gut microbiota has emerged as a key factor in the maintenance of
   the intestinal mechanical barrier, with a role in the maturation of the
   local and immune systems, as well as in the regulation of epithelial
   cell proliferation [[58]7, [59]8]. A number of studies have reported
   disturbances in the microbiota, which are associated with system
   infection [[60]9, [61]10].

   Among the various influencing factors, the angiotensin-converting
   enzyme 2 (ACE2) has aroused our interest because of its
   multifunctionality. Its enzymatic role in metabolizing angiotensin
   (Ang) II has been well studied. Another distinct role is in maintaining
   the intestinal barrier and regulating intestinal flora [[62]11].
   Hashimoto et al. demonstrated that loss of ACE2 led to malfunction of
   the intestinal amino acid transporter B0 AT1, which in turn affected
   the gut microbiome and increased susceptibility to colitis [[63]12].
   Furthermore, the significance of ACE2 in maintaining the integrity of
   the intestinal epithelial barrier and the composition of the intestinal
   flora has been corroborated in research on diabetes [[64]13, [65]14].
   However, the mechanism by which ACE2 helps maintain the gut barrier and
   the interaction between altered microbiome and intestinal homeostasis
   remain to be elucidated.

   As previously stated, numerous gut microbiota have been identified as
   influencing host physiology, including intestinal homeostasis. However,
   only a limited number of microbiota-derived metabolites have been
   characterized [[66]15]. 5-Methoxytryptophan (5-MTP), a novel compound
   derived from L-tryptophan, has been demonstrated to possess
   anti-inflammatory properties in the context of systemic inflammation
   [[67]16] and anti-fibrotic actions in chronic kidney disease [[68]17].
   5-MTP is produced in vascular cells, pulmonary cells, and renal
   epithelial cells via two enzymes, hydroxyindole O-methyltransferase
   (HIOMT), and tryptophan hydroxylase (TPH) [[69]16, [70]18].

   In this study, we conducted a comprehensive evaluation of the functions
   and mechanisms of ACE2 in regulating intestinal homeostasis in the
   context of sepsis. Our findings may provide a viable therapeutic
   approach to limit the severity of sepsis.

Methods

Human specimens

   Patients diagnosed with sepsis, presenting with suspected infection and
   a total Sequential Organ Failure Assessment (SOFA) score of ≥ 2, were
   recruited (sepsis-3 criteria). Exclusion criteria included pregnancy,
   cancer, HIV infection, age under 18, and those discharged or deceased
   within 12 h of admission. Serum samples were collected within 12 h of
   admission, and relevant medical test results were recorded. Serum
   samples were also collected from healthy volunteers, who were
   demographically similar to the septic patients. All samples were
   centrifuged at 2000 rpm for 10 min at 4 °C and stored at − 80 °C before
   use.

Enzyme-linked immunosorbent assay

   The enzyme-linked immunosorbent assay (ELISA) kit for angiotensin I
   converting enzyme 2 (SEB886Hu, SEB886Mu, Cloudclone), human
   lipopolysaccharide-binding protein (CSB-[71]E09629 h, CUSABIO), mouse
   tumor necrosis factor (CSB-[72]E04741 m, CUSABIO), mouse procalcitonin
   (CSB-[73]E10371 m, CUSABIO), and mouse serum creatinine (No.2
   M-KMLJM219960 m, CAMILO) were utilized following the manufacturer’s
   protocols. Standards of varying concentrations and serum samples were
   added to the plates, followed by incubation at 37 °C for 1 h. Diluted
   enzyme-labeled antibodies were subsequently added and incubated for
   another hour at 37 °C. Then, 90 μL of the substrate solution was added
   to each well, which was then incubated in the dark at 37 °C for 15 min.
   The reaction was stopped, and optical density (OD) values were measured
   at 450 nm.

Measurement of glycemia

   Serum glucose levels were measured using a glucose assay kit with
   O-toluidine. Standards and serum samples were added with glucose assay
   reagent to achieve a final volume of 190 µL. Vortex thoroughly and
   centrifuge briefly at 5000 × g to collect the solution.‌ Incubate the
   tubes at 95 °C for 8 min in a PCR thermocycler, then cool to 4 °C.
   ‌ Transfer the supernatant from each tube to a 96-well plate and
   measure the absorbance at 630 nm using a microplate reader.

Animals

   Male C57BL/6 and ICR mice, aged 6–8 weeks, were acquired from Guangdong
   Ruge Biotechnology Co., Ltd., and Guangdong Medical Animal Experimental
   Center. Both ACE2-knockout mice (Ace2^−/y or KO) and h-ACE2
   overexpression mice (hACE2^+/+ or OE) were purchased from VIEWSOLID
   BIOTECH. The knockout site was selected to be exon7 of the
   transcription product 202, and the target gene was shifted from exon7
   by CRISPR/Cas9 editing [[74]19]. OE mice were generated by
   microinjection of the mouse Ace2 promoter driving the human ACE2 coding
   sequence into the pronuclei of fertilized ova from ICR mice [[75]20].
   Littermate mice were produced by breeding trios consisting of one
   Ace2^−/y male with two heterozygous females (ACE2^±). Male offspring
   were genotyped (either ACE2^−/y or ACE2^+/y) and housed in separate
   cages accordingly after weaning. Mice were housed in a specific
   pathogen-free (SPF) environment at the Experimental Animal Center of
   Southern Medical University, maintained at a temperature of 20–25 °C
   and a relative humidity of 40–70%, with ad libitum access to food and
   water.

Cecal ligation and puncture

   Polymicrobial sepsis was induced by cecal ligation and puncture (CLP)
   as described [[76]21]. Briefly, mice were anesthetized with 1%
   pentobarbital, followed by aseptic preparation. A 1.5 cm midline
   abdominal incision was made to exteriorize the cecum, and 2/3 of the
   distal portion of the cecum was ligated. The cecum was then punctured
   twice with a 21-gauge syringe needle, and a small amount of intestinal
   contents was extruded. The cecum was replaced, and the abdominal
   incision was closed with intermittent sutures. Preheated saline (37 °C,
   50 ml/kg) was administered to aid resuscitation. 5-MTP (M4001,
   Sigma-Aldrich) was administered intraperitoneally or orally to the mice
   at 23.4 mg/kg for the required groups. The sham-operative group
   underwent the same procedure without cecal ligation or puncture.

Bacterial strain and fibrin clot preparation

   Escherichia coli (Migula) Castellani and Chalmers strain (ATCC25922)
   was obtained from the BeNa Culture Collection and cultured in LB broth.
   The number of bacteria was estimated by measuring the optical density
   at A600 using a spectrophotometer. An aliquot of the culture medium was
   pelleted and resuspended with fibrinogen (1%) and thrombin (0.01 U) in
   PBS. Fibrin clots without bacteria were used as sham controls.

Bacterial load analysis

   For quantitative assessment of bacterial load, biological samples
   including whole blood, peritoneal lavage fluid (PLF), and homogenized
   lung tissue were collected 24 h after CLP procedures. Serial dilutions
   of each sample type were prepared under sterile conditions, followed by
   inoculation of 100 uL aliquots onto nutrient agar plates and Columbia
   blood agar plates. Cultivation was performed in duplicate under
   controlled atmospheric conditions, using both aerobic and anaerobic
   environments maintained at 37 °C. After 24 h of incubation, CFUs were
   counted. Final bacterial loads were normalized to sample volume for
   liquid samples (expressed as CFU/mL) or tissue mass for organ samples
   (expressed as CFU/g).

In vivo imaging experiment

   Mice were orally administered with bioluminescent E. coli (Lux-CDABE)
   for five consecutive days prior to surgery and were anesthetized 24 h
   post-operation for in vivo imaging. The AmiHTX imaging system was used
   to acquire and analyze photon emissions from regions of interest. The
   imaging parameters were set as follows: binning = 2, emission filter
   wavelength = open, exposure time = 15 s, field of view (FOV) = 25,
   F-stop = 1.2, object height = 1.5.

Antibiotic treatment and fecal microbiota transplantation

   We administered an antibiotic (ABX) cocktail including vancomycin (100
   mg/kg), neomycin sulfate (200 mg/kg), metronidazole (200 mg/kg), and
   ampicillin (200 mg/kg), all homogenized in phosphate-buffered saline
   (PBS), to 6–8-week-old male C57BL/6 mice. The ABXs were given
   intragastrically once a day for 3 days to deplete the gut microbiota
   [[77]22]. For the fecal microbiota transplantation (FMT) experiment,
   fresh feces from either Ace2^−/y or Ace2^+/y littermate mice were
   collected and homogenized in PBS at a concentration of 100 mg/ml. The
   homogenate was centrifuged to pellet debris, and the supernatant,
   supplemented with an equal volume of 40% glycerol, was stored at − 80
   °C. Post-ABX treatment, wild-type (WT) C57BL/6 mice were randomly
   divided into two groups and received 200 µl of the fecal suspension by
   oral gavage daily for 5 days.

Measurement of intestinal permeability

   Intestinal permeability was assessed by measuring the serum
   concentration of fluorescein isothiocyanate-dextran (FITC-dextran,
   4 kDa, Sigma Aldrich).

   Following the operation, mice were administered FD-4 solution orally at
   a dose of 20 mg/kg, 3 h before sacrifice. Blood samples were collected
   and centrifuged at 3000 rpm at 4 °C for 10 min to obtain serum. The
   fluorescence intensity of serum samples and serial dilutions of an FD-4
   standard was measured on a SpectraMax M5 plate reader (Molecular
   Devices) at 485 nm excitation/528 nm emission. Serum FITC-dextran
   concentration was calculated using the standard curve as a reference.

Determination of lung wet/dry ratio

   After the mice were sacrificed, the left lung lobes were absorbed with
   filter paper, weighed, and then the tissues were dried at 70 °C for 24
   h. The dry weight was taken and the wet/dry ratios of the lungs were
   calculated.

16S rRNA gene sequencing

   Total genomic DNA was extracted from fecal samples of eight littermate
   mice using the TGuide S96 Magnetic Soil/Stool DNA Kit (Tiangen Biotech,
   Beijing Co., Ltd.) following the manufacturer’s instructions. The V1-V9
   hypervariable regions of the 16S rRNA gene were amplified using
   specified primers (27 F: AGRGTTTGATYNTGGCTCAG; 1492R:
   TASGGHTACCTTGTTASGACTT). Polymerase chain reaction (PCR) products were
   then purified, quantified, and homogenized to prepare a sequencing
   library. Quality control of the library was performed before sequencing
   using the PacBio Sequel II system (Beijing Biomarker Technologies Co.,
   Ltd.). Downstream data and the CCS file were exported by smrtlink
   analysis software, and sample-specific sequences were identified by
   barcode and converted into fastq format. Bioinformatics analysis was
   performed using BMKCloud.

Metabolomics

   Metabolic profiling of feces from the same eight littermate mice was
   performed using a Waters Acquity I-Class PLUS UPLC tandem Waters Xevo
   G2-XS QTOF high-resolution mass spectrometer. Columns were purchased
   from Waters Acquity (UPLC HSS T3 column 1.8 µm 2.1 × 100 mm). Positive
   ion mode: mobile phase A: 0.1% formic acid aqueous solution; mobile
   phase B: 0.1% formic acid acetonitrile; negative ion mode: mobile phase
   A: 0.1% formic acid aqueous solution; mobile phase B: 0.1% formic acid
   acetonitrile; Injection volume 1 μL primary and secondary mass
   spectrometry data were collected by acquisition software (MassLynx
   V4.2, Waters). The low collision energy is 2 V, the high collision
   energy range is 10–40 V, and the scanning frequency is 0.2 s for a mass
   spectrum. The parameters of the electron spray ionization (ESI) ion
   source are as follows: capillary voltage: 2000 V (positive ion mode) or
   − 1500 V (negative ion mode); cone voltage: 30 V; ion source
   temperature: 150 °C; desolvent gas temperature 500 °C; backflush gas
   flow rate: 50 L/h; desolventizing gas flow rate: 800 L/h. Raw data was
   processed by a Progenesis QI software for peak extraction, peak
   alignment, and other data processing operations, based on the
   Progenesis QI software online METLIN database and self-built library
   for identification. Principal component analysis and Spearman
   correlation analysis were used to judge the repeatability of the
   samples. T-test was used to calculate the difference significance
   p-value of each compound. The R language package ropls was used to
   perform OPLS-DA modeling. The VIP value of the model was calculated
   using multiple cross-validation. P value and the VIP value of the
   OPLS-DA model were adopted to screen the differential metabolites,
   applying a fold change > 1, P value < 0.05 and VIP > 1 criteria.

   Quantification of 5-methoxytryptophan was performed by SHIMADZU Nexera
   UHPLC LC-30 A tandem AB Sciex 4000 Q-trap. The column was purchased
   from Waters, UPLC BEH Amide column (1.7 μm, 2.1 × 100 mm). Mobile phase
   A: 100% H[2]O 25 mM CH3 COONH[4] + 25 mM NH[4]OH, B-100% ACN. Elution
   gradient at 0.3 mL/min was applied as follows: 0 ~ 1 min, 85% B; 1 ~ 12
   min, 65% B; 12 ~ 12.1 min, 40% B; 12.1 ~ 15 min, 40% B; 15 ~ 15.1 min,
   85% B; 15.1 ~ 20 min, and 85% B. ESI ion source parameters are as
   follows, ion source temperature: 600 °C; capillary voltage: − 4500 V
   (negative ion mode); backflush gas flow rate: 20 psi; GS1 and GS2: 60
   psi. The most responsive parent-to-daughter ion transition
   (233.1/146.1) was selected to record the analytes in multiple reaction
   monitoring mode. Raw data was extracted and processed by SCIEX OS
   software as described above.

RNA sequencing

   The total RNA of ileal tissues was extracted using Trizol reagent
   (AG21102, Accurate Biology) and quantified with a NanoDrop 2000
   spectrophotometer (Thermo Fisher Scientific, Wilmington, DE).
   Sequencing libraries were generated from 1 µg of RNA using Hieff NGS
   Ultima Dual-mode mRNA Library Prep Kit for Illumina (Yeasen
   Biotechnology (Shanghai) Co., Ltd.) and sequenced on an Illumina
   NovaSeq platform to generate 150 bp paired-end reads. The raw reads
   were further processed with a bioinformatic pipeline tool (BMKCloud).
   Differential expression analysis was performed using the DESeq2, with p
   values adjusted using the Benjamini–Hochberg method. Genes with an
   adjusted p value < 0.05 and fold change ≥ 1.5 found by DESeq2 were
   assigned as differentially expressed. Gene Ontology (GO) enrichment
   analysis of the differentially expressed genes was implemented by the
   clusterProfiler package based on Wallenius non-central hyper-geometric
   distribution (Young et al., 2010). For the Kyoto Encyclopedia of Genes
   and Genomes (KEGG) pathway enrichment analysis, we used the KOBAS (Mao
   et al., 2005) database and clusterProfiler software to test the
   statistical enrichment of differential expression genes. Raw data are
   available at the GEO database (accession number GSE267002).

Cell culture and treatments

   Caco-2 cells were cultured in Dulbecco’s modified Eagle medium (DMEM,
   C11995500BT, Gibco) supplemented with 10% fetal bovine serum (FBS,
   FSP500, ExCell), at 37 °C in a humidified atmosphere containing 5%
   CO[2]. For the in vitro experiment, Caco-2 cells were seeded onto
   6-well plates and cultured for 24 h with a complete medium. Thereafter,
   the cells were serum-starved overnight prior to drug treatments in a
   serum-free medium. Cells were preincubated with 100 µM
   5-methoxy-DL-tryptophan (Sigma-Aldrich) for 30 min (for required
   groups). TNF-α (RP00001, Abclonal) was used at a concentration of 100
   ng/ml, hydrogen peroxide was used at 100 µM.

Cell proliferation assay

   The proliferation of cells was assessed in vivo by means of a
   5-ethynyl-20-deoxyuridine (EdU) assay (40275ES60, YEASEN) and in vitro
   by a Cell Counting Kit-8 (CCK-8) (C0038, Beyotime) in accordance with
   the instructions provided by the manufacturer. Mice that underwent CLP
   and were treated with PBS or 5-MTP were administered with EdU by
   intraperitoneal injection at a dose of 5 mg/kg body weight 6 h before
   sacrifice. The intestinal segments were fixed, paraffin-embedded,
   sectioned, deparaffinized, and hydrated in accordance with the
   previously described methodology. The tissue sections were treated with
   0.5% Triton X-100 (T8200, Solarbio) for 20 min and washed three times
   with 3% bovine serum albumin (BSA, BS114, Biosharp) in PBS. The tissue
   sections were incubated with the Click-iT reaction mixture for 30 min
   in the dark. The reaction was terminated by washing the sections in 3%
   BSA in PBS. The sections were then counterstained using Mounting Medium
   with 4',6-diamidino-2-phenylindole (DAPI, [78]Ab104139, Abcam).

Cell cycle analysis

   Caco-2 cells were seeded in a 6-well plate and maintained in DMEM
   supplemented with 10% FBS for 24 h at 37 °C. Following a 30-min
   preincubation with 5-MTP, the cells were exposed to TNF-α at a
   concentration of 100 µM for a period of 24 h. H[2]O[2] was added at a
   concentration of 100 µM. The cells in the plate were harvested, washed,
   and resuspended in PBS and fixed with 4 °C precooled ethanol overnight.
   The following day, the cells were resuspended in 2 mL PBS for 15 min
   and washed twice. Subsequently, the cells were pelleted and resuspended
   in 1 mL of a DNA staining solution (propidium iodide, PI) for 30 min in
   a dark environment. The DNA content analysis was carried out using a
   CytoFLEX flow cytometer (BECKMAN COULTER) and the Flowjo v10.10.0
   software (BD Biosciences).

Western blot

   The total protein content of the tissue samples from mice or cells was
   extracted using a RIPA lysis buffer (P0013B, Beyotime) with the
   addition of a 1% protease inhibitor cocktail mix (KGP603, Keygen).
   After a centrifuging at 12,000 rpm, 4 °C for 15 min, the supernatant
   was collected and heated with 5 × loading buffer (FD002, FdBio Science)
   at 95 °C for 7 min. The total protein concentration was then determined
   using the Pierce™ BCA Protein Assay Kit (23,225, Thermo Fisher). Equal
   amounts of each protein sample (20–40 µg) were loaded and separated in
   7.5–12.5% SDS-PAGE gels by electrophoresis, transferred to PVDF
   membranes (ISEQ00010, Merck Millipore), and blocked for 1 h in 5% BSA
   or non-fat milk in Tris-buffered saline with Tween-20 (TBST).
   Subsequently, the blots were incubated with primary antibodies
   overnight at 4 °C, followed by washing in TBST and incubation with
   horseradish peroxidase (HRP)-labeled secondary antibodies for 1 h at
   room temperature. Finally, the signals were detected using an
   enzyme-linked enhanced chemiluminescence (ECL) reagent (BL520 A,
   Biosharp) and quantified by using ImageJ software. The antibodies used
   are listed in Table [79]1.

Table 1.

   Antibodies
   Product title Source Identifier
   Anti-ZO1 Polyclonal antibody Thermo Fisher Scientific 61–7300
   Anti-Occludin Monoclonal Antibody Thermo Fisher Scientific 33–1500
   Anti-Occludin Polyclonal Antibody Proteintech 27,260–1-AP
   CDC25B Monoclonal antibody Proteintech 10,009,433
   Myeloperoxidase (MPO) Rabbit pAb ABclonal Technology 5,500,017,439
   Phospho-WEE1 (Ser642) Antibody ABclonal Technology 10,151,170
   Phospho-CDK1-Y15 Rabbit pAb ABclonal Technology 5,500,028,738
   CDK1 Rabbit pAb ABclonal Technology 0081150201
   Cyclin B1 Rabbit pAb ABclonal Technology 5,500,008,677
   Phospho-AKT1-S473 Rabbit pAb ABclonal Technology 5,500,020,007
   Phospho-PI3 KP85α/γ/β-Y467/Y199/Y464 Rabbit pAb ABclonal Technology
   5,500,028,946
   PI3 Kinase p85 alpha/beta Rabbit mAb ABclonal Technology A22487
   TPH1 Rabbit pAb ABclonal Technology 0205950101
   Ki67 Rabbit mAb ABclonal Technology 4,000,122,207
   β-Actin Rabbit mAb ABclonal Technology 9,100,026,001
   Akt(pan)(11E7) Rabbit monocloning antibody Cell Signaling Technology
   4685 s
   PCNA Rabbit pAb BOSTER Biological Technology BM0104
   Anti-PCNA antibody [PC10] Abcam ab29
   GAPDH Monoclonal antibody Proteintech 60,004–1-Ig
   ACE2 polyclonal antibody Proteintech 21,115–1-AP
   HRP-conjugated Affinipure Goat Anti-Mouse IgG(H + L) Proteintech
   SA00001-1
   HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H + L) EarthOx E030120
   [80]Open in a new tab

Real-time quantitative polymerase chain reaction

   Total RNA was extracted from tissue or cells using the AG RNAex Pro
   Reagent (AG21102, Accurate Biology) and isopropyl alcohol (I112011,
   aladin), and its purity and concentration were determined by a Nanodrop
   2000 (Thermo Fisher Scientific). Single-strand cDNA was generated using
   the HiScript II QRT SuperMix for quantitative PCR (qPCR) (R223-01,
   Vazyme) in accordance with the manufacturer’s instructions.
   Quantitative real-time PCR (qRT-PCR) was performed using Taq Pro
   Universal SYBR qPCR Master Mix (Q712-02, Vazyme). The fold changes in
   the expression levels of the targets were calculated using the 2^−ΔΔCT
   method with β-actin as an endogenous reference. The primers used in the
   qRT-PCR were designed with NCBI Primer-BLAST or acquired from
   Primer-bank (Table [81]2).

Table 2.

   Primers
   Gene symbol Sequence                 Gene symbol Sequence
   H-TJP1-F    ACCAGTAAGTCGTCCTGATCC    Tlr2-R      AGGCGTCTCCCTCTATTGTATT
   H-TJP1-R    TCGGCCAAATCTTCTCACTCC    Tlr4-F      ATGGCATGGCTTACACCACC
   H-OCLN-F    ACAAGCGGTTTTATCCAGAGTC   Tlr4-R      GAGGCCAATTTTGTCTCCACA
   H-OCLN-R    GTCATCCACAGGCGAAGTTAAT   Tjp1-F      GCTTTAGCGAACAGAAGGAGC
   H-IL1B-F    ATGATGGCTTATTACAGTGGCAA  Tjp1-R      TTCATTTTTCCGAGACTTCACCA
   H-IL1B-R    GTCGGAGATTCGTAGCTGGA     Actb-F      GTGACGTTGACATCCGTAAAGA
   H-IL6-F     ACTCACCTCTTCAGAACGAATTG  Actb-R      GCCGGACTCATCGTACTCC
   H-IL6-R     CCATCTTTGGAAGGTTCAGGTTG  Ocln-F      TGAAAGTCCACCTCCTTACAGA
   H-TNF-F     CCTCTCTCTAATCAGCCCTCTG   Ocln-R      CCGGATAAAAAGAGTACGCTGG
   H-TNF-R     GAGGACCTGGGAGTAGATGAG    Pik3r1-F    CATAACCTGCAAACACTGCCC
   H-ACE2-1 F  CGAAGCCGAAGACCTGTTCTA    Pik3r1-R    ATCCTGCAAGGACATATTGTTGT
   H-ACE2-1R   GGGCAAGTGTGGACTGTTCC     Pik3ca-F    CACTCGTCACCATCAAACATGA
   H-CCL2-F    CAAGCAGAAGTGGGTTCAGGATT  Pik3ca-R    AGGGTTGAAAAAGCCGAAGGT
   H-CCL2-R    TCTTGGGTTGTGGAGTGAGTGTTC Akt1-F      ATGAACGACGTAGCCATTGTG
   H-CXCL2-F   CGCCCATGGTTAAGAAAATCA    Akt1-R      TTGTAGCCAATAAAGGTGCCAT
   H-CXCL2-R   CCTTCTGGTCAGTTGGATTTGC   Ccnb1-F     CTTGCAGTGAGTGACGTAGAC
   H-CDK1-F    AAACTACAGGTCAAGTGGTAGCC  Ccnb1-R     CCAGTTGTCGGAGATAAGCATAG
   H-CDK1-R    TCCTGCATAAGCACATCCTGA    Ccnb2-F     GCCAAGAGCCATGTGACTATC
   H-CCNB1-F   TTGGGGACATTGGTAACAAAGTC  Ccnb2-R     CAGAGCTGGTACTTTGGTGTTC
   H-CCNB1-R   ATAGGCTCAGGCGAAAGTTTTT   Ccna1-F     CAGTTTCCCCAATGCTGGTTG
   H-CDC25 A-F GTGAAGGCGCTATTTGGCG      Ccna1-R     CCTCTGCATACTCCGTTACGTTA
   H-CDC25 A-R TGGTTGCTCATAATCACTGCC    Ccna2-F     GTCCTAACGCTCCCATCTCC
   H-CDC25B-F  ACGCACCTATCCCTGTCTC      Ccna2-R     TCGGAAAGAGTGTCAGCCTC
   H-CDC25B-R  CTGGAAGCGTCTGATGGCAA     Cdk1-F      AGAAGGTACTTACGGTGTGGT
   H-CDC25 C-F TCTACGGAACTCTTCTCATCCAC  Cdk1-R      GAGAGATTTCCCGAATTGCAGT
   H-CDC25 C-R TCCAGGAGCAGGTTTAACATTTT  cdc25a-F    TCCCTGACGAGAATAAATTCCCT
   H-ACTB-F    CATGTACGTTGCTATCCAGGC    cdc25a-R    TCGATGAGGTGAAAGGTGTCG
   H-ACTB-R    CTCCTTAATGTCACGCACGAT    cdc25b-F    TCCGATCCTTACCAGTGAGG
   Ace2-F      GGCGACAAGCACAGACTACAA    cdc25b-R    GGGCAGAGCTGGAATGAGG
   Ace2-R      GCCATCTCGTTTTTCAGGACC    cdc25c-F    GTTTCAGCACCCAGTTTTAGGT
   Tlr2-F      GCAAACGCTGTTCTGCTCAG     cdc25c-R    AGAATGCTTAGGTTTGCCGAG
   [82]Open in a new tab

Histology staining, immunohistochemistry, and immunofluorescence

   Tissues from mice were isolated and fixed in a 4% paraformaldehyde
   solution for 24 h at room temperature. They were then embedded in
   paraffin to obtain tissue sections. The sections were deparaffinized by
   xylene and hydrated. Pathological damage in different organs was
   assessed by conducting hematoxylin and eosin (H&E), periodic acid
   Schiff staining (PAS), and alcian blue periodic acid Schiff (AB-PAS)
   staining (BH0022, ERFUL BIOLOGY). Semiquantitative histological scores
   of lung injury included the thickness of alveolar walls, alveolar
   fusion, hemorrhage in the air compartment, inflammation, and tissue
   exudation. To analyze the distribution and expression of specific
   proteins, the sections were subjected to an epitope retrieval process.
   This involved steaming in sodium citrate buffer pH 7.0 (AR0024,
   BOSTER), treating the sections with 10% goat serum (ZLI-9021, ZSGB-BIO)
   and 3% H[2]O[2] to avoid non-specific binding, and incubating them with
   primary antibodies overnight at 4 °C. Following three times of washing
   with PBS and trisodium citrate buffer (AR0024, BOSTER), the sections
   were incubated with the corresponding secondary antibodies for 1 h at
   room temperature. For histology staining, immunohistochemistry (IHC),
   the DAB Kit (ZLI-9018, ZSGB-BIO) was used to visualize the staining,
   whereas hematoxylin was employed as a counterstain. In
   immunofluorescence (IF), a mounting medium with DAPI was used to
   counterstain.

Statistical analysis

   The data presented in this study are expressed as mean ± standard error
   (X ± SD). Data were analyzed and plotted using R software with IDE R
   Studio and GraphPad Prism software (9.5.0). Survival analysis was
   performed by Mantel-Cox log-rank test. For statistical analysis between
   two groups, data conforming to a normal distribution and homogeneity of
   variance were analyzed by a two-tailed t-test. For groups with
   non-normal distribution, Mann–Whitney U test was used. For mean
   analysis between three groups or more, one-way ANOVA and Sidak’s post
   hoc analysis were employed. A value of P < 0.05 was considered
   significant.

Results

Leaky gut exacerbates sepsis and is highly positively correlated with shed
ACE2 levels in sepsis

   From 2020 to 2024, 71 septic patients who met the inclusion criteria
   were enrolled. Baseline patient characteristics are summarized in
   Additional file 1. Serum levels of ACE2 as well as LPS binding protein
   (LBP) (an indicator of gut leak) were significantly higher in patients
   than in healthy volunteers (Fig. [83]1A, B). Furthermore, a positive
   correlation was observed between both parameters and the SOFA index
   (Fig. S1 A, B). To confirm the upregulated serum ACE2 level in sepsis,
   we performed a polymicrobial sepsis model on WT C57BL/6 mice. Compared
   with sham-operated mice, septic mice exhibited more than two-fold ACE2
   concentration (Fig. [84]1C). Furthermore, a temporal gradient
   measurement of serum ACE2 demonstrated that ACE2 shedding occurred 1-h
   post-operation and continued to rise (Fig. S1 C). Given that ACE2 is a
   transmembrane protein, we sought to identify the primary source of
   soluble ACE2, which is cleaved into the circulation. It has been
   reported that the small intestine has the highest reads per kilobase
   per million mapped reads (RPKM) in tissues [[85]23]. We verified that
   the ACE2 protein level in the small intestine also exceeded that of
   other major tissues, including the lung, colon, liver, gallbladder, and
   kidney (Fig. [86]1D-E) and that it dropped in septic mice.
   Concurrently, intestinal ADAM17 sheddase and fecal ACE2 levels were
   increased, suggesting a cleavage on the luminal side. Notably, ACE2
   levels remained constant in the kidneys (which exhibited the
   second-highest ACE2 expression) and lungs in sepsis (Fig. [87]1F-L).
   These findings indicate that the small intestine is probably a major
   source of ACE2 shedding.

Fig. 1.

   [88]Fig. 1
   [89]Open in a new tab

   Leaky gut exacerbates sepsis and is highly positively correlated with
   shed ACE2 levels in sepsis. A Serum ACE2 levels of healthy volunteers
   and septic patients (n (healthy volunteer) = 18, n (septic patient)
   = 71). B Serum LPS-binding protein (LBP) levels of healthy volunteers
   and septic patients (n (healthy volunteer) = 16, n (septic patient)
   = 71). C Serum ACE2 levels in sham and CLP (cecal ligation and
   puncture) mice (n(sham) = 7, n(CLP) = 17). D, E ACE2 protein levels of
   the lung, small intestine, colon, liver, gallbladder, and kidney by
   Western blot (n = 4). F–J ACE2 protein levels of the small intestine,
   kidney, and lung and ADAM17 protein levels of the small intestine (n =
   6). K Feces ACE2 levels of sham and CLP mice (n = 6). L
   Immunohistochemistry (IHC) staining of ACE2 in the ileum (scale bar
   = 50 μm). M IL-6, Pro-BNP, lactic acid, LBP, urea, age, WBC,
   PO[2]/FiO[2] ratio, IBIL, and PCT levels were shown between survivors
   and non-survivors by fold change. N The receiver operating
   characteristic (ROC) curve of LBP for predicting in-hospital death of
   patients with sepsis (n = 71). O Correlation analysis between LBP,
   ACE2, and clinical tests (n = 71). Data are presented as mean ± SD by
   the Student’s t test. ns = no significance, *p < 0.05, **p < 0.01,
   ***p < 0.001, and **** p < 0.0001. Abbreviations: IL-6, interleukin-6;
   pro-BNP, pro-brain natriuretic peptide; Lac, lactic acid; LBP,
   lipopolysaccharide-binding protein; WBC, white blood cell count; IBIL,
   indirect bilirubin; PCT, procalcitonin

   When patients were grouped according to clinical outcome into survivors
   and non-survivors, pro-BNP, lactic acid, age, and LBP levels were
   elevated, whereas PO[2]/FiO[2], IBIL, and PCT levels were lower in
   non-survivors during sepsis (Fig. [90]1M). Receiver operating
   characteristic (ROC) curve analysis showed that LBP could predict
   in-hospital death with an area under the curve (AUC) of 0.734
   (Fig. [91]1N). Whilst serum ACE2 levels were found to be elevated in
   cases of sepsis, the concentrations observed were comparable between
   survivors and non-survivors (Fig. S1D). Consequently, the levels of
   this marker were inadequate to predict in-hospital death (Fig. S1E). We
   then analyzed the possible correlations between ACE2, LBP, and clinical
   test results (Fig. [92]1O). Serum LBP was positively correlated with
   pro-BNP (r = 0.346, p = 0.004), urea (r = 0.300, p = 0.009), and ACE2
   levels (r = 0.737, p < 0.001) and negatively correlated with
   PO[2]/FiO[2] (r = − 0.517, p < 0.001). These results suggest that gut
   leak may accelerate the progress of sepsis and that ACE2 might play a
   role in maintaining gut barrier integrity.

ACE2 contributes to gut integrity in septic mice

   To ascertain the role of membrane form of ACE2 (m-ACE2) during sepsis,
   we employed the Ace2^−/y (KO) mice and conducted a sham or CLP
   operation together with a C57BL/6 WT control (Fig. [93]2A). We used
   agarose gel electrophoresis for mouse genotyping and validated the
   knockout efficiency in the ileum (Fig. S1 F, G). The cecal ligation and
   puncture model was produced as described previously. The overall effect
   of ACE2 on mice was first investigated using survival analysis
   (Fig. [94]2B). The sham operation did not affect the survival rate in
   both groups. The CLP mice began to show clinical syndromes 6 h
   post-operation, featuring less movement, ruffled hair, and diarrhea.
   The WT-CLP and KO-CLP group mice exhibited acute mortality. However,
   while the survival curve of the WT-CLP group reached a plateau between
   12- and 24-h post-operation, the survival rate of the KO-CLP group
   continued to decline. (n (WT-CLP) = 15, 7-day survival rate 52%, 95% CI
   21.9–60.7%; n (KO-CLP) = 15, 7-day survival rate 20.0%, 95% CI
   19.9–60.0%; P = 0.0012). KO-CLP mice exhibited more body weight loss
   (Fig. S1H), higher levels of inflammatory cytokine TNF, serological
   infectious parameter procalcitonin (PCT), and lower glucose levels in
   comparison with WT-CLP mice (Fig. [95]2C–E). The worsened survival rate
   of KO mice suggests that ACE2 may be beneficial in overcoming septic
   shock. As ACE2 was rather specific and highly enriched on the luminal
   side of the villi (Fig. S1G), we considered whether the loss of ACE2
   might compromise the functions of the intestinal epithelial cells,
   which act as the first line of defense against potentially pathogenic
   microorganisms. The integrity of the intestinal epithelium was assessed
   by measuring the intensity of FITC-dextran (MW 4 kDa) fluorescence in
   serum [[96]24]. The FITC intensity was found to be significantly higher
   in the WT-CLP group than in its sham control, indicating the presence
   of gut leak in sepsis. Interestingly, the knockout of Ace2 did not
   influence the permeability of epithelial cells in the sham-operated
   group, whereas it disrupted epithelial integrity severely in sepsis
   (Fig. [97]2F). In evaluations of the epithelial mechanical barrier, it
   was confirmed that CLP-operated mice exhibited villi damage and
   discontinuities. Structure shattering and stripping were more severe in
   KO mice. The intestinal chemical barrier was evaluated using AB-PAS
   staining (Fig. [98]2G middle panel). The knockout of Ace2, as well as
   CLP operations on WT mice, led to a mild loss of goblet cells. In
   contrast, KO mice exhibited aggravated goblet cell damage and lost the
   majority of their goblet cells. Tight junction (TJ) proteins were
   evaluated by immunofluorescence (IF) and Western blot (Fig. [99]2G
   lower panel, Fig. [100]2H-K). Intestinal ZO-1 or OCLN levels were
   unchanged in sham animals, while they were reduced in sepsis.
   Similarly, these TJ protein levels were even lower in KO mice. To
   rescue the loss of ACE2, hACE2^+/+ (OE) mice (ICR background) were
   employed. Mice were genotyped and the overexpression was confirmed in
   the ileum (Fig. S1I, J). Levels of shed ACE2 were found to be elevated
   in the feces and serum of OE mice, and they increased following CLP
   surgery (Fig. S1 K, L). OE-CLP mice exhibited improved survival rates,
   less loss of body weight, higher glycemia levels, and lower
   inflammatory markers (Fig. S1M-Q). Serum FITC intensity was reduced in
   OE-CLP mice compared with WT-CLP mice (Fig. S1R). Intestinal TJ protein
   ZO-1 and OCLN were also partly rescued in OE-CLP mice (Fig. S1S).
   Furthermore, HE and AB-PAS staining revealed that intestinal epithelial
   barrier and goblet cell damage were less severe (Fig. S1 T, U). In
   brief, upon sepsis challenge, loss of ACE2 exacerbates intestinal
   barrier dysfunction and leads to a worse prognosis, which could be
   improved by overexpression of ACE2. However, merely knockout or
   overexpression of ACE2 barely affected intestinal barrier function and
   was asymptomatic. These results suggest an intriguing role ACE2 plays
   in maintaining gut homeostasis.

Fig. 2.

   [101]Fig. 2
   [102]Open in a new tab

   ACE2 contributes to gut integrity in septic mice. A A schematic diagram
   of the experimental procedures. B Survival rates of Sham or CLP
   operation of both WT mice and Ace2^-/y mice (n(Sham) = 5, n(CLP) = 15).
   C–E Serum TNF, PCT, and glucose concentration of WT mice and Ace2^-/y
   mice underwent Sham or CLP operation (n = 4–15). F Fluorescein
   isothiocyanate-dextran (FITC-dextran; FD-4) was gavaged 3 h before
   sacrifice (20 mg/kg), and serum FD-4 concentration was examined (n =
   4–15). G Hematoxylin and eosin (H&E) staining (upper panel), alcian
   blue periodic acid Schiff (AB-PAS) staining (middle panel), and IF
   staining of tight junction (TJ) protein OCLN (lower panel) in the ileum
   (scale bar = 50 μm). H–J Ileal ZO-1, OCLN, and ACE2 levels by Western
   blot (n = 6). K Quantification of goblet cells (n = 6). Data are
   presented as mean ± SD. ns = no significance, *p < 0.05, **p < 0.01,
   ***p < 0.001, and ****p < 0.0001 by two-tailed Student’s t test,
   Mann–Whitney test, or one-way ANOVA and Sidak’s post hoc analysis.
   Intergroup survival differences were analyzed by a log-rank test.
   Abbreviations: CLP, cecal ligation and puncture; TNF, tumor necrosis
   factor; PCT, procalcitonin; FD-4, fluorescein isothiocyanate-dextran;
   OCLN, occludin; ZO-1, zona occludens 1

ACE2 reduces bacteria translocation and alleviates organ dysfunction in
sepsis

   Following gastric gavage of bioluminescent E. coli, bacterial
   luminal-basolateral translocation was assessed via the AmiHTX Imaging
   System 24 h post-operation. Bioluminescent E. coli was colonized in the
   recipients’ gut upon a 5-day gavage. Bioluminescent imaging
   demonstrated that photon intensity was relatively low in the
   sham-operated groups. Given that gut homeostasis was maintained in both
   groups, the engineered E. coli was likely at a disadvantage in the
   competition with indigenous microbiota. For septic mice, significant
   photon signals were observed at the abdomen and chest area, indicating
   microbial dysbiosis in the gut and bacteria translocation to
   extra-intestinal organs in sepsis (Fig. [103]3A–C). The knockout of
   Ace2 resulted in a more severe gut leak, while OE mice partly preserved
   the integrity of the epithelial barrier (Fig. S2 A-C). As the swift
   clearance of bacteria could reflect a defense strategy and predict the
   outcomes of sepsis [[104]25, [105]26], bacterial counts of both aerobic
   and anaerobic bacteria (24 h after CLP) were analyzed in the blood,
   peritoneal lavage fluid (PLF), and lung samples (Fig. [106]3D, E). The
   knockout of Ace2 resulted in a higher bacteria count. Excessive
   bacteria load in vital organs could disrupt oxidative and inflammatory
   balance during sepsis [[107]27]. The histological examination and
   wet/dry ratio of the lung tissues revealed the presence of acute lung
   injury in the CLP groups, characterized by inflammation, edema,
   alveolar septal thickening, and hemorrhage (Fig. [108]3F, G). In the
   kidney, the glomerular and tubular structures of the sham group
   remained intact. Following CLP, renal damage was observed, including
   swelling of the tubule epithelium, brush border abscission, tubular
   dilation, and elevation of serum creatinine levels (Fig. [109]3H, I).
   The knockout of Ace2 led to a greater incidence of lung injury and
   renal dysfunction. Conversely, OE mice exhibited a mitigating effect on
   these organ dysfunctions (Fig. S2D-G). In addition to the polymicrobial
   sepsis model, we performed live-bacteria-induced sepsis in mice by
   implanting a fibrin clot containing Escherichia coli (E. coli) in the
   peritoneal cavity [[110]28]. One million colony-forming units (CFU)
   were chosen for the experiments, as this dosage demonstrated a moderate
   50% mortality within a 48-h period (Fig. S2H). Similarly, KO- E. coli
   mice exhibited worse survival rates, more weight loss, lower serum
   glucose levels, and higher TNF levels (Fig. S2I-L). Furthermore, villi
   damage and discontinuities were more severe in this group of mice (Fig.
   S2M, N), which led to more bacterial translocation (Fig. S3 A, B) and
   organ dysfunction (Fig. S3 C-F). These results suggest that KO mice
   were more susceptible to infectious challenges and that their
   intestinal barrier integrity was more easily compromised.

Fig. 3.

   [111]Fig. 3
   [112]Open in a new tab

   ACE2 reduces bacteria translocation and alleviates organ dysfunction in
   sepsis. A–C In vivo imaging and photon quantifications of
   bioluminescent E. coli (n = 3). D, E Quantification of bacterial load
   in blood, peritoneal lavage fluid (PLF), and lung samples from mice who
   underwent sham or CLP operation (n = 3). F H&E staining and
   histopathological evaluation of the lungs (scale bar = 50 μm, n = 5). G
   Wet/dry ratio of the lungs (n = 6). H Periodic acid Schiff (PAS)
   staining and the histopathological evaluation of the kidneys. Tubular
   structural disruption was assessed with a semi-quantitative scale (0:
   no lesion; 1: < 20%; 2: 20–40%; 3: 40–60%; 4: 60–80%; 5: 80–100% (scale
   bar = 50 μm, n = 4–6). I Serum creatinine levels of the mice (n = 6).
   Data are presented as the mean ± SD. ns = no significance, *p < 0.05,
   **p < 0.01, ***p < 0.001, and ****p < 0.0001 by one-way ANOVA and
   Sidak’s post hoc analysis. Abbreviations: PLF, peritoneal lavage fluid;
   Scr, serum creatinine

5-MTP was highly correlated with a reduced abundance of
tryptophan-metabolizing bacteria in ACE2 knockout mice

   Since Ace2 knockout itself was not sufficient to induce observable
   intestinal leakage, potential mediators in the regulation of intestinal
   homeostasis were investigated. It is well established that the gut
   microbiota, as well as microbial metabolites, affect intestinal
   homeostasis. Furthermore, ACE2 has been reported to alter the microbial
   community [[113]12]. However, a detailed profile of the gut microbiota
   in the absence of ACE2 was not available. As knockout of Ace2 did not
   directly alter the expression of TJ proteins, we postulated that a
   pre-existing change, such as the loss of beneficial commensal bacteria
   or microbial metabolites, rendered the gut barrier of KO mice more
   susceptible to sepsis-induced gut leak. To taxonomically characterize
   the gut microbiota composition, 16S rRNA gene sequencing of intestinal
   contents was performed. The rarefaction curves and rank abundance
   curves demonstrated that the differences within the groups are small
   and that these samples were sufficient to depict the microbiome of both
   strains (Fig. S4 A, B). Knockout of Ace2 significantly reduced the
   abundance of verrucomicrobiae, accompanied by an increase in
   bacteroidia and clostridia (Fig. S4 C, D). The Shannon indices were
   elevated in the KO mice compared to their WT littermates
   (Fig. [114]4A), indicating an increased microbial complexity at the
   operational taxonomic unit (OTU) level. The principal coordinate
   analysis (PCoA) and stacked bar chart separated the KO mice from their
   littermates (Fig. [115]4B–D). To identify significant bacterial taxa in
   the two groups, we employed the linear discriminant analysis effect
   size (LEfSe) method, which identified significant differences in the
   bacterial taxa with an LDA score of ≥ 4.5. Akkermansia mucinipil (s),
   Verrucomicrobiales (o), Akkermansiaceae (f), Verrucomicrobiota (p),
   Akkermansia (g), Verrucomicrobiae (c), and uncultured_Barnesiella_sp.
   (g) were found to be significantly less abundant in KO mice than in WT
   mice, while Clostridia (c), Lachnospirales (o), Lachnospiracae (f), and
   Lachnospiraceae_NK4 A136_group (g) were found to be more abundant in KO
   mice (Fig. [116]4E). In parallel, untargeted metabolomics was employed
   to generate a comprehensive picture of the metabolome of the two
   strains. A total of 1667 metabolites were identified, with 88 being
   upregulated and 293 being downregulated as a consequence of Ace2
   knockout (Fig. [117]4F). Samples were also separated into two distinct
   groups by PCoA (Fig. [118]4G). Volcano plots of the -log10 (P-value) as
   a function of log2(FC) were employed to visualize the significant
   changes in metabolites (Fig. [119]4H). The top five ranked metabolites
   that were downregulated in KO mice were 3'-hydroxyamobarbital,
   2-cis-abscisate, demethyllactenocin, biopterin, and 5-methoxytryptophan
   (5-MTP). The top 5 upregulated metabolites were Mpomeovt,
   gamma-aminobutyryllysine, PG(LTE4/i-12:0), avenoleic acid, and
   N-nervonyl threonine. Among these metabolites, 5-MTP, a tryptophan
   derivative, was considered to be of greater biological significance. It
   has been reported that tryptophan hydroxylase 1 (TPH-1) is a key enzyme
   in the synthesis of 5-MTP [[120]18]. However, the protein levels of
   instestinal TPH-1 were comparable between KO and WT mice (Fig. S4E, F).
   Altered levels of some other tryptophan metabolites may also indicate
   the aberrant tryptophan metabolism in KO mice (Fig. S4G, H). Tryptamine
   was reduced in KO mice while the level of its precursor, indole, had a
   tendency to increase (p = 0.06). Furthermore, correlation analysis was
   employed to characterize bacteria species associated with the 5-MTP
   alteration. A total of six species demonstrated a high correlation (r >
   0.8) with 5-MTP. The Akkermansia muciniphila exhibited a correlation of
   0.8133 with 5-MTP, with a 95% confidence interval of [0.2543, 0.9649]
   and a p-value of 0.0141. Similarly, the Ligilactobacillus murinus
   demonstrated a correlation of 0.8125 with 5-MTP, with a 95% confidence
   interval of [0.2522 to 0.9648] and a p-value of 0.0143. Turicibacter
   sp. LA61 (r = 0.8751, 95%CI [0.4447 to 0.9772], p = 0.0044),
   Adlercreutzia muris (r = 0.8557, 95%CI [0.3804, 0.9734], p = 0.0067),
   Romboutsia ilealis (r = 0.8358, 95%CI [0.3190 to 0.9695], p = 0.0097),
   and uncultured Barnesiella sp. (r = 0.8586, 95%CI [0.3897 to 0.9740],
   p = 0.0063) were also identified as significant (Fig. [121]4I, Fig.
   S4I-K).

Fig. 4.

   [122]Fig. 4
   [123]Open in a new tab

   Microbial composition and metabolites undergo alterations in Ace2^−/y
   mice. A Shannon index of Ace2^−/y mice and WT littermates (n = 4). B–E
   Beta-diversity analyzed by 3D principal component analysis (PCA),
   principal coordinate analysis (PCoA), cluster tree barplot, and Lefse
   analysis (LDA score > = 4.5) of WT and Ace2^−/y mice. F Regulated
   metabolites detected by untargeted metabolomics (n = 4). G PCoA plot
   (PCo1 vs. PCo2) of metabolite composition in Ace2^−/y mice and WT
   littermates (n = 4). H Volcano plot representation of regulated
   metabolite (black arrow indicating 5-methoxytryptophan). I Bacterial
   species highly correlate with 5-methoxytryptophan (5-MTP) abundance
   (n = 8). Data are presented as the mean ± SD. Alpha-diversity was
   calculated by two-tailed Student’s t test, **p < 0.01, and
   beta-diversity was calculated by the binary Jaccard method.
   Abbreviation: 5-MTP, 5-methoxytryptophan

   It is noteworthy that Akkermansia muciniphila outnumbered the other
   bacteria by 1055-fold (Adlercreutzia muris), 36-fold (Ligilactobacillus
   murinus), 167-fold (Romboutsia ilealis), 80-fold (Turicibacter sp.
   LA61), and 526-fold (uncultured Barnesiella sp.), suggesting the role
   between Akkermansia muciniphila and 5-MTP level could be dominant
   compared to other bacteria species (Fig. S4L).

The worsening of sepsis-induced gut leak is transferrable by fecal
transplantation partially via 5-MTP

   To figure out the role of the gut microbiota and microbial metabolites
   in sepsis, an antibiotic cocktail was administered to both mouse
   strains prior to the CLP operation. ABX depletion resulted in a
   deterioration of intestinal permeability in WT-CLP mice (Fig. S5 A-E).
   This was accompanied by TNF upregulation, hypoglycemia, weight loss,
   increased bacterial load, and a more severe organ injury profile,
   comparable to that observed in KO mice (Fig. S5 F-M). These findings
   indicate that the microbiota and microbial metabolites are key
   mediators in ACE2-induced gut barrier repair.

   Following the administration of ABX, we conducted a fecal microbiota
   transplantation (FMT) study on two groups of WT-ABX mice. Feces from WT
   or KO littermate mice were transplanted for a period of five
   consecutive days (Fig. [124]5A). Thereafter, the fecal samples from the
   recipients were collected for further analysis. Following the CLP
   operation, subjects who had received KO feces exhibited features of the
   KO mice. These included a diminished survival rate, hypoglycemia, a
   more pronounced inflammatory cytokine level, and weight loss
   (Fig. [125]5B–D and Fig. S6 A). Meanwhile, gut leak, bacterial
   translocation, and extra-intestinal organ injury were more severe in
   the KO recipients when compared to the mice that received WT feces
   (Fig. [126]5E–J and Fig. S6B-G). Additionally, we employed LC/MS to
   quantify 5-MTP levels post-ABX administration and FMT. Monitoring of
   parent-daughter ion pairs at m/z (233.1/146.1) and retention time of
   5-MTP at 3.2 min (Fig. [127]5K) revealed a linear regression curve for
   peak area and standard concentration (y = 7E-06x + 0.0204, R^2 = 0.99).
   Following the depletion of the microbiota, 5-MTP was barely detected
   (tangerine curve). Mice that received feces from KO mice (pink curve)
   exhibited slightly higher 5-MTP content, while the 5-MTP levels of mice
   that received feces from WT mice (blue curve) recovered significantly
   (Fig. [128]5L, M). Further, the levels of 5-MTP in the feces of OE mice
   were found to be 2.3 times those observed in WT mice (Fig. S6H). These
   results demonstrated that the worsened features of KO mice in the
   septic challenge were transferable by the gut microbiome, and microbial
   metabolite 5-MTP was closely involved.

Fig. 5.

   [129]Fig. 5
   [130]Open in a new tab

   The worsening of sepsis-induced gut leak is transferrable by fecal
   transplantation partially via 5-MTP. A A schematic diagram of fecal
   microbiota transplantation (FMT) and pretreatments. B Survival rates of
   WT-FMT mice and Ace2^−/y -FMT mice underwent CLP (n = 10). C, D Serum
   glucose and TNF concentration of WT-FMT mice and Ace2^−/y -FMT mice
   underwent CLP (n = 6). E Serum FD-4 concentration of WT-FMT mice and
   Ace2^−/y -FMT mice underwent CLP (n = 5–9). F–H Ileal TJ protein (ZO-1
   and OCLN) levels by Western blot (n = 6). I H&E staining (left panel),
   AB-PAS staining (middle panel), and IF staining of TJ protein OCLN
   (right panel) in the ileum. J Quantification of goblet cells (n = 6). K
   Typical multiple reaction monitoring chromatogram and chemical
   structural formula of pure 5-MTP. L Extracted ion chromatogram (XIC)
   overlap diagram targeting fecal 5-MTP of antibiotic (ABX) mice, WT-FMT
   mice, and Ace2^−/y -FMT mice. M Fecal 5-MTP quantification of ABX-mice
   and FMT-mice (n = 5). Data are presented as the mean ± SD. **p < 0.01,
   ***p < 0.001, and ****p < 0.0001 by two-tailed Student’s t test or
   Mann–Whitney test. Intergroup survival differences were analyzed by a
   log-rank test. Abbreviations: ABX, antibiotic; FMT, fecal microbiota
   transplantation; PCT, procalcitonin; TNF, tumor necrosis factor; FD-4,
   fluorescein isothiocyanate-dextran; TJ, tight junction; OCLN, occludin;
   ZO-1, zona occludens 1; 5-MTP, 5-methoxytryptophan

5-MTP-mediated gut barrier protection was associated with enhanced epithelial
cell proliferation and the activation of the PI3K-AKT-WEE1 pathway

   5-MTP was administered intraperitoneally to both WT mice and KO mice at
   23.4 mg/kg [[131]16] postoperation. The survival rate and body weight
   of the 5-MTP treatment group were significantly higher than the PBS
   group (Fig. [132]6A and Fig. S6I-K). Pro-inflammatory parameter levels
   were downregulated, while glucose levels were partly recovered
   (Fig. [133]6B–D and Fig. S6L, M). Gut leak and villi shattering were
   both alleviated, as indicated by serum FITC-dextran intensity and
   histological evaluation (Fig. [134]6E, F and Fig S6 N, O). Meanwhile,
   the inflammation of the alveoli and the thickening of the septa were
   less prominent in the lung than in the PBS-treated CLP group
   (Fig. [135]6G and Fig. S6P, Q). For renal tubular structure, a smoother
   brush border and a reduced degree of tubular dilation were observed
   (Fig. [136]6H and Fig. S6R, S). To investigate the mechanism of
   5-MTP-induced gut barrier protection, transcriptional features were
   mapped (RNA-seq) for ileum from CLP mice treated with either 5-MTP or
   PBS (n = 3). KEGG pathway enrichment identified a cluster of genes
   concerning cell cycle and cell proliferation (Fig. S7 A). Therefore, an
   EdU assay was performed to measure cell proliferation. The nucleus of
   intestinal epithelial cells exhibited minimal staining with EdU in CLP
   mice, whereas increased EdU incorporation was observed in 5-MTP-treated
   mice (Fig. [137]6I). In accordance with the EdU assay, proliferating
   cell nuclear antigen (PCNA), a DNA synthesis marker, was upregulated in
   the ileum of 5-MTP-treated mice (Fig. [138]6 J). The effect of 5-MTP on
   proliferation was confirmed in the OE-CLP mice (Fig. S7B, C). The
   beneficial effect of 5-MTP on survival, weight change, glycemia,
   inflammation, gut leak, and epithelial cell proliferation could also be
   achieved by oral administration (Fig. S7D–K).

Fig. 6.

   [139]Fig. 6
   [140]Open in a new tab

   5-MTP protects the gut barrier by promoting epithelial cell
   proliferation. A Survival rates of sham or CLP mice treated with 5-MTP
   or phosphate-buffered saline (PBS) (n=5–10). B–D Serum TNF, PCT, and
   glucose concentration of CLP mice treated with 5-MTP or PBS (n=6). E
   Serum FD-4 concentration in CLP mice treated with 5-MTP or PBS (n=6). F
   Ileal H&E staining (left panel), AB-PAS staining (middle panel), and IF
   staining of TJ protein OCLN (right panel). The bar chart shows the
   quantification of ileal goblet cells (n=6). G H&E staining,
   histopathological evaluation, and the wet/dry ratio of the lungs (scale
   bar= 50 μm, n=4–6). H PAS staining, histopathological evaluation of the
   kidneys, and the serum creatinine levels of the mice (scale bar= 50 μm,
   n=4–6). I Quantification of ileal 5-ethynyl-20-deoxyuridine (EdU) assay
   of 5-MTP or PBS-treated CLP mice (scale bar= 50 μm, n=6). J Ileal
   proliferating cell nuclear antigen (PCNA) protein level by Western blot
   (n=6). K A schematic diagram illustrating the role of ACE2 in promoting
   intestinal epithelial cell repair in sepsis via the key microbial
   metabolite 5-MTP. Data are presented as the mean ± SD. ns=no
   significance, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001
   by two-tailed Student’s t test or Mann-Whitney test. Intergroup
   survival differences were analyzed by the log-rank test. Abbreviations:
   5-MTP, 5-methoxytryptophan; TNF, tumor necrosis factor; PCT,
   procalcitonin; FD-4, fluorescein isothiocyanate-dextran; Scr, serum
   creatinine

   The PI3K-AKT signaling pathway, which is crucial for cell survival and
   proliferation [[141]29, [142]30], was also enriched in the
   5-MTP-treated group (Fig. [143]7A, Fig. S7L). Upregulation of the
   cyclin B1-CDK1 complex was revealed by the GO biological process and
   cellular component plot (Fig. [144]7B). The GSEA results and heatmap
   indicated that 5-MTP could induce intestinal epithelial cell repair by
   stimulating cell proliferation (Fig. [145]7C, D). We hypothesized that
   the mechanism was likely related to the PI3 K-AKT signaling pathway and
   the accelerated G2/M transition of the mitotic cell cycle. We performed
   qPCR to validate differentially expressed genes identified in RNA-seq
   as well as some other members of cyclin, cell division cyclin, and
   cyclin-dependent kinase families. The mRNA levels of Ccnb1, Cdk1, and
   cell cycle division 25B (Cdc25B) were found to be upregulated in the
   5-MTP group, while Ccna2 and Cdc25 C expression were downregulated
   (Fig. [146]7E). The expression of mitotic cell cycle-relevant genes was
   also validated in vitro (Fig. [147]7F). The expression of PI3 K, AKT,
   WEE1 (G2 checkpoint kinase), critical cell cycle kinases CDK1,
   CDK-tyrosine phosphatases CDC25B and CCNB1, and phosphorylated forms
   was examined (Fig. [148]7G). The activated PI3 K-AKT signaling pathway
   could phosphorylate WEE1, thereby preventing its phosphatase activity
   on CDK1. Furthermore, the upregulation of CDC25B could dephosphorylate
   P-CDK1, thereby activating the CDK1-CCNB1 complex and promoting the
   transition from the G2 to the M phase. The proportion of cells in the
   G1, S, and G2/M phases was quantified by flow cytometry (Fig. [149]7H,
   I). The administration of 5-MTP was found to overcome the cell cycle
   arrest at the G2/M phase induced by TNF (100 ng/ml). The pretreatment
   of cells with a CDK1 inhibitor (RO-3306) resulted in a diminished
   5-MTP-induced G2/M phase release. Furthermore, as TNF exhibited a mild
   blockade of the cell cycle phase at G2/M, we proceeded to administer
   TNF + H[2]O[2] (100 µM) in order to reproduce oxidative stress damage
   in sepsis. A greater proportion of cells was found to be blocked at the
   G2/M phase, with a distinct overturn observed in the 5-MTP-treated
   group (Fig. S7M, N).

Fig. 7.

   [150]Fig. 7
   [151]Open in a new tab

   The PI3K-AKT-WEE1 pathway participated in 5-MTP-induced epithelial cell
   proliferation and repair. A, B RNA-sequencing reveals enriched pathways
   and cellular components after 5-MTP administration. C Gene set
   enrichment analysis (GSEA) of regulated genes. D Heatmap visualizes
   regulated gene expression after 5-MTP administration (n = 3). E Cell
   cycle-related genes of CLP mice treated with 5-MTP or PBS were analyzed
   in ileal (n = 5). F, G Protein levels and mRNA levels of the cell cycle
   and PI3K-AKT-WEE1 signaling pathway were measured in vitro (n = 6–9).
   H, I Cell cycle analysis by flow cytometry (n = 3). Data are presented
   as the mean ± SD. ns = no significance, *p < 0.05, **p < 0.01, ***p <
   0.001, and ****p < 0.0001 by two-tailed Student’s t test or one-way
   ANOVA and Sidak’s post hoc analysis

Discussion

   In this study, we sought to examine the alterations in ACE2 expression
   in a murine model of sepsis. Our findings demonstrate that the shedding
   of ACE2 leads to an augmentation in gut leak, consequently impacting
   the function of vital organs and the survival status of septic mice.
   The specific mechanism may be to regulate the content of tryptophan
   metabolite 5-MTP produced by intestinal flora, which promotes the
   proliferation and repair of intestinal epithelial cells.
   Supplementation with 5-MTP can counteract the sepsis-induced barrier
   damage. The PI3K-AKT-WEE1 signaling pathway was identified as a key
   mediator of the beneficial effects of 5-MTP administration on the
   CDK1-CCNB1 complex. This resulted in a G2/M phase shift and enhanced
   epithelial repair.

   ACE2 is a pivotal component of the renin-angiotensin system, which
   plays a multifaceted role in the vascular system, amino acid
   absorption, and SARS-CoV-2 entry. ACE2 shedding is the process by which
   the full-length membrane form of ACE2 (m-ACE2) undergoes ectodomain
   shedding to generate a soluble form (s-ACE2). This process has been
   demonstrated to be deleterious in diabetic cardiomyopathy (DCM)
   [[152]31], neurons [[153]32], and Influenza virus-infected airway
   epithelial cells [[154]33]. Likewise, our study demonstrated that ACE2
   shedding increases susceptibility to gut leak, facilitates bacteria
   translocation, and exacerbates organ dysfunction. As previously stated,
   the translocation of bacteria represents a pivotal link between
   localized intestinal injury and the onset of systemic inflammation. A
   method frequently employed to assess bacterial load is the cultivation
   of blood or tissue homogenization on agar plates [[155]34]. In addition
   to this, in vivo imaging was performed to better visualize bacterial
   translocation. Escherichia coli was selected as the bioluminescent gene
   plasmid carrier due to its indigenous existence in the gut and its
   prevalence in the abdominal cavity in the CLP model [[156]27]. A
   primary constraint of the CLP model is its reliance on the composition
   of the gut microbiota, which serves as the inoculum that initiates the
   infection. Consequently, it is imperative to demonstrate that the
   observed phenotype is not directly attributable to the altered gut
   microbiome in knock-out mice. By inoculation the same number of
   bacteria into the peritoneal cavity of mice, the intrinsic gut
   microbiota composition difference between WT and KO mice could be ruled
   out. Furthermore, we found that the shedding of ACE2 appears to
   exacerbate gut leak, at least in part, through the loss of the
   tryptophan metabolite 5-MTP. Tryptophan can be metabolized by the
   intestinal epithelium or intestinal flora [[157]35]. To identify the
   major source of 5-MTP, a joint analysis of 16S rRNA sequencing and
   untargeted metabolomics was conducted, which revealed reduced levels of
   5-MTP and a high correlation between this metabolite and specific
   bacterial species. Among these, reduced Akkermansia muciniphila, a
   mucin-degrading bacterium [[158]36, [159]37], was consistent with the
   loss of mature goblet cells and the weakening of the mucus barrier in
   mice lacking ACE2. Furthermore, 5-MTP levels were almost non-existent
   in ABX-treated mice and could be reversed by FMT of conventional mouse
   feces. In addition, 5-MTP levels were increased in the feces of OE
   mice. These findings collectively indicated that 5-MTP is likely to be
   a microbial metabolite. Similarly, a study observed that the intestinal
   flora of mice with global overexpression of ACE2 (ACE2 KI) underwent
   modulation, with an increase in OTU abundance and α-diversity, and a
   significant upregulation of the tryptophan metabolism pathway
   [[160]38].

   To the best of our knowledge, this is the first study to reveal the
   function of fecal 5-MTP. The fecal 5-MTP level was found to be four
   times lower in Ace2-KO mice than in WT littermates. This high
   correlation between 5-MTP level and certain bacteria abundance was
   further verified by a series of FMT experiments and targeted
   metabolomics. Additionally, intestinal TPH-1 level was not altered by
   knocking out Ace2, suggesting that intestinal epithelial cells were
   unlikely responsible for 5-MTP synthesis in this context. Collectively,
   the loss of ACE2 resulted in a reduction in intestinal neutral amino
   acid transport, modification of the mucin environment, and,
   consequently, an impact on the abundance of tryptophan metabolizers.
   Previous studies have demonstrated that Akkermansia muciniphila and its
   outer protein Amuc_1100 regulate tryptophan metabolism [[161]39]. It is
   therefore unsurprising that our joint analysis indicated that
   Akkermansia muciniphila was a promising bacterium in 5-MTP synthesis.
   However, further studies are required to gain a deeper understanding of
   the role of other species in maintaining gut homeostasis. For instance,
   Lactobacilli has been demonstrated capable of converting tryptophan in
   the stomach and ileum of mice [[162]40]. A specific species of this
   genus, Ligilactobacillus murinus, was also identified as highly
   correlated with the level of 5-MTP.

   The limitations of our study are as follows. Firstly, in order to
   facilitate clinical transformation and application, OE mice were
   employed to rescue ACE2 shedding. However, this transgenic mouse model
   was of ICR background, rendering it incomparable with KO mice (C57
   background). The baseline characteristics of the two strains of mice
   were demonstrated in Additional file 2. Furthermore, the generation of
   transgenic mice involved the microinjection of the mouse Ace2 promoter
   driving the human ACE2 coding sequence into the pronuclei of fertilized
   ova [[163]20], resulting in variable copy numbers of the targeted
   sequence in the offspring. Therefore, we selected only KO mice and
   their WT littermates for microbial and metabolomics analysis. It would
   be more convincing to identify specific bacteria or metabolites in both
   KO and OE mice. Secondly, in septic mice, we observed a significant
   reduction in small intestine ACE2 levels, while other major
   ACE2-expressing organs remained unchanged. This suggests that the small
   intestine may be a primary source of s-ACE2. Further evidence could be
   provided by the utilization of villin-GFP reporter mice, which would
   strengthen this hypothesis.

Conclusions

   Our findings demonstrate that ACE2 shedding contributes to gut leak and
   multiple organ dysfunction in sepsis. The mediator in question was
   found to be closely related to bacterial metabolite 5-MTP, a tryptophan
   derivative. Furthermore, the evidence indicates that 5-MTP promoted
   epithelial proliferation via the PI3K/AKT/WEE1 pathways and
   CDK1-CCNB1-induced G2/M cell cycle transition. Our study enriched the
   mechanisms by which ACE2 regulates gut homeostasis and shed light on
   further applications.

Supplementary Information

   [164]40168_2025_2128_MOESM1_ESM.xlsx^ (36.3KB, xlsx)

   Additional file 1. Figure S1. (A) Correlation analysis between ACE2 and
   the SOFA index (n=71). (B) Correlation analysis between LBP and the
   SOFA index (n=71). (C) Temporal gradient measurement of serum ACE2
   levels (n=6). (D)Serum ACE2 levels of survivor and non-survivor in
   septic patients (n(survivor)=51, n(non-survivor) =20). (E) The ROC
   curve of ACE2 in predicting in-hospital mortality among patients(n=71).
   (F-G, I-J) Genotyping of Ace2^-/y and hACE2^+/+ mice by agarose gel
   electrophoresis/ethidium bromide staining and IHC staining (Scale bar=
   50 μm). (H) Changes in body weight of WT and Ace2^-/y mice after
   undergoing CLP or sham surgery (n=4-6). (K-L) Feces and serum ACE2
   levels of WT and hACE2^+/+ mice underwent sham or CLP surgery(n=6). (M)
   Survival rates of WT and hACE2^+/+ mice underwent sham or CLP surgery
   (n=5-15). (N) Changes in body weight of WT and hACE2^+/+ mice after
   undergoing CLP or sham surgery (n=4-6). (O-Q) Serum glucose, TNF and
   PCT concentration of WT and hACE2^+/+ mice underwent sham or CLP
   surgery (n=4-6). (R) Serum FD-4 concentration of WT-sham,
   hACE2^+/+-sham, WT-CLP and hACE2^+/+-CLP mice(n=5-8). (S) Ileal TJ
   protein (OCLN and ZO-1) level by Western blot (n=4-6). (T) AB-PAS
   staining (upper panel), IF staining of TJ protein OCLN (middle panel),
   and H&E staining of ileum (Scale bar= 50 μm). (U) Quantification of
   ileal goblet cells(n=6). Data are presented as the mean ± SD. ns=no
   significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by
   one-way ANOVA and Sidak's post-hoc analysis. Intergroup survival
   differences were analyzed by Log-rank test. Abbreviations: SOFA,
   sequential organ failure assessment; LBP, lipopolysaccharide-binding
   protein; TNF, tumor necrosis factor; PCT, procalcitonin; FD-4,
   fluorescein isothiocyanate-dextran; TJ, tight junction; OCLN, occludin;
   ZO-1, zona occludens 1. Figure S2. (A-C) In vivo imaging and photon
   quantifications of bioluminescent E. coli of WT mice and hACE2^+/+mice
   after undergoing sham or CLP operation(n=3). (D-E) H&E staining,
   histopathological evaluation and wet/dry ratio of lungs (Scale bar= 50
   μm, n=4-6). (F) PAS staining and histopathological evaluation of the
   kidneys (Scale bar= 50 μm, n=4-6). (G)Serum creatinine levels of the
   mice(n=6). (H) Survival rates of wild type (WT) mice after undergoing
   sham surgery or different doses of E. coli inoculation (n=4-10). (I)
   Survival rates of both wild type (WT) mice and Ace2^-/y mice after
   undergoing sham or E. coli treatment (n=4-10). (J) Changes in body
   weight of WT andAce2^-/y mice after undergoing sham surgery or E. coli
   inoculation (n=4-6). (K-M) Serum glucose, TNF and FD-4 concentration of
   mice (n=4-6). (N) Ileal H&E staining and IF staining of TJ protein OCLN
   (Scale bar= 50 μm). Data are presented as the mean ± SD. ns=no
   significance, **p < 0.01, ***p< 0.001, ****p < 0.0001 by one-way ANOVA
   and Sidak's post-hoc analysis. Intergroup survival differences were
   analyzed by Log-rank test. Abbreviations: Scr, serum creatinine; TNF,
   tumor necrosis factor; FD-4, fluorescein isothiocyanate-dextran; TJ,
   tight junction; OCLN, occludin. Figure S3. (A, B) Quantification of
   bacterial load in blood, PLF and lung samples from mice underwent sham
   surgery or E. coli inoculation (n =3). (C-D) H&E staining,
   histopathological score and wet/dry ratio of lungs(n=4-6). (E)PAS
   staining and histopathological score of the kidneys (Scale bar= 50 μm,
   n=4-6). (F)Serum creatinine levels of the mice(n=6). Data are presented
   as the mean ± SD. ns=no significance, *p < 0.05, **p < 0.01, ***p <
   0.001, ****p < 0.0001 by one-way ANOVA and Sidak's post-hoc analysis.
   Abbreviation: Scr, serum creatinine. Figure S4. (A) The multi-sample
   rarefaction curves and the rank abundance curve for all samples. (C-D)
   Taxonomic composition visualized by Krona online tool of WT and
   Ace2^-/ymice (n=4). (E-F) Western blot analysis of TPH1 protein levels
   in ileum (n=6-7). (G, H) Relative tryptamine and Indole abundance of WT
   and Ace2^-/y mice (n=4). (I-K) Correlation analysis of 5-MTP levels and
   the abundance of linked bacterial species (n=8). (L)The relative
   abundance of linked bacterial species in WT and Ace2^-/y mice (n=4).
   Data are presented as the mean ± SD. ns=no significance, *p < 0.05 by
   two-tailed Student’s t test or Mann Whitney test. Abbreviations: TPH1,
   tryptophan 5-hydroxylase 1; 5-MTP, 5-methoxytryptophan. Figure S5. (A)
   Ileal H&E staining (upper panel), AB-PAS staining (middle panel) and IF
   staining of TJ protein OCLN (lower panel) in ABX-treated mice (Scale
   bar= 50 μm). (B) Serum FD-4 concentration of ABX-treated mice(n=5-6).
   (C) Quantification of goblet cells in ileum (n=6). (D-E) Western blot
   analysis of ileal TJs protein OCLN and ZO-1 level of ABX-treated
   mice(n=6). (F-G) Serum TNF and glucose concentration of ABX-treated
   mice (n=6). (H) Changes in body weight of ABX-treated WT and Ace2^-/y
   mice after undergoing CLP or sham surgery(n=4-6). (I) In vivo imaging
   of ABX-treated WT mice and Ace2^-/y mice after undergoing sham or CLP
   operation. (J-K) H&E staining, histopathological scores and wet/dry
   ratio of lungs of ABX-treated mice (Scale bar= 50 μm, n=4-6). (L) PAS
   staining and histopathological scores of kidneys of ABX-treated mice
   (Scale bar= 50 μm, n= 6). (M)Serum creatinine levels of ABX-treated
   mice(n=6). Data are presented as the mean ± SD. ns=no significance, **p
   < 0.01, ****p < 0.0001 by one-way ANOVA and Sidak's post-hoc analysis.
   Abbreviations: ABX, antibiotic; OCLN, occludin; ZO-1, Zona Occludens 1;
   TNF, tumor necrosis factor; Scr, serum creatinine. Figure S6. (A)
   Changes in body weight of WT-FMT mice and Ace2^-/y-FMT mice after
   undergoing CLP(n=6). (B) In vivoimaging and the and photon
   quantifications of bioluminescent E. coliof WT-FMT mice and
   Ace2^-/y-FMT mice after undergoing CLP operation(n=3). (C-E) H&E
   staining, histopathological evaluation and the wet/dry ratio of lungs
   from mice (Scale bar= 50 μm, n=4-6). (F)PAS staining and
   histopathological evaluation of kidneys from FMT CLP mice (Scale bar=50
   μm, n=6). (G) Serum creatinine levels of the FMT CLP mice(n=6). (H)
   Feces 5-MTP levels of WT and hACE2^+/+mice (n=4). (I) Changes in body
   weight of WT-CLP mice treated with PBS or 5-MTP(n=6). (J) Survival
   rates of Ace2^-/y-CLP mice treated with PBS or 5-MTP(n=5-10). (K)
   Changes in body weight of Ace2^-/y-CLP mice treated with PBS or
   5-MTP(n=6). (L-N) Serum glucose, TNF and FD-4 concentration of
   Ace2^-/y-CLP mice treated with PBS or 5-MTP (n=6). (O) H&E staining and
   IF staining of TJ protein OCLN in ileum (Scale bar= 50 μm). (P-Q) H&E
   staining, histopathological evaluation and the wet/dry ratio of lungs
   from Ace2^-/y-CLP mice (Scale bar= 50 μm, n=6). (R) PAS staining and
   histopathological scores of kidneys from Ace2^-/y-CLP mice (Scale bar=
   50 μm, n=6). (S) Serum creatinine levels of Ace2^-/y-CLP mice(n=6).
   Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p< 0.001,
   ****p < 0.0001 by two-tailed Student’s t test or Mann Whitney test.
   Intergroup survival differences were analyzed by Log-rank test.
   Abbreviations: FMT, fecal microbiota transplantation; TNF, tumor
   necrosis factor; FD-4, fluorescein isothiocyanate-dextran; TJ, tight
   junction; OCLN, occludin; Scr, serum creatinine; 5-MTP,
   5-methoxytryptophan. Figure S7. (A) Pathway enrichment and biological
   process of Gene Ontology (GO) enrichment analysis. (B) Ileal
   5-ethynyl-20-deoxyuridine (EdU) assay of WT and hACE2^+/+ mice (Scale
   bar=50 μm). (C) Western blot analysis of Ileal PCNA protein levels in
   WT and hACE2+/+ mice (n=6). (D) Survival rates of sham or CLP mice
   treated with 5-MTP or PBS orally (n=5-10). (E)Changes in body weight of
   sham and CLP mice treated with PBS or 5-MTP orally(n=4-6). (F-H) Serum
   glucose, TNF and FD-4 concentration of mice treated with 5-MTP or PBS
   orally(n=4-6). (I) Ileal EdU assay (left panel) and IF staining of TJ
   protein OCLN (right panel) (Scale bar= 50 μm). (J) Ileal TJs protein
   OCLN level of mice by Western blot (n=6). (K) In vivo imaging of mice
   treated with PBS or 5-MTP orally. (L) GSEA analysis of PI3 K-AKT
   signaling pathway. (M, N) Flowcytometry cell cycle analysis of cells
   treated with 5-MTP (n=3). Data are presented as mean ± SD. *p < 0.05,
   **p < 0.01, ***p < 0.001, ****p< 0.0001 by two-tailed Student’s t test,
   one-way ANOVA and Sidak's post-hoc analysis or Mann Whitney test.
   Intergroup survival differences were analyzed by Log-rank test.
   Abbreviations: PCNA, proliferating cell nuclear antigen; TNF, tumor
   necrosis factor; FD-4, fluorescein isothiocyanate-dextran; 5-MTP,
   5-methoxytryptophan; TJ, tight junction; OCLN, occluding.
   [165]Additional file 2^ (213.5KB, png)

Acknowledgements