Abstract

   Atherosclerosis (AS) is a major global contributor to cardiovascular
   diseases and associated mortality. The traditional treatment primarily
   relies on statins; however, these drugs are often linked to side
   effects such as liver dysfunction and muscle impairment. Recent studies
   have highlighted the potential protective properties of saponin
   compounds derived from traditional herbal sources, such as
   notoginsenoside R1 (NGR1) and saikosaponin B2 (SSB2), in combating
   atherosclerosis. However, the comprehensive effects of these compounds
   against atherosclerosis and their underlying mechanisms remain
   inadequately understood. Firstly, we employed network pharmacology
   analysis to identify 113 common targets, including mTOR and CASP3, for
   NGR1, SSB2, and atherosclerosis from databases such as TCMSP. We
   constructed a protein-protein interaction (PPI) network and performed
   GO and KEGG enrichment analyses, whcih revealed key signaling pathways
   involved in PI3K/Akt, inflammation, and autophagy. The atherosclerosis
   model was established using ApoE^-/- mice fed with a “Western diet”
   followed by treatment with NGR1, SSB2, or NS combination. Histological
   examinations, including hematoxylin-eosin (HE) staining, oil red O
   (ORO) staining, and CD68 immunofluorescence, were conducted to evaluate
   the pathological conditions of the aortic root, liver and kidneys in
   ApoE^-/- mice. Our findings demonstrate that the NS combination
   improves lipid levels, lipid transport, and unstable plaque formation
   in ApoE^-/- mice without adverse effects on liver or kidney function.
   Finally, oxidized low-density lipoprotein (ox-LDL) was used to culture
   RAW264.7 macrophages to establish an in vitro foam cell model. The
   effects of NS combination on lipid uptake, inflammatory response,
   apoptosis, the PI3K/Akt/mTOR signaling pathway, and autophagy were
   evaluated using methods such as CCK-8 assay, Oil Red O staining,
   immunofluorescence analysis, flow cytometry, RT-PCR, and Western blot
   analysis. The results indicated that NS combination promoted autophagy
   by inhibiting the PI3K/Akt/mTOR pathway. This significantly alleviated
   inflammation, reduced apoptosis, and decreasing lipid accumulation,
   thereby improving the pathological progression of atherosclerosis.
   Collectively, this study demonstrates, for the first time, that the NS
   combination synergistically activates macrophage autophagy by
   suppressing the PI3K/AKT/mTOR pathway, thereby attenuating lipid
   accumulation, inflammation, and apoptosis in atherosclerotic models.

1 Introduction

   Atherosclerosis(AS) is one of the leading causes of cardiovascular
   diseases and related mortality globally, including conditions such as
   myocardial infarction and stroke [[38]1,[39]2]. With the aging global
   population and the increasing prevalence of unhealthy lifestyles, the
   incidence of atherosclerosis has been steadily increasing. Globally,
   millions of people die each year from atherosclerosis-related diseases,
   particularly in developing countries, where the mortality rate
   continues to climb [[40]3]. Current therapeutic strategies for
   atherosclerosis are primarily centered around pharmacological
   interventions, including lipid-lowering agents, antiplatelet therapies,
   and invasive procedures like angioplasty or bypass surgery. However,
   these treatments often come with significant challenges in clinical
   practice, including issues such as drug resistance, hepatotoxicity, and
   an increased risk of severe hemorrhagic complications [[41]4–[42]6].
   Given these limitations, there is an urgent need for the continuous
   development of novel therapeutic strategies and drug candidates to
   minimize adverse effects while enhancing clinical outcomes.

   Recent studies have shown that phytochemicals derived from traditional
   herbal plants exhibit a wide range of biological activities,
   contributing to significant preventive and therapeutic effects against
   various diseases [[43]7–[44]9]. Among them, saponins from traditional
   Chinese herbal medicine are particularly notable due to their
   multifaceted roles in preventing and treating atherosclerotic diseases
   through mechanisms such as anti-inflammatory, antioxidant,
   cholesterol-lowering, immunomodulatory, and antiplatelet aggregation
   effects [[45]10]. Notably, Panax notoginseng and Bupleurum, have
   demonstrated prominent efficacy in cardiovascular disease management.

   Notoginsenoside R1 (NGR1) is a unique component of Panax notoginseng.
   Previous studies have shown that NGR1 exhibits a variety of biological
   activities and provides protective effects across multiple organs,
   including neuroprotection, cardiovascular protection, pulmonary
   protection, and hepatic protection [[46]11]. Jia and his team
   [[47]12]were the first to demonstrate that NR1 may counteract
   atherosclerosis by modulating inflammation, oxidative stress, and lipid
   metabolism. A recent study has further highlighted its role in
   ameliorating atherosclerosis by alleviating inflammatory responses and
   inhibiting endothelial dysfunction [[48]13].

   Saikosaponin is the active component in Bupleurum, account for up to 7%
   of the plant’s dry root weight and possess a wide array of
   pharmacological activities. Among them, saikosaponin A (SSA) and
   saikosaponin D (SSD) have received the most attention in
   pharmacological research. Of particular interest is saikosaponin B2
   (SSB2), a compound formed when SSD is exposed to high temperatures or
   low pH, reflecting its significance in the traditional preparation of
   TCM decoctions [[49]14,[50]15]. Previous studies have indicated that
   SSB2 exerts anti-inflammatory effects in LPS-induced macrophages, and
   influence the lipid metabolism process in HepG2 cells, demonstrating
   anti-atherosclerotic activity potential [[51]16,[52]17]. These findings
   suggest SSB2 may regulate the occurrence and development of
   atherosclerosis, potentially serving as a valuable new drug for
   treating atherosclerosis. Although studies have suggested that NGR1 and
   SSB2 may have protective effects in cardiovascular diseases, the
   precise molecular mechanisms by which these compounds exert their
   effects on atherosclerosis, either individually or in combination,
   remain incompletely understood.

   Current research attributes the development of atherosclerosis to lipid
   accumulation, chronic inflammation, and immune dysregulation [[53]18].
   However, the pathogenesis of this disease is not fully understood. A
   growing body of evidence links atherosclerosis progression to foam cell
   formation, which derived from monocyte differentiation and matured
   macrophage [[54]19,[55]20].When exposed to excessive ox-LDL,
   macrophages acquired a foam cell-like phenotype through scavenger
   receptors, leading to necrotic cores formation within atherosclerotic
   plaques [[56]21]. Persistent exposure to atherogenic lipoproteins, the
   necrosis and apoptosis of these foam cells result in lipid core
   necrosis, activating vascular inflammatory responses that lead to cell
   apoptosis and abnormal lipid metabolism. In contrast, macrophage
   autophagy has been shown to inhibit the progression of atherosclerosis
   and stabilize plaques by promoting intracellular lipid degradation
   [[57]22–[58]24]. Enhancing autophagic activity in macrophages
   facilitates intracellular lipid degradation; while inhibition of
   autophagy predisposes cells to necrosis and inflammation following foam
   cell death, contributing to plaque formation and rupture
   [[59]25].Considering these insights, inhibiting the formation of
   macrophage-derived foam cells and enhancing macrophage autophagy
   represent effective therapeutic strategies for the treatment of
   atherosclerosis.

   Despite some existing studies revealing the biological activity and
   potential therapeutic effects of NGR1 and SSB2 in atherosclerosis,
   there is currently no definitive conclusion regarding their efficacy
   when applied individually. More importantly, whether NGR1 and SSB2 can
   synergistically enhance therapeutic effects remains underexplored.
   Therefore, the combined use of these two substances with unique
   pharmacological properties not only inherits traditional Chinese
   medicine compatibility theories but also represents an innovative
   exploration in modern medical translation. This study aims to delve
   into the potential of combining NGR1 and SSB2 for atherosclerosis
   treatment based on contemporary understanding of the mechanisms
   underlying atherosclerosis development. Specifically, through a
   comprehensive approach incorporating network pharmacology, in vitro
   cellular experiments, and in vivo animal studies, we will
   systematically evaluate their mechanisms of action in atherosclerosis.
   The focus will be on how both agents may exert a synergistic effect by
   regulating the formation of macrophage-derived foam cells and
   influencing macrophage autophagy processes to improve therapeutic
   outcomes for atherosclerosis. We anticipate that this combination
   therapy strategy will not only effectively alleviate the pathological
   progression of atherosclerosis but also reduce common side effects
   associated with existing treatments, ultimately providing a safer and
   more effective new treatment option for clinical practice.
   Consequently, this research not only theoretically expands new avenues
   for atherosclerosis treatment but is also expected to offer more
   scientific evidence and practical guidance for the application of
   traditional Chinese medicine formulations.

2 Materials and methods

2.1 Drugs and reagents

   Notoginsenoside R1 (NGR1, chemical structure C[47]H[80]O[18], molecular
   weight = 933 g/mol, purity = 99.5%, BD2143) and saikosaponin B2 (SSB2,
   chemical structure C[42]H[68]O[13], molecular weight = 781 g/mol,
   purity = 99.5%, [60]BD150742) were purchased from
   bidepharm(Shanghai,China). Additionally, the following reagents were
   purchased:Oxidized low-density lipoprotein (ox-LDL, YB-002, Yiyuan
   Biotech, China), Rapamycin (HY-10219, MCE, USA), Ultra-sensitive ECL
   chemiluminescence kit (M2301, HaiGene, China), Reactive Oxygen Species
   Assay Kit(S0033S, Beyotime, China),Oil Red O (O8010, Solarbio, China),
   total cholesterol assay kit (A111-1–1, njjcnio, China), triglyceride
   assay kit (A110-1–1, njjcbio, China), high-density lipoprotein
   cholesterol assay kit (A112-1–1, njjcbio, China), low-density
   lipoprotein cholesterol assay kit (A113-1–1, njjcbio, China),
   creatinine assay kit (C011-2–1, njjcbio, China), aspartate
   aminotransferase assay kit (C010-2–1, njjcbio, China), alanine
   aminotransferase assay kit (C009-2–1, njjcbio, China).

2.2 Animal programs

   30 Male ApoE^-/- mice at 7 weeks of age were obtained from the Animal
   Experimental Center of North Sichuan Medical College (Sichuan, China).
   All intervention measures and animal care protocols were conducted in
   accordance with the Animal Ethics Committee guidelines provided by the
   North Sichuan Medical College (NSMC2024100, Sichuan, China). The mice
   were housed in temperature-controlled facilities (temperature:
   25 ± 2°C, humidity: 55 ± 5%), with a 12-hour light-dark cycle, which
   continued until the completion of sample collection [[61]26]. They were
   acclimatized for 1 week with ad libitum access to standard maintenance
   feed and sterile drinking water before experimental procedures
   commenced.

   At 8 weeks of age, ApoE^-/- mice were randomly divided into 5 groups
   (n = 6 per group). Due to the poor water solubility of the administered
   compounds, a vehicle was prepared with the following composition: 10%
   DMSO (HY-Y0873, MCE, USA), 40% PEG300 (HY-Y0873, MCE, USA), 5% Tween-80
   (HY-Y1891, MCE, USA), and 45% saline solution [[62]27,[63]28]. The
   groups included control group (Con,vehicle,ip.), model group
   (Mod,vehicle,ip.), NGR1 group (NGR1,30 mg/kg/day, ip.), SSB2 group
   (SSB2,30 mg/kg/day, ip.), and NGR1 + SSB2 group (NS,NGR1
   30 mg/kg/day + SSB2 30 mg/kg/day, ip.). The dosage of 30 mg/kg/day was
   selected based on previous pharmacological studies indicating its
   effectiveness in mitigating atherosclerotic changes while minimizing
   potential toxicity [[64]29,[65]30]. All groups, except the control
   group, were fed a Western diet containing 21% fat and 0.15% cholesterol
   for 12 weeks. Starting from the 9th week, mice received intraperitoneal
   injections daily for 4 weeks. For intraperitoneal injections, mice were
   briefly anesthetized with 2% isoflurane to minimize distress. Mice were
   monitored daily for signs of pain or distress, and body weight was
   recorded weekly [[66]26]. No unexpected adverse events occurred. After
   the completion of the task, mice were euthanized via cervical
   dislocation under deep anesthesia induced by intraperitoneal injection
   of sodium pentobarbital (50 mg/kg) [[67]31].

2.3 Histological analysis

   Liver tissues were fixed in 10% formalin for 24 hours, then embedded in
   paraffin or OTC, and consecutively sectioned at a thickness of 7μm.
   Standard hematoxylin and eosin (H&E) staining was performed on
   paraffin-embedded tissue sections, while frozen sections of liver
   embedded in OTC were stained with Oil Red O (ORO) to assess hepatic
   lipid accumulation and tissue damage.

   The aorta was dissected from the heart base of the mice and fixed in 4%
   paraformaldehyde. The aortic tissues were embedded in OCT and sectioned
   at a thickness of 7 μm. Subsequently, sections of the aortic sinus were
   stained with hematoxylin and eosin (H&E) and Oil Red O (ORO).
   Additionally, the entire aorta was longitudinally sectioned and stained
   with Oil Red O to visualize lipid deposition. The areas of lesion in
   the aorta and aortic sinus were quantified using ImageJ software
   [[68]32].

2.4 Immunofluorescence staining

   The aortic roots of mice or the treated cells were fixed with 4%
   paraformaldehyde. After permeabilization with Triton X-100, the samples
   were blocked with BSA and subsequently incubated overnight at 4°C with
   P62 antibody (M00300-1, Boster, China) at a dilution of 1:100, p-mTOR
   antibody (67778–1-Ig, Proteintech, China) at a dilution of 1:100, and
   LAMP-1 (CL647–65050, Proteintech, China) at a dilution of 1:100.
   Following incubation with FITC-conjugated antibodies and DAPI staining,
   the cells were washed with PBS and mounted using an anti-fade reagent.
   Observations were conducted using an inverted fluorescence microscope.

2.4 Biochemical Analysis

   Blood was collected from fasting mice via retro-orbital puncture into
   Eppendorf tubes pre-coated with heparin, and centrifuged at 5000 rpm
   for 10 minutes at 4°C to isolate plasma. Hepatic and renal indicators,
   as well as lipid markers, were measured in the plasma samples according
   to the manufacturer’s instructions. These markers included alanine
   aminotransferase (ALT)(C009-2–1, NJJCBIO, china), aspartate
   aminotransferase (AST)(C010-2–1, NJJCBIO, china), creatinine
   (Cr)(C011-2–1, NJJCBIO, china), total cholesterol (TC)(A111-1–1,
   NJJCBIO, china), triglycerides (TG)(A110-1–1, NJJCBIO, china),
   low-density lipoprotein cholesterol (LDL-C)(A113-1–1, NJJCBIO, china),
   and high-density lipoprotein cholesterol (HDL-C)(A112-1–1, NJJCBIO,
   china).

2.5 Network pharmacology

   Potential targets of NGR1 and SSB2 were identified through
   SwissTargetPrediction
   [[69]33]([70]http://www.swisstargetprediction.ch/), Encyclopedia of
   Traditional Chinese Medicine [[71]34]
   ([72]http://www.tcmip.cn/ETCM/index.php/Home/Index/All), Traditional
   Chinese Medicine Systems Pharmacology Database and Analysis Platform
   [[73]35]([74]https://old.tcmsp-e.com/tcmsp.php), and Herb
   [[75]36]([76]http://herb.ac.cn/). Molecular targets related to
   atherosclerosis were screened using GeneCards
   [[77]37]([78]https://www.genecards.org/), PharmGKB
   [[79]38]([80]https://www.pharmgkb.org/), and OMIM
   [[81]39]([82]https://omim.org/) databases. A protein-protein
   interaction (PPI) network was constructed using STRING 11.0 database
   [[83]40]([84]https://string-db.org) and visualized using Cytoscape
   3.9.1 to identify key targets based on degree and Maximum Clique
   Centrality (MCC). Subsequently, key shared targets in the PPI network
   for NGR1-SSB2-atherosclerosis were imported into R software for
   pathways enrichment analysis of Gene Ontology (GO) and Kyoto
   Encyclopedia of Genes and Genomes (KEGG) using ‘enrichplot’ and
   ‘clusterProfiler’ R packages [[85]41].

2.6 Cell culture

   RAW264.7 cells (CL-0190) were purchased from Procell(china,wuhan). The
   cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM;
   KGL1206−500, KeyGEN bioTECH, China), supplemented with 10% fetal bovine
   serum from South America (FBS,10270106, Gibco, USA)at 37°C in a
   humidified atmosphere containing 5% CO₂.

2.7 CCK8 assay

   Cell proliferation was assessed using the CCK-8 kit (KGA9305−500,
   KeyGEN BioTECH, China). A total of 6 × 10^3 cells per well were seeded
   in a 96-well plate. The cells were stimulated with varying
   concentrations of ox-LDL, NGR1, and SSB2, and then incubated under
   appropriate conditions for 24 hours. Afterward, the culture medium was
   removed and DMEM containing 10% CCK-8 solution was added to each well.
   The plates were incubated for an additional 2 hours Absorbance was
   measured at 450nm using a microplate reader (Bio-Tek, Winooski, VT)
   after shaking for 30 seconds.

2.8 Oil Red O staining and dil labeling

   Oil Red O staining was employed to observe changes in lipid droplet
   phagocytosis in RAW264.7 cells. A total of 4 × 10^43 cells per well
   were seeded in a 24-well plate with coverslips. The RAW264.7 cells were
   treated with ox-LDL, NGR1, and SSB2 for 24 hours. Then, the cells were
   gently washed with PBS and fixed with 4% paraformaldehyde solution for
   3 minutes. They were then stained with freshly prepared Oil Red O
   working solution in a 37°C water bath for 15 minutes. Followed by
   counterstain with hematoxylin for 5 minutes. Staining and cell
   morphology were observed under an optical microscope (OLYMPUS,
   Japan),where lipid droplets within the cells appear as red granules,
   and cell nuclei as blue and elliptical.

   Similarly, after fixing RAW264.7 cells, DiI labeling was performed by
   adding the Dil working solution directly to the cells. The cells were
   stained for 10 minutes and then observed under an inverted fluorescence
   microscope. Lipid droplets exhibited red fluorescence, while cell
   nuclei showed blue fluorescence.

2.9 Analysis of apoptotic cells by flow cytometry

   Cell apoptosis was detected using the Annexin V-FITC/PI double staining
   apoptosis detection kit (KGA1102−50, KeyGEN BioTECH, China). After 24
   hours of treatment, RAW264.7 cells were stained with Annexin V-FITC and
   propidium iodide (PI) in the dark at room temperature. The extent of
   apoptosis was then analyzed using a flow cytometer (Agilent, USA).

2.10 Measurement of cellular reactive oxygen species

   RAW264.7 cells were seeded in a 24-well sterile culture plate and
   treated with the appropriate drug. DCFH-DA (S0033S, Beyotime, China)
   was diluted with serum-free medium to a final concentration of 10
   μmol/L at a ratio of 1:1000. After removing the cell culture medium,
   the diluted DCFH-DA was added, and the cells were incubated at 37°C for
   20 minutes.. The cells were then washed three times with serum-free
   medium to completely remove any excess DCFH-DA that had not entered the
   cells. Then, reactive oxygen species were observed using a fluorescence
   microscope.

2.11 RT-qPCR

   Total RNA was extracted from macrophages using Trizol reagent
   (15596018CN, Invitrogen, USA). The extracted RNA was then reverse
   transcribed into cDNA using a reverse transcription kit (A502, ExonGen,
   China). qPCR is performed using Fast SYBR Green qPCR Master Mix UDG
   (A402, ExonGen, China) on the LightCycler® 480 system (Roche
   LifeScience, USA). Specific primers for tumor necrosis factor alpha
   (Tnf-α), interleukin-1 Beta (Il-1β), interleukin-18 (Il-18), NOD-like
   receptor family pyrin domain containing 3(Nlrp3), peroxisome
   proliferator-activated receptor γ(PPAR-γ), liver X receptor α(LXR-α)
   and ATP-binding cassette transporters A1/G1 (ABCA1/ABCG1)were designed
   using Primer 3 software ([86]Table 1). Expression levels of target gene
   expression is normalized to β-actin. The relative fold changes in
   target gene expression were calculated using the 2^−ΔΔCt method. Each
   sample was tested in at least three replicates.

Table 1. Primers used for RT-qPCR.

   Primer Name Forward Primer (5’-3’)    Reverse primer (5’-3’)
   β-actin     CTGGCTCCTAGCACCATGAAGA    ACAGTCCGCCTAGAAGCACTTG
   TNF-α       CCCTCCAGAAAAGACACCATG     CACCCCGAAGTTCAGTAGACAG
   IL-1β       GAAATGCCACCTTTTGACAGTG    TGGATGCTCTCATCAGGACAG
   IL-18       GTGAACCCCAGACCAGACTG      CCTGGAACACGTTTCTGAAAGA
   Nlrp3       GATCTTCGCTGCGATCAACA      GGGATTCGAAACACGTGCATTA
   PPAR-γ      CATTCTGGCCCACCAACTTC      TCAAAGGAATGCGAGTGGTCTT
   LXR-α       CCTTCCTCAAGGACTTCAGTTACAA CATGGCTCTGGAGAACTCAAAGAT
   ABCA1       GCGGACCTCCTGGGTGTT        CAAGAATCTCCGGGCTTTAGG
   ABCG1       AAGGCCTACTACCTGGCAAAGA    GCAGTAGGCCACAGGGAACA
   [87]Open in a new tab

2.12 Western blot analysis

   Total protein was extracted from cells or tissue using RIPA buffer
   (BL504A, Biosharp, China) supplemented with protease inhibitors (P1045,
   Beyotime, China), and phosphatase inhibitors (P1045, Beyotime, China).
   Protein concentration was measured using a BCA protein assay kit
   (Bio-Rad, China).The protein samples were then mixed with 5 × SDS
   sample buffer (P0015, Beyotime, China) and heated at 95°C for 15
   minutes. Subsequently, 30 μg of protein from each sample was separated
   by 7%, 10%, or 12.5% SDS-PAGE (60V for 15 minutes; 110V for 75
   minutes).The proteins were transferredl to a 0.22μm PVDF membrane
   (Millipore, USA) (200mA for 80 minutes). The membrane was blockedwith
   5% non-fat milk in TBST and incubated with diluted primary antibodies
   at 4°C overnight on a shaker. The antibodies included: AKT Monoclonal
   antibody (60203–2-Ig, Proteintech, China), Phospho-AKT (Ser473)
   Monoclonal antibody (66444–1-Ig, Proteintech, China), mTOR Monoclonal
   antibody (66888–1-Ig), Phospho-mTOR (Ser2448) Monoclonal antibody
   (67778–1-Ig, Proteintech, China), PI3 Kinase p110 Beta Polyclonal
   antibody (20584–1-AP, Proteintech, China), Phospho-PI3 Kinase p85
   (Tyr458)/p55 (Tyr199) Antibody (4228T, CST, USA), IL-1 Beta Polyclonal
   antibody (16806–1-AP, Proteintech, China), IL-18 Polyclonal antibody
   (10663–1-AP, Proteintech, China), Nlrp3 Polyclonal antibody
   (30109–1-AP, Proteintech, China), Caspase 3/p17/p19 Polyclonal antibody
   (19677–1-AP, Proteintech, China), BAX Polyclonal antibody (50599–2-Ig,
   Proteintech, China), Bcl2 Polyclonal antibody (A00040-1, Boster,
   China), Anti-LC3B/MAP1LC3B Antibody (BM4827, Boster, China), Beclin-1
   Antibody (3738T, CST, USA), Anti-P62/SQSTM1 Antibody (M00300-1, Boster,
   China).After incubation with secondary antibodies (BA1056, Boster,
   China) for 1 hour, protein bands were visualized using an enhanced ECL
   chemiluminescence reagent (P0018AM, Beyotime, China) and an Odyssey
   infrared imaging scanner (LI-COR Biosciences). The intensity of the
   bands was analyzed using Image-J software (NIH, Bethesda, MD) and and
   protein expression levels were normalized to β-actin as a loading
   control.

2.13 Statistical analysis

   All data were presented as the mean ± standard deviation (SD).
   Statistical analysis were performed using GraphPad Prism 8.0 (GraphPad
   Software, Inc.). Comparisons between multiple groups were made using
   one-way analysis of variance (ANOVA), with p-values < 0.05 considered
   statistically significant.

3 Results

3.1 Network pharmacology analysis reveals a close association between NS and
atherosclerosis

   To explore the potential mechanisms of NS in combating atherosclerosis,
   we employed network pharmacology approaches A total of 241 NGR1-related
   targets, 222 SSB2-related targets, and 4619 atherosclerosis-related
   targets were identified, with113 shared targets ([88]Fig 1A).
   Enrichment analysis using KEGG and GO indicated that NS may modulate
   processes involved in inflammation, apoptosis, autophagy, and the
   PI3K/AKT signaling pathway to mediate the progression of
   atherosclerosis ([89]Fig 1B-[90]C). The protein-protein interaction
   network comprised 110 nodes and 1732 edges ([91]Fig 1D). Through target
   contribution (degree) and maximum clique centrality (MCC), 10 key
   proteins including CASP3 and MTOR were identified as core targets
   ([92]Fig 1E, [93]1F).

Fig 1. Network pharmacology analysis predicted the targets of NS on
atherosclerosis.

   [94]Fig 1
   [95]Open in a new tab

   (A) Venn analysis of NGR1, SSB2, and atherosclerosis overlapping
   targets.(B) GO enrichment analysis of NS-atherosclerosis shared
   targets.(C) KEGG enrichment analysis of NS-atherosclerosis shared
   targets.(D) PPI (Protein-Protein Interaction) network of
   NS-atherosclerosis shared targets.(E) Top 10 core targets selected from
   a list of 113 targets based on degree contribution.(F) Identification
   of 10 targets from shared targets based on Maximum Clique Centrality
   (MCC).

3.2 NS promotes lipid transport in the ApoE^−/− mouse model

   The atherosclerosis model was induced in ApoE^-/- mice by feeding
   Western diet for 12 weeks. During this period, the control group showed
   a declining trend in body weight from weeks 8–12 ([96]Fig 2A). In
   contrast, the other groups did not show significant differences in
   weight change during this time.To investigate the effect of the NS
   combination on lipid metabolism in vivo, we measured four blood lipid
   parameters in these ApoE^-/- mice fed the Western diet. Compared to the
   control group, the model group showed significantly elevated levels of
   TC, TG, and LDL-C, along with a significant reduction in HDL-C.
   Treatment with NGR1, SSB2, or the NS combinationreduceed the levels of
   TC, TG, and LDL-C levels,while increaseing HDL-C levels in ApoE^-/-
   mice. Among them, the NS combination group showed the most significant
   effects ([97]Figs 2B–[98]E). Furthermore, we conducted biochemical and
   morphological analyses of the liver and kidneys in these mice. The
   Western diet increased serum ALT and AST levels in the liver. Compared
   to the model group and the monotherapy group, the NS combination
   therapy group showed reduced serum ALT and AST levels ([99]Figs
   2F-[100]G). H&E staining of liver sections revealed significant
   hepatocellular steatosis induced by the Western diet, which was
   mitigated under NS treatment, as evidenced by reduced lipid vacuoles
   and inflammatory changes. Oil Red O staining of the liver confirmed a
   notable decrease in lipid droplets in the NS-treated group ([101]Fig
   2I). There were no significant differences observed among groups in
   kidney morphology ([102]S1 Fig).

Fig 2. NS affects lipid transport in ApoE^-/-mouse models.

   [103]Fig 2
   [104]Open in a new tab

   Eight-week-old male ApoE-/- mice, weighing approximately 25g, were fed
   a Western high-fat diet for 12 weeks. They were then intraperitoneally
   injected with NGR1 (30 mg/kg/day) and SSB2 (30 mg/kg/day) for 4 weeks.
   (A) Effects of NGR1 and SSB2 on the body weight of ApoE-/- mice. (B)
   Triglycerides (TG), (C) total cholesterol (TC), (D) high-density
   lipoprotein cholesterol (HDL-C), (E) low-density lipoprotein
   cholesterol (LDL-C), (F) alanine transaminase, (G) aspartate
   transaminase, and (H) creatinine levels in the control group(Con),
   model group(Mod), NGR1 group(NGR1), SSB2 group(SSB2), and NGR1 + SSB2
   combination treatment group(NS). (I) Representative images of liver
   sections stained with H&E and Oil Red O. Tissues were examined using an
   optical microscope (scale bar = 50 µm).All data were presented as the
   mean ± SD. **p < 0.01 vs. control group, ##p < 0.01 vs. model
   group,$p < 0.05, $$p < 0.01 vs. NGR1 group, + p < 0.05, ++p < 0.01 vs.
   SSB2 group.

3.3 NS delays the formation of atherosclerotic plaques in the ApoE^-/- mouse
model

   To investigate the effects of NS on atherosclerotic plaques, we
   assessed the changes in the entire aortic tissues of high-fat-fed
   ApoE^-/- mouse models. Oil Red O staining revealed that the stained
   area in the NS-treated group was smaller compared to both the high-fat
   diet group and the monotherapy groups ([105]Fig 3C). Histological
   examination of aortic root sections under optical microscopy showed
   severe lipid accumulation, and the formation of unstable plaques with
   necrotic cores in the model group ([106]Figs 3A-[107]B). In contrast,
   the plaque area was reduced in the NGR1 and SSB2 treatment groups.
   Notably, the NS combination intervention significantly limited necrotic
   area and reduced lipid deposition to stabilize aortic
   plaques.Macrophage accumulation, a hallmark of atherosclerotic plaques,
   was assessed using CD68 immunofluorescence analysis. The results
   indicated that NS treatment significantly reduced the accumulation of
   macrophages in atherosclerotic lesions.

Fig 3. NS delays the formation of atherosclerotic plaques in ApoE^-/- mouse
models.

   [108]Fig 3
   [109]Open in a new tab

   (A, D) Representative images and quantitative analysis of the aortic
   roots from ApoE^-/- mice using H&E staining (scale bars = 200 μm and
   100 μm, respectively). (B, E) Representative images and quantitative
   analysis of the aortic roots from ApoE^-/- mice using Oil Red O
   staining (scale bar = 200 μm). (C, F) Representative images and
   quantitative analysis of CD68 immunostaining in the aortic root (scale
   bar = 50 μm).All data were presented as the mean ± SD, (n = 3).
   **p < 0.01 vs. control group, #p < 0.05, ##p < 0.01 vs. model group,
   $p < 0.05, $$p < 0.01 vs. NGR1 group, + p < 0.05, ++p < 0.01 vs. SSB2
   group.

3.4 NS combination attenuates ox-LDL-induced foam cell formation

   Before assessing the in vitro effects of two traditional Chinese
   medicine monomers, RAW 264.7 macrophage cells were exposed for 24 hours
   to various concentrations of NGR1 and SSB2, and their cytotoxicity was
   evaluated using the CCK-8 assay. As shown in [110]Fig 4A, SSB2 did not
   demonstrate significant cytotoxic effects at concentrations ranging
   from 12.5 to 50 μM. However, at 100 μM (cell viability 84.09%) and 200
   μM (cell viability 61.94%), it exhibited notable cytotoxicity, leading
   to the selection of 50 μM for further experiments. Meanwhile, NGR1 did
   not display significant cytotoxicity across concentrations from 12.5 to
   200 μM, with a trend of increased cell viability at lower
   concentrations, peaking at 50 μM ([111]Fig 4B). Therefore, the
   concentration of 50 μM was chosenas the optimal concentration for NGR1
   as well.When over-loaded with ox-LDL, macrophages uptake excessive
   lipids, inducing the formation of foam cells, and ultimately leading to
   the instability and rupture of atherosclerotic plaques.To explore the
   effects of NS on foam cell formation induced by ox-LDL, we established
   a foam cell model by treating macrophages with 50 μg/ml ox-LDL. We
   found that after incubation with ox-LDL, RAW 264.7 macrophages
   transitioned from a round shape to an irregular morphology with
   pseudopodia, accompanied by significant cytoplasmic lipid droplet
   accumulation. In contrast, treatment with NGR1 or SSB2 corrected cell
   morphology and lipid droplet burden. Compared to the individual
   treatment groups, combination therapy markedly reduced lipid droplet
   accumulation ([112]Figs 4C-[113]D). In order to further investigate the
   regulatory mechanisms by which NS modulates lipid transport, we
   assessed the expression of mRNA associated with cholesterol transport.
   The results indicated that ox-LDL stimulation significantly
   downregulated the expression levels of PPAR-γ, LXR-α, ABCA1, and
   ABCG1([114]Figs 4E-[115]H). Notably, NS was able to restore the
   expression levels of these key factors, demonstrating a more pronounced
   effect compared to the monotherapy group. These findings suggest that
   NS may collaboratively inhibit ox-LDL-induced lipid transport in RAW
   264.7 macrophages, thereby impeding the process of foam cell formation.

Fig 4. NS attenuates ox-LDL-induced foam cell formation.

   [116]Fig 4
   [117]Open in a new tab

   (A) Effect of NGR1 on RAW264.7 cell viability. (B) Effect of SSB2 on
   RAW264.7 cell viability.(C) Representative fluorescence images of
   RAW264.7 cells labeled with Dil-oxLDL. Cells were visualized using
   inverted fluorescence microscopy (scale bar = 50 μm). (D)
   Representative images of Oil Red O staining showing lipid droplets
   accumulation in RAW264.7 cells. Cells were examined using an optical
   microscope (scale bar = 100 μm). (E-H) The use of gene-specific
   oligonucleotide primers for the real-time PCR analysis of PPAR-γ,
   LXR-α, ABCA1, and ABCG1. All data were presented as the mean ± SD,
   (n = 3). *p < 0.05 vs. control group, **p < 0.01, **p < 0.01 vs.
   control group, #p < 0.05, ##p < 0.01 vs. model group, $$p < 0.01 vs.
   NGR1 group, ++p < 0.01 vs. SSB2 group.

3.5 NS inhibits inflammation induced by Ox-LDL in RAW264.7 cells

   Based on in vivo experiments and network pharmacology results, we
   further investigated whether NS could inhibit ox-LDL-induced macrophage
   inflammatory responses. Results from [118]Fig 5(A-[119]D) revealed that
   NR1 and SSB2 significantly reduced the gene expression levels of
   inflammatory cytokines (TNF-α, IL-1β, IL-18) as well as NLRP3. Visual
   and quantitative results from Western blotting indicated that ox-LDL
   stimulation markedly increased the expression of NLRP3
   inflammasome-related proteins, including NLRP3, IL-1β, and
   IL-18.Treatment with NGR1 or SSB2 treatment slightly reversed this
   upregulation, with the combination therapy showing a more pronounced
   inhibitory effect ([120]Figs 5E-[121]H).

Fig 5. NS suppresses inflammation induced by Ox-LDL in RAW264.7 cells.

   [122]Fig 5
   [123]Open in a new tab

   Relative mRNA levels of inflammatory genes. (A) TNF-α,(B) IL-1β, (C)
   IL-18, and (D) NLRP3 measured by RT-qPCR. (E) Representative Western
   blot images showing protein expression of NLRP3, IL-1β, and IL-18 in
   the Ox-LDL-induced cell model. β-actin was used as a loading control.
   (F-H) Quantification of the relative protein levels of NLRP3, IL-1β,
   and IL-18, normalized to β-actin and presented as relative intensity
   based on Western blot.analysis. All data were presented as the
   mean ± SD, (n = 3). **p < 0.01 vs. control group, #p < 0.05, ##p < 0.01
   vs. model group, $p < 0.05, $$p < 0.01 vs. NGR1
   group, + p < 0.05, ++p < 0.01 vs. SSB2 group.

3.6 NS inhibits apoptosis induced by Ox-LDL in RAW264.7 cells

   Network pharmacology results indicate that the anti-atherosclerotic
   effects of NS are closely associated with apoptosis, with CASP3 playing
   a crucial role in apoptosis and identified as a potential key target of
   NS in its anti-atherosclerotic action. To understand the role of NS in
   ox-LDL-induced apoptosis in RAW264.7 cells, we measured intracellular
   ROS levels and assessed apoptosis using flow cytometry and western
   blotting.Compared to the model group, the NS combination treatment
   significantly reduced the ROS levels in RAW264.7 cells ([124]Fig 6A).
   As shown in [125]Fig 6B, compared to the control group, ox-LDL-treated
   RAW264.7 cells exhibited a significantly increased number of apoptotic
   cells, this increase was reversed by NS treatment. Consistent with the
   changes in apoptosis data, ox-LDL induction in the model group led to
   the downregulation of the anti-apoptotic protein Bcl-2, while
   upregulating the pro-apoptotic proteins Bax and cleaved caspase-3.
   Treatment with either NGR1 or SSB2 attenuated the apoptotic effects of
   ox-LDL, and compared to single-drug treatment, the combination therapy
   further inhibited apoptosis in macrophage cells ([126]Figs 6C-[127]F).
   In summary, these data indicate that NS effectively suppresses
   ox-LDL-induced apoptosis in RAW264.7 cells.

Fig 6. NS co-suppresses Ox-LDL-induced apoptosis in RAW264.7 cells.

   [128]Fig 6
   [129]Open in a new tab

   (A) ox-LDL induces ROS generation in RAW264.7 cells, visualized by
   inverted fluorescence microscopy (scale bar = 50 μm). (B)
   Representative images of apoptosis detected by flow cytometry. (C)
   Representative Western blot images showing protein expression of BAX,
   BCL2, and Caspase-3 in the ox-LDL-induced cell model. β-actin was used
   as a loading control. (D-F) Quantification of the relative protein
   levels of BAX, BCL2, and Caspase-3 normalized to β-actin, and presented
   as relative intensity measured by Western blot analysis. All data were
   presented as the mean ± SD, (n = 3).**p < 0.01 vs. control group,
   ##p < 0.01 vs. model group, $$p < 0.01 vs. NGR1
   group, + p < 0.05, ++p < 0.01 vs. SSB2 group.

3.7 NS affects the PI3K/AKT/mTOR pathway in RAW264.7 cells

   The above results indicate that the PI3K/AKT signaling pathway plays a
   significant role in the anti-atherosclerotic effect of NS. mTOR is a
   potential core target for the anti-atherosclerotic effect of NS, acting
   as a downstream target of the PI3K/AKT pathway and exerting pleiotropic
   cellular effects.Therefore, we further explored the changes in the
   PI3K/AKT/mTOR pathway in vivo and in ox-LDL-induced macrophages treated
   with NS. We observed the expression of proteins involved in the
   PI3K/AKT/mTOR signaling pathway. In ApoE^-/- mice, as shown by western
   blot results, the ratio of p-PI3K/PI3K and p-Akt/Akt in ox-LDL-exposed
   RAW264.7 cells was significantly higher than in the control group. The
   monotherapy group did not exhibit significant changes, however, the NS
   treatment significantly diminished this increase. Similarly, the ratio
   of p-mTOR/mTOR in ox-LDL-exposed RAW264.7 cells was significantly
   enhanced compared to the control group. In contrast, NS treatment
   significantly reduced these ratios ([130]Figs 7A-[131]D).
   Immunofluorescence analysis further supported these findings. Compared
   to the control group, the staining intensity of p-mTOR gradually
   increased in the ox-LDL group. Additionally, p-mTOR expression was
   reduced in the NS treatment group ([132]Figs 7E-[133]F). These results
   indicates that NS partially inhibits the activation of the
   PI3K/Akt/mTOR pathway.

Fig 7. NS affects the PI3K/AKT/mTOR pathway in RAW264.7 cells.

   [134]Fig 7
   [135]Open in a new tab

   (A) Representative western blot images showing protein expression of
   P-PI3K, PI3K, P-AKT, AKT, P-mTOR, and mTOR in the Ox-LDL-induced cell
   model. β-actin was used as a loading control. (B) Quantitative analysis
   of P-PI3K/PI3K ratio.(C) Quantitative analysis of P-AKT/AKT ratio. (D)
   Quantitative analysis of P-mTOR/mTOR ratio. The ratios are presented as
   relative intensities. (E) Representative fluorescence staining image of
   P-mTOR examined by inverted fluorescence microscopy (scale bar = 50
   μm).(F)Quantitative analysis of representative fluorescent staining
   images of P-AKT, expressed as relative intensity. All data were
   presented as the mean ± SD, (n = 3). **p < 0.01 vs. control group,
   ##p < 0.01 vs. model group, $$p < 0.01 vs. NGR1
   group, + p < 0.05, ++p < 0.01 vs. SSB2 group.

3.8 NS inhibits atherosclerosis by enhancing macrophage autophagic flux

   Within the autophagy regulatory pathway, mTOR acts as a negative
   regulator of autophagy. Thus, inhibiting the PI3K/AKT/mTOR pathway can
   regulate macrophage autophagy. Using Western blotting, we evaluated the
   expression of key autophagy proteins Beclin-1, P62, and LC3 in
   ox-LDL-exposed RAW264.7 cells. Our findings indicated that NS treatment
   significantly enhances Beclin-1 expression in ox-LDL-exposed RAW264.7
   cells. Conversely, NS treatment markedly attenuates P62 expression in
   ox-LDL-exposed RAW264.7 cells. Additionally, the LC3 II/I protein
   ratio, which was significantly reduced in ox-LDL-exposed RAW264.7
   cells, was significantly reversed by NS treatment. Next, we assessed
   the expression level of p-mTOR and analyzed its co-localization with
   lysosomal marker protein LAMP-1 to evaluate lysosomal function through
   immunofluorescence staining. As shown in [136]Fig 8E, compared with the
   control group, which displayfewer yellow puncta,ox-LDL-induced RAW264.7
   cells exhibited significantly enhanced co-localization of p-mTOR
   (green) with LAMP-1 (red), with a marked increase in the area of yellow
   merged puncta in confocal images. Notably, NS treatment significantly
   suppressed the ox-LDL-induced lysosomal localization of p-mTOR, as
   evidenced by a substantial reduction in co-localized yellow puncta. In
   vivo Immunofluorescence analysis of P62 to assess autophagic activity
   in lesions revealed decreased autophagic activity in atherosclerotic
   lesions([137]Fig 8F). However, following administration of NS,
   autophagy significantly recovered ([138]Figs 8F-[139]G). In summary,
   these results indicate that NS can alleviate atherosclerosis by
   activating macrophage autophagy.

Fig 8. NS enhances autophagy inhibits atherosclerosis in RAW264.7 cells.

   [140]Fig 8
   [141]Open in a new tab

   (A) Representative Western blot images showing protein expression
   levels of BECLIN1, LC3, and P62 in the Ox-LDL-induced cell model.
   β-actin was used as a loading control. (B-D) Relative protein levels of
   BECLIN1, LC3, and P62, normalized to β-actin and presented as relative
   intensities. (E) Representative confocal microscopy images
   demonstrating the co-localization of p-mTOR (green) and Lamp-1 (red) in
   RAW264.7 macrophages (scale bar = 10 μm). (F) Representative
   fluorescence staining images of P62 examined by inverted fluorescence
   microscopy (scale bar = 50 μm). (G) Quantitative analysis of the
   fluorescence intensity of P62 from representative staining images. All
   data were presented as the mean ± SD, (n = 3). **p < 0.01 vs. control
   group, #p < 0.05, ##p < 0.01 vs. model group, $$p < 0.01 vs. NGR1
   group, + p < 0.05, ++p < 0.01 vs. SSB2 group.

3.9 NS restores autophagy via the PI3K/AKT/mTOR pathway, inhibiting foam cell
formation and suppressing inflammation and apoptosis in ox-LDL-stimulated
macrophages

   To futher determine whether the NS improves atherosclerosis by
   affecting the PI3K/Akt/mTOR signaling pathway and autophagy, we
   evaluated the effects of rapamycin (Ra) and 3-MA on ox-LDL-stimulated
   macrophages. We observed that rapamycin further reduced the
   accumulation of lipid droplets and the rate of apoptosis induced by
   ox-LDL. Additionally, it effectively enhanced the transcription levels
   of PPAR-γ, LXR-α, ABCA1, and ABCG1 genes. In contrast, the beneficial
   effects of NS treatment were partially blocked by 3-MA ([142]Figs
   9A-[143]F). Next, we measured the levels of key proteins using Western
   blot, including NLRP3 ([144]Fig 9H), caspase-3 ([145]Fig 9K), the
   p-mTOR/mTOR ratio ([146]Fig 9L), and p62 ([147]Fig 9M). Compared to the
   control group, the Mod group showed a significant increase in these
   markers. In contrast, Bcl2 ([148]Fig 9J) and Beclin1 ([149]Fig 9N) were
   significantly reduced in the ox-LDL group, indicating that ox-LDL
   treatment activates the PI3K/Akt/mTOR pathway and apoptosis while
   inhibiting autophagic flux and inflammation in RAW264.7 cells. Notably,
   immunofluorescence co-localization analysis revealed that, in
   comparison to the NS group, rapamycin-treated RAW264.7 cells exhibited
   further reduced co-localization of p-mTOR with LAMP-1. Conversely,
   3-MA-treated RAW264.7 cells demonstrated significantly enhanced
   p-mTOR/LAMP-1 co-localization, with a marked increase in the area of
   yellow merged puncta observed in the confocal microscopy images
   ([150]Fig 9P). As expected, compared to cells treated with ox-LDL
   alone, NS treatment significantly reduced the expression of NLRP3,
   p-mTOR, BAX, and p62. The NS treatment group showed significantly
   higher levels of BCL2, Beclin1, and, LC3-II and LAMP1 compared to the
   Mod group, with rapamycin further enhancing the effects of NS. However,
   these effects of NS could be partially eliminated by the autophagy
   inhibitor 3-MA. These results suggested that NS mitigates the
   activation of the PI3K/Akt/mTOR signaling pathway induced by ox-LDL,
   thereby restoring autophagic flux in ox-LDL-treated macrophages and
   inhibiting foam cell formation and apoptosis.

Fig 9. NS restores macrophage autophagy and alleviates the progression of
atherosclerosis by inhibiting the PI3K/Akt/mTOR pathway.

   [151]Fig 9
   [152]Open in a new tab

   Representative images of Oil Red O staining showing lipid droplets in
   RAW264.7 cells. Cells were examined under a light microscope (scale
   bar = 100 μm). (B) Representative images of cell apoptosis detected by
   flow cytometry. (C-F) The use of gene-specific oligonucleotide primers
   for the real-time PCR analysis of PPAR-γ, LXR-α, ABCA1, and ABCG1. (G)
   Representative Western blot images showing protein expression levels of
   P-mTOR, mTOR, NLRP3, BAX, BCL2, Caspase3, P62, BECLIN1, and LC3 in
   ox-LDL-induced cellular models. β-actin was used as the loading
   control. (H-O) Quantification of relative protein levels were
   normalized to β-actin and were presented as relative intensity. (P)
   Representative confocal microscopy images demonstrating the
   co-localization of p-mTOR (green) and Lamp-1 (red) in RAW264.7
   macrophages (scale bar = 10 μm). All data were presented as the
   mean ± SD, (n = 3). **p < 0.01 vs. control group, #p < 0.05, ##p < 0.01
   vs. model group, $p < 0.05, $$p < 0.01 vs. NS
   group, + p < 0.05, ++p < 0.01 vs. NS group. Rapamycin: 0.5 μM, 3-MA:
   3 mM.

4 Discussion

   Atherosclerosis is a chronic vascular disease characterized by the
   deposition of lipids within the vascular wall, which triggers
   inflammatory responses and the formation of foam cells, ultimately
   leading to plaque development and vascular stenosis [[153]42].
   Increasing evidence suggests that macrophage autophagy plays a
   protective role in the progression of atherosclerosis, and the
   pharmacologically active compounds such as NGR1 and SSB2 (derived from
   Panax notoginseng and Bupleurum, respectively) may enhance autophagic
   flux, providing a promising therapeutic strategy to mitigate the
   disease progression and stabilize plaques [[154]43]. However, the
   synergistic mechanisms of their combined use (NS) remain unclear. In
   this study, we employed an integrative approach combining network
   pharmacology, in vivo ApoE^−/− mouse model, and in vitro macrophage
   assays to demonstrate, for the first time, that NS combination therapy
   synergistically suppresses the PI3K/Akt/mTOR signaling pathway, thereby
   restoring macrophage autophagy flux. This dual-targeted mechanism
   effectively attenuates lipid accumulation, inflammation, and apoptosis,
   offering a novel therapeutic strategy for atherosclerosis.

   Our network pharmacology analysis identified shared targets of NGR1 and
   SSB2 within pathways critical to atherosclerosis progression, including
   lipid, apoptosis, and inflammatory ([155]Figs 1B-[156]C). Consistent
   with these predictions, NS treatment in ApoE^−/− mouse model revealed
   that NS combination therapy significantly improved dysregulated lipid
   metabolism by reducing serum TC, TG, LDL-C levels while simultaneously
   increasing HDL-C levels ([157]Figs 2B-[158]E). Histological analyses
   further revealed that compared to the model group and treatments with
   either NGR1 or SSB2 alone, NS combination therapy significantly reduced
   aortic plaque area and decreased the formation of hepatic fat vacuoles
   ([159]Figs 3A-[160]B and [161]2I), underscoring its superior efficacy
   in mitigating systemic lipid dysregulation. Furthermore, in vitro
   experiments showed that Oil Red O staining results indicated a marked
   reduction in intracellular oil droplet numbers in the NS combined
   treatment group relative to the model group and single-agent treatments
   with NGR1 or SSB2, suggesting that NS effectively inhibits lipid
   accumulation ([162]Fig 4C), aligning with recent reports that
   macrophage lipid uptake exacerbates plaque instability [[163]44].
   Mechanistically, NS significantly enhanced the transcription levels of
   PPARγ, LXRα, ABCA1, and ABCG1, as determined by real-time quantitative
   PCR([164]Figs 4E-[165]H). The reverse cholesterol transport (RCT)
   pathway involving PPARγ/LXRα/ABCA1 represents a potential therapeutic
   target for the treatment of atherosclerotic cardiovascular diseases
   [[166]45], it plays a key role in RCT by promoting the transport of
   cholesterol from the intracellular to the extracellular space
   [[167]46]. Not only that, NS inhibited NLRP3 inflammasome activation,
   as demonstrated by reduced mRNA and protein levels of TNF-α, IL-1β,
   IL-18, and NLRP3 ([168]Fig 5). During the progression of
   atherosclerosis, macrophages extensively uptake oxidized low-density
   lipoprotein (ox-LDL) to form foam cells [[169]47]. These foam cells are
   not only rich in lipids and cholesterol but also promote persistent
   local inflammatory responses by releasing inflammatory mediators
   [[170]48]. Upon sensing danger signals such as ox-LDL, macrophages
   activate the NLRP3 inflammasome, which subsequently facilitates the
   maturation and release of pro-inflammatory cytokines IL-1β and IL-18
   [[171]49]. This anti-inflammatory effect is critical, given the
   established role of NLRP3 in driving atherosclerosis through
   IL-1β/IL-18-mediated vascular inflammation Notabley, NS combination
   therapy NS combination therapy restored the balance of apoptotic
   regulators, upregulating the expression of the anti-apoptotic protein
   Bcl-2 while downregulating the expression of pro-apoptotic proteins Bax
   and Caspase-3 ([172]Fig 6). These findings align with emerging evidence
   that macrophage apoptosis promotes necrotic core formation and plaque
   rupture [[173]50], positioning NS as a modulator of plaque stability.
   Moreover, CAP3 was also identified as a core target. Protecting
   macrophages from apoptosis is considered an effective strategy to
   mitigate plaque instability and combat acute vascular events [[174]51].
   Liao and her team proposed that macrophage apoptosis could render
   plaques unstable, leading to inflammation and necrosis, which increases
   the risk of plaque rupture and thrombosis, consequently resulting in
   acute cardiovascular events such as myocardial infarction or stroke
   [[175]52]. Oxidative stress experiments revealed that NS combination
   therapy significantly reduced intracellular ROS levels. These findings
   indicate that the NS combination therapy markedly improves the
   pathological progression of atherosclerosis through synergistic effects
   from multiple avenues.

   Central to our findings is the identification of the PI3K/AKT/mTOR
   pathway as a key regulatory node for NS-mediated autophagy ([176]Figs
   7−8). The mechanistic target of rapamycin (mTOR) exists in two distinct
   complexes: mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2)
   [[177]53], these complexes are capable of receiving signals from
   various pathways. The PI3K/AKT pathway is closely associated with
   processes such as cell growth, metabolism, inflammation, apoptosis, and
   autophagy [[178]54]. As a downstream target of the PI3K/AKT pathway,
   the excessive activation of the PI3K/AKT/mTOR signaling cascade can
   promote the formation and progression of atherosclerotic plaques by
   inhibiting autophagic processes [[179]55–[180]57]. Interestingly,
   enrichment analysis has revealed that NGR1 and SSB2 may participate in
   the regulation of atherosclerosis through their roles in lipid,
   apoptosis, inflammatory, and autophagy. This further corroborates the
   significance of the PI3K/AKT/mTOR pathway in the pathological
   progression of atherosclerosis. Furthermore, our in vitro experiments
   revealed that compared to the model group or monotherapy group, NS
   combined treatment significantly inhibited the activation of this
   pathway. By suppressing p-PI3K/PI3K, p-Akt/Akt, and p-mTOR/mTOR ratios
   ([181]Fig 7), NS alleviated ox-LDL-induced autophagy inhibition, as
   evidenced by elevated LC3-II/LC3-I and Beclin-1 alongside reduced P62
   ([182]Fig 8). This mechanistic insight extends prior work demonstrating
   mTOR as a negative regulator of autophagy in atherosclerosis [[183]58],
   and highlights NS as a potential dual inhibitor of PI3K/Akt/mTOR
   signaling.

   In recent years, scientists have discovered that autophagy plays a
   positive role in atherosclerosis, a finding that has been extensively
   explored and emphasized in numerous studies [[184]59–[185]61]. In our
   study, the NS combination therapy significantly reversed the effects
   observed in the ox-LDL-induced RAW264.7 macrophage model. This was
   evidenced by a notable increase in the LC3-II/LC3-I ratio and Beclin-1
   protein expression, along with a significant reduction in P62 protein
   accumulation.The high expression of the autophagy key protein Beclin-1
   serves as a marker for the activation of autophagosomes [[186]62].
   Alongside LC3-II, it is considered a critical component involved in the
   formation of mammalian autophagosomes [[187]63].LC3, or
   Microtubule-associated Protein 1A/1B-light chain 3 (MAP1LC3), is a
   crucial biomarker for identifying the autophagy process. When autophagy
   is activated, there is a significant conversion of LC3-I to LC3-II,
   making it an important indicator for detecting the initiation of
   autophagy. P62 is a connective protein that plays a crucial role in the
   identification and clearance of cellular cargo. Its accumulation is
   typically associated with a reduction in autophagic activity [[188]64].
   Conversely, during the activation of autophagy, P62 undergoes
   degradation, leading to a reduction in its expression levels. Our study
   revealed a significant increase in colocalization between p-mTOR and
   LAMP-1 in ox-LDL-stimulated RAW264.7 macrophages ([189]Fig 8E). This
   enhanced colocalization suggests that lipid overload leads to
   hyperactivation of the PI3K/AKT/mTOR signaling pathway, promoting
   mTORC1 recruitment and anchoring to the lysosomal membrane. Previous
   studies have demonstrated that lysosomal localization of mTORC1 is
   essential for its biological functions in promoting cell growth and
   inhibiting autophagy [[190]65]. As a highly glycosylated lysosomal
   membrane marker, LAMP-1 not only serves as a key indicator of lysosomal
   biogenesis [[191]66], but also plays a crucial role as a mediator in
   autophagosome-lysosome fusion, which is critical for completing
   autophagic flux [[192]67]. However, when mTOR becomes overactivated and
   accumulates on LAMP-1-positive lysosomal membranes, it phosphorylates
   and inhibits ULK1 (a key kinase involved in autophagy initiation),
   thereby blocking autophagic progression [[193]68]. This inhibitory
   effect may impair the clearance of damaged lipids and protein
   aggregates, exacerbating intracellular lipid accumulation and
   ultimately promoting macrophage transformation into foam cells. This
   discovery reveals the significant role of NS combination therapy in
   regulating autophagy to prevent atherosclerosis. It is noteworthy that
   the expression of P62 protein in the NS combination therapy group was
   significantly lower than that in the monotherapy group, while the
   expression of Beclin-1 protein was markedly higher than that in the
   NGR1 monotherapy group. This indicates that the combined administration
   of NGR1 and SSB2 effectively modulates the expression of
   autophagy-related proteins through a synergistic mechanism. Therefore,
   this result further validates that combination therapy is more
   effective than monotherapy, demonstrating a more pronounced synergistic
   effect. In another words, the combined treatment may play a synergistic
   role in modulating autophagy-related proteins.

   The functional significance of NS-induced autophagy was further
   validated using pharmacological modulators. Co-treatment with rapamycin
   (mTOR inhibitor) enhanced NS-mediated lipid clearance ([194]Fig 9A,
   [195]C–F), while 3-MA (autophagy inhibitor) abolished these effects,
   confirming autophagy as the primary mechanism ([196]Figs 9H-[197]O).
   Similarly, there was a corresponding difference in apoptosis
   rates([198]Fig 9B). Rapamycin is an mTOR inhibitor that exerts its
   effects by directly binding to mTORC1, thereby inhibiting its activity
   [[199]69]. This action relieves the suppressive effect of mTOR on
   autophagy, promoting the activation of this cellular process. While
   3-MA is a PI3K inhibitor that blocks the initiation of autophagy by
   suppressing the activity of PI3K [[200]70]. The two compounds mentioned
   here are frequently utilized in atherosclerosis research. Rapamycin
   exerts its anti-atherosclerotic effects by inhibiting mTOR, which
   restores autophagic activity, reduces serum LDL cholesterol levels,
   alleviates inflammatory responses within the vascular system, and
   suppresses apoptotic processes [[201]71]. In contrast, 3-MA inhibits
   PI3K to block autophagy, which exacerbates lipid accumulation and
   inflammatory responses, further promoting plaque instability [[202]72].
   Here, following the addition of rapamycin, there was a further
   reduction in the expression levels of NLRP3 and p62 compared to the NS
   combination treatment group. Conversely, the expressions of Bcl2 and
   Beclin1 were significantly elevated. In contrast, the introduction of
   3-MA resulted in a marked increase in NLRP3 levels while concurrently
   decreasing the Beclin1 and LC3-II/LC3 ratio. As shown in [203]Fig 9P,
   our immunofluorescence co-localization analysis revealed that
   rapamycin-treated RAW264.7 cells exhibited significantly reduced
   co-localization of p-mTOR with LAMP-1 compared to the normal control
   group. This reduction islikely attributable to rapamycin-mediated
   inhibition of mTOR activity which consequently impaired
   autophagosome-lysosome fusion. Conversely, 3-MA treatment markedly
   enhanced the p-mTOR/LAMP-1 co-localization, potentially through its
   inhibitory effect on the initial stages of autophagy, which secondarily
   modulates mTOR activity, thereby promoting the association between
   p-mTOR and LAMP-1. In summary, NS influences autophagy through the
   PI3K/Akt/mTOR pathway, significantly regulating the interplay between
   lipid accumulation, apoptosis, and inflammatory responses
   [[204]73,[205]74]. Our study elucidates a previously unrecognized
   synergy between NGR1 and SSB2 in combating atherosclerosis through
   PI3K/Akt/mTOR pathway inhibition and autophagy restoration.

5 Conclusion

   This pioneering study provides compelling evidence that the combination
   of NGR1 and SSB2 (NS) effectively mitigates inflammation and inhibits
   the activation of the PI3K/Akt/mTOR signaling pathway in
   atherosclerosis. Our findings reveal that NS treatment promotes
   autophagy, reduces the formation of inflammatory foam cells, and
   decreases macrophage apoptosis ([206]Fig 10). This multifaceted
   approach underscores NS’s potential as a therapeutic strategy for
   preventing the onset and progression of atherosclerosis. Importantly,
   our research elucidates the molecular mechanisms underlying the
   synergistic effects of NGR1 and SSB2, highlighting their therapeutic
   promise in atherosclerosis management. By restoring autophagic flux and
   modulating inflammatory responses, NS not only addresses key
   pathological features of atherosclerosis but also opens avenues for
   innovative treatment strategies targeting lipid metabolism and
   macrophage function.

Fig 10. NS effectively modulates the PI3K/Akt/mTOR signaling pathway and
inhibits lipid transport, inflammation, and apoptosis in macrophages by
enhancing autophagy.

   [207]Fig 10
   [208]Open in a new tab

   In conclusion, this study lays a solid foundation for future
   investigations into the clinical applications of NS in atherosclerosis
   and emphasizes the need for further research to explore its potential
   in combination therapies. The insights gained from this research
   contribute significantly to our understanding of atherosclerosis
   pathophysiology and may inform the development of novel interventions
   aimed at improving cardiovascular health.

Supporting information

   S1 Fig. Histopathological analysis of mouse kidney tissue under
   different treatments.

   The HE-stained section of mouse kidney, scale bar = 50 μm.

   (TIF)
   [209]pone.0326687.s001.tif^ (7MB, tif)
   S1 File. S1 raw images.

   (PDF)
   [210]pone.0326687.s002.pdf^ (70.6MB, pdf)

Data Availability

   All figures files are available from the dryad database
   ([211]http://datadryad.org/share/4GvB7LlOnZ0wtL8Og2WIplaC9ZctRnAeJkkWt7
   K1FnI).

Funding Statement

   1.The Scientific Startup Foundation for Doctors of North Sichuan
   Medical College(CBY23-QDA11) to XM; 2.Key Research and Development
   Projects of the Sichuan Provincial Department of Science and Technology
   (2020YFS0528) to CZ. The funders had no role in study design, data
   collection and analysis, decision to publish and preparation of the
   manuscript.

References