Abstract

   Macrophages play a critical role in both initiating and resolving
   inflammation following MI (myocardial infarction). Their polarization
   is essential for maintaining cardiac function. This study aims to
   explore the role of MCPIP1(Monocyte chemotactic protein‐induced protein
   1) in regulating macrophage polarization and its impact on heart‐spleen
   interactions during MI recovery. The role of MCPIP1 was investigated
   using histological staining, RNA sequencing of bone marrow‐derived
   macrophages, co‐culture experiments, and validated by western blot.
   Compared to controls, myeloid MCPIP1‐deficient mice had lower survival
   rates, larger infarction areas, and more severe inflammatory responses
   after MI. This was due to increased M1 polarization and impaired
   conversion to the M2 phenotype. Ferroptosis activation in
   MCPIP1‐deficient macrophages was inhibited by Fer‐1 and PFT‐α, which
   promoted M2 polarization and fibroblast activation into myofibroblasts.
   MCPIP1‐deficient MI mice also showed splenomegaly and elevated levels
   of circulating macrophages, indicating excessive extramedullary
   hematopoiesis. Splenectomy improved survival rates and reduced
   infarction size in MCPIP1‐deficient mice. MCPIP1 suppresses the
   P53/ferroptosis pathway to regulate macrophage polarization and
   TGF‐β/SMAD3‐mediated fibroblast activation. Its deficiency exacerbates
   inflammation through abnormal splenic macrophage output, impairing
   cardiac repair. MCPIP1 is a promising therapeutic target for modulating
   ferroptosis and heart‐spleen communication to protect cardiac function
   following MI.

   Keywords: ferroptosis, Heart‐spleen axis, macrophage, MCPIP1
     __________________________________________________________________

   Following myocardial infarction, MCPIP1 deficiency in macrophages
   triggers ferroptosis, driving proinflammatory M1 dominance over
   reparative M2 phenotypes. This imbalance amplifies splenic monocyte
   release and sustains cardiac inflammation. Concurrently, excessive
   inflammatory mediators and insufficient TGF‐β impair fibroblast
   activation, delaying extracellular matrix repair. These cascades
   culminate in cardiac dysfunction, elevated heart rupture rates, and
   reduced survival in MCPIP1‐ deficient mice.

   graphic file with name ADVS-12-2500747-g004.jpg

1. Introduction

   Myocardial infarction (MI) remains a leading cause of death and
   disability worldwide, imposing a substantial health and economic burden
   on society.^[ [40]^1 ^] Following MI, a complex inflammatory response
   is initiated, involving a diverse array of various immune cells and
   inflammatory factors.^[ [41]^2 , [42]^3 ^] Obtaining an equilibrium
   between pro‐inflammatory and anti‐inflammatory processes can profoundly
   affects cellular functions within the inflamed myocardial tissue.^[
   [43]^4 ^] Proper resolution of inflammation is essential for a
   favorable healing outcome, as excessive or prolonged inflammatory
   response can lead to adverse remodeling and complications.^[ [44]^5 ^]
   Consequently, maintaining a delicate balance between pro‐inflammatory
   and anti‐inflammatory processes is crucial for removing damaged cardiac
   tissue and preserving heart function.^[ [45]^6 , [46]^7 ^]

   In MI, the timely recruitment and multifaceted functions of monocytes
   and macrophages drive both the inflammatory response and subsequent
   tissue repair. Monocytes and macrophages are recruited to the infarcted
   area in response to damage‐associated molecular patterns (DAMPs) and
   inflammatory cues released by dying cardiac cells.^[ [47]^8 ^] These
   cells assist in removing necrotic debris and secrete cytokines that
   shape the inflammatory milieu. They also help form tension‐free zones
   in the ischemic and necrotic myocardium and activate fibroblasts,
   converting them into myofibroblasts that stabilize the extracellular
   matrix (ECM) through collagen deposition.^[ [48]^9 , [49]^10 ^] This
   adaptive remodeling prevents heart rupture during the acute phase of
   MI.^[ [50]^11 ^] During this process, macrophages play as dual role:
   acting as “arsonists” by releasing pro‐inflammatory factors that drive
   inflammation and as “firefighters” by producing repair factors that
   promote tissue healing.^[ [51]^8 ^] Given their high heterogeneity and
   plasticity, the regulation of macrophages function has become an
   attractive therapeutic strategy for improving long‐term prognosis in MI
   patients.^[ [52]^12 , [53]^13 , [54]^14 , [55]^15 ^]

   Monocyte chemoattractant protein‐induced protein 1 (MCPIP1), a member
   of CCCH zinc finger family, is increasingly recognized as a pivotal
   regulator of inflammation.^[ [56]^16 ^] This protein was first
   identified in peripheral blood monocytes from patients with ischemic
   heart disease in 2006.^[ [57]^17 ^] MCPIP1 expression increases in
   response to LPS/IL‐1β activation of the NFκB pathway via TLR
   receptors.^[ [58]^18 ^] Through its ribonuclease activity, MCPIP1 then
   degrades mRNAs encoding several pro‐inflammatory cytokines (e.g., IL‐6,
   IL‐1β, IL‐2, IL‐12, and IL‐17), thereby exerting an anti‐inflammatory
   effect.^[ [59]^19 ^] Mice lacking MCPIP1 exhibit severe inflammation
   and premature death.^[ [60]^20 ^] Overexpression of MCPIP1 in
   cardiomyocytes confers protection against LPS‐induced myocarditis.^[
   [61]^21 ^]

   Despite these findings, the roles of MCPIP1 in regulating post‐MI
   inflammation remains underexplored. To bridge this gap, we generated a
   myeloid‐specific MCPIP1 knockout mouse model to investigate the role of
   MCPIP1 in macrophage function during MI. Our findings provide insights
   into a potentially novel therapeutic strategy for modulating the
   inflammatory response after MI.

2. Results

2.1. MCPIP1 is Highly Expressed in Macrophages Following MI

   To explore the gene expression profile within macrophages after MI, we
   analyzed three representative GEO datasets. We found that MCPIP1 was
   upregulated in all three datasets (Figure [62]1A). A total of 116
   differentially expressed genes overlapped among these datasets
   (Figure [63]1B). GO and KEGG analyses revealed strong association with
   inflammatory responses and classical inflammatory pathways
   (Figure [64]1C,D). STEM analysis demonstrated progressively increase in
   MCPIP1 expression as MI progressed (MI 1D – 7D – 14D). Such increase is
   particularly with third module, by exhibiting significant temporal
   expression differences (Figure [65]1E–G).

Figure 1.

   Figure 1
   [66]Open in a new tab

   MCPIP1 Is Expressed In Macrophages After Myocardial Infarction and Its
   Expression Increases Over Time. A) Volcano plot of differential genes,
   utilizing three datasets from GEO: [67]GSE166780 (comparing peripheral
   blood monocytes from AMI patients versus healthy individuals),
   [68]GSE172270 (comparing monocyte‐derived macrophages from AMI patients
   versus healthy individuals), and [69]GSE268352 (comparing LPS‐treated
   versus PBS‐treated human monocyte‐derived macrophages), with Zc3h12a
   (MCPIP1) highlighted in green. B) Venn contains 116 differential genes
   (DEGs). GO C) and KEGG D) analyses were conducted using DSEGs. E)
   Utilizing [70]GSE88924 from GEO, a STEM (Short Time‐series Expression
   Miner) trend analysis was performed on the gene expression profiles of
   macrophages in the mouse heart, following the temporal sequence of
   MI1D, MI7D, and MI14D. F) Module 15, which exhibits significant trend
   differences, contains 528 genes. The green line represents the
   expression trend of MCPIP1 over time. G) This figure displays a subset
   of genes within Module 15, with Zc3h12a (MCPIP1) highlighted in yellow.

   To validate the bioinformatics analysis, we induced MI in wild‐type
   (WT) mice. Compared to the sham group, MCPIP1 protein and mRNA levels
   have more increased progressively over time, peaking on Day 14 (Figure
   [71]2A). Previous studies have shown that MCPIP1 is not exclusive to
   macrophages.^[ [72]^22 , [73]^23 , [74]^24 ^] Dual IF staining using
   CD68 (a specific marker for macrophages) and MCPIP1 confirmed that
   MCPIP1 was highly expressed by macrophages (CD68^+ cells) in the
   infarct border zone (IBZ) on Day 7 post‐MI (Figure [75]2B), aligning
   with silico results (Figure [76]1E).

Figure 2.

   Figure 2
   [77]Open in a new tab

   Post‐Myocardial Infarction, MCPIP1 is Primarily Expressed by
   Macrophages. A) MCPIP1 protein and mRNA levels at various time points
   (sham, 1, 3, 7, 14, and 28 days) post‐MI. n = 3. B) IF of heart at
   various time points (sham, MI3D, and MI7D), DAPI (blue) stains nuclei,
   MCPIP1 (red), and CD68 (green) stains macrophages. The line graph
   represents the distribution of red (MCPIP1) and green (CD68)
   fluorescence within the tissue sections.(C) Genotype verification of
   myeloid‐specific MCPIP1 knockout mice. D) Protein levels of MCPIP1 in
   heart and BMDMs from MCPIP1 ^mko and MCPIP1 ^fl/fl mice. n = 3. E) Body
   weight, heart‐to‐body weight ratio, and spleen‐to‐body weight ratio in
   littermate mice of the same age (10 weeks). n = 5. F) Survival curves
   of unoperated MCPIP1^mko and MCPIP1^fl/fl mice. n = 15. ns P > 0.05, ^*
   P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^**** P < 0.0001.

2.2. MCPIP1 ^mko Mice Exhibit Higher Mortality and Poorer Cardiac Function
Following MI

   Next, we generate MCPIP1 ^mko mice to explore the functional role of
   MCPIP1 in regulating macrophage inflammation after MI (Figure [78]2C).
   WB confirmed efficient deletion of MCPIP1 in heart tissue and bone
   marrow‐derived macrophages (BMDMs) (Figure [79]2D). During breeding,
   MCPIP1 ^mko mice progressively developed systemic inflammatory
   responses, leading to splenomegaly around 10 weeks of age
   (Figure [80]2E), and increased mortality by 12 weeks (Figure [81]2F).

   To avoid confounding effects from spontaneous inflammation in older
   MCPIP1 ^mko mice, MI was induced at 6 weeks of age. Over a 28‐Day
   period, the survival rate of MCPIP1 ^mko mice (33.33%) was
   significantly lower than controls (53.33%) (Figure [82]3A). Necropsy
   revealed a higher incidence of cardiac rupture in MCPIP1 ^mko mice
   (8/10, 80.00%), although this difference did not reach statistically
   significant (P = 0.058) (Figure [83]3B). Echocardiography at 28 days
   post‐MI showed worse cardiac function in MCPIP1 ^mko mice, with
   significantly lower LVEF% and FS%, plus increase in LVEDV
   (Figure [84]3C,D). Histological examination at multiple time points (3,
   7, 14, and 28 days post‐MI) demonstrated loosely arranged myocardial
   tissue, prominent vacuolar structures, and reduced collagen deposition
   in MCPIP1 ^mko mice (Figure [85]3E). The MCPIP ^mko mice also presented
   larger infarction angle, thinner left ventricles, and overall lower
   collagen content than their controls (Figure [86]3F). Previous studies
   have shown that MI can lead to heart failure and damage to target
   organs, including the heart, liver, and lungs.^[ [87]^25 , [88]^26 ,
   [89]^27 ^] Compared to controls, MCPIP1 ^mko mice exhibited higher
   ratios heart, spleen, and lung weights to body weight, respectively
   (Figure [90]3G).

Figure 3.

   Figure 3
   [91]Open in a new tab

   MCPIP1 ^mko Mice Exhibit Higher Mortality and Poorer Cardiac Function
   Following MI. A) Survival curves of MCPIP1^mko and MCPIP1^fl/fl mice
   after MI. n = 15. B) Causes of death are categorized as cardiac rupture
   and other causes. C) Representative cardiac ultrasound images at MI28D.
   D) Echocardiographic measurements of LVEF, FS, and LVEDV in mice. At
   least 5 mice per group. E) MASSON and HE staining of hearts from
   MCPIP1^mko and MCPIP1^fl/fl mice at different time points (3, 7, 14,
   and 28 days) post‐MI. F) Cardiac collagen content, infarction angle,
   and left ventricular thickness in MCPIP1^mko and MCPIP1^fl/fl mice at
   MI28D based on MASSON staining results. n = 5. G) Comparison of wet
   organ weights (heart, liver and lungs) relative to body weight at
   various time points. n = 5.ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^***
   P < 0.001, ^**** P < 0.0001.

   Collectively, these data suggest that MCPIP1 ^mko mice suffer from
   increased mortality and impaired cardiac remodeling following MI.

2.3. MCPIP1 Deficiency Leads to Excessive Macrophage Accumulation

   We are curious whether MCPIP1 deficiency macrophages will accumulate
   within the infarcted heart. The higher number of CD68^+ cells and
   fluorescence intensity in MCPIP1 ^mko mice hearts confirm excessive
   macrophage infiltration into the IBZ (Figure [92]4A,B). WB revealed
   increased levels of CD68 and CCL2(also known as MCP‐1) in MCPIP1 ^mko
   mice hearts, indicating elevated macrophage accumulation and enhanced
   chemotactic signals (Figure [93]4C). Furthermore, IF staining for
   F‐actin in BMDMs showed upregulated cytoskeletal proteins in
   MCPIP1‐deficient macrophages, suggesting greater migration capacity
   (Figure [94]4D). MCPIP1 profoundly alters the chemotactic ability of
   macrophages, causing them to continuously accumulate in the heart after
   infarction.

Figure 4.

   Figure 4
   [95]Open in a new tab

   MCPIP1 Deficiency Leads to Excessive Macrophage Accumulation. A,B) IF
   showing the number of macrophages (CD68+) and mean fluorescence
   intensity in IBZ at different time points (3, 7, 14 days) post‐MI. DAPI
   (blue) stains nuclei, and CD68 (green) stains macrophages. n = 5 fields
   of view. C) Protein levels of CD68 and CCL2 in IBZ of mice hearts after
   MI. n = 3. D) Phalloidin staining revealed the content of F‐actin in
   BMDMs from MCPIP1^mko and MCPIP1^fl/fl mice. DAPI (blue) stains nuclei,
   and F‐actin (green) stains filamentous actin. n = 5 fields of view. ns
   P > 0.05, ^* P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^**** P < 0.0001.

2.4. MCPIP1 ^mko Macrophages Remain Predominantly in M1 Polarization, Leading
to Excessive Inflammation and Impaired Collagen Production

   Macrophages exhibit significant heterogeneity, with M1 macrophages
   (marked by CD86) promoting inflammation and M2 macrophages (marked by
   Arg1) facilitating tissue repair. IF staining at two time points
   post‐MI—the acute inflammatory phase (MI‐3 Days) and the scar repair
   phase (MI‐14 Days)—revealed that MCPIP1 ^mko mice had a higher
   proportion of M1 macrophages during the acute phase (p = 0.056) and a
   severe deficiency of M2 macrophages during the repair phase (Figure
   [96]5A,B). Macrophage markers (CD68) (Figure [97]5C) and M1 phenotype
   markers (CD86) (Figure [98]5D) were elevated, while M2 phenotype
   markers (Arg1) (Figure [99]5E) were reduced in MCPIP1 ^mko mice hearts.
   Furthermore, qRT‐ PCR indicated upregulation of pro‐inflammatory
   markers (IL‐1β, TNF‐α) (Figure [100]5F,H) and chemokines (CCL2, VCAM‐1)
   (Figure [101]5I,J), while showed downregulation of repair‐associated
   genes (IL‐10) in MCPIP1 ^mko hearts (Figure [102]5G). In vitro,
   MCPIP1‐deficient macrophages exhibited exaggerated CD86 expression
   under LPS stimulation but failed to upregulate Arg1 in response to
   IL‐10(Figure [103]5K,L), confirming the crucial role of MCPIP1 for M2
   polarization.

Figure 5.

   Figure 5
   [104]Open in a new tab

   MCPIP1 Plays A Crucial Role in Regulating M2 Polarization Of
   Macrophages And Cardiac Inflammation. A) IF reveals the percentage of
   M1 macrophages in IBZ of the hearts. The percentage of (F4/80 + CD86+)/
   F4/80+ was calculated. CD86 serves as an M1‐specific marker, while
   F4/80 is a macrophage‐specific marker. DAPI (blue), F4/80 (green), CD86
   (red). n = 5 per field of view. B) IF shows the percentage of M2
   macrophages in IBZ of the hearts. The percentage of (F4/80 + Arg1+)/
   F4/80+ was calculated. Arg1 is an M2‐specific marker, and F4/80 is a
   macrophage‐specific marker. DAPI (blue), F4/80 (green), Arg1 (red). n =
   5 per field of view. mRNA was extracted from the heart tissues of mice
   in the sham group and 7 days post‐MI. qRT‐PCR was performed to detect
   the relative mRNA levels of CD68C), CD86D), Arg1E), IL‐1βF), IL‐10G),
   TNF‐a H), VCAM‐1I) and CCL2 J). n = 3. BMDMs from MCPIP1^mkoand
   MCPIP1^fl/fl mice were treated with LPS (50 ng mL^−1) and IL‐10
   (20 ng mL^−1) respectively to induce classical M1 and M2 phenotypes. WB
   and qRT‐PCR showed protein and mRNA of CD86 (K) and Arg1(L). n = 3. ns
   P > 0.05, ^* P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^**** P < 0.0001.

   Because of M2 macrophages produce TGF‐β to stimulate
   myofibroblast‐mediated collagen deposition,^[ [105]^28 , [106]^29 ^]
   MCPIP1 ^mko mice presented reduced collagen I secretion in the IBZ
   (Figure [107]6A). Fibroblast activation markers (Col I, α‐SMA, TGF‐β)
   were decreased, and ECM‐degrading enzymes (MMP9) were increased in
   MCPIP1 ^mko mice hearts (Figure [108]6C). The TGF‐β/Smad3 signaling
   pathway is essential for fibroblast activation into myofibroblasts and
   subsequent collagen I secretion.^[ [109]^29 ^] MCPIP1‐deficient
   macrophages, even under IL‐10 stimulation, failed to secrete normal
   levels of TGF‐β (Figure [110]6D). WB analysis indicated that
   MCPIP1‐deficient macrophages did not effectively activate primary
   cardiac fibroblasts (PCFs) to myofibroblasts (Figure [111]6E,F) via the
   TGF‐β/Smad3 pathway (Figure [112]6E,G), resulting in decreased collagen
   production (Figure [113]6F) and increased PCFs apoptosis
   (Figure [114]6H). Furthermore, co‐staining with α‐SMA (myofibroblast
   marker) and F4/80 (macrophage marker) revealed reduced
   macrophage‐to‐myofibroblast transition (MMT) in the infarcted hearts of
   MCPIP1 ^mko mice (Figure [115]6B).

Figure 6.

   Figure 6
   [116]Open in a new tab

   Deficiency of MCPIP1 in Macrophages Suppresses Cardiac Fibroblast
   Activation. A) IF displays the content of type I collagen in IBZ of
   MCPIP1^mko and MCPIP1^fl/fl hearts at different time points post‐MI (3,
   7, and 14 days), DAPI (blue), Collagen I (green). n = 5 per field of
   view. B) IF demonstrates MMT in infarcted hearts, calculated as the
   percentage of (a‐SMA+ F4/80+)/ F4/80+. DAPI (blue), F4/80 (green),
   a‐SMA (red). n = 5 per field of view. C) qRT‐PCR was performed to
   detect the relative mRNA levels of Col1, α‐SMA, TGF‐β, and MMP9. n = 3.
   D) WB was performed to detect the protein level of TGF‐β in BMDMs from
   MCPIP1 ^mko and MCPIP1 ^fl/fl mice after IL‐10 treatment. n = 3. E)
   BMDMs from MCPIP1 ^mko and MCPIP1 ^fl/fl mice were co‐cultured with
   PCFs from WT mice, respectively. WB analysis was conducted to assess
   the protein levels of myofibroblast markers F), TGF‐β/Smad3 signaling
   pathway G) and apoptosis related proteins (H), n = 3. ns P > 0.05, ^*
   P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^**** P < 0.0001.

   Collectively, these findings underscore that MCPIP1 deficiency
   exacerbates inflammation and impairs myocardial repair.

2.5. MCPIP1 Inhibits Ferroptosis by Restraining P53 in Macrophages

   To elucidate the intrinsic regulatory mechanisms of MCPIP1 in
   macrophages, we performed RNA sequencing on BMDMs from MCPIP1 ^fl/fl
   and MCPIP1 ^mko mice. The volcano plot and heatmap (Figure [117]7A,B)
   revealed significant differences in gene expression between the two
   groups. While polarization‐related gene changes may be subtle due to
   the lack of stimulation, this analysis still offers valuable insights
   into the potential effects of MCPIP1 deficiency on macrophage
   polarization in an unstimulated state (Figure [118]7B). KEGG analysis
   showed significant enrichment of the ferroptosis pathway among DEGs
   (Figure [119]7C). Gene Set Enrichment Analysis (GSEA) indicated that
   ferroptosis‐related genes were activated in MCPIP1‐deficient
   macrophages (Figure [120]7D,E). Specifically, the Xc^− system genes
   (SLC3A2 and SLC7A11) were downregulated in MCPIP1 ^mko macrophages
   compared to controls (Figure [121]7F).

Figure 7.

   Figure 7
   [122]Open in a new tab

   Ferroptosis in Macrophages Lacking MCPIP1 is Significantly Enhanced.
   RNA‐seq analysis was performed on BMDMs from MCPIP1 ^mko and MCPIP1
   ^fl/fl mice, and volcano plots A), heatmaps B), and KEGG) enrichment
   pathway maps C) were generated based on the differential gene
   expression. GESA was conducted on DEGs between MCPIP1 ^fl/fl and MCPIP1
   ^mko BMDMs in the ferroptosis signaling pathway. The GESA plot D) and
   grouped clustering heatmap E) presented the results. F) Genes with
   significant differential expression in the ferroptosis signaling
   pathway are depicted, with red (increased), blue (decreased), and green
   (no significant difference).

   Further experiments showed reduced xCT (SLC7A11) and GPX4 levels in
   MCPIP1 ^mko macrophages, especially under the LPS treatment (Figure
   [123]8A). Additionally, mRNA levels of Ptgs2 and Acsl4, which promote
   ferroptosis, were significantly increased in MCPIP1 ^mko BMDMs
   (Figure [124]8B). Malondialdehyde (MDA) and glutathione (GSH) levels
   did not differ between untreated groups but showed significant
   differences after LPS treatment (Figure [125]8C). Treatment with Fer‐1,
   a classic ferroptosis inhibitor, restored xCT and GPX4 levels
   (Figure [126]8D) and decreased the M1 marker (CD86) (Figure [127]8E).
   Furthermore, MCPIP1‐deficient macrophages, which initially struggled to
   differentiate into the M2 phenotype, successfully underwent this
   transition after Fer‐1 treatment (Figure [128]8E). These findings
   indicated that ferroptosis serves as a critical signaling pathway
   through which MCPIP1 regulates phenotypic transformation of
   macrophages.

Figure 8.

   Figure 8
   [129]Open in a new tab

   Fer‐1 Attenuates Ferroptosis in MCPIP1‐Deficient Macrophages. A) WB
   showed protein levels of xCT and GPX4 in MCPIP1 ^fl/fl and MCPIP1 ^mko
   BMDMs treated with PBS and LPS. n = 3. B) qRT‐PCR measured mRNA levels
   of Ptgs2 and Acsl4. n = 3. C) Spectrophotometric analysis determined
   relative levels of MDA and GSH. n = 5. D) Protein levels of xCT and
   GPX4 in MCPIP1 ^mko BMDMs after LPS (50 ng mL^−1,24 h), with Fer‐1
   (2µm,6 h) treatment. n = 3. E) Protein levels and mRNA levels of M1 and
   M2 macrophage markers, CD86 and Arg1, respectively, in BMDMs after
   Fer‐1 treatment. n = 3. ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^***
   P < 0.001, ^**** P < 0.0001.

   Given that MCPIP1 significantly inhibits the Xc^− system in
   macrophages, P53 emerged as a potential target for MCPIP1 regulation
   (Figure [130]7F). The protein‐binding prediction model Z‐dock was used
   to predict the binding sites between MCPIP1 and P53.^[ [131]^30 ^] The
   model suggested extensive interactions between MCPIP1 and P53,
   facilitating the formation of a stable complex (Figure [132]9A).
   Consistent with this, WB results showed that MCPIP1 deficiency elevated
   P53 protein levels in macrophages (Figure [133]9B). Treatment with
   PFT‐α, a P53 inhibitor,^[ [134]^31 ^] restored xCT and GPX4 levels
   (Figure [135]9C). Both Fer‐1 and PFT‐α significantly decreased mRNA
   levels of Ptgs2, Acsl4 (Figure [136]9D) and MDA levels while increasing
   GSH levels in BMDMs (Figure [137]9E). IF showed that both Fer‐1 and
   PFT‐α reduced M1 marker (CD86) expression and promoted M2 marker (Arg1)
   expression (Figure [138]10A,B). However, Fer‐1 appeared to be more
   effective than PFT‐α.

Figure 9.

   Figure 9
   [139]Open in a new tab

   MCPIP1 Regulates Ferroptosis Through P53. A) Z‐dock prediction of the
   docking model between MCPIP1 and P53, with MCPIP1 in green, P53 in
   blue, and the binding domain highlighted in a red box. B) WB showed P53
   in MCPIP1 ^fl/fl and MCPIP1 ^mko BMDMs after treatment with PBS and
   LPS. n = 3. C) WB analysis of protein levels of xCT and GPX4 in MCPIP1
   ^mko BMDMs after LPS (50 ng mL^−1, 24 h) and PFT‐α (10µm,6 h)
   treatment. n = 3. D) qRT‐PCR measured mRNA levels of Ptgs2 and Acsl4 in
   MCPIP1 ^fl/fl and MCPIP1 ^mko BMDMs under DMSO, Fer‐1 and PFT‐α
   treatment. n = 3. E) Spectrophotometric analysis was employed to
   determine the relative levels of MDA and GSH in MCPIP1 ^fl/fl and
   MCPIP1 ^mko BMDMs treated with DMSO, Fer‐1 and PFT‐α. n = 5. ns
   P > 0.05, ^* P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^**** P < 0.0001.

Figure 10.

   Figure 10
   [140]Open in a new tab

   Inhibition of Ferroptosis in Macrophages Promotes Their Maturation and
   Activates Cardiac Fibroblasts. A) MCPIP1^mko BMDMs were pretreated with
   LPS and then treated with DMSO, Fer‐1, or PFT‐α. The expression level
   of CD86 was detected by IF. DAPI (blue), CD86 (red). B) MCPIP1 ^mko
   BMDMs were pretreated with IL‐10 and then treated with DMSO, Fer‐1, or
   PFT‐α. The expression level of Arg1 was detected by IF. DAPI (blue),
   Arg1 (red). C) The expression level of α‐SMA in PCFs cocultured with
   BMDMs was detected by IF. DAPI (blue), α‐SMA (red). D) Similarly,
   P‐Smad3 in PCFs was detected. DAPI (blue), β‐actin (red), P‐Smad3
   (green). E) Again, NOX4 in cardiac fibroblasts was detected. DAPI
   (blue), β‐Tubulin (red), NOX4 (green). F) A wound‐healing assay was
   performed to assess the proliferation and migration capabilities of
   PCFs. n = 3.ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^*** P < 0.001,
   ^**** P < 0.0001.

   The effects of inhibiting ferroptosis in MCPIP1‐deficient macrophages
   on fibroblast activation was also examined. IF results after co‐culture
   indicated that MCPIP1 ^mko BMDMs inhibited the activation of PCFs into
   myofibroblasts, as evidenced by decreased α‐SMA expression
   (Figure [141]10C). The TGF‐β/Smad3 signaling pathway within fibroblasts
   was suppressed, as shown by reduced nuclear translocation of P‐Smad3
   (Figure [142]10D), which is detrimental to collagen I (Col1) secretion.
   Oxidative stress within PCFs increased, as indicated by elevated NOX4
   expression (Figure [143]10E), and their migration and proliferation
   capabilities declined (Figure [144]10F). Treatment with Fer‐1 or PFT‐α
   reversed these adverse effects on PCFs (Figure [145]10C–F).

   These findings highlight the role of MCPIP1 in inhibiting ferroptosis
   through the regulation of P53 and the Xc^− system, thereby maintaining
   ferroptosis‐related gene expression and balancing macrophage
   polarization.

2.6. Splenectomy Alleviates Cardiac Damage Caused by MCPIP1 Deficiency

   The significant splenomegaly observed in MCPIP1 ^mko mice following MI
   is a critical phenomenon. Gross dissection revealed marked splenic
   enlargement in MCPIP1 ^mko mice (Figure [146]11A). In control mice,
   there was no significant difference in spleen‐to‐body weight ratio
   between the sham group (0.003740 ± 0.000356 g g^−1) and the MI‐28D
   group (0.003677 ± 0.000280 g g^−1) (Figure [147]11A). However, MCPIP1
   ^mko mice showed a substantial increase from the sham group (0.006394
   ± 0.000326 g g^−1) to the MI‐28D group (0.015898 ± 0.002947 g g^−1,
   P < 0.0001) (Figure [148]11B). H&E staining showed significant
   expansion of the red pulp structure and disrupted splenic architecture
   in MCPIP1 ^mko mice, indicating hypersplenism (Figure [149]11C).
   RNA‐seq revealed significant activation of hematopoietic cell lineage
   genes and signaling pathways in MCPIP1‐deficient BMDMs
   (Figure [150]11D). To validate whether splenic hematopoietic activity
   was activated, we measured the levels of Ki‐67, a critical marker for
   hematopoietic stem cell activation in the spleen (Figure [151]11E). WB
   results demonstrated a marked increase in Ki‐67 expression in the
   spleens of MCPIP1 ^mko mice following MI. Blood analysis revealed that
   MCPIP1 ^mko mice had higher absolute and percentage counts of
   circulating monocytes post‐MI‐28D, accompanied by a decrease in
   lymphocytes. There were no significant changes in total white blood
   cell (WBC) or red blood cell (RBC) counts (Figure [152]11F). These
   findings suggest a shift in hematopoietic lineage towards monocytes in
   MCPIP1 ^mko mice.

Figure 11.

   Figure 11
   [153]Open in a new tab

   Hyperactive Hematopoietic Function in MCPIP1 ^Mko Mice Spleen. A)
   Necropsy showed spleen size alterations post‐MI. B) Spleen‐to‐body
   weight ratio at different time points post‐MI (sham, 3, 7, 14, 28
   days). C) HE staining revealed histological changes in splenic
   architecture post‐MI. D) GSEA enrichment analysis of hematopoietic cell
   lineage‐associated genes using DEGs in BMDMs from MCPIP1 ^fl/fl and
   MCPIP1 ^mko mice. E) WB analysis of Ki67 protein levels in the spleen
   post‐MI. F) Complete blood cell counts in MCPIP1 ^fl/fl and MCPIP1 ^mko
   mice pre‐ and post‐MI. ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^***
   P < 0.001, ^**** P < 0.0001.

   To investigate whether the spleen mediates post‐myocardial infarction
   (MI) inflammatory regulation and monocyte proliferation, splenectomy
   was performed concomitantly with MI modeling. In MCPIP1 ^fl/fl mice,
   splenectomy (SE) did not significantly affect survival rates compared
   to non‐splenectomized (NSE) controls (Figure [154]12A). However, in
   MCPIP1 ^mko mice with MI, splenectomy significantly improved survival
   rates, delaying the time to death in the acute phase (5 days post‐MI)
   compared to NSE mice (Figure [155]12B). Although the rate of cardiac
   rupture was higher in the NSE group (85%) than in the SE group (20%),
   this difference was not statistically significant (P = 0.072)
   (Figure [156]12C). Regarding cardiac function 28 days post‐MI, SE
   MCPIP1 ^mko mice showed improvements in LVEF, FS, and LVEDV compared to
   NSE mice (Figure [157]12D,E). As for cardiac structure, HE revealed
   that splenectomy increased cardiac collagen content and reduced infarct
   size in MCPIP1 ^mko mice, whereas no significant difference was
   observed in left ventricular wall thickness (Figure [158]12F,H). The
   circulating monocytosis induced by MI in MCPIP1 ^mko mice was restored
   following splenectomy (Figure [159]12I). In addition to circulating
   monocytes, macrophages in the IBZ were also markedly reduced
   (Figure [160]12J). Due to the significant improvement in cardiac
   pumping function after splenectomy, the blood stasis in the heart,
   lungs, and liver of MCPIP1 ^mko mice also improved (Figure [161]12K).

Figure 12.

   Figure 12
   [162]Open in a new tab

   Splenectomy Exerts Protective Effects on Myocardial Infarction in
   MCPIP1 ^mko Mice. A) Survival curve analysis of MCPIP1 ^fl/fl mice. B)
   Survival curve analysis of MCPIP1 ^mko mice. C) Effects of splenectomy
   on the incidence of cardiac rupture in MCPIP1 ^mko mice. D)
   Echocardiographic images of MCPIP1 ^mko mice hearts 28 days
   post‐splenectomy combined with MI. E) The impact of splenectomy on
   cardiac function in MCPIP1 ^mko mice. Each group consists of at least 3
   mice. F) Masson's trichrome staining of hearts from MCPIP1 ^mko mice 28
   days post‐splenectomy combined with MI, to detect collagen content,
   infarction angle, and left ventricular thickness H). n = 5. I) Complete
   blood cell counts in MCPIP1 ^mko mice NSE and SE. J) The percentage of
   CD68+ cells/ total cell number (counted by nuclei) was calculated. DAPI
   (blue), CD68 (red), n = 5 per field of view. K) The influence of
   splenectomy on heart‐to‐body weight ratio, liver‐to‐body weight ratio,
   and lung‐to‐body weight ratio in MCPIP1 ^mko mice. Each group comprises
   at least 3 mice. ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^***
   P < 0.001, ^**** P < 0.0001.

3. Discussion

   After myocardial infarction, a controlled inflammatory response is
   essential for clearing necrotic tissue and cellular debris from the
   infarcted area.^[ [163]^32 ^] This response requires the coordinated
   action of multiple cell types and organs.^[ [164]^33 ^] Our research
   demonstrates that MCPIP1 plays a central role in regulating this
   process by modulating macrophage polarization, fibroblast activation,
   and splenic immune cell output. This multifaceted regulation highlights
   MCPIP1's critical function in balancing inflammation and repair after
   MI (Figure [165]13 ).

Figure 13.

   Figure 13
   [166]Open in a new tab

   Diagram of the Regulatory Mechanism of MCPIP1. Following the occurrence
   of MI, necrotic cardiomyocytes release inflammatory cytokines into the
   bloodstream, leading to the recruitment of macrophages. This intense
   inflammatory response, albeit short‐lived, not only stimulates
   hematopoiesis in the bone marrow but also in the spleen. Due to the
   deficiency of MCPIP1 in macrophages, a substantial number of
   macrophages recruited to the IBZ undergo ferroptosis, which potentiates
   the M1 phenotype while inhibiting the M2 phenotype. Persistent cardiac
   inflammation results in the expansion of the red pulp in the spleen and
   a continuous release of monocytes/macrophages into the circulation.
   Furthermore, the abundance of inflammatory mediators and the scarcity
   of TGF‐β in the IBZ hinder the activation of fibroblasts, rendering the
   repair of the ECM inefficient and slow. Collectively, these factors
   contribute to a severe decline in cardiac function, a marked increase
   in the rate of heart rupture, and an extremely low survival rate in
   MCPIP1 ^mko mice. Diagram was created in [167]https://BioRender.com.

3.1. MCPIP1 Facilitates Macrophage Transition from M1 to M2 Phenotype by
Inhibiting P53/Ferroptosis

   Ferroptosis is an iron‐dependent regulated cell death mechanism driven
   by lipid peroxide accumulation and redox imbalance, implicated in
   cardiovascular pathologies such as atherosclerosis, myocardial
   infarction, and cardiomyopathy. Our study reveals that MCPIP1 disrupts
   the pathogenic M1 macrophage‐ferroptosis cycle by degrading P53 to
   restore Xc⁻ system functionality and suppress ferroptosis.
   MCPIP1‐deficient macrophages exhibit elevated Ptgs2/Acsl4 mRNA levels
   and ROS accumulation, sustaining a self‐amplifying loop of lipid
   peroxidation and pro‐inflammatory cytokine production. Inhibition of
   ferroptosis (Fer‐1 or PFT‐α) restored Arg1 expression and enabled M2
   polarization in MCPIP1‐deficient macrophages, confirming ferroptosis
   suppression as essential for phenotype switching.

   Mechanistically, DAMPs activate macrophage P53 expression, which
   suppresses the Xc⁻ system to deplete GSH and induce ferroptosis. MCPIP1
   counteracts this process through P53 degradation, rebalancing redox
   homeostasis. While MCPIP1‐deficient macrophages readily adopt
   LPS‐induced M1 polarization, they resist IL‐10‐mediated M2 conversion.
   Crucially, P53/ferroptosis inhibition restores M2 transition capacity
   in these cells, a prerequisite for inflammation resolution and post‐MI
   tissue repair. These findings position MCPIP1 as a dual regulator of
   macrophage polarization and ferroptosis, offering therapeutic potential
   for modulating the inflammation‐ferroptosis axis in cardiovascular
   recovery.

3.2. MCPIP1 Regulates Fibroblast Activation Through the TGF‐β/Smad3 Pathway

   Macrophage‐cardiac fibroblast crosstalk critically influences
   post‐infarction cardiac remodeling. Impaired α‐SMA and collagen I
   secretion by fibroblasts compromise IBZ structural integrity,
   predisposing to left ventricular rupture. Prolonged inflammatory
   responses suppress fibroblast activation, enhance ECM degradation, and
   reduce collagen deposition, collectively weakening myocardial tensile
   strength. MCPIP1 deficiency exacerbates this pathology through
   diminished TGF‐β secretion from macrophages, impairing Smad3‐mediated
   fibroblast activation and collagen production. Masson's staining
   demonstrated significantly reduced collagen deposition in
   MCPIP1‐deficient mice hearts, correlating with elevated cardiac rupture
   incidence. MCPIP1 ^mko BMDMs fail to activate the TGF‐β/Smad3 pathway
   in fibroblasts, evidenced by reduced α‐SMA expression and suppressed
   P‐Smad3 nuclear translocation. Co‐culture experiments revealed dual
   defects: MCPIP1‐deficient BMDMs not only insufficiently stimulated
   cardiac fibroblasts but also upregulated fibroblast apoptosis genes.
   Ferroptosis inhibition (Fer‐1/PFT‐α) reversed these effects by
   restoring TGF‐β signaling, enhancing collagen synthesis, and reducing
   oxidative stress markers like NOX4.

   MCPIP1‐deficient macrophage accumulation in the IBZ, creating a vicious
   cycle of insufficient fibroblast activation, impaired ECM remodeling,
   and increased apoptosis susceptibility. Our data establish MCPIP1 as a
   master regulator bridging macrophage polarization and fibroblast
   functionality through TGF‐β/Smad3 activation. Therapeutic targeting of
   this axis may prevent cardiac rupture by promoting myofibroblast
   differentiation and collagen matrix stabilization.

3.3. MCPIP1 Regulates the Cardiosplenic Axis by Controlling Splenic
Macrophage Output

   The spleen orchestrates systemic cardiac inflammation through the
   cardiosplenic axis, mediating crosstalk via immune cell trafficking,
   neural signaling, and cytokine release. Beyond its hematopoietic
   functions, the spleen serves as a key reservoir for extramedullary
   monocyte/macrophage production, particularly within the red pulp.
   Post‐MI, sympathetic activation mobilizes splenic
   monocytes/macrophages, which infiltrate the IBZ. Our findings identify
   MCPIP1 as a central regulator of cardiosplenic axis, curbing splenic
   hyperactivity. MCPIP1‐deficient mice developed hypersplenism,
   exhibiting 4‐fold spleen weight increases 28 days post‐MI, with red
   pulp expansion and reduced white pulp areas. This correlated with
   systemic monocytosis, lymphocytopenia, and chemokine pathway activation
   via GSEA analysis. Splenic overactivity in MCPIP1 ^mko mice drove
   continuous monocyte/macrophage release into circulation, with these
   cells preferentially adopting pro‐inflammatory M1 polarization in the
   IBZ. Splenectomy reversed this pathology, reducing infarct size,
   improving survival, and preserving cardiac function—particularly in
   MCPIP1 ^mko mice. The intervention attenuated inflammatory macrophage
   influx, mitigating border zone inflammation critical for determining
   final infarct dimensions.

   MCPIP1 loss disrupts homeostatic control of splenic hematopoiesis,
   enabling unchecked monocyte production and chemotaxis toward
   infarct‐associated chemokines. Persistent M1 polarization of
   splenic‐derived macrophages exacerbates myocardial damage by sustaining
   inflammatory cascades. These results highlight the spleen's dual role
   as both a source of reparative cells and a driver of maladaptive
   inflammation post‐MI, contingent on MCPIP1‐mediated regulation.
   Clinically, these findings suggest two translational avenues: 1)
   Assessing MCPIP1 expression in circulating macrophages as a biomarker
   of cardiosplenic axis dysregulation post‐MI, and 2) Developing
   therapies targeting splenic macrophage output to modulate infarct zone
   inflammation. Strategic modulation of this axis could complement
   existing interventions by balancing immune‐driven repair and
   destructive inflammation during cardiac recovery.

4. Conclusion

   Our study has uncovered several pivotal insights that position MCPIP1
   as a crucial regulator in the inflammatory and reparative processes
   following myocardial infarction. Firstly, MCPIP1 enables the transition
   of macrophages from the pro‐inflammatory M1 phenotype to the reparative
   M2 phenotype by inhibiting the P53/ferroptosis signaling pathway.
   Secondly, within the IBZ microenvironment, MCPIP1 enhances the
   secretion of TGF‐β by macrophages, which in turn activates fibroblasts
   into myofibroblasts. Lastly, MCPIP1 plays a critical role in regulating
   splenic monocyte output following MI. Collectively, these findings
   underscore MCPIP1 as a promising therapeutic target for future
   strategies aimed at mitigating inflammation, promoting tissue repair,
   and improving cardiac function following MI. Targeting MCPIP1 could
   provide a novel approach to modulate macrophage polarization,
   fibroblast activation, and splenic immune cell output, thereby
   enhancing the overall recovery and prognosis in patients with
   myocardial infarction.

5. Limitations and Future Directions

   A significant limitation of this study is the lack of a targeted
   delivery system for ferroptosis inhibitors and p53 inhibitors
   specifically to macrophages in mice. This gap precluded the inclusion
   of relevant animal experiments that could have further validated our
   findings. The development of effective macrophage‐specific delivery
   strategies is therefore a crucial direction for future research.

   Several potential approaches could address this challenge. For
   instance, nanoparticle‐based delivery systems, antibody‐drug
   conjugates, and gene‐editing technologies all hold promise as
   innovative solutions to enhance precision and therapeutic translation.
   Advancing these targeted delivery systems will not only provide more
   comprehensive validation of our findings but also lay the groundwork
   for clinically viable interventions targeting macrophage polarization
   and ferroptosis in the context of myocardial infarction.

6. Experimental Section

Data Source and Processing

   Gene Expression Omnibus (GEO) database provides datasets including
   [168]GSE166780 (comparing peripheral blood monocytes from acute
   myocardial infarction [AMI] patients versus healthy individuals),
   [169]GSE172270 (comparing monocyte‐derived macrophages from AMI
   patients versus healthy individuals), and [170]GSE268352 (comparing
   lipopolysaccharide [LPS]‐treated versus phosphate‐buffered saline
   [PBS]‐treated human monocyte‐derived macrophages). Differentially
   expressed genes across these datasets were analyzed using R software
   (version 4.4.2). Further Gene Ontology (GO) and Kyoto Encyclopedia of
   Genes and Genomes (KEGG) analyses were conducted on these DEGs.
   [171]GSE88924 dataset from GEO was also analyzed using Short
   Time‐series Expression Miner (STEM) analysis to investigate the trend
   of gene expression of cardiac macrophages, following the time sequence
   of MI1D‐MI7D‐MI14D. Genes lacking significant temporal expression
   gradients were excluded, and the remains were categorized into
   different modules. False Discovery Rate with adjusted p‐value <0.05 was
   considered statistically significant.

Mice

   The C57BL/6 MCPIP1^fl/fl and C57BL/6 LysM‐Cre mice have been previously
   characterized. These mice were reared under pathogen‐free conditions at
   the animal facilities of Tongji Medical College. Animal experiments
   were conducted according to the Chinese National Institutes of Health
   and Animal Care guidelines and were approved by the Animal Care Ethics
   Committee of Shanghai Tenth People's Hospital of Tongji University
   School of Medicine (approval number: SHDSYY‐2022‐4303). LysM‐Cre mice
   were crossed with MCPIP1^fl/fl mice to generate myeloid‐specific MCPIP1
   knockout mice, with co‐housed MCPIP1^fl/fl mice serving as controls.^[
   [172]^34 ^] For simplicity, these knockout mice
   (MCPIP1^fl/fl‐LysM‐Cre+) are referred to as MCPIP1 ^mko mice hereafter.
   The following primer sequences were used for genotyping via tail
   biopsy: floxp (forward primer: CAGGTATGTTGCAAATGGCCCGAC; reverse
   primer: CTGTAGGACTCAGCCCATGGCC) and LysM‐Cre (forward primer:
   CCCAGAAATGCCAGATTACG; reverseprimer: CTTGGGCTGCCAGAATTTC‐TC).

MI Model

   The MI model was established following a previously described
   protocol.^[ [173]^35 ^] Briefly, weight‐matched male mice (6 weeks old)
   were anesthetized and intubated. A skin incision was made on the left
   side between the third and fourth intercostal spaces, and the muscle
   and pericardium were separated to expose the left anterior descending
   (LAD) artery. The LAD was ligated using a 7‐0 silk suture, and the
   chest was then sutured. Sham‐operated mice underwent the same procedure
   without LAD ligation. Heart tissues were collected for further
   experiments.

Splenectomy

   Splenectomy was performed in anesthetized male mice by making a small
   abdominal incision, isolating the spleen, severing and ligating its
   vessels and ligaments before the organ removal. Hemostasis was ensured
   to control bleeding, and postoperative care was provided to monitor for
   complications and support recovery.

Echocardiography

   Echocardiography evaluated the mice's cardiac function at 10 weeks
   post‐surgery using the Vevo 2100 system equipped with an 18–30 MHz
   transducer. Mice were anesthetized with 1%–2% isoflurane, and left
   ventricle's parasternal long axis and mid‐papillary muscle short axis
   were recorded for five cardiac cycles. A blinded operator measured left
   ventricular ejection fraction (LVEF), fractional shortening (FS), and
   left ventricular end‐diastolic volume (LVEDV).

Masson Trichrome and H&E Staining

   On day 28 post‐MI, heart tissues from 1 mm below the ligation to the
   apex were paraffin‐embedded. Heart sections were stained with Masson
   Trichrome and Hematoxylin and Eosin (H&E) to visualize infarcted areas.
   Images were captured using an Olympus microscope, and infarct size was
   calculated using ImageJ software.

BMDMs Preparation

   Bone marrow‐derived macrophages (BMDMs) were isolated from the femurs
   and tibias of female mice (≈6 weeks old) as previously described. These
   cells were differentiated in DMEM supplemented with 10% fetal bovine
   serum (FBS) and 20 ng mL^−1 of MCSF.

Primary Cardiac Fibroblasts Isolation

   Neonatal mouse hearts were dissected, minced, and digested with
   collagenase II for four 10‐min intervals. The cells were centrifuged
   and filtered through a 70 µm filter. After plating on 6‐cm dishes for
   an hour, adherent cells were cultured in DMEM containing 20% FBS in a
   humidified incubator at 37^ °C and 5% CO₂.

RNA‐Seq

   RNA was extracted using TRIzol and sequenced on an Illumina HiSeqTM
   2500. Differentially expressed genes (DEGs) were analyzed using the
   limma R package, with |Log2 fold change| >1.5 and p‐value <0.05 as
   threshold. Volcano plots were generated to visualize DEG distribution,
   and heatmap were used to display specific DEGs. KEGG pathway enrichment
   analysis was performed to identify enriched biological pathways.

Immunofluorescence Staining (IF)

   Tissues and cells were fixed and permeabilized with 4% paraformaldehyde
   and 0.1% Triton X‐100 for 10 min at 4^ °C. After blocking with 5% BSA
   for 30 min, samples were incubated with primary antibodies overnight at
   4^ °C, followed by Alexa Fluor 488/594‐conjugated secondary antibodies
   for 1 h at room temperature. Nuclei were stained with DAPI, and images
   were captured using fluorescence microscopy. Positive cells and mean
   fluorescence intensity were quantified in randomly selected fields
   using ImageJ software (version 2.0.0‐RC).

RNA Isolation and Quantitative Real‐Time Polymerase Chain Reaction

   RNA was extracted from heart tissue homogenates and cells using TRIzol
   reagent. The reverse transcription was performed using the PrimeScript
   RT Reagent Kit. Quantitative real‐time PCR (qRT‐PCR) was conducted
   using Hieff qPCR SYBR Green Master Mix on a LightCycler 480 Real‐time
   PCR System (Roche), following the manufacturer's instructions. Relative
   gene expression was calculated by the 2‐ΔΔCt method, normalized to
   GAPDH expression.

Western Blot (WB)

   Proteins were extracted from cells using RIPA buffer, and
   concentrations were measured with a BCA protein assay kit. Samples were
   then resolved by SDS‐PAGE and transferred onto a PVDF membrane
   (Millipore). After blocking with 5% nonfat milk containing 0.1%
   Phosphate‐Buffered Saline with Tween‐20 (PBST) for 1 h at room
   temperature, membranes were incubated with primary antibodies overnight
   at 4^ °C. Following PBST washes, membranes were incubated with the
   appropriate secondary antibody, and signals were detected using ECL
   Western Blotting Detection Reagent.

Statistical Analysis

   Data are presented as means ± standard deviations. Normality was
   assessed using the Shapiro‐Wilk test. For two‐groups comparisons, a
   two‐tailed Student's t‐test was used if data were normally distributed;
   otherwise, a Mann‐Whitney U test was applied. For three or more groups,
   a one‐way ANOVA followed by the Bonferroni post hoc test was used for
   normally distributed data; otherwise, a Kruskal‐Wallis test with the
   Dunn post hoc test was applied. Survival rate changes were analyzed
   using the Kaplan–Meier method and log‐rank test. GraphPad Prism 7.0 and
   SPSS 20.0 were used for all statistical analyses. A two‐sided P value
   <0.05 (ns P > 0.05, ^* P < 0.05, ^** P < 0.01, ^*** P < 0.001, ^****
   P < 0.0001) indicates statistical significance.

Conflict of Interest

   The authors declare no conflict of interest.

Acknowledgements