Abstract

   Mesenchymal stem/stromal cells (MSCs) are integral components of the
   tumor microenvironment and critical for the colonization of
   disseminated cancer cells; specifically, stem cell antigen (Sca-1) is
   recognized as a surface marker of MSCs. In this study, we found that
   MSCs highly expressing Sca-1 are positively associated with lung
   metastasis. MSCs derived from the lungs of mice bearing metastasized
   breast tumors (LMSCs) exhibited higher level of Sca-1 compared to those
   with adenoma. When co-injected with 4T1 cells intravenously, Sca-1^high
   LMSCs resulted in more tumor nodules in lung tissue than Sca-1^low
   LMSCs. Furthermore, Sca-1^high LMSCs expressed higher levels of CCL2,
   CCL7, and CXCL1 than Sca-1^low LMSCs. Sca-1^high LMSCs can directly
   recruit 4T1 cells through producing CXCL1. Additionally, Sca-1^high
   LMSCs are highly potent in recruiting immune cells of the myeloid
   lineage (neutrophils and macrophages) to the lungs. Inhibition of
   macrophage chemotaxis by Bindarit, an inhibitor of CCL2/7/8
   transcription, decreased the lung tumor burden induced by Sca-1^high
   MSCs. Using Ccr5^−/− mice, it was further confirmed that Sca-1^high
   LMSCs promote tumorigenesis by recruiting macrophages, further
   supporting that the increased recruitment of macrophages mediates the
   pro-metastasis effect of Sca-1^high LMSCs. Collectively, this study
   demonstrated that Sca-1^high LMSCs and their effectors could be
   targeted to inhibit breast cancer metastasis to the lung.

   Subject terms: Mesenchymal stem cells, Cancer microenvironment

Introduction

   Mesenchymal cells, derived from mesoderm or ectoderm, are primarily
   recognized for their roles in providing structural support to organs,
   synthesizing and remodeling the extracellular matrix (ECM), and
   regulating development, homeostasis, and tissue repair. Mesenchymal
   stem cells (MSCs), also known as mesenchymal stromal cells, exist in
   many tissues and are known to actively migrate to site of tissue
   injury, where they participate in wound repair [[50]1, [51]2]. As stem
   cells, MSCs possess the potential for multi-directional
   differentiation, including adipogenesis, osteogenesis, and
   chondrogenesis. Additionally, their immunoregulatory function has
   gained recognition in recent years. MSCs licensed by IFN-γ, plus any
   one of TNF-α, IL-1α, or IL-1β in the inflammatory environment, acquire
   the immunosuppressive function. Consequently, they upregulate
   chemokines and effectors to modulate immune cells-induced inflammation
   response and promote tissue repair [[52]3, [53]4].

   Stem cell antigen (Sca-1) expression is mainly on mesoderm-derived
   cells, although it is not restricted to the stem cell/progenitor cell
   population. Several surface markers have been utilized to identify
   mouse MSCs, with Sca-1 being one of the most common. Sca-1 and Sca-2
   are members of Ly-6 family of interferon-inducible lymphocyte
   activation proteins, encoded by genes located on mouse chromosome 15.
   Sca-1 is an 18 kDa mouse glycosyphosphatidylinositol (GPI)-linked cell
   surface protein and is also known as Ly6A/E encodes by the
   strain-specific Ly6a/e gene. When present on the cell membrane, Sca-1
   is associated with protein tyrosine kinases and lipid rafts, suggesting
   its potential involvement in signal transduction. Although the syntenic
   region of the Sca-1 gene is found on human chromosome 8, it does not
   seem to encode a functional equivalent of the mouse Sca-1. The human
   counterpart remains elusive. Interestingly, a population of
   Sca-1^+-like cells was isolated from the adult human heart with an
   anti-mouse Sca-1 antibody [[54]5], indicating a human ortholog or
   related protein may exist in humans.

   Tumors are often regarded as “wounds that never heal”, with metastatic
   dissemination representing the final stage of a deteriorating process.
   These ectopic sites, known as metastatic niches, provide activated
   harbors for tumor cells, driving their colonization and proliferation.
   In recent years, evidence has emerged suggesting that primary tumors
   prime certain cells for tumor cell engraftment, with bone
   marrow-derived cell clusters (BMDCs) in the ‘pre-metastatic
   microenvironment’ creating a conducive environment for tumor cell
   adhesion and invasion. The pre-metastatic microenvironment, also termed
   the ‘pre-metastatic niche’ (PMNs), refers to microenvironments in
   distant organs that are capable of supporting the survival and
   outgrowth of tumor cells before their arrival at these sites. BMDCs
   play vital role in the formation of pre-metastatic niche. Macrophages,
   as key determinants for the formation of PMNs, are mobilized to the
   bloodstream and subsequently clustered in pre-metastatic sites by
   various tumor-secreted factors, such as CCL2, CFS-1, VEGF, PLGF, TNF-α,
   TGF-β, tissue inhibitor of metallopeptidase-1 (TIMP-1), and exosomes
   [[55]6].

   We previously reported that LMSCs play a critical role in establishing
   PMNs and metastatic niches for breast cancer cells [[56]7]. In this
   study, we demonstrate that along with the development of breast cancer,
   Sca-1 expression is increased in LMSCs. Sca-1^high LMSCs could
   effectively promote the colonization of tumor cells in the lung.
   Sca-1^high LMSCs can directly increase tumor cell migration through the
   secretion of chemokines such as CXCL1. Furthermore, the presence of
   macrophages increases in tumors following the co-injection of 4T1 and
   Sca-1^high LMSCs compared to 4T1 and Sca-1^low LMSCs. Inhibiting
   macrophage infiltration in mice co-injected with 4T1 and Sca-1^high
   LMSCs reduces tumor nodules to corresponding control level. Taken
   together, Sca-1^high LMSCs promote tumor metastasis by recruiting tumor
   cells and increasing macrophage infiltration through the secretion of
   chemokines.

Results

Tumor-associated LMSCs highly express Sca-1

   In our previous study, we discovered the involvement of LMSCs in the
   establishment of metastatic niches for breast cancer cells [[57]7]. By
   analyzing RNA-seq datasets generated previously ([58]GSE125591), we
   found numerous differentially expressed genes in LMSCs derived from
   MMTV-PyMT mice at different stages of tumor development. Notably, Sca-1
   (Ly6a/e), a hallmark of MSCs, showed elevated expression in LMSCs from
   the metastasis stage compared to the adenoma stage (Fig. [59]1A).
   Furthermore, analysis of the TCGA BRCA breast cancer cohort revealed a
   significantly higher expression level of LY6E in breast tumor patients
   compared to healthy individuals, especially in basal subtype of BRCA.
   Moreover, metastatic samples showed a trend towards an increased
   expression of LY6E, although the differences did not reach statistical
   significance (Fig. [60]1B). To corroborate these findings, we measured
   the Sca-1 protein level in wild-type (WT) LMSCs and MMTV-PyMT LMSCS
   using flow cytometry. Consistently, MMTV-PyMT LMSCs exhibited higher
   fluorescence intensity, indicating elevated Sca-1 expression (Fig.
   [61]1C). Additionally, we assessed Sca-1 expression levels in LMSCs
   derived from different metastatic stages, finding that LMSCs from
   metastatic stages displayed higher fluorescence intensity compared to
   those from the adenoma stage (Fig. [62]1D). These observations suggest
   that Sca-1 may define a subset of tumor-associated MSCs that promote
   metastasis. To investigate whether the altered Sca-1 expression is
   influenced by tumor cells, we cultured wild-type (WT) LSMCs with
   conditioned medium containing 4T1 cell culture supernatant. As
   expected, the 4T1-conditioned medium significantly increased Sca-1
   expression on LMSCs (Fig. [63]1E). Western blotting analysis further
   confirmed the elevated expression of Sca-1 in tumor-associated LMSCs.
   Taken together, these findings indicate that breast cancer-associated
   LMSCs are heterogeneous, and Sca-1 expression is associated with the
   emergence of a subset of pro-metastatic LMSCs.

Fig. 1. Tumor associated LMSCs show higher expression of Sca-1.

   [64]Fig. 1
   [65]Open in a new tab

   A RNA sequencing analysis of LMSCs derived from MMTV-PyMT mice at
   adenomatous and metastatic stages (n = 3). B Viloin plots showing LY6E
   expression in TCGA BRCA samples (n = 1247) based on subtype (left) or
   tumor type (right). Single values are shown as dots. C Comparison of
   Sca-1 expression level in LMSCs derived from FVB mice and MMTV-PyMT
   mice, respectively (n = 3). D Comparison of Sca-1 expression level in
   LMSCs derived from MMTV-PyMT mice at adenoma and metastatic stages
   (n = 3). E Comparison of Sca-1 expression level in LMSCs cultured with
   normal medium and 4T1 cells-derived supernatant, respectively (n = 3).
   F Lung mesenchymal stem cells (LMSCs) derived from FVB or MMTV-PyMT
   mice were collected for immunoblot analysis. G Western blot analysis of
   LMSCs derived from adenoma and metastatic MMTV mice. H Lung mesenchymal
   stem cells treated with or without 4T1 supernatant were analyzed by
   Western blot. Data are mean ± SEM of biologically independent samples.
   Statistical analysis was determined by one-tailed unpaired t test (C–E)
   or one-way ANOVA (B). *p < 0.05, **p < 0.01.

Sca-1^high LMSCs promote breast cancer lung metastasis

   While we observed differential Sca-1 expression in LMSCs, it remained
   unclear whether this expression level was associated with
   metastasis-promoting properties. To address this, we enriched Sca-1^low
   LMSCs and Sca-1^high LMSCs using magnetic-activated cell sorting (MACS)
   (Fig. [66]2A). To assess the impact of Sca-1 expression levels on tumor
   metastasis, we established a mouse model of breast cancer lung
   colonization. In this model, 4T1 cells were co-injected with either
   Sca-1^low or Sca-1^high LMSCs into Balb/c mice via intravenous
   injection. Mice injected with 4T1 and Sca-1^low LMSCs experienced
   weight loss, while those injected with 4T1 mixed with Sca-1^high LMSCs
   exhibited significant weight loss, ~33% greater than the 4T1-only group
   (Fig. [67]2B). Weight loss is closely associated with cancer
   progression and is a common side effect experienced by cancer patients
   [[68]8]. More importantly, mice injected with 4T1 admixed with
   Sca-1^high LMSCs exhibited shorter survival than those receiving 4T1
   alone or 4T1 admixed with Sca-1^low LMSCs (Fig. [69]2C). Additionally,
   we quantified lung metastatic nodule formation. Consistently, Sca-1^low
   LMSCs promoted the formation of lung metastatic nodules compared to the
   4T1-only group (Fig. [70]2D). Intriguingly, Sca-1^high LMSCs led to
   even larger metastatic nodules than Sca-1^low LMSCs (Fig. [71]2D).
   Moreover, the number of lung nodules was also quantified, revealing
   that co-administration of 4T1 cells with Sca-1^high LMSCs resulted in a
   greater number of lung nodules compared to the other groups (Fig.
   [72]2E). In conclusion, our findings suggest that Sca-1 expression
   facilitates breast cancer lung metastasis, with Sca-1^high LMSCs
   exhibiting a stronger capacity to support lung metastasis than
   Sca-1^low LMSCs.

Fig. 2. Sca-1^high LMSCs are more potent in promoting 4T1 tumor cell
colonization in lung.

   [73]Fig. 2
   [74]Open in a new tab

   A Identification of sorted Sca-1^low and Sca-1^high LMSCs (n = 3). B, C
   Body weights (n = 4 or 5) and survival rate (n = 7 or 8) of mice 2
   weeks after co-injection of 4T1 tumor cells and Sca-1^low or Sca-1^high
   LMSCs, respectively. D, E Nodules of 4T1 colonization in lungs were
   stained by Bouin’s solution (n = 4 or 5). Data are mean ± SEM of
   biologically independent samples. Statistical analysis was determined
   by one-tailed unpaired t test (A) and one-way ANOVA with Bonferroni’s
   multiple comparisons test (B, D). *p < 0.05, **p < 0.01, ***p < 0.001.

Sca-1^high LMSCs recruit tumor cells via CXCL1

   To understand a possible association between Sca-1 and TME, we
   performed differential expression analysis between two cohorts of
   breast cancer samples (TCGA) with high or low levels of LY6E (Fig.
   [75]3A). The genes enriched in LY6E^high tumors were strongly and
   significantly associated with chemokine signaling (Fig. [76]3B),
   consistent with previous reports [[77]9]. We aimed to investigate
   whether Sca-1 modulates the expression of key cytokines to promote
   tumor metastasis. To address this, we conducted gene expression
   profiling of Sca-1^low and Sca-1^high LMSCs. Interestingly, our
   chemokine qPCR-array revealed significantly elevated levels of CCL2,
   CCL7, and CXCL1 in Sca-1^low LMSCs (Fig. [78]3C). Furthermore, these
   cytokines were further upregulated in Sca-1^high LMSCs (Fig. [79]3C).
   To further explore whether LMSCs could recruit 4T1 cells to the lungs
   via secreted cytokines, we examined the expression of their receptors
   on the 4T1 cell line. Our results showed low but detectable levels of
   CCR2, CCR3, and CXCR2, which are the classical receptors for CCL2
   (CCR2), CCL7 (CCR1, CCR2, CCR3), and CXCL1 (CXCR2), respectively (Fig.
   [80]3D). Subsequently, we utilized a trans-well system to co-cultured
   the 4T1 cell line with supernatant from Sca-1^low or Sca-1^high LMSCs,
   respectively. Surprisingly, crystal violet staining results suggested
   that 4T1 cells migrated to the lower chamber, with significantly more
   4T1 cells observed in the Sca-1^high LMSCs treated group (Fig.
   [81]3E-F). To ascertain which factor mediates the recruitment of 4T1
   cells, we added Bindarit (a selective inhibitor of the monocyte
   chemotactic proteins CCL2, CCL7, and CCL8 by inhibiting gene
   transcription), CCL2 antibody, and CXCL1 antibody into the 4T1 culture
   medium separately. We found a notable reduction in 4T1 cells migration
   when Sca-1^high LMSCs supernatant was supplemented with the CXCL1
   antibody (Fig. [82]3G, H). Taken together, these findings demonstrate
   that Sca-1^high LMSCs can recruit 4T1 cells directly through the
   chemokine-receptor interaction, specifically via CXCL1.

Fig. 3. Sca-1^high LMSCs promote 4T1 cell migration through CXCL1.

   [83]Fig. 3
   [84]Open in a new tab

   A Volcano plot showing genes enriched in LY6E^high or LY6E^low samples
   from TCGA BRCA cohort. Genes from Reactome pathway “Chemokine receptors
   bind chemokines” are highlighted. B GSEA Reactome enrichment analysis
   of genes enriched in LY6E^high samples from (A). Inflammation-related
   pathways are in black, and other pathways are in gray. C Expression
   levels of different genes associated with cytokines in Sca-1^low and
   Sca-1^high LMSCs were determined by real-time PCR (n = 3). D Expression
   levels of chemokine receptors on the 4T1 cells were also detected by
   real-time PCR (n = 3). E, F Transferred 4T1 cells cultured with
   Sca-1^low and Sca-1^high LMSCs supernatant separately were analyzed by
   crystal violet staining (n = 3). Scale bar = 500 μm. G, H Sca-1^high
   LMSCs supernatant was treated with Bindarit, CCL2 antibody, or CXCL1
   antibody, respectively, and then employed to culture 4T1 cells (n = 3).
   The migrated 4T1 cells were stained by crystal violet. Scale
   bar = 500 μm. Data are mean ± SEM of biologically independent samples.
   Statistical analysis was determined by one-tailed unpaired t test (A,
   D) and one-way ANOVA with Bonferroni’s multiple comparisons test (F).
   *p < 0.05, ****p < 0.0001.

Sca-1^high LMSCs promote infiltration of myeloid immune cells in metastatic
lung tissue

   It has been well-established that immune cells play a crucial role in
   tumor metastasis [[85]7, [86]10]. Building on our previous findings,
   which showed that Sca-1^high LMSCs exhibited high expression of CCL2 (a
   classical chemokine for macrophage recruitment) and CXCL1 (a ligand for
   CXCR2), and considering the known expression of CXCR2 in neutrophils
   [[87]11], we investigated whether Sca-1^high LMSCs promote neutrophil
   accumulation in lung tissue. Using a defined gating strategy (Fig.
   [88]4A), we analyzed immune cell infiltration in the lung following
   tumor metastasis. Remarkably, we observed increased accumulation of
   CD11b^+ F4/80^+ cells in the lung tissue of mice co-injected with 4T1
   cells and Sca-1^low LMSCs. Moreover, the administration of Sca-1^high
   LMSCs further augmented the recruitment of CD11b^+ F4/80^+ cells into
   the lung compared to Sca-1^low LMSCs (Fig. [89]4B, C). Additionally,
   the accumulation of CD11b^+ Ly6G^+ cells in the lungs was also elevated
   in mice injected with 4T1 cells and Sca-1^high LMSCs compared to those
   co-injected with Sca-1^low LMSCs (Fig. [90]4D, E). These findings
   suggest that Sca-1^high LMSCs are more potent in promoting neutrophil
   and macrophage infiltration into metastatic niches.

Fig. 4. Co-injection of 4T1 and Sca-1^high LMSCs facilitate the recruitment
of neutrophils and macrophages.

   [91]Fig. 4
   [92]Open in a new tab

   A The immune cells in mice blood were analyzed by flow cytometry, the
   gating strategy of flow cytometry is shown. B, C CD11b^+ F4/80^+ cells
   were further increased after co-injection of 4T1 and Sca-1^high LMSCs
   compared with Sca-1^low LMSCs (n = 5). D, E CD11b^+ Ly6G^+ cells were
   also further elevated in tumor-bearing mice after injection of
   Sca-1^high LMSCs (n = 5). Data are mean ± SEM of biologically
   independent samples. Statistical analysis was determined by one-way
   ANOVA with Tukey’s multiple comparisons test. *p < 0.05, **p < 0.01,
   ***p < 0.001.

Macrophage infiltration blockage abolishes the pro-metastatic effect of
Sca-1^high LMSCs

   CCR2 and CCR5 are highly expressed in macrophages, which can be
   recruited by chemokines such as CCL2, CCL5, and CCL7. To investigate
   the correlation between CCL2/7/8 levels and Sca-1 expression levels, we
   analyzed TCGA BRCA data and saw a positive correlation between CCL2/7/8
   or CXCL1 expression level and LY6E expression in cancer tissues (Fig.
   [93]5A). To further explore the critical role of macrophages in
   mediating the pro-metastasis effects of Sca-1^high LMSCs, we used
   Bindarit to inhibit the production of monocyte chemotactic proteins
   CCL2/7/8, thereby blocking the macrophage recruitment. After
   co-injecting 4T1 cells with Sca-1^high LMSCs, mice were administered
   Bindarit (10 mg/kg) intraperitoneally 3 times (Fig. [94]5B) and
   sacrificed 2 weeks later. Notably, Sca-1^high LMSC-driven lung
   metastasis was significantly reduced following Bindarit intervention
   (Fig. [95]5C). Moreover, following Bindarit treatment, Sca-1^high LMSCs
   were less effective in promoting lung colonization (Fig. [96]5D).
   Further analysis of the TCGA BRCA data revealed a positive correlation
   between CCL5 and LY6E level in cancer tissues (Fig. [97]5E).
   Furthermore, we observed a positive correlation between LY6E expression
   and predicted proportion of macrophages in TCGA BRCA tumors by using
   xCell deconvolution algorithm [[98]12] (Fig. [99]5F). To further
   confirm a critical role of macrophages in mediating the
   metastasis-promoting effect of Sca-1^high LMSCs, CCR5-deficient
   (Ccr5^−/−) mice were employed. Since CCR5 is predominantly expressed on
   monocyte/macrophages, its deficiency inhibits macrophage chemotaxis. As
   expected, Ccr5^−/− mice exhibited reduced lung nodule formation
   compared to WT mice. More importantly, Sca-1^high LMSCs failed to
   promoting tumor growth when co-injected with AT-3 cells in Ccr5^−/−
   mice (Fig. [100]5G, H). Collectively, these results demonstrate that
   macrophages play a pivotal role in mediating the metastasis-promoting
   effect of Sca-1^high LMSCs.

Fig. 5. The blockade of macrophage infiltration abolished the tumor promotion
potential of Sca-1^high LMSCs.

   [101]Fig. 5
   [102]Open in a new tab

   A Correlation between LY6E and CCL2/7/8 or CXCL1 expression levels in
   breast cancer tissues from TCGA BRCA. B Schematic illustration of
   blockade of macrophages infiltration after co-injection of 4T1 and
   LMSCs. C, D Lung nodules in mice treated by tumor cells and LMSCs were
   stained by Bouin’s solution (n = 5 or 6). E Correlation between LY6E
   and CCl5 expression levels in breast cancer tissues from TCGA BRCA. F
   Correlation between LY6E expression and predicted proportion of
   macrophages in breast cancer tissues from TCGA BRCA using xCell
   algorithm. G, H Wild type or Ccr5^−/− mice were treated by AT-3 and
   LMSCs injection (n = 4 or 5). The colonization of AT-3 cells in lungs
   was analyzed by Bouin’s staining. Data are mean ± SEM of biologically
   independent samples. Statistical analysis was determined by one-way
   ANOVA with Tukey’s multiple comparisons test (D), two-way ANOVA with
   Tukey’s multiple comparisons test (H). *p < 0.05, **p < 0.01,
   ***p < 0.001, ****p < 0.0001.

Discussion

   MSCs exhibit high heterogeneity in their developmental lineages, stages
   of differentiation, and functional specializations. Tumor-associated
   MSCs likely consist of functionally distinct subsets. Our study shows
   that Sca-1 expression is higher in LMSCs at the metastatic stage
   compared to those in the pre-metastatic niche and is positively
   correlated with the expression of chemokines, including CCL2, CCL7, and
   CXCL1, that recruit myeloid cells. Consistently, macrophages were
   increasingly accumulated in lung tissue following co-injection of
   Sca-1^high LMSCs with 4T1 cells. In addition, CXCL1 directly mediated
   the migration of 4T1 cells. Thus, Sca-1^high MSCs promote breast cancer
   lung metastasis by recruiting both macrophages and cancer cells (Fig.
   [103]6). These findings provide valuable insight into the complex
   interplay between LMSCs, chemokines, immune cells, and tumor cells in
   the metastatic cascade of breast cancer to the lungs.

Fig. 6. Schematic graph of pro-metastatic effect of Sca1^high LMSCs.

   Fig. 6
   [104]Open in a new tab

   Sca1^high LMSCs facilitate lung metastasis of breast tumor cells
   through the secretion of CXCL1 and CCL2/7. Compared with Sca1^low
   LMSCs, Sca1^high LMSCs exhibit elevated levels of CXCL1, attracting
   breast tumor cells directly. Meanwhile, CCL2/7 are also highly
   expressed in Sca1^high LMSCs, thus recruiting more macrophages into the
   lung tissue. Diagram created with BioRender.com.

   Tumors have often been described as ‘wounds that never heal’, as
   tumorigenesis is closely linked to chronic inflammation. This
   inflammatory microenvironment drives the recruitment of various
   responsive cell types, including macrophages, myeloid-derived
   suppressor cells, and MSCs [[105]13, [106]14]. MSCs have been
   implicated in promoting tumor growth and metastasis across multiple
   cancer types [[107]15–[108]22]. Importantly, a growing body of research
   highlights the heterogeneous nature of MSCs [[109]23–[110]25]. Indeed,
   we recently demonstrated functional differences among LMSCs at various
   stages of breast cancer development [[111]7]. Notably, metastatic LMSCs
   exhibited upregulated complement C3 expression when stimulated with Th2
   cytokines, which led to increased neutrophil recruitment to
   pre-metastatic sites, promoting tumor metastasis. Consistent with these
   findings, our study also revealed elevated expression of Sca-1 along
   with the progression of breast cancer lung metastasis. Considering that
   Sca-1^high LMSCs promote lung metastasis of breast cancer by recruiting
   myeloid cells, which generally facilitate tumor colonization and
   growth, Sca-1^high LMSCs may also promote tumor metastasis to other
   organs. Further investigation is warranted to this possibility and to
   elucidate the key factors that drive Sca-1 expression in LMSCs.

   Sca-1 expression is highly dynamic across various tissues, and its
   proper regulation is essential for tissue development and homeostasis.
   Despite its recognized importance, the biology of Sca-1 remains
   partially understood. Sca-1 functions as a co-regulator in lipid raft
   signaling, influencing stem cell fate [[112]26] and acting as a
   cell-surface signaling protein and adhesion molecule [[113]27]. It also
   plays a role in cell differentiation and signaling, modulating key
   pathways such as TGF-β [[114]28, [115]29], ERK, and PI3K [[116]30].
   Sca-1 deficiency has been linked to increased fibrosis during tissue
   regeneration due to reduced MMP activity and impaired ECM turnover
   [[117]31, [118]32]. In our study, we observed significant heterogeneity
   between Sca-1^high LMSCs and Sca-1^low LMSCs. Sca-1^high LMSCs
   exhibited markedly higher levels of cytokines, including CCL2, CCL7,
   and CXCL1, compared to Sca-1^low LMSCs. The Sca-1^high LMSCs promote
   metastasis both directly and indirectly through the secretion of
   cytokines. These findings suggest that Sca-1 plays a critical role in
   regulating the secretion of various cytokines. However, the exact
   mechanism behind this remains elusive.

   The chemokine CCL2 acts on the macrophage receptor CCR2, and studies in
   mice with deletions in CCL2 or CCR2 have shown that macrophage
   infiltration and the conditioning lesion response in dorsal root
   ganglia are impaired (FRG) [[119]33]. Our data indicate that tumors
   with high LY6E expression tend to have higher levels of macrophages.
   Moreover, in vitro, Bindrait effectively inhibited the pro-metastatic
   effects of Sca-1^high LMSCs, indicating that macrophages mediate the
   pro-metastatic effect.

   Metastasis is a key determinant of cancer prognosis, and understanding
   how the pre-metastatic niche (PMN) or tumor micro-environment (TME) is
   established has garnered significant interest. Given the critical role
   of MSCs in the PMN and TME, targeting Sca-1^high MSCs in the TME has
   emerged as a potential strategy to improve outcomes for cancer
   patients. By targeting Sca-1^high LMSCs in human breast cancer, it may
   be possible to disrupt the establishment of the PMN in the lungs and
   inhibit metastatic progression.

Methods and materials

Animals

   Female BALB/c mice and C57BL6/J mice were purchased from GemPharmatech.
   Ccr5^−/− mice (B6;129P2-Ccr5tm1Kuz/J) were purchased from Jackson Lab.
   All animals were maintained under specific pathogen-free conditions and
   were 6–8 weeks old for our experiments. The mice were randomly grouped
   according to a random number table. 5 × 10^5 4T1 or AT-3 and 1 × 10^5
   LMSCs were co-injected into the mice intravenously. Two weeks after
   cell administration, the mice were euthanized, and tumor nodules in the
   lungs were examined. The investigators were blinded to the group
   allocation during outcome assessment.

Cell lines

   Murine 4T1 and AT-3, mammary tumor cells, were cultured in DMEM/high
   medium containing 10% fetal bovine serum (FBS), 1%
   penicillin-streptomycin (Gibco, USA). All cells were recently
   authenticated by STR profiling and regularly tested to ensure they were
   mycoplasma-free.

Lung-derived MSCs (LMSCs) isolation and culture

   To isolate LMSCs, 6–8-week-old Balb/c mice were anesthetized. The whole
   lung was dissected and minced with a scalpel in DMEM/low medium. The
   resulting single cell and lung tissue suspension was plate in a 10-cm^2
   cell culture dish at a density of a whole lung/dish. These cells were
   cultured in complete DMEM/low medium consisting of 10% fetal bovine
   serum (FBS), 2 mmol/L-glutamine, and 1% penicillin and streptomycin
   (Gibco, USA). After 24 h, nonadherent cells were removed by 2 washes
   with phosphate-buffered saline (PBS), and adherent cells were cultured
   until they reached confluence. Cells were then trypsinized (0.25%
   trypsin with 0.1% EDTA) and sub-cultured at a density of 3 × 10^5
   cells/10 cm^2 dish.

Phenotype analysis of LMSCs

   Cultured LMSCs were harvested, and flow cytometry was performed to
   analyse the phenotype after Sca-1 micromagnetic bead purification.
   Cells were washed with PBS, and then incubated with Sca-1 (eBioscience,
   45-5981-82), CD11b (BD, 557657), Ly6G (Invitrogen, 63-9668-82), F4/80
   (Invitrogen, 25-4801-82), CD45 (Biolegend, 147712) antibodies for
   30 min in PBS containing 5% FBS at 4 °C. Analysis was performed using
   FlowJo software.

Western blotting analysis

   Cells were lysed in RIPA buffer (Beyotime, China) containing 1 mM
   phenylmethanesulfonyl fluoride (PMSF, Beyotime) for 30 min on ice.
   Proteins were incubated overnight at 4 °C with primary antibodies
   against Sca-1 (abcam, ab255604), β-actin (CST, Proteintech,
   60008-1-Ig). The blotting membranes were then incubated with
   anti-rabbit or anti-mouse secondary antibodies for 1 h at room
   temperature. Chemiluminescent reagents (NCM Biotech, China) were used
   to develop the blotting membranes. The images were captured by
   ImageQuant 800 (Cytiva, USA).

RNA sequencing of LMSCs

   LMSCs isolated from MMTV-PyMT mice at different tumor stages (n = 3 for
   each stage) were subjected to RNA-seq analysis. The accession number
   for RNA sequencing data deposited in NCBI Gene Expression Omnibus is
   GEO: [120]GSE125591.

Quantitative real-time PCR

   Total RNA was isolated using RNAfast200 Kit (Fastagen Biotech,
   Shanghai, China). Reverse transcription PCR was finished using the
   PrimeScriptTM RT Master Kit (TakaRa Biotech, Beijing, China). The mRNA
   expression was quantified by Real-Time PCR with SYBR Green Master Mix
   (ThermoFisher Scientific, USA). The relative abundance of mRNA was
   compared with endogenous β-actin mRNA. The mouse primer sequences were
   as follows: Ccl2-F: TTAAAAACCTGGATCGGAACCAA; Ccl2-R:
   GCATTAGCTTCAGATTTACGGGT; Ccl3-F: TTCTCTGTACCATGACACTCTGC; Ccl3-R:
   CGTGGAATCTTCCGGCTGTAG; Ccl4-F: TTCCTGCTGTTTCTCTTACACCT; Ccl4-R:
   CTGTCTGCCTCTTTTGGTCAG; Ccl5-F: GCTGCTTTGCCTACCTCTCC; Ccl5-R:
   TCGAGTGACAAACACGACTGC; Ccl6-F: GCTGGCCTCATACAAGAAATGG; Ccl6-R:
   GCTTAGGCACCTCTGAACTCTC; Ccl7-F: ATCACCAGTAGTCGGTGTCCCT; Ccl7-R:
   TCCATGCCCTTCTTTGTCTTG; Ccl11-F: GAATCACCAACAACAGATGCAC; Ccl11-R:
   ATCCTGGACCCACTTCTTCTT; Ccl17-F: TACCATGAGGTCACTTCAGATGC; Ccl17-R:
   GCACTCTCGGCCTACATTGG; Ccl19-F: CCTGGGAACATCGTGAAAGC; Ccl19-R:
   TAGTGTGGTGAACACAACAGC; Ccl20-F: GCCTCTCGTACATACAGACGC; Ccl20-R:
   CCAGTTCTGCTTTGGATCAGC; Ccl22-F: CTCTGCCATCACGTTTAGTGAA; Ccl22-R:
   GACGGTTATCAAAACAACGCC; Ccl24-F: TCTTGCTGCACGTCCTTTATT; Ccl24-R:
   GCATCCAGTTTTTGTATGTGCC; Ccl25-F: TTACCAGCACAGGATCAAATGG; Ccl25-R:
   CGGAAGTAGAATCTCACAGCAC; Ccl26-F: TTCTTCGATTTGGGTCTCCTTG; Ccl26-R:
   GTGCAGCTCTTGTCGGTGAA; Ccl27-F: AGGAGGATTGTCCACATGGAA; Ccl27-R:
   CTTGGCGTTCTAACCACCGA; Ccl28-F: GATGAGAGCCTCAGAGGTAAAGA; Ccl28-R:
   CTTTCTCGTAGTGTGCCCTTTT; Cxcl1-F: ACTGCACCCAAACCGAAGTC; Cxcl1-R:
   TGGGGACACCTTTTAGCATCTT; Cxcl2-F: CCAACCACCAGGCTACAGG; Cxcl2-R:
   GCGTCACACTCAAGCTCTG; Cxcl9-F: TCCTTTTGGGCATCATCTTCC; Cxcl9-R:
   TTTGTAGTGGATCGTGCCTCG; Cxcl10-F: CCAAGTGCTGCCGTCATTTTC; Cxcl10-R:
   GGCTCGCAGGGATGATTTCAA; Cxcl11-F: GGCTTCCTTATGTTCAAACAGGG; Cxcl11-F:
   GCCGTTACTCGGGTAAATTACA; Cxcl12-F: TGCATCAGTGACGGTAAACCA; Cxcl12-R:
   TTCTTCAGCCGTGCAACAATC; Ccr1-F: TACTCTGGAAACACAGACTCACT; Ccr1-R:
   ACAGCAGTCTTTTGGCATGG; Ccr2-F: AGAACTGTAGATCTTTGGGGAAACT; Ccr2-R:
   GTCTTTGCAGGCAGCTGAAC; Ccr3-F: TCGAGCCCGAACTGTGACT; Ccr3-R:
   CCTCTGGATAGCGAGGACTG; Ccr4-F: GGAAGGTATCAAGGCATTTGGG; Ccr4-R:
   GTACACGTCCGTCATGGACTT; Ccr5-F: TTTTCAAGGGTCAGTTCCGAC; Ccr5-R:
   GGAAGACCATCATGTTACCCAC; Ccr6-F: TGTACGAGTCGGTGTGCTTC; Ccr6-R:
   GGTAGGTATCCGTCATGGTCTTG; Cxcr1-F: TCTGGACTAATCCTGAGGGTG; Cxcr1-R:
   GCCTGTTGGTTATTGGAACTCTC; Cxcr2-F: ATGCCCTCTATTCTGCCAGAT; Cxcr2-R:
   GTGCTCCGGTTGTATAAGATGAC; Cxcr3-F: TACCTTGAGGTTAGTGAACGTCA; Cxcr3-R:
   CGCTCTCGTTTTCCCCATAATC; Cxcr4-F: CTTCTGGGCAGTTGATGCCAT; Cxcr4-R:
   CTGTTGGTGGCGTGGACAAT.

Flow cytometry

   Cells were washed with PBS and then were resuspended in
   fluorescence-activated cell sorting (FACS) buffer (PBS with 5% FBS) at
   a concentration of 5 × 10^5 cells per 50 μL. These single-cell
   suspensions were incubated at 4 °C for 25 min with specific antibodies
   as described. FACS analysis was performed with FlowJo software.

Trans-well assay

   For trans-well migration and invasion assay, 5 × 10^5 cells cultured in
   400 μL medium with 10% FBS were plated in the upper chamber of a
   non-coated trans-well insert. In the lower chamber, 600 μL medium with
   50% Sca-1^high or Sca-1^low LMSCs culture supernatant, respectively,
   was used as a chemo-attractant to encourage cell migration. Cells were
   incubated for 24 h, and those cells that did not migrate or invade were
   removed using a cotton swab. All cells were stained using crystal
   violet staining and counted under a light microscope. We selected five
   random views to count the target cells, and each experiment was
   repeated independently three times.

Quantify of breast cancer metastasis nodules

   Mice were sacrificed, and the lungs were surgically removed, followed
   by staining with Bouin’s solution. The lung metastasis was determined
   by counting the tumor nodules on the lungs.

Bioinformatic analyses

   The TCGA BRCA gene expression values were retrieved using Xena Browser
   ([121]https://xenabrowser.net/). The differential expression analysis
   was performed using DESeq2 package from Xena Browser. Genes with
   P < 0.05 and abs(log2FC)>1 were considered significantly enriched. The
   values were represented as volcano plot using ggplot2 package.
   Correlation between LY6E and other genes’ expression levels was
   visualized using ggpointdensity and viridis packages. Pathway
   enrichment analysis was carried out using fgsea package. xCell
   predicted proportion of macrophages in TCGA BRCA samples was obtained
   from Timer2.o website ([122]http://timer.cistrome.org/).

Statistical analysis

   Data were shown as mean ± SEM. Each result was confirmed by two or
   three repeated experiments. The significance was determined by a
   two-tailed unpaired Student t-test or one-way ANOVA with multiple
   comparisons as appropriate with Prism software (GraphPad9). *p < 0.05,
   **p < 0.01, ***p < 0.001, ****p < 0.0001. All of the data met the
   assumptions of the tests. The exact statistical parameters were
   presented in figure legends.

Supplementary information

   [123]Supplementary Material^ (463.2KB, docx)

Acknowledgements