Abstract

Background

   Transcriptional co-regulators fine-tune gene expression by modulating
   transcription factor activity and chromatin dynamics. HCF-1 (Host Cell
   Factor 1), a conserved transcriptional co-regulator, has been
   implicated in cell cycle progression, liver metabolism, and
   regeneration. Loss of hepatocyte-specific HCF-1 in mice leads to
   spontaneous NAFLD, which rapidly exacerbates to NASH and compromises
   liver regeneration. While its role in transcriptional regulation is
   well-established, the impact of HCF-1 on epigenetic modifications
   remains relatively unexplored.

Methods

   To investigate the consequences of HCF-1 depletion, we performed
   histological and biochemical analyses of murine livers, assessing liver
   injury, lipid accumulation, and hepatocyte proliferation upon 2/3
   partial hepatectomy (PH). Additionally, we conducted RNA sequencing
   (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) for
   H3K4me3 and RNA polymerase II (POL2) to examine the epigenetic and
   transcriptional alterations associated with HCF-1 loss.

Results

   Loss of HCF-1 results in severe liver injury, causing hallmark features
   of NAFLD, including steatosis, inflammation, fibrosis, and
   mitochondrial dysfunction. Following injury, hepatocytes typically
   re-enter the cell cycle to replenish lost cells. However, in the
   absence of HCF-1, hepatocytes fail to proliferate leading to a
   progressive decline in liver function. Even upon 2/3 PH,
   HCF-1-deficient hepatocytes remain arrested in the cell cycle, further
   exacerbating disease severity and preventing tissue regeneration.
   RNA-seq analyses revealed significant downregulation of genes involved
   in cell cycle progression, metabolism, and mitochondrial structure and
   function including those regulating oxidative phosphorylation. ChIP-seq
   data showed altered H3K4me3 patterns at promoter and enhancer regions
   of key hepatic genes. These findings indicate that HCF-1 is essential
   for maintaining transcriptional and epigenetic landscapes necessary for
   hepatocyte proliferation and regeneration.

Conclusions

   Our study establishes HCF-1 as a critical regulator of hepatic
   homeostasis, with roles extending beyond transcriptional control to
   epigenetic regulation of liver function and repair. Loss of HCF-1 not
   only induces liver injury and NAFLD but also prevents hepatocyte
   proliferation, impairing regeneration and accelerating disease
   progression.

Supplementary Information

   The online version contains supplementary material available at
   10.1186/s12864-025-11786-5.

   Keywords: HCF-1, Epigenetics, Methylation, ChIP-seq, Non-alcoholic
   fatty liver disease

Background

   The liver is a major organ found in vertebrates and is responsible for
   performing many essential biological processes. It plays a critical and
   indispensable role in the biotransformation of xenobiotics, the
   processing of metabolites as well as regulation of glucose and lipid
   metabolism [[34]1]. It is a remarkable organ with the capacity for
   regeneration upon various injuries, where all types of mature liver
   cells participate in its execution [[35]2, [36]3]. Due to its
   multidimensional functionality, however, liver is also prone to many
   diseases. Non-alcoholic fatty liver disease (NAFLD) is one such
   disease. Characterized by excessive lipid accumulation within
   hepatocytes, NAFLD emerges as a dynamic interplay between metabolic
   deregulation and cellular responses. It is a multifaceted condition
   that has recently gathered significant attention due to its rising
   global prevalence and its potential progression to more severe stages,
   such as non-alcoholic steatohepatitis (NASH), fibrosis, and eventually
   cirrhosis. In line with this, HCF-1 (Host cell factor 1) is one of the
   epigenetic coregulators that has recently been shown to be necessary
   for both healthy liver homeostasis and proper regeneration [[37]4,
   [38]5].

   HCF-1 is a conserved metazoan transcriptional co-regulator that was
   first identified as a host-cell factor for herpes simplex virus
   infection [[39]6]. In mice, HCF-1 is encoded by the Hcfc1 gene located
   on the X chromosome [[40]7]. The precursor protein consisting of 2045
   amino acids is predominantly cleaved by site-specific proteolysis with
   the help of O-linked β-N-acetylglucosamine transferase (OGT)
   [[41]8–[42]13]. HCF-1 is known to bind to the transcriptional start
   sites (TSS) of many genes and physically link sequence-specific
   DNA-binding transcription factors with chromatin-modifying enzymes such
   as histone demethylases (KDM1A [[43]14, [44]15] and PHF8 [[45]16]),
   Set1 histone H3 lysine 4 methyltransferases, mixed-lineage leukemia
   (MLL) [[46]17–[47]19], histone acetyltransferase (KAT8 MOF) [[48]20,
   [49]21], ubiquitin hydrolase RNF2 (BAP-1) [[50]22–[51]24], histone
   deacetylase (SIN3A) [[52]25], glycosyl transferase OGT [[53]24,
   [54]26], and phosphatase PPA1 [[55]27]. This regulatory protein is
   implicated in several significant and varied processes, including
   development, differentiation, and embryonic stem cell pluripotency
   [[56]27–[57]31]. Moreover, HCF-1 has been shown to serve a vital role
   for cell proliferation in cell culture and in mice during both
   embryogenesis and liver regeneration [[58]4, [59]32–[60]35].
   Particularly, in the context of liver regeneration, it has been shown
   that quiescent HCF-1 negative hepatocytes fail to re-enter the cell
   cycle post-2/3rd partial hepatectomy (PH) and, hence, cannot contribute
   to restoration of lost liver mass [[61]4].

   Additionally, human clinical trials of X-linked disorders, such as
   mental impairment and cobalamin dysfunction, have linked the Hcfc1 gene
   to non-proliferative functions [[62]36–[63]39] It has also been
   demonstrated that HCF-1 stabilization increases the synthesis of
   glucose in hepatocytes, and that HCF-1 knockdown improves glucose
   homeostasis in diabetic mice [[64]24]. Additionally,
   hepatocyte-specific disruption of HCF-1 function results in NAFLD and
   NASH in mice [[65]5]. Despite these findings, the precise molecular
   mechanisms by which HCF-1 coordinates hepatocyte proliferation,
   metabolic function, and epigenetic regulation remain unclear.

   In this study, we have assessed the effect of HCF-1 depletion in mouse
   liver regeneration in terms of RNA polymerase II (POL2) activity and
   histone H3 lysine 4 tri-methylation (H3K4me3) modification in the
   genome in non-regenerating liver. Using RNA-seq and ChIP-seq analyses,
   we identified key gene regulatory pathways affected by HCF-1 loss. Our
   findings highlight HCF-1 as a critical epigenetic regulator essential
   for hepatic function, linking metabolic homeostasis, gene expression,
   and liver regeneration.

Materials and methods

Mice

   All experimental studies have been performed in compliance with EU and
   national legislation rules, as advised by the Lemanique Animal Facility
   Network (Resal), concerning ethical considerations of transportation,
   housing, strain maintenance, breeding, and experimental use of animals.
   The animals used in this study were obtained from and housed within the
   authorized animal facility at the University of Lausanne. For all
   experiments, mice were housed four or five per cage at 23 °C, with a
   12-h light and 12-h dark cycle and ad libitum access to food and water,
   unless specifically mentioned. For regeneration experiments, all mice
   were subjected to 12-h light and 12-h dark cycles for a duration of two
   weeks, followed by 12-h cycles of light and fasting and 12-h cycles of
   darkness and feeding. Mice were anesthetized with isoflurane and
   euthanized by cervical dislocation before the surgical procedure.
   Tamoxifen treatment and all tissue collections post-surgery were done
   between Zeitgeber Time ZT2 to ZT3, where ZT0 is the start of the light
   cycle. For all experiments with Hcfc1^hepKO/Y (KO) males, Hcfc1^lox/Y
   male mice were chosen as controls, whereas for Hcfc1^hepKO/+ (HET)
   females, Hcfc1^lox/+ female mice were used. No significant differences
   were observed between the phenotypes of the Hcfc1^lox/Y male and
   Hcfc1^lox/+ female mice.

DNA isolation and genotyping

   Genomic DNA isolated from the ear tags of postnatal mice were used for
   genotyping. The DNA so isolated was used for PCR amplification using
   the KAPA2G Fast Hot Start Genotyping PCR mix (cat. # KK5621). The
   primer sets used for the genotyping reactions are mentioned in the
   Table [66]1 below.

Table 1.

   Primers for genotyping
   Sample Sequence Annealing Extension
   p1 for HCF-1 genotyping 5’GGAGGAACATGAGCTTTAGG3’

   62 °C for

   15 s

   72 °C for

   10 s
   p2 for HCF-1 genotyping 5’CAATAGGCGAGTACCATCACAC3’
   p3 for HCF-1 genotyping 5’GGGAAAGTAGACCCACTCTG3’
   p1 for AlbCre genotyping 5’ATCATTTCTTTGTTTTCAGG3’

   53 °C for

   1 min

   72 °C for

   1 min
   p2 for AlbCre genotyping 5’GGAACCCAAACTGATGACCA3’
   p3 for AlbCre genotyping 5’TTAAACAAGCAAAACCAAAT3’
   [67]Open in a new tab

   The PCR product of 229 bp generated by combination of p1 and p2 primers
   was used to detect the wild-type AlbCre allele. While the 444 bp PCR
   product generated by p2 and p3 primers sets detected the Cre allele
   [[68]4].

Tamoxifen treatment

   10–14 week-old control (Hcfc1^lox/Y) and test (Alb-Cre-ERT2^tg;
   Hcfc1^lox/Y) male mice were intraperitoneally injected with 1 mg/mouse
   tamoxifen [100 μl of 10 mg/ml (1:10 ethanol:corn oil)] (Sigma-Aldrich
   CAS#10,540–29-1) twice at intervals of every 24 h from day 0 to day 2.
   RNA sequencing analysis showed that tamoxifen treatment caused splicing
   of exon 1 to exon 4 of the Hcfc1 gene leading to rapid conversion of
   Hcfc1^lox/Y to Hcfc1^hepKO [[69]5].

Immunohistochemistry

   Immunohistochemistry was performed on 4 μm thick paraffin embedded
   liver tissue sections. The sections were first deparaffinized in
   xylene, followed by rehydration with graded ethanol washes. The tissue
   sections were then rinsed twice with 1X PBS. For antigen retrieval, the
   sections were heated in a 10 mM citrate buffer (pH 6) for about 10 min
   or until boiling in a 750 W microwave. The set-up was then cooled to 4℃
   followed by two 1X PBS washes. Blocking was performed for 30 min at
   room temperature with 2% NGS (Normal Goat Serum, Sigma-Aldrich cat. #
   G9023) prepared in 1X PBS. Individual sections were then incubated with
   specific primary antibodies (dilutions prepared in 2% NGS) overnight at
   4℃. Following the primary antibody incubation, the sections were washed
   thrice with 1 × PBS. Secondary antibody incubation was then performed
   in the dark at room temperature for 30 min. After this, the sections
   were again rinsed in 1X PBS and then counter stained with DAPI
   (4',6-diamidino-2-phenylindole, Sigma-Aldrich, CAS # 28,718–90-3) for
   5 min. The DAPI stain was then washed away by PBS rinsing. The section
   was then mounted in mowiol mounting medium (Sigma-Aldrich, CAS #
   9002–89-5).

   The primary antibodies used were rabbit anti-HCF-1 (1:1000, H12),
   anti-HNF4α (1:100, R&D Systems cat. # 5 PP-H1415-00), rat anti-Ki67
   (1:60, eBioscience cat. # 41–5698), mouse anti-PCNA (1:50, BD
   Transduction Laboratories cat. # 610,665), rabbit anti-Histone H3
   phosphoSerine 10 (1:100, Abcam cat. # ab5176), rat anti-F4/80 (1:800,
   Abcam cat. # ab6640), anti-SMA (1:400, Abcam cat. # ab5694), mouse
   anti-OXPHOS (1:100, Abcam cat. # ab110413), mouse anti-MTCO1 (1:200,
   Abcam cat. # ab14705), mouse anti-ATP5α (1:400, Abcam cat. # ab14748),
   rabbit anti-TGFβ (1:100, Abcam cat. # ab 313,730), mouse anti-PCNA
   (1:50, BD Transduction Laboratories cat. # 610,665) and rat anti-CD31
   (1:20, Dianova GmbH cat. # DIA-310-M).

   Secondary antibodies used were goat anti-rabbit Alexa 488 (1:400,
   Molecular Probes cat. # A11034), goat anti-mouse Alexa 568 (1:500,
   Molecular Probes cat. # A11019), goat anti-rabbit Alexa 568 (1:1000,
   Molecular Probes cat. # A21069), goat anti-mouse Alexa 488 (1:400,
   Molecular Probes cat. # A11029), donkey anti-mouse Alexa 594 (1:500,
   Molecular Probes cat. # A11005), and goat anti-mouse Alexa 635 (1:300,
   Molecular Probes cat. # [70]A31575).

Tunel assay

   Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end
   labeling (TUNEL) was performed on paraffin-embedded liver sections
   using the In Situ Cell Death Detection Kit (Roche Applied Science, Cat.
   #11,684,795,910), following the manufacturer’s instructions.

Electron microscopy

   Small liver tissue fragments (2 mm^3) were initially fixed in a 2.5%
   glutaraldehyde solution (EMS, Hatfield, PA, USA) prepared in 0.1 M
   phosphate buffer (PB, pH 7.4) (Sigma, St. Louis, MO, USA) for 2 h at
   room temperature (RT). Following primary fixation, the samples
   underwent post-fixation in 1% osmium tetroxide (EMS, Hatfield, PA, USA)
   in the same phosphate buffer for an additional 2 h at RT. Subsequently,
   the samples were rinsed twice with distilled water and dehydrated using
   a graded acetone series (30% for 30 min, 70% for 30 min, and 100% for
   two cycles of 1 h each) (Sigma, St. Louis, MO, USA). The dehydrated
   samples were then gradually infiltrated with epoxy resin (Sigma, St.
   Louis, MO, USA) at increasing concentrations: Epon 1:3 acetone for 1 h,
   Epon 3:1 acetone for 1 h, Epon 1:1 for 2 h, and finally Epon 1:1 for 12
   h. The resin-infiltrated tissue pieces were embedded in molds filled
   with resin and polymerized at 60 °C for 48 h. Ultrathin Sects. (50 nm)
   were obtained using a Leica Ultracut ultramicrotome (Leica Mikrosysteme
   GmbH, Vienna, Austria) and mounted on copper slot grids (2 × 1 mm)
   (EMS, Hatfield, PA, USA) coated with a polystyrene film (Sigma, St.
   Louis, MO, USA). Transmission electron microscopy (TEM) imaging was
   performed using a Philips CM100 TEM (FEI, Eindhoven, The Netherlands)
   operating at 80 kV, and micrographs were captured with a TVIPS
   TemCam-F416 digital camera (TVIPS GmbH, Gauting, Germany).

Tissue histology

   Various stainings were performed either on paraffin embedded liver
   sections (4 μm) or cryosections (8 μm).

Hematoxylin and eosin staining

   Tissue organization was examined using hematoxylin and eosin staining
   [[71]40]. Hematoxylin stains the nucleus while eosin stains the
   cytoplasm of the cell. The paraffin sections were initially dewaxed by
   heating and xylene treatment. This was followed by rehydration with
   repeated ethanol washes of decreasing percentages. Following this, the
   sections were rehydrated with ultrapure water and then stained with
   hematoxylin. Excess stain was washed in water followed by acid-alcohol
   wash for 2 min. The sections were then washed well in water before
   counterstaining with 0.25% eosin for 90 s. The sections were then
   dehydrated with higher percentage ethanol washes. Finally, the sections
   were washed in xylene and then mounted for imaging.

Sirius red staining

   This azo dye is used to stain collagen fibers and can help assess
   hepatic fibrogenesis. For this, paraffin sections are washed in 0.2%
   phosphomolybdic acid for 5 min following rehydration. The sections are
   then stained with 0.1% sirius red staining solution (90 min) and
   counterstained with Mayer’s hematoxylin (for 1 min).

Oil red O

   Oil Red O stain selectively stains neutral lipids. For this, 8 μm thick
   liver cryosections are first air dried followed by fixation with 4% PAF
   for 10 min at room temperature. Following fixation, the sections are
   quickly washed with distilled water, rinsed with 60% isopropanol for
   1 min and then stained with Oil Red O stain (Sigma Cat #0625) for 10
   min. The sections are then subjected to quick washes with 60%
   isopropanol and distilled water followed by co-staining with
   hematoxylin for 45 s. Subsequently the sections are washed well with
   water and mounted. In this staining, lipids and nuclei are seen in red
   and blue colours respectively.

Immunoblotting

   100 mg of control Hcfc1^lox/Y liver tissue were collected at every
   point (0 h, 1 h, 10 h, 24 h, 36 h, 48 h, 72 h, 1 week) and homogenized
   well using RIPA buffer containing protease inhibitor (components of
   RIPA buffer listed in the Table [72]2). 10–20 μg samples were then
   mixed with a 1X loading buffer and heated at 95℃ for 5 min. Following
   transfer to nitrocellulose membrane, blocking was performed for 1 h
   with 5 mL of LI-COR blocking buffer. The membrane was then incubated
   overnight with primary antibody (1:1000 dilution of anti-HCF-1
   antibody, Bethyl Laboratories; 1:1000 dilution of anti-OXPHOS antibody)
   (prepared in 1:1 blocking buffer:1 × PBST) at 4℃. The following day,
   the membrane was washed thrice and incubated with 1:10,000 dilution of
   secondary antibody at room temperature for 30 min. The membrane was
   then washed well and developed.

Table 2.

   Components of RIPA buffer
   Components          Final concentration
   Tris–HCl pH7.4      50 mM
   NaCl                150 mM
   EDTA                1 mM
   Sodium deoxycholate 0.2%
   DTT                 1 mM
   PMSF                1 mM
   Triton X            1%
   [73]Open in a new tab

ChIP-seq analysis

Chromatin isolation, immunoprecipitation, and preparation of high throughput
sequencing

   Chromatin was isolated from the liver of individual male
   Alb-Cre-ERT2^tg; Hcfc1^lox/Y mice at 0, 4 and 7 days after Hcfc1^hepKO
   allele induction by tamoxifen administration as described in Methods.
   Chromatin was immunoprecipitated and prepared for high-throughput
   sequencing as described [[74]41] using the anti-HCF-1 (Bethyl
   Laboratories, A301-400A; RRID: AB_961015) H12, anti-RPB2 (Santa Cruz
   Biotechnology, sc-673–18), and anti-H3K4me3 (Abcam, ab8580) [[75]8,
   [76]26].

Processing of the sequencing data

   Raw data were cleaned using Trim Galore (v0.6.4) [[77]42] and were
   checked for quality using FastQC (v0.11.8) [[78]43]. STAR aligner
   (v2.7.9a) was deployed to align the reads to the mouse reference genome
   (mm10) once they had passed quality control [[79]44]. Random, chimeric
   and uncharacterised reads were removed. Regions from the ENCODE
   blacklisted list were discarded for further analysis [[80]45]. Only the
   fragments with 255 (unique mapping) and 3 (maps to 2 locations in the
   target) and 1 (maps to more than 2 locations in the target) MAPQ score
   were considered. All the fragments bigger than 2 kb were discarded. The
   module “callpeak” in MACS2 (Model-based Analysis for ChIP Sequencing
   v2.0) was used to identify regions of ChIP-seq enrichment over the
   background in an unbiased manner [[81]46]. The parameters were adjusted
   according to different markers, HCF-1 and POL2 in narrow peak mode,
   H3K4me3 in broad peak mode, with q-value of 0.1. Further, differential
   peaks were identified using HOMER (v4.11) and intersect function in
   BEDTools (v2.30.0) [[82]47, [83]48]. Motifs enrichment in peak regions
   were searched using the findMotifsGenome.pl script in the HOMER suite
   of tools. For biological interpretation of the results from the
   ChIP-Seq experiments, gene ontology and pathway analysis was
   implemented using web-based tool DAVID (The Database for Annotation,
   Visualization and Integrated Discovery) [[84]49].

Statistical analysis

   All the experiments were performed for a minimum of three biological
   replicates. Immunohistochemistry data were analyzed and quantified
   using ImageJ software. The percentage of positively stained cells was
   determined using the formula:
   graphic file with name d33e782.gif

   Data have been represented as mean ± SEM and p-values have been
   calculated using two-tailed Student’s t-test using GraphPad Prism
   Software, wherein p < 0.05 is statistically significant.

Results

Loss of HCF-1 leads to severe liver injury

   We began by investigating the effect of hepatocyte-specific loss of
   HCF-1 on overall liver health and morphology. To achieve the liver
   specific deletion of HCF-1, we administered tamoxifen treatment to
   10–14-week-old Albumin-Cre-ERT2^tg; Hcfc1^lox/Y and
   Albumin-Cre-ERT2^tg; Hcfc1^lox/+ male and female mice. As previously
   demonstrated [[85]4, [86]5], in the aforementioned strains, the
   Albumin-Cre-ERT2^tg allele ensures a hepatocyte-specific knockout of
   the Hcfc1 gene upon tamoxifen activation. Since Hcfc1 gene is X-linked,
   this conversion results in generation of Hcfc1^hepKO/Y allele in male
   mice (completely lacking HCF-1 expression) and Hcfc1^hepKO/+ allele in
   female mice (exhibiting heterogeneous gene expression) [[87]4, [88]5].
   Before tamoxifen treatment, all HNF4α-positive hepatocytes consistently
   displayed HCF-1 expression (indicated by red arrows in Fig. [89]1A).
   However, within 7 days of tamoxifen induction, a noticeable
   hepatocyte-specific reduction in HCF-1 levels was observed in both
   Albumin-Cre-ERT2^tg; Hcfc1^KO/+ (HET) heterozygous female (Fig. [90]1B)
   and Albumin-Cre-ERT2^tg; Hcfc1^KO/Y (KO) knockout male (Fig. [91]1C)
   mice. Female mice showed heterogenous expression of the X-linked hcfc1
   gene upon tamoxifen treatment by virtue of random X-chromosome
   inactivation. Some clusters of hepatocytes (HNF4α-positive) were found
   to be HCF-1 positive (red arrows in Fig. [92]1B), while others were
   HCF-1 negative (white arrows in Fig. [93]1B), in the female mice,
   dependent on the location of the Hcfc1^KO allele on the active or
   inactive X-chromosome, thus generating a 50/50 mix of HCF-1 positive
   and negative hepatocytes. Non-hepatocytes (HNF4α-negative) remained
   positive for HCF-1 (yellow arrows in Fig. [94]1B). In contrast,
   Hcfc1^KO/Y male mice displayed complete loss of hepatocyte-specific
   HCF-1 expression upon tamoxifen activation (white arrows in
   Fig. [95]1C), although non-hepatocytes remained positive for HCF-1
   (yellow arrows in Fig. [96]1C). Upon quantification we observe, a
   significant decrease in the number of hepatocytes expressing HCF-1 in
   Hcfc1^KO/+ (HET) heterozygous female mice and Hcfc1^KO/Y (KO) knockout
   male mice as compared to Hcfc1^lox/+ control mice (Fig. [97]1D).

Fig. 1.

   [98]Fig. 1
   [99]Open in a new tab

   Tamoxifen induction leads to rapid loss of hepatocyte-specific HCF-1
   expression in Hcfc1^hepKO/+ female and Hcfc1^hepKO/Y male livers.
   Immunofluorescence analysis of HCF-1 and hepatocyte specific marker
   (HNF4α) of 10-week old control (0d Ctrl WT; panels A), heterozygous
   Alb-Cre-ERT2^tg; Hcfc1^hepKO/+ female (7d HET; panel B) and knockout
   Alb-Cre-ERT2^tg; Hcfc1^hepKO/Y male livers (7d KO; panel C) 7 days
   post-tamoxifen treatment. The paraffin-embedded sections of livers
   (panels A, B, and C) were stained with DAPI (blue), anti-HNF4a (red),
   anti-HCF-1 (green). In panels A, and B the red arrows point to
   HCF-1-positive and HNF4α-positive hepatocytes. White arrows in panels B
   and C point to HCF-1-negative and HNF4α-positive hepatocytes. Yellow
   arrows in panel C point towards HCF-1-positive and HNF4α-negative
   non-hepatocytes. The indented circles in B reflect some of the visible
   HCF-1-positive and negative hepatocyte clusters. Percentages of HCF-1
   positive hepatocytes (panel D, n = 4) were calculated for 0 d Ctrl WT,
   heterozygous Alb-Cre-ERT2^tg; Hcfc1^hepKO/+ female and and knockout
   Alb-Cre-ERT2^tg; Hcfc1.^hepKO/Y male mice livers. Students’ T test was
   used to calculate the significance. (**, p ≤ 0.001;***, p ≤ 0.0001;
   n.s., p > 0.05)

   Assessment of liver damage upon loss of HCF-1 expression was examined
   by checking for AST levels, a liver injury marker (Additional Fig. 1).
   Histological assessments of liver tissue sections from both male and
   female Hcfc1^hepKO/Y and Hcfc1^hepKO/+ mice showed increased steatosis,
   identified by Oil Red O staining, (Fig. [100]2A) and infiltration of
   macrophages, labelled with F4/80 inflammatory marker, (Fig. [101]2B) by
   7 days post-tamoxifen induction. Infiltration of macrophages (F4/80
   staining) was also examined at 18 days post tamoxifen treatment in both
   Hcfc1^hepKO/+ female and Hcfc1^hepKO/Y male mice (Additional Fig. 2).
   Hepatic steatosis levels appeared to be more prominent in Hcfc1^hepKO/Y
   male mice, which completely lacked hepatocyte-specific HCF-1 expression
   compared to the heterozygous female mice that still retained patches of
   HCF-1-positive hepatocytes. Hcfc1^hepKO/Y male mice also showed
   appearance of ballooned hepatocytes indicating extensive liver injury
   (Additional Fig. 3). Further signs of liver injury emerged, such as
   accumulation of fibrotic fibres (Fig. [102]2C) together with the
   activation of hepatic stellate cells by the 18th day, as evidenced by
   the presence of smooth muscle α-actin (SMA) positive cells
   (Fig. [103]3A). Increased cell death in liver paraffin sections of
   Hcfc1-depleted mice was also observed at the 18th day, indicated by
   TUNEL staining where apoptotic cells were stained green (Fig. [104]3B).
   TUNEL staining was also performed at various time points post tamoxifen
   treatment for Hcfc1^hepKO/Y knockout male mice which showed significant
   cell death upon loss of HCF-1 (Additional Fig. 4). We also observed
   significant increased expression of cleaved-caspase 3 staining
   (Fig. [105]3C) and appearance of CD31-positive cells (Fig. [106]3D) at
   18th day indicating increased cell death and increased angiogenesis
   upon loss of HCF-1. We also observed increased expression of another
   inflammatory marker TGF-β in Hcfc1^hepKO/Y knockout male mice compared
   to control and both Hcfc1^hepKO/+ heterozygous females (Additional Fig.
   5).

Fig. 2.

   [107]Fig. 2
   [108]Open in a new tab

   Hcfc1 knock-out leads to severe liver injury. Comparison of
   cryosections (A) and paraffin-embedded sections (B and C) of control
   livers (0d; left), heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female
   (middle) and knockout Alb-Cre-ERT2tg; Hcfc1^hepKO/Y livers (right).
   A The presence of steatosis was estimated by Oil Red O staining of
   cryo-sections from control, heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+
   female and knockout Alb-Cre-ERT2tg; Hcfc1^hepKO/Y livers. Scale bar 50
   μm. Quantifications show significant increase in area of lipid droplets
   in heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female and
   Alb-Cre-ERT2tg; Hcfc1^hepKO/Y knockout male livers in comparison to
   control (n = 4, ***, p ≤ 0.0001; *, p ≤ 0.05,) (B) DAB immunostaining
   for macrophage marker F4/80 (brown). The sections were also stained
   with hematoxylin (blue). Scale bar 25 μm. Quantifications show
   significant increase in percentage area of F4/80 staining in
   heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female and Alb-Cre-ERT2tg;
   Hcfc1^hepKO/Y knockout male livers in comparison to control (n = 4, **,
   p ≤ 0.001; *, p ≤ 0.05,) (C) Sirius red staining of paraffin embedded
   sections. Scale bar 25 μm. Quantifications show significant increase in
   percentage area of sirius red staining in Alb-Cre-ERT2tg; Hcfc1^hepKO/Y
   knockout male livers in comparison to control, while non-significant
   increase in case of heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female
   in comparison to Control (n = 4, **, p ≤ 0.001; n.s., p > 0.05).
   Students’ T test was used to calculate the significance

Fig. 3.

   [109]Fig. 3
   [110]Open in a new tab

   Loss of Hcfc1 leads to rapid progression to NASH-like characteristics
   (A) Sections stained with DAPI (blue) and smooth-muscle -actin (SMA;
   green) antibody. Scale bar 50 μm. Quantifications show significant
   increase in intensity of SMA staining in Alb-Cre-ERT2tg; Hcfc1^hepKO/Y
   knockout male livers in comparison to control and non-significant
   increase in SMA staining intensity in heterozygous Alb-Cre-ERT2tg;
   Hcfc1^hepKO/+ female in comparison to control (n = 4, ****, p < 0.0001;
   n.s., p > 0.05) (B) TUNEL assay of apoptotic cells (green) co-stained
   with HCF-1 antibody (red). TUNEL-positive apoptotic cells are shown in
   green. Scale bar 50 μm. Quantifications show significant increase in
   cell death in heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female and
   Alb-Cre-ERT2tg; Hcfc1^hepKO/Y knockout male livers in comparison to
   control (n = 3, ****, p < 0.0001; *, p ≤ 0.05). C Sections co-stained
   with cleaved caspase 3 (red), SMA (green) antibody and DAPI (blue).
   Scale bar 50 μm. Quantifications show significant increase in intensity
   of cleaved-caspase3 staining in heterozygous Alb-Cre-ERT2tg;
   Hcfc1^hepKO/+ female and Alb-Cre-ERT2tg; Hcfc1^hepKO/Y knockout male
   livers in comparison to control (n = 4, **, p ≤ 0.001; *, p ≤ 0.05,). D
   Cryosections stained with DAPI (blue) and CD31 (green) antibody. Scale
   bar 100 μm. Quantifications show significant increase in intensity of
   CD31positive staining in Alb-Cre-ERT2tg; Hcfc1^hepKO/Y knockout male
   livers in comparison to control (n = 4, *, p ≤ 0.05; n.s., p > 0.05).
   Students’ T test was used to calculate the significance

   Collectively, these findings suggest the development of chronic liver
   injury akin to advanced stages of NAFLD within approximately three
   weeks due to the spontaneous hepatocyte-specific deletion of the Hcfc1
   gene in Hcfc1^hepKO/Y male mice. In contrast, Hcfc1^hepKO/+ female mice
   exhibit milder morphological defects compared to Hcfc1^hepKO/Y male
   mice. While Hcfc1^hepKO/Y male mice exhibit signs of rapid progression
   from NAFL to NASH in approximately three weeks, the Hcfc1^hepKO/+
   female mice eventually begin to show signs of complete recovery over
   time. This recovery is likely driven by the proliferation of HCF-1
   positive hepatocytes, as indicated by the restoration of HCF-1-positive
   cells one month after its induced loss (Additional Figures 6 and 7).

Hepatocytes are unable to proliferate upon loss of HCF-1

   Hepatocyte-specific depletion of HCF-1 leads to increased cell death
   following extensive liver injury. Typically, the liver initiates a
   robust regenerative response to replace lost hepatocytes, with existing
   hepatocytes re-entering the cell cycle to restore liver mass. However,
   we sought to determine if this regenerative response is also activated
   following the loss of HCF-1, as significant hepatocyte death occurs
   under these conditions. We, therefore, utilized these
   Albumin-Cre-ERT2^tg; Hcfc1^KO/+ heterozygous female and
   Albumin-Cre-ERT2^tg; Hcfc1^KO/Y knockout male mice to evaluate the
   effects of both partial and complete HCF-1 loss on the regenerative
   response in the mouse liver following 2/3rd partial hepatectomy (PH).
   Overall morphology of the control, Albumin-Cre-ERT2^tg; Hcfc1^KO/+
   heterozygous female and Albumin-Cre-ERT2^tg; Hcfc1^KO/Y knockout male
   mice livers, were examined by performing HE staining at various time
   points, including 0H, 4H, 12H, 24H, 36H, 48H, 60H, 72H, and 1 week post
   PH (Additional Fig. 8).

   Firstly, we analysed HCF-1 levels with the help of immunoblotting in
   wild-type mice following partial hepatectomy and observed no clear
   upregulation (Additional Fig. 9). To further investigate whether the
   loss of HCF-1 affects liver regeneration at the cellular level, we
   decided to perform immunostaining for a more detailed assessment. Here,
   we began by examining the cell proliferation response in both
   Albumin-Cre-ERT2^tg; Hcfc1^KO/+ heterozygous female and
   Albumin-Cre-ERT2^tg; Hcfc1^KO/Y knockout male mice before and after
   tamoxifen-dependent HCF-1 deletion, prior to PH, as shown in
   Fig. [111]4A (before tamoxifen) and Fig. [112]4B and 4 C (after
   tamoxifen). We utilized Ki67 and histone H3 serine 10 phosphorylation
   (H3S10P), two mitotic markers, for this analysis. Prior to PH, few, if
   at all any, hepatocytes were positive for Ki67 or H3S10P in the control
   (Fig. [113]4A), Albumin-Cre-ERT2^tg; Hcfc1^KO/+ (Fig. [114]4B) and
   Albumin-Cre-ERT2^tg; Hcfc1^KO/Y (Fig. [115]4C) mice livers
   (Fig. [116]4F). We then performed 2/3rd PH to induce a more robust and
   synchronized regenerative response, ensuring that a large number of
   hepatocytes re-enter the cell cycle simultaneously, making the analysis
   more pronounced and easier to observe. Interestingly, within 48 h of
   2/3rd PH, we observed that only HCF-1-positive hepatocytes in
   Hcfc1^KO/+ female mice rapidly entered the cell division cycle, as
   evidenced by increased Ki67 expression only in patches of
   HCF-1-positive hepatocytes (red arrows in Fig. [117]4D). We also
   observed similar results for two other cell proliferation markers PCNA
   and H3S10P in Hcfc1^KO/+ female mice (Additional Fig. 10). Conversely,
   HCF-1-negative hepatocytes in Hcfc1^KO/+ heterozygous female and
   Hcfc1^KO/Y knockout male mice completely failed to re-enter the cell
   cycle and remained negative for Ki67 (white arrows in Fig. [118]4D and
   E). In fact, in comparison to HCF-1-positive hepatocytes, none of the
   HCF-1-negative hepatocytes were observed to undergo cell proliferation
   (Fig. [119]4G). We observed similar results in Hcfc1^KO/Y knockout male
   mice at different time points post 2/3rd PH until 6 days, wherein only
   few HCF-1 positive hepatocytes that either remained as escapers or were
   a result of transdifferentiation entered cell division (Additional Fig.
   11). These results indicate the vital role of HCF-1 in facilitating
   hepatocyte re-entry into the cell cycle during the regeneration
   process. Immunostaining for Ki67 in control, however showed rapid
   proliferation of hepatocytes thus mounting a strong regenerative
   response post-PH (Additional Fig. 12).

Fig. 4.

   [120]Fig. 4
   [121]Open in a new tab

   HCF-1-depleted hepatocytes fail to proliferate upon partial
   hepatectomy. Immunofluorescence analysis of cell-cycle progression
   markers of 10-week old control (0d Ctrl WT; panels A), heterozygous
   Alb-Cre-ERT2^tg; Hcfc1^hepKO/+ female (7d HET; panels B and D) and
   knockout Alb-Cre-ERT2^tg; Hcfc1^hepKO/Y male livers (7d KO; panels C
   and E) 7 days post-tamoxifen treatment before (pre PH) and 48 h after
   being additionally subjected to 70% PH (48H PH). The paraffin-embedded
   sections of livers before (panels A, B, C, D, and E) and 48 h after PH
   (panels G and H) were stained with DAPI (blue), one of two
   cell-proliferation markers shown in red: H3S10P (red; panels A, B and
   C), and Ki67 (red; panels D and E), and anti-HCF-1 (green; panels A, B,
   C, D and E). In panels A, B and C yellow arrows point towards
   HCF-1-positive non-hepatocytes that are positive for cell proliferation
   marker H3S10P. The red arrows in panels A and B point towards the
   HCF-1-positive hepatocytes that are positive for cell proliferation
   marker H3S10P. In panel D, the HCF-1-positive hepatocytes (red arrows)
   are positive for cell proliferation marker Ki67. In panels D and E, the
   HCF-1-negative hepatocytes (white arrows) are negative for the Ki67,
   whereas the HCF-1-positive non-hepatocytes (yellow arrows; panel E) are
   positive for Ki67. The indented circles in D reflect some of the
   visible HCF-1-negative hepatocyte clusters. Scale bar: 50 μm.
   Percentages of HCF-1 positive hepatocytes also positive for H3S10P were
   calculated for 0 d Ctrl WT, heterozygous Alb-Cre-ERT2^tg; Hcfc1^hepKO/+
   female and knockout Alb-Cre-ERT2^tg; Hcfc1^hepKO/Y male mice livers
   prior to PH (panel F, n = 4, n.s., p > 0.05). Quantifications for
   percentages of HCF-1-positive and HCF-1-negative hepatocytes also
   positive for Ki67 were done 48 h post PH in heterozygous
   Alb-Cre-ERT2^tg; Hcfc1^hepKO/+ female mice (panel G, n = 4, ****, p <
   0.000.1). Students’ T test was used to calculate the significance

   The notable disparity between the responses of Hcfc1^hepKO/+ female and
   Hcfc1^hepKO/Y male mice to the extensive liver injury upon HCF-1 loss,
   therefore, primarily arises from the fact that HCF-1-deficient
   hepatocytes are unable to participate in the regenerative response.
   Hence,Hcfc1^hepKO/Y male mice to succumb to death while the
   Hcfc1^hepKO/+ female mice recuperate. Consequently, Hcfc1^hepKO/Y male
   mice not only serve as a model for the spontaneous development of NAFLD
   but also as a model lacking regenerative capabilities.

Presence of HCF-1 at transcriptional start sites correlates with
transcriptional activity

   Having established that the loss of HCF-1 hinders hepatocyte entry into
   the cell cycle, effectively blocking their regenerative capacity and
   contributing to the progression of NAFLD, we next sought to investigate
   the potential mechanisms underlying the effects observed upon loss of
   HCF-1. HCF-1 regulates gene expression by interacting with various
   transcription factors, leading to activation or repression of the
   target genes. In HeLa cells, HCF-1 was found to be bound to CpG-rich
   promoters of 5400 genes while, in the embryonic stem cells (ESCs),
   HCF-1 was observed at the transcriptional start sites of 743 promoters
   [[122]31, [123]50]. This disparity hints at a context-dependent role
   for HCF-1 in gene regulation.

   Given the association of HCF-1 with several transcription start sites
   (TSSs) in mouse livers, we wondered whether HCF-1-bound and -unbound
   TSSs might differ in associated transcriptional activity. To understand
   how the depletion of HCF-1 affects transcriptional regulation, we first
   began by performing immunostainings for investigating the presence of
   H3K4me3 mark, a modification associated with transcriptional activity,
   on control, Hcfc1^hepKO/Y male and Hcfc1^hepKO/+ female livers.
   Interestingly, it was observed that upon loss of HCF-1, the H3K4me3
   signal appeared to be significantly reduced in HCF-1-depleted
   Hcfc1^hepKO/Y male livers as compared to the control livers after
   7 days of tamoxifen treatment, indicating probable reduction in
   transcription of genes regulated by HCF-1 (Fig. [124]5). These results
   suggest that HCF-1 can have a major impact (direct or indirect) on
   epigenetic status. Thus, these findings shed new light on the role of
   HCF-1 in influencing the presence of H3K4me3 mark, highlighting its
   context-specific interactions, and underscoring its significance in
   governing gene expression that warrants further investigation.

Fig. 5.

   [125]Fig. 5
   [126]Open in a new tab

   Hepatocytes lacking HCF-1 have significantly lowered H3K4me3 signal.
   Immunofluorescence analysis of active transcription marker H3K4me3 in
   (A) control Hcfc1^lox/Y, B heterozygous Alb-Cre-ERT2tg; Hcfc1^hepKO/+
   female and (C) Alb-Cre-ERT2^tg; Hcfc1^hepKO/Y male mice, post-tamoxifen
   treatment. The paraffin-embedded liver sections of control Hcfc1^lox/Y,
   Hcfc1^hepKO/+, and Hcfc1^hepKO/Y mice were stained with DAPI (blue),
   anti-H3K4me3(green). The area marked with indented rectangle in panels
   A3, B3, and C3 is shown at high magnification in A4, B4, and C4,
   respectively. Scale bar: 50 μm. D Percentage of H3K4me3 positive
   hepatocytes were calculated in control Hcfc1^lox/Y, heterozygous
   Alb-Cre-ERT2tg; Hcfc1^hepKO/+ female and Alb-Cre-ERT2^tg; Hcfc1^hepKO/Y
   male mice (n = 4, **, p ≤ 0.001; ***, p ≤ 0.0001). Students’ T test was
   used to calculate the significance

   The enrichment of H3K4me3 marks and presence of RNA polymerase II near
   the transcription start sites (TSSs) is indicative of active
   transcription and robust gene expression [[127]51]. Hence, we performed
   chromatin immunoprecipitation followed by high-throughput sequencing
   (ChIP-Seq) analyses for trimethylated H3K4 (H3K4Me3) and RNA polymerase
   II (POL2) in both control (Day 0) and Hcfc1 knockdown livers after 4-
   and 7-days post induction of hepatocyte-specific Hcfc1 gene disruption.
   Additionally, HCF-1 genomic localization was also investigated in the
   murine liver at days 0 (control), 4, and 7 after induction of
   hepatocyte-specific Hcfc1 gene disruption.

ChIP-Seq peaks signals associated with HCF-1, POL2, and H3K4me3

   The distribution of peaks across different chromosomes at day 0, 4 and
   7 is visually depicted in circos plot Fig. [128]6A. Intriguingly,
   annotation of these peaks revealed a noteworthy pattern. Though HCF-1
   is known to bind to TSS, we also observed a notable enrichment of HCF-1
   peaks at locations other than TSS. Approximately 28% of
   HCF-1-associated peaks were found within the promoter-TSS regions,
   while peaks for H3K4me3 marks enriched around TSS regions were
   estimated to be 32%. POL2 related signals showed maximum enrichment in
   TSS regions, about 42%. This insightful delineation of peak
   distribution is represented in the stacked bar plot presented in
   Fig. [129]6B. These findings display the genomic occupancy of HCF-1 and
   its associated factors, offering an insight into their roles in
   transcriptional regulation across different genomic contexts.

Fig. 6.

   [130]Fig. 6
   [131]Open in a new tab

   A Circos plot depicting the distribution of a) HCF-1 b) POL2 and c)
   H3K4me3 peaks. Red, blue and green colors represent day 0, day 4 and
   day 7 respectively. Bioconductor package circlize was used with mm10 as
   the reference genome. B Stacked bar plot showing the genomic annotation
   by functional region of HCF-1, POL2 and H3K4me3 peak signals.
   Annotation was obtained from HOMER. Associated data is available in
   Additional file 1

   As shown in the circos plot (Fig. [132]6A) there were about 390 HCF-1
   associated peaks on day 0, and as anticipated, these numbers decreased
   over time in day 4 and 7 post-tamoxifen induction in Hcfc1^hepKO/Y male
   mice. Moreover, there were different trends observed for HCF-1
   associated peak signals as shown in the heatmap (Fig. [133]7A)—(i) a
   continuous decrease in the signal intensity from day 0 to day 7 [D0
   > D4 > D7], (ii) a decrease in the signal intensity from day 0 to day
   4, followed by a slight increase on day 7, however, the signal on day 7
   was still less compared to that on day 0 [D0 > D4 < D7], (iii) a
   decrease in signal intensity from day 0 to day 4, which then remained
   constant from day 4 to day 7 [D0 > D4 = D7], (iv) the peak signal
   increased from day 0 to day 4, but the signal intensity on day 7 was
   again less in comparison to day 0 [D0 < D4 > D7] and at last (v) the
   signal intensity remained same from day 0 to day 4, followed by a
   decrease on day 7 [D0 = D4 > D7]. Overall, these trends demonstrate a
   progressive loss of HCF-1 signal over time. Figure [134]7B shows two
   genes, Denr and Pura, where the peak signal was found to be decreasing
   from day 0 to day 7. This loss of HCF-1 signals coincided with
   alterations in H3K4me3 and POL2 signals, indicating substantial
   transcriptional changes in genes regulated by HCF-1, leading to
   subsequent up- or down-regulation of other affected downstream target
   genes.

Fig. 7.

   [135]Fig. 7
   [136]Open in a new tab

   A Heatmap displaying decreasing trends [D0 > D4 > D7], [D0 > D4 < D7],
   [D0 > D4 = D7], [D0 < D4 > D7] in HCF-1 peak signals. Here * represent
   the [D0 = D4 > D7] trend. The color key indicates the associated row
   z-score. B Visual representation of HCF-1 ChIP-Seq profiles mapped on
   the genes Denr and Pura for day 0, 4 & 7 showing continuous decrease
   trends [D0 > D4 > D7] C) Gene ontology (GO) of the genes i.e.
   Biological process (BP), Molecular Function (MF) and Cellular component
   (CC) associated with regions where HCF-1 peak signals were decreasing
   with time. D Pathway analysis of the genes associated with regions
   where HCF-1 peak signals were decreasing with time. The enrichment in a
   specific process and pathway was measured by DAVID. The p-value was
   determined by Fisher's Exact test. E Top ten transcription factor
   motifs overrepresented in HCF-1 peak regions, found using HOMER. Data
   associated with each figure is given in Additional file 2

Potential pathways controlled by HCF-1

   The dysregulated peak signals (identified from the comparison between
   day 0, day 4 and day 7) that were directly associated with the genes
   were then analyzed to get the associated gene ontologies and enriched
   pathways to infer biological significance (Fig. [137]7C&D). This
   analysis revealed multiple pathways and processes in which these genes
   were enriched. GO Biological processes such as cell cycle, cell
   proliferation, multicellular organism development and terms related to
   mitosis and transcription were enriched. Pathways related to MAPK
   signaling pathway, lipid and atherosclerosis, adaptive immune system,
   sphingolipid signaling pathway, cellular response to stimulus and
   stress and transcription were found to be enriched. Dysregulation in
   signaling pathways can disrupt critical cellular processes closely
   linked to NAFLD development. The enrichment in developmental processes
   may impact liver tissue regeneration and maintenance, which could
   hinder recovery from HCF-1 loss, a contributing factor to NAFLD.
   Perturbations in cellular and biological processes may influence lipid
   metabolism, a key element in NAFLD pathogenesis. Genes associated with
   stimulus response may affect the liver's susceptibility to injury,
   inflammation, and oxidative stress, all of which are implicated in
   NAFLD. Dysregulated localization and transportation processes can lead
   to lipid accumulation, again a hallmark of NAFLD. Aberrations in
   metabolic pathways are directly linked to lipid build up in the liver,
   insulin resistance, and hepatic inflammation, all critical factors in
   NAFLD development. Hence, the combined effect of these dysregulated
   pathways and processes may disrupt the delicate balance of liver
   function, ultimately contributing to the development of NAFLD due to
   Hcfc1 loss. Thus, this categorization presents the overall impact of
   HCF-1 dysregulation on diverse biological processes and pathways in
   murine liver, hence, shedding light on the molecular events triggered
   by HCF-1 modulation.

Binding partners of HCF-1

   HCF-1 is a co-transcriptional regulator, and therefore it interacts
   with the DNA with the help of other transcription factors and DNA
   modulators. To be confident about the peak signals associated with
   HCF-1 being analysed, we further searched for recurrent motifs in the
   DNA regions where peaks were observed. The top ten motifs with p-value
   ≤ 0.01 found to be enriched in the HCF-1 associated peak regions, along
   with their matching transcription factors are shown in Fig. [138]7E.
   This list contained well known HCF-1 binding partners like THAP, KLF10,
   E2F and ZNF143 [[139]50, [140]52]. We also found some other
   transcription factors that could potentially be interacting with HCF-1
   and can be explored further. The complete list of significantly
   enriched motifs and corresponding transcription factors can be found in
   the Additional file 2.

Annotation of HCF-1 peak signals localized in intergenic regions

   As shown in Fig. [141]6B, a lot of the HCF-1 signals were found in the
   intergenic regions (regions located between two different genes) and
   hence could not be directly associated with a functional annotation.
   Therefore, these regions were explored for their potential using HOMER,
   which presents chromatin state annotations derived from ChIP-seq of
   histone modifications [[142]53]. Many of these intergenic regions with
   HCF-1 peak signals were found to be in one of the following categories-
   (i) Simple repeat (ii) Short Interspersed Nuclear Element (SINE) (iii)
   Long Interspersed Nuclear Element (LINE) (iv) Low complexity (v)
   Cytosine-phosphate-Guanine (CpG) (vi) signal recognition particle RNA
   (srpRNA) (vii) Satellite (viii) Young repetitive elements (YREP_Mm)
   (ix) tRNA and (x) intergenic regions as shown in Fig. [143]8A. These
   annotated intergenic sites were analyzed for their sequence features
   and matched with transcription factors using ORegAnno [[144]54]
   (Fig. [145]8B). The significantly enriched transcriptional factors were
   studied for their functional roles in the cells to infer their
   biological significance (Table [146]3). As previously noted, these
   transcription factors were involved in transcriptional regulation,
   methylation activity, chromatin remodelling and many more.

Fig. 8.

   [147]Fig. 8
   [148]Open in a new tab

   A Donut chart representing the percentage of functional annotation of
   intergenic regions with HCF-1 peak signals. Epigenomic resource of
   HOMER was utilized for the annotation. B Sunburst chart displaying the
   transcription factors mapped for the annotated intergenic sites with
   HCF-1 peak signals. Associated data is available in Additional file 3

Table 3.

   Functional role of significantly enriched transcription factors mapped
   to regulatory sites present in the intergenic region interacting with
   HCF-1
   Transcription Factor Function
   Stat1 Signal transducer and transcription activator that mediates
   cellular responses to interferons (IFNs), cytokine KITLG/SCF and
   others, and growth factors. Also leads to activation of the JAK-STAT
   signaling pathway
   Foxa2 Involved in longevity regulating pathway. Involved in the
   development of multiple endoderm-derived organ systems such as the
   liver, pancreas, and lungs. Essential for hepatic specification and
   bile duct formation, IL-6 induced fibrinogen beta transcriptional
   activation. Transcription activator for number of liver genes such as
   AFP, albumin, tyrosine aminotransferase, PEPCK etc. Onset of diabetes-
   Involved in glucose homeostasis, regulates fat metabolism, activates
   transcriptional programs of lipid metabolism and ketogenesis at low
   insulin state
   Klf1/Elkf Transcription regulator of erythrocyte development. Binds to
   the CACCC box in the beta-globin gene promoter and activates
   transcription. When SUMOylated, acts as a transcriptional repressor by
   promoting interaction with CDH2/MI2beta and also represses
   megakaryocytic differentiation
   Tbx3 Involved in signaling pathways regulating pluripotency of stem
   cells
   Cdx1 Plays a role in transcriptional regulation. Involved in activated
   KRAS-mediated transcriptional activation of PRKD1 in colorectal cancer
   (CRC) cells
   Mtf2 Regulates the transcriptional networks during embryonic stem cell
   self-renewal and differentiation. Enhances PRC2 H3K27me3 methylation
   activity
   Spi1 Controls hematopoietic cell fate by decompacting stem cell
   heterochromatin and allowing other transcription factors to enter
   otherwise inaccessible genomic sites
   Jarid2 Regulator of histone methyltransferase complexes that plays an
   essential role in embryonic development, including heart and liver
   development. Binds DNA and mediates the recruitment of the PRC2
   (Polycomb Repressive Complex 2 Subunit) complex to target genes in
   embryonic stem cells, thereby playing a key role in stem cell
   differentiation and normal embryonic development
   Ezh2 This gene encodes a member of the Polycomb-group (PcG) family. PcG
   family members form multimeric protein complexes, which are involved in
   maintaining the transcriptional repressive state of genes over
   successive cell generations
   Suz12 Polycomb group (PcG) protein. Component of the PRC2 complex,
   which methylates'Lys-9'(H3K9me) and'Lys-27'(H3K27me) of histone H3,
   leading to transcriptional repression of the affected target gene.The
   PRC2 complex may also serve as a recruiting platform for DNA
   methyltransferases, thereby linking two epigenetic repression systems
   Erg This gene encodes a member of the erythroblast
   transformation-specific (ETS) family of transcriptions factors. All
   members of this family are key regulators of embryonic development,
   cell proliferation, differentiation, angiogenesis, inflammation, and
   apoptosis
   Ebf1 Enable DNA-binding transcription activator activity, RNA
   polymerase II-specific and RNA polymerase II cis-regulatory region
   sequence-specific DNA binding activity
   Atoh1 Enables sequence-specific double-stranded DNA binding activity.
   Predicted to be involved in neuron differentiation; positive regulation
   of neuron differentiation; and regulation of transcription by RNA
   polymerase II
   [149]Open in a new tab

Changes in gene expression profiles and its regulation by methylation upon
loss of HCF-1

   In line with the experimental results, many genes involved in the
   process of cell cycle were found to be dysregulated (as inferred from
   ChIP-seq analysis of Hcfc1 KO group, HCF-1 peak signals decreasing over
   time). Some of the major players included Brd7 (bromodomain containing
   7), Ppp2r5b (protein phosphatase 2 regulatory subunit B), Cdk6 (cyclin
   dependent kinase 6), Cdk12 (cyclin dependent kinase 12) and Cdc27 (cell
   division cycle 27). These genes are known to play vital roles in the
   control of cell cycle progression, DNA repair, and genomic stability,
   respectively. Their proper functioning is crucial for normal cellular
   development, tissue homeostasis, and efficient regeneration processes.
   Additionally, many genes associated with liver regeneration process
   were also found enriched in regions where the POL2 and H3K4me3 peak
   signals decreased from day 0 to day 7. Some selected genes and their
   functions have been listed in Table [150]4).

Table 4.

   Genes associated with liver regeneration were found to be downregulated
   upon loss of Hcfc1
   Genes Function References