Abstract

   Equine asthma is a chronic respiratory disease characterised by
   neutrophilic inflammation, airway hyperresponsiveness, and impaired
   pulmonary function. Obesity, increasingly prevalent among domestic
   horses, has been identified as a potential risk factor for exacerbating
   inflammatory conditions. This study aimed to explore whether obesity
   modifies neutrophil metabolism and inflammatory responses in horses
   affected by asthma. Six asthmatic horses in clinical remission were
   categorised into two groups: obese and non-obese, based on body
   condition score. Serum levels of interleukin-1β (IL-1β) and peripheral
   blood neutrophil counts were significantly higher in obese horses,
   indicating a heightened systemic inflammatory state. Neutrophils from
   obese horses displayed a stronger oxidative burst following zymosan
   stimulation and elevated IL-1β gene expression in response to
   lipopolysaccharide, suggesting a hyperinflammatory phenotype.
   Metabolomic profiling of neutrophils identified 139 metabolites, with
   notable differences in fatty acids, branched-chain amino acids, and
   tricarboxylic acid (TCA) cycle intermediates. Pathway enrichment
   analysis revealed significant alterations in fatty acid biosynthesis,
   amino acid metabolism, and glutathione-related pathways. Elevated
   levels of itaconate, citraconic acid, and citrate in obese horses
   indicate profound metabolic reprogramming within neutrophils. These
   results suggest that obesity promotes a distinct neutrophil phenotype
   marked by increased metabolic activity and heightened responsiveness to
   inflammatory stimuli. This altered profile may contribute to the
   persistence or worsening of airway inflammation in asthmatic horses.
   The findings underscore the importance of addressing obesity in the
   clinical management of equine asthma and open avenues for further
   research into metabolic-targeted therapies in veterinary medicine.

1. Introduction

   Equine asthma is a human asthma-like condition that develops in mature
   horses following stabling and exposure to dusty hay and straw [[38]1].
   The term “equine asthma” encompasses the previous names of recurrent
   airway obstruction (RAO) and inflammatory airway disease (IAD), which
   are now considered moderate-to-severe and mild forms, respectively, of
   a single disease; moreover, several authors suggest that equine asthma
   is the study model of neutrophilic asthma in humans
   [[39]2,[40]3,[41]4]. Aspergillus fumigatus, an opportunistic fungus, is
   commonly found in environments surrounding horses and is considered to
   be one of the inciting agents in equine asthma [[42]5]. Asthma-affected
   horses respond to this exposure by developing an increase in airflow
   resistance due to neutrophilic inflammation, mucus accumulation, and
   airway hyper-responsiveness, with a decrease in pulmonary function
   [[43]1]. In general, airway inflammation in asthma horses involves the
   activation of pathogenic specific inflammatory cells, modulation of
   gene transcription factors, and release of inflammatory mediators
   [[44]6].

   Obesity is defined by the World Health Organization (WHO) as the
   abnormal or excessive accumulation of fat that can be harmful to the
   body, and is currently considered a global epidemic [[45]7,[46]8]. The
   worrying increase in overweight and obesity in today’s society is not
   limited to humans, with significant increases reported in companion and
   domestic animals [[47]9,[48]10]. In horses, numerous quantitative
   studies have also described a sustained growth in the prevalence of
   overweight and obesity [[49]11,[50]12,[51]13], principally attributable
   to poor management practices, such as inappropriate feeding regimes and
   limited exercise [[52]14]. Furthermore, obesity is often poorly
   recognised by owners, who tend to underestimate the body condition
   score (BCS) of their animals [[53]15].

   The relationship between obesity and human severe asthma appears to be
   weight-dependent, causal, partly genetic, and probably bidirectional
   [[54]16]. Several studies suggest the existence of an excess risk of
   developing asthma in obese subjects compared with lean subjects,
   regardless of gender or age
   [[55]17,[56]18,[57]19,[58]20,[59]21,[60]22,[61]23,[62]24,[63]25] and
   appears stronger for those with central adiposity [[64]26,[65]27].
   Adipose tissue plays a role in the regulation of inflammation and
   immune function through the secretion of adipokines such as leptin
   (pro-inflammatory) and adiponectin (anti-inflammatory) [[66]28,[67]29].
   In line with this, in asthmatic-obese subjects there is a rise in the
   serum concentrations of the pro-inflammatory adipokine leptin whereas
   adiponectin levels are decreased [[68]30]. Furthermore, severe asthma
   is extremely common in patients with obesity [[69]31]. A study reported
   that well over 50% of severe asthmatics were obese [[70]32], suggesting
   a relationship between both diseases [[71]33]. Furthermore, human obese
   patients tend to have more severe asthma that does not respond as well
   to conventional therapy compared with lean asthmatics [[72]34]. Obese
   asthma patients are more at risk than lean asthma patients, as obesity
   has profound effects on the immune system and physiological function
   [[73]35]. In horses, one study shows that obesity, defined by having a
   BCS of 7 points or higher, is a risk factor for the development of
   equine asthma [[74]36].

   The activation of immune cells exerts a profound influence on cellular
   metabolic pathways, enhancing the generation of energy and biosynthetic
   precursors required to sustain inflammatory processes and cell
   proliferation. During the last few years, much evidence has been
   generated about the role of cellular metabolism in the regulation of
   certain effector processes [[75]37]. Studies mainly performed on
   macrophages and dendritic cells show how cells adapt their metabolism
   depending on certain signals sensed from their environment. Upon
   activation, these cells exhibit enhanced aerobic glycolysis (the
   Warburg effect), accompanied by a reduction in oxidative
   phosphorylation (OXPHOS), fatty acid oxidation (FAO), and Krebs cycle
   activity [[76]38,[77]39].

   In the case of neutrophils, primary cytotoxic cells responding to
   inflammatory signals, in contrast to what was previously believed, do
   not represent only a homogeneous population of terminally
   differentiated cells but show high heterogeneity and phenotypic
   plasticity [[78]40,[79]41]. During maturation, neutrophils are
   primarily dependent on OXPHOS, FAO, and the pentose phosphate pathway
   (PPP). Subsequently, in a steady state, they rely mainly on glucose and
   lipid metabolism to sustain their survival and maintain redox balance.
   Upon activation in response to inflammatory stimuli or infections,
   neutrophils depend almost exclusively on aerobic glycolysis
   [[80]42,[81]43]. On the other hand, it has been shown that
   mitochondrial metabolism plays a key role in effector function by
   modulating chemotaxis, cytokine production, NET formation, and ROS
   generation [[82]44,[83]45,[84]46,[85]47].

   Given the central role of neutrophils in equine asthma and their
   potential association with obesity in the development of more severe
   disease phenotypes, the aim of this study was to investigate whether
   differences in inflammatory markers exist and to evaluate their
   relationship with metabolic status and neutrophils functional activity
   in non-obese versus obese asthmatic horses in remission.

2. Materials and Methods

2.1. Animals

   Three obese and three non-obese horses with naturally occurring asthma
   in clinical remission were included in this study. The diagnosis of
   severe asthma in the animals was established through a general clinical
   examination and bronchoalveolar lavage (BAL). At the time of diagnosis,
   all horses exhibited a clinical score above 15, based on a scoring
   system described by Lavoie at al. [[86]48]. Cytological analysis of the
   BAL fluid confirmed a neutrophilic asthma phenotype in all cases,
   characterised by a neutrophil proportion exceeding 20%. During clinical
   remission, the horses showed no respiratory clinical signs, such as
   coughing, dyspnoea, or nasal discharge, and BAL cytology revealed a
   neutrophil percentage below 8%. The animals were aged between 5 and 12
   years, belonged to the Chilean Criollo crossbreed, and comprised four
   mares and two geldings. None of the horses had received corticosteroid
   or bronchodilator treatment for at least two months prior to this
   study. All horses belong to the teaching and research herd of the
   Universidad Austral de Chile. Inclusion criteria for obese asthmatic
   horses include BCS score ≥7/9, based on a 9-point scale (wrinkles under
   the loin, difficulty in palpating the ribs, very soft fat around the
   root of the tail, fat around the withers and behind the shoulder,
   noticeable thickening of the neck, and fat deposited along the inner
   thigh) [[87]49]. The animals were kept in the stables of the Veterinary
   Teaching Hospital or in their paddocks and were dewormed and clinically
   evaluated on a regular basis. All experimental procedures were approved
   by the Bioethics Committee for the Use of Animals in Biomedical
   Research of the Universidad Austral de Chile (n°497/2023).

2.2. Polymorphonuclear Isolation

   The isolation of blood neutrophils was performed as previously
   described by our group [[88]50]. Briefly, 10 mL of blood obtained by
   jugular venipuncture was placed in sterile tubes containing 1 mL of
   3.8% w/v sodium citrate. Blood was placed on a discontinuous density
   gradient (Percoll, GE Healthcare, Uppsala, Sweden), with 4 mL of 85%
   Percoll in the bottom of a 15 mL tube and 4 mL of 70% Percoll above.
   After centrifugation (45 min, 670× g), the lower layer containing
   neutrophils, was aspirated for further processing. Granulocyte cell
   purity and viability were assessed by flow cytometry (BD FACS Canto
   II). Viability was assessed using an Annexin V assay as previously
   described by our group [[89]50]. Cells were subsequently prepared for
   bioassays.

2.3. Sample Preparation for Metabolomics Analysis

   Samples were prepared using methodology described in previous papers by
   this group [[90]51,[91]52]. Polymorphonuclear neutrophils (1 × 10^7)
   were cryofractured with liquid nitrogen, and metabolites were extracted
   using cold acetonitrile/isopropanol/water (3:3:2, v/v/v) containing
   ribitol as an internal standard. After vortexing and centrifugation,
   the supernatant was dried in a SpeedVac (Thermo Fisher Scientific Inc,
   Waltham, MA, USA), reconstituted in acetonitrile/water (1:1), and
   centrifuged again. A second drying step was followed by addition of
   FAMEs (as retention index markers) and methoxyamine hydrochloride for
   oximation. Samples were incubated at 30 °C, then derivatised with MSTFA
   + 1% TMCS at 37 °C. The final derivatised extracts were transferred to
   glass vials for GC-MS analysis.

2.4. Metabolomics Analysis by GC-MS

   The metabolomic analysis was previously published by our group
   [[92]51,[93]52]. Derivatised samples were analysed using an Agilent
   7890B GC coupled to a 5977A mass selective detector in electron impact
   mode (Santa Clara, CA, USA), with a DB-5 column and splitless injection
   of 1 μL. The oven temperature was ramped from 60 to 325 °C over 37.5
   min. Mass spectra were acquired in full-scan mode (m/z 50–600). Raw MS
   data were converted to ABF format and processed using MSDIAL 2.83 for
   peak detection, deconvolution, and alignment. Metabolite identification
   was based on spectral matching against NIST and Fiehn libraries using
   retention index (RI) and EI-MS similarity, applying thresholds of RI
   tolerance ≤ 2000, EI similarity ≥ 70%, m/z tolerance ≤ 0.5 Da, and RT
   tolerance ≤ 0.5 min.

2.5. Respiratory Burst Production

   Reactive oxygen species (ROS) production by polymorphonuclear
   neutrophils (PMNs) was assessed using a luminol-dependent
   chemiluminescence assay adapted for equine neutrophils [[94]53].
   Briefly, neutrophils isolated from obese and non-obese asthmatic horses
   were resuspended at a concentration of 1 × 10^6 cells/mL in Hank’s
   Balanced Salt Solution. The respiratory burst was triggered by
   stimulation with opsonised zymosan (0.1 mg/mL), followed by the
   addition of luminol (80 µM; Sigma Chemical Co., St. Louis, MO, USA) to
   each well. Negative controls consisted of unstimulated neutrophils
   incubated with luminol alone. Chemiluminescence, generated by the
   reaction between luminol and superoxide anion (O[2]^−) or its
   dismutation products, was recorded over a 1 h incubation period at 37
   °C using a Victor 2030 luminometer (Perkin Elmer, Waltham, MA, USA).

2.6. Enzyme Linked Immunosorbent Assay (ELISA) Analysis

   Plasma concentrations of secreted IL-1β were quantified in obese and
   non-obese asthmatic horses using a commercial equine-specific ELISA kit
   (MyBioSource, San Diego, CA, USA), following the manufacturer’s
   instructions. The assay had a detection range of 31.25 to 2000 pg/mL
   and an inter-assay variability of 8%. Absorbance was measured at 450 nm
   using a Varioskan Flash multimode plate reader (ThermoFisher
   Scientific, Waltham, MA, USA). A four-parameter logistic (4PL) model
   was applied to generate the standard curve and to analyse the data,
   using GraphPad Prism software (version 9.1.0; GraphPad Software Inc.,
   Boston, MA, USA).

2.7. Real Time Quantitative PCR Analysis

   To evaluate the IL-1β gene expression in obese and non-obese asthmatic
   horses, neutrophils were plated onto 24 well plates (1 × 10^7
   cells/well), and then stimulated with 200 ng/mL of LPS for 2.5 h at 37
   °C and 5% CO[2], and finally incubated for 1 h with nigericin (5 µM).
   The RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA,
   USA). The RNA (2 µg) was reverse transcribed using the superscript III
   enzyme, according to the manufacturer’s instructions (ThermoFisher
   Scientific). Gene amplification was performed with the RT-qPCR
   (StepOneTM, ThermoFisher Scientific, Waltham, MA, USA) method using
   SYBR green Master Mix (Takyon EU.UF RSMT B0701). The sequences of the
   primer pair used in this study are as follows: IL 1β (gene ID:
   100034237): F-5′AGTACCCGACACCAGTGACA 3′; R- 5′GCCACAATGATTGACACGACA 3′
   (product length 201 bp). The primers used in this study were designed
   by our laboratory using Primer Blast software
   [95]https://www.ncbi.nlm.nih.gov/tools/primer-blast (accessed on 1 July
   2023). Relative gene expression levels were normalised to the
   housekeeping gene HPRT1 (gene ID: 100034149) (hypoxanthine-guanine
   phosphoribosyltransferase 1) using the following primers: forward
   5′-GGTGAATACGGGACCTCTCG-3′ and reverse 5′-TGCATTGTTTTACCAGTGTCAA-3′
   (product length 121 bp). Expression values were calculated using the
   comparative cycle threshold method (2^−∆∆Ct method) [[96]19], with
   analysis performed in StepOne™ software version 2.3 (Applied
   Biosystems, Waltham, MA, USA).

2.8. Statistics Analysis

   Graph generation and statistical analyses were performed using GraphPad
   Prism (GraphPad Software Inc., version 10.2.2, Boston, MA, USA) and
   SigmaPlot (Systat Software Inc., version 11.0, San Jose, CA, USA). The
   Kolmogorov–Smirnov test confirmed that the data were normally
   distributed. Comparisons between obese and non-obese asthmatic horses
   were made using the Student’s t-test, which enabled the assessment of
   differences in reactive oxygen species (ROS) production. Area under the
   curve (AUC) values for respiratory burst production, expression, and
   IL-1β levels were also calculated. A p-value of <0.05 was considered
   statistically significant. MetaboAnalyst software version 6.0
   ([97]http://www.metaboanalyst.ca (accessed on 11 May 2024)) was
   employed for all multivariate metabolomics analyses [[98]54].
   Metabolites that were frequently (>50%) below the limit of detection or
   had ≥50% missing values were excluded from the analysis. Ribitol was
   used as an internal standard for the normalisation of metabolite
   concentrations. Prior to statistical analysis, data were
   log-transformed and auto-scaled to approximate a Gaussian distribution
   [[99]54]. Partial Least Squares-Discriminant Analysis (PLS-DA) was
   conducted using MetaboAnalyst v4.0.

3. Results

3.1. Asthmatic Obese Animals Exhibit Higher Levels of Circulating IL-1β

   As shown in [100]Figure 1, obese asthmatic horses exhibited
   significantly elevated systemic markers of inflammation compared to
   their non-obese counterparts. Basal serum concentrations of
   interleukin-1β (IL-1β) were markedly higher in the obese group (226.5 ±
   21,979 pg/mL) than in the non-obese group (29 ± 218 pg/mL; p < 0.01)
   ([101]Figure 1A), indicating a pronounced pro-inflammatory state. In
   addition, the total peripheral neutrophil count was significantly
   increased in obese asthmatic horses (5301 ± 1196 PMNs/mm^3) compared to
   non-obese animals (3105 ± 360 PMNs/mm^3; p < 0.05) ([102]Figure 1B).
   Together, these findings suggest a potential association between
   obesity and enhanced innate immune responses in equine asthma,
   reflected by elevated circulating IL-1β levels and increased neutrophil
   counts. Nevertheless, these observations should be interpreted with
   caution, as they may not be generalisable and could be subject to
   individual and contextual variability.

Figure 1.

   [103]Figure 1
   [104]Open in a new tab

   Circulating IL-1β levels and total neutrophil counts in non-obese and
   obese asthmatic horses. (A) Serum concentrations of interleukin-1β
   (IL-1β; pg/mL) were significantly higher in obese asthmatic horses
   compared to non-obese counterparts. (B) Total neutrophil counts
   (PMNs/mL) in peripheral blood were also significantly increased in
   obese horses. Bars represent mean ± SEM, n = 3. p < 0.05 (*), p < 0.01
   (**).

3.2. Neutrophils from Obese Asthmatic Animals Display a Distinct Metabolic
Phenotype

   Untargeted metabolomic profiling identified a total of 139 metabolites.
   Upon classification into major chemical categories, these included 21
   monosaccharides and oligosaccharides, 45 carboxylic acids and
   derivatives, 21 amino acids and their metabolites, 7 nucleotides and
   related compounds, 12 alcohols and polyols, and 33 metabolites falling
   under miscellaneous categories. Statistical interrogation of normalised
   data revealed a significant metabolic divergence between neutrophils
   isolated from obese and non-obese asthmatic animals. Supervised
   multivariate modelling via Partial Least Squares-Discriminant Analysis
   (PLS-DA) indicated that principal components 1 and 2 accounted for
   18.7% and 51.3% of the total variance, respectively ([105]Figure 2A). A
   hierarchical clustering heatmap constructed from the 55 most
   discriminant metabolites demonstrated clear segregation of the groups,
   underscoring the metabolic heterogeneity driven by the obese phenotype
   ([106]Figure 2B). [107]Figure 3 illustrates the relative abundance
   (log[10] scale) of selected metabolites in leukocytes from non-obese
   and obese animals. A consistent increase in metabolite levels is
   observed across all panels in obese individuals compared to their
   non-obese counterparts. Notably, key intermediates of the tricarboxylic
   acid (TCA) cycle and immune regulation—such as citric acid, itaconate,
   and oxoproline—are significantly elevated, suggesting alterations in
   mitochondrial metabolism and antioxidant pathways. The observed
   increase in citraconic acid and itaconate may further reflect metabolic
   rewiring associated with immune cell activation.

Figure 2.

   [108]Figure 2
   [109]Open in a new tab

   Heatmap and PLS-DA of neutrophil metabolomic profiles from non-obese
   and obese asthmatic horses. (A) Heatmap representing the relative
   abundance of the 55 metabolites with the lowest p-values, as determined
   by one-way ANOVA, in neutrophils isolated from non-obese and obese
   asthmatic horses. (B) Partial Least Squares-Discriminant Analysis
   (PLS-DA) score plot illustrating the separation of neutrophil
   metabolomic profiles between groups. Each point represents one
   biological replicate, n = 3.

Figure 3.

   [110]Figure 3
   [111]Open in a new tab

   Log[10]-transformed relative abundance of selected metabolites in
   neutrophils from asthma-affected horses and obese asthma-affected
   horses. Obese animals consistently show higher levels of metabolites
   involved in TCA intermediates, amino acid, and lipid metabolism. Each
   dot represents an individual animal; horizontal lines indicate group
   medians, n = 3.

   Profound metabolic perturbations were particularly evident in
   neutrophils derived from obese asthmatic animals, with marked changes
   in pathways related to fatty acid metabolism—including oleic, palmitic,
   stearic, linoleic, arachidic, heptadecanoic, pentadecanoic, lignoceric,
   myristic, lauric, and capric acids. Amino acid metabolism was similarly
   affected, as reflected by increased levels of valine, isoleucine,
   glutamate, aspartate, histidine, lysine, tyrosine, asparagine,
   threonine, proline, glycine, phenylalanine, and serine ([112]Figure 3).
   These changes may indicate enhanced protein turnover or shifts in
   nutrient sensing in immune cells. Taken together, the data suggest that
   obesity induces significant changes in metaboloma of neutrophils,
   characterised by an increased abundance of fatty acids, branched-chain
   amino acids, and TCA intermediates.

3.3. Metabolic Pathway Analysis

   Pathway enrichment analysis of differentially expressed metabolites in
   neutrophils from obese versus non-obese asthmatic horses revealed
   significant alterations in multiple metabolic pathways. Using
   untargeted GC-MS metabolomics and KEGG-based pathway mapping with
   over-representation analysis and pathway topology scoring, several key
   pathways were identified as enriched ([113]Figure 4). These included
   lipid metabolism (biosynthesis of unsaturated fatty acids, linoleic
   acid metabolism), amino acid biosynthesis (valine, leucine and
   isoleucine; phenylalanine, tyrosine, and tryptophan), and glutathione
   metabolism, indicating changes in membrane composition,
   immune-regulatory metabolites, and oxidative stress responses.
   Additionally, pathways involved in alanine, aspartate, and glutamate
   metabolism, as well as dicarboxylate metabolism, were enriched,
   suggesting shifts in nitrogen handling and mitochondrial function.
   These findings would suggest that obesity may influence neutrophil
   metabolic reprogramming in equine asthma, potentially enhancing
   inflammatory responses.

Figure 4.

   [114]Figure 4
   [115]Open in a new tab

   Metabolic pathways altered between neutrophils asthma-affected horses
   and obese asthma-affected horses. All matched pathways according to the
   p-values from enrichment analysis, and pathway impact values from the
   pathway topology analysis are shown, n = 3.

3.4. Neutrophils Isolated from Obese Asthmatic Animals Demonstrate a
Heightened Responsiveness to Pro-Inflammatory Stimuli

   [116]Figure 5A illustrates the kinetics of the oxidative burst in
   peripheral blood neutrophils from non-obese and obese asthmatic horses
   following stimulation with opsonised zymosan. Time-resolved
   chemiluminescence profiles were used to monitor reactive oxygen species
   (ROS) production over a 10,000 s period. Neutrophils were either left
   unstimulated (C- or exposed to zymosan (C+), and the resulting
   chemiluminescence signals—expressed in arbitrary light units—reflect
   the dynamic ROS response. The traces represent the mean ROS production
   per condition for each group. The cumulative oxidative response,
   quantified as the area under the chemiluminescence curve (AUC), was
   significantly higher in neutrophils from obese horses compared to
   non-obese counterparts (p < 0.05) ([117]Figure 5B). These results
   suggest an enhanced oxidative burst capacity in neutrophils from obese
   animals, supporting the hypothesis that obesity amplifies neutrophil
   reactivity in equine asthma and may thereby contribute to sustained
   airway inflammation and oxidative tissue damage.

Figure 5.

   [118]Figure 5
   [119]Open in a new tab

   Temporal dynamics (A) and area under curve (AUC) quantification (B) of
   the oxidative burst in neutrophils from non-obese and obese asthmatic
   horses following zymosan stimulation. n = 3, * p < 0.05.

   Finally, [120]Figure 6 shows the fold change in IL-1β mRNA expression
   in peripheral blood neutrophils isolated from non-obese and obese
   asthmatic horses following in vitro stimulation with lipopolysaccharide
   (LPS). Neutrophils from obese horses exhibited a significantly greater
   fold induction of IL-1β transcription compared to those from non-obese
   counterparts, reflecting an enhanced pro-inflammatory transcriptional
   response. These findings suggest that obesity may prime neutrophils for
   increased cytokine expression, which could contribute to the
   exacerbation of airway inflammation observed in equine asthma.

Figure 6.

   Figure 6
   [121]Open in a new tab

   Relative IL-1β gene expression in neutrophils from non-obese and obese
   asthmatic horses following LPS stimulation. Gene expression was
   quantified by real-time PCR and normalised to a reference
   (housekeeping) gene. Data are presented as mean ± SEM. n = 3, ** p <
   0.01.

4. Discussion

   The findings of this study would suggest a potentially relevant link
   between obesity, inflammation, and metabolic alterations in asthmatic
   horses. The significantly elevated serum IL-1β levels detected in obese
   asthmatic individuals suggest that this cytokine may contribute to
   disease exacerbation. This is consistent with evidence from human and
   animal studies demonstrating that altered visceral adipose tissue
   promotes systemic inflammation. Specifically, hypertrophic adipocytes
   are known to secrete pro-inflammatory cytokines such as TNF and IL-6,
   which drive the recruitment and activation of immune cells. Taken
   together, these observations support the hypothesis that
   obesity-related inflammation may play a mechanistic role in the
   progression of equine asthma [[122]55,[123]56].

   IL-1β has been proposed as a key mediator in the crosstalk between
   macrophages and adipocytes during obesity [[124]57,[125]58]. Its
   neutralisation has been shown to attenuate obesity-induced
   inflammation, highlighting its role as an important regulator of
   inflammatory processes in this context [[126]59]. Equine asthma serves
   as a valuable model for studying severe asthma in humans, with both
   conditions characterised by neutrophilic inflammation [[127]1]. In
   humans, this inflammatory phenotype has been directly associated with
   obesity [[128]31]. In the present study, we observed an increase in
   circulating neutrophil counts in the obese group of horses, indicating
   a potential link between higher BSC and systemic neutrophilia. This
   observation aligns with previous reports in humans
   [[129]36,[130]60,[131]61]. Accordingly, elevated basal levels of IL-1β
   may contribute to the progression of equine asthma by amplifying airway
   inflammation through the promotion of neutrophil recruitment and
   activation.

   Remarkably, neutrophils isolated from the peripheral blood of obese
   asthmatic horses exhibited clear metabolic alterations. The metabolomic
   analysis revealed substantial differences in the abundance of numerous
   metabolites when comparing neutrophils from obese versus non-obese
   asthmatic animals. These differences spanned several metabolic
   pathways, including linoleic acid metabolism; phenylalanine, tyrosine,
   and tryptophan biosynthesis; valine, leucine, and isoleucine
   biosynthesis; fatty acid biosynthesis; and glutathione metabolism. This
   distinct metabolic profile suggests that neutrophils in obese animals
   undergo metabolic reprogramming, likely in response to the obese state
   and/or chronic inflammatory stimuli. Such reprogramming has been
   associated with enhanced pro-inflammatory functions in neutrophils,
   including increased reactive oxygen species (ROS) production and the
   formation of neutrophil extracellular traps (NETs) [[132]62]. These
   effector functions, while essential for host defence, may contribute to
   tissue damage and perpetuation of inflammation in chronic airway
   diseases. Therefore, the altered metabolic phenotype of neutrophils in
   obese asthmatic horses may play a critical role in amplifying and
   sustaining airway inflammation in this model of severe asthma.

   Our study demonstrated elevated levels of branched-chain amino acids
   (BCAAs), specifically valine and isoleucine, as well as increased
   concentrations of positively charged amino acids such as histidine and
   lysine, and aromatic amino acids including tyrosine, phenylalanine, and
   tryptophan in neutrophils. This finding aligns with previous reports
   suggesting that neutrophils are a major source of the elevated plasma
   concentrations of BCAAs, aromatic, and positively charged free amino
   acids observed in diabetic patients [[133]63,[134]64,[135]65,[136]66].
   The accumulation of BCAAs in plasma has been extensively documented and
   is strongly associated with insulin resistance in both obesity and type
   2 diabetes
   [[137]67,[138]68,[139]69,[140]70,[141]71,[142]72,[143]73,[144]74].
   BCAAs act as metabolic signaling molecules that influence glucose,
   lipid, and protein metabolism [[145]75]. Moreover, BCAAs are potent
   activators of the mTOR signaling pathway [[146]76] and play a crucial
   role in immune cell function by promoting lymphocyte proliferation and
   the activation of cytotoxic T cells [[147]77]. The increased levels in
   these amino acids in neutrophils may reflect a shift towards
   alternative energy sources to meet heightened metabolic demands. This
   metabolic adaptation likely supports the functional activity of
   neutrophils, particularly under conditions of metabolic stress, as
   previously described [[148]40].

   Of particular interest in our study was the increased abundance of
   citrate and two of its downstream metabolites, citraconate and
   itaconate. Itaconate, in particular, is a metabolite known to play a
   key role in immune regulation and inflammation. Its accumulation has
   been well documented in macrophages exposed to lipopolysaccharide (LPS)
   or other inflammatory stimuli, as part of the metabolic reprogramming
   that occurs upon cellular activation [[149]78,[150]79,[151]80]. Derived
   from cis-aconitate via the enzyme cis-aconitate decarboxylase (ACOD1),
   encoded by the Irg1 gene, itaconate synthesis reflects a shift towards
   an anaplerotic modification of the Krebs cycle. Itaconate exerts
   multiple immunomodulatory effects: it is a potent inhibitor of
   succinate dehydrogenase (SDH) [[152]81], activates the
   anti-inflammatory transcription factors Nrf2 and ATF3
   [[153]82,[154]83], and suppresses NLRP3 inflammasome activation
   [[155]84]. Notably, infection models in mice have shown that
   neutrophils upregulate Irg1 more robustly than any other immune cell
   following exposure to Staphylococcus aureus or Mycoplasma pneumoniae
   [[156]85,[157]86]. In neutrophils, itaconate has been reported to
   impair glycolysis and ROS production, reduce bacterial killing
   capacity, and promote apoptosis. Conversely, itaconate-producing
   neutrophils have also been identified as regulators of both local and
   systemic inflammation in the context of trauma [[158]87]. Therefore,
   the increased levels in itaconate observed in our study may reflect a
   cellular attempt to restrain inflammation. However, it remains to be
   clarified whether this compensatory response also contributes to the
   establishment of a more persistent pro-inflammatory phenotype in the
   setting of obesity-associated asthma.

   The findings of our study reveal notable differences in the abundance
   of fatty acids—particularly saturated fatty acids—in obese animals.
   Obesity creates a nutrient-rich microenvironment, especially in terms
   of fatty acid availability [[159]88] which may adversely affect immune
   cell function. Although mature neutrophils primarily rely on glycolysis
   to fulfil their effector roles, fatty acids are critical during their
   maturation and play a modulatory role in various neutrophil functions.
   For instance, oleic and linoleic acids—two unsaturated fatty acids
   found at elevated levels in our study—have been shown to induce NETs
   release in bovine neutrophils [[160]89]. Similar dose-dependent effects
   have been reported with palmitic and oleic acids in human neutrophils
   [[161]90], while a diet enriched in oleic and linoleic acids was shown
   to enhance neutrophil activity and modulate inflammation in rats
   [[162]91]. Moreover, saturated fatty acids, including palmitic acid,
   have been demonstrated to activate neutrophils, with chain length
   appearing to influence this interaction [[163]92]. In a recent study,
   mice fed a high-fat diet exhibited neutrophils with impaired phagocytic
   and bactericidal functions. Notably, neutrophils from obese animals
   displayed overexpression of genes involved in fatty acid
   metabolism—acyl-CoA thioesterase 1 (ACOT1) and carnitine
   palmitoyltransferase 1A (CPT1A)—as well as perilipin 2 (PLIN2), a
   marker of neutral lipid accumulation within lipid droplets, indicating
   enhanced fatty acid oxidation (FAO) and lipid storage [[164]93]. In
   light of these findings, the diverse profile of fatty acid chain
   lengths observed in neutrophils from obese horses in our study may
   reflect both an increased uptake of circulating free fatty acids (FFA)
   and their active intracellular metabolism. This alteration in lipid
   handling may significantly affect neutrophil physiology and potentially
   exacerbate inflammatory responses in obese asthmatic horses. However,
   these effects are complex and warrant further investigation.

   In accordance with their metabolic state, functional assays performed
   on neutrophils from obese asthmatic horses demonstrated a significant
   increase in their capacity to generate a respiratory burst upon
   stimulation with opsonised zymosan, as well as an enhanced inflammatory
   response following LPS treatment. In both instances, an augmented
   response to pro-inflammatory stimuli was observed. These findings are
   consistent with previous reports and suggest that neutrophils from
   obese individuals may exist in a pre-activated or “primed” state
   [[165]94,[166]95,[167]96].

   Equine asthma was studied during the remission phase, as this
   clinically stable state provides a particularly useful
   pathophysiological context to identify persistent immunological and
   metabolic alterations without the confounding effects of acute
   inflammatory responses characteristic of exacerbations. In this phase,
   subclinical changes in immune cell function—particularly
   neutrophils—can be detected, allowing exploration of processes
   associated with disease chronicity, such as residual inflammation or
   immunometabolic reprogramming. This approach is especially relevant for
   understanding the mechanisms that sustain the disease and for
   identifying early biomarkers of susceptibility to future exacerbations.
   Furthermore, remission offers more controlled experimental conditions,
   minimising variability introduced by intensive treatments or systemic
   stress, and thus, enables more consistent baseline measurements for
   comparative or longitudinal studies. Nevertheless, future
   investigations during clinical exacerbations will also be essential to
   deepen our understanding of the acute immunopathological and
   immunometabolic events, particularly those involving neutrophils.

   In this study, equine asthma was investigated during the remission
   phase, as this clinically stable state provided a particularly valuable
   pathophysiological context for identifying persistent immunological and
   metabolic alterations, without the confounding effects of the acute
   inflammatory responses typically observed during exacerbations. During
   remission, we considered that subclinical changes in immune cell
   function—particularly neutrophils—could be detected, allowing the
   exploration of processes associated with disease chronicity, such as
   residual inflammation or immunometabolic reprogramming. This approach
   proved especially relevant for understanding the mechanisms that
   sustain the disease and for the potential identification of early
   biomarkers indicating susceptibility to future exacerbations.
   Furthermore, remission offers more controlled experimental conditions
   by minimising variability introduced by intensive treatments or
   systemic stress. As stated in the Materials and Methods section, the
   animals included in this study had not received corticosteroids or
   bronchodilators for at least two months prior to sampling, thereby
   allowing for more consistent baseline measurements for comparative
   purposes. Nevertheless, future investigations during clinical
   exacerbations will also be essential to deepen our understanding of
   acute immunopathological and immunometabolic events, particularly those
   involving neutrophils [[168]1].

   This study has several limitations that should be acknowledged. The
   small sample size (n = 6), although constrained by the availability of
   clinically well-characterised animals, limits the statistical power and
   generalisability of the findings. The cross-sectional design precludes
   causal inferences regarding the relationship between obesity,
   neutrophil metabolism, and asthma severity. Moreover, the analysis was
   confined to neutrophils, excluding the potential contribution of other
   immune cell populations. Functional validation of key metabolic
   findings—such as the role of itaconate in neutrophil activation—was not
   performed. Another limitation of this study is the absence of a
   non-asthmatic control group, which prevents us from determining whether
   the metabolic and inflammatory differences observed are specific to
   asthmatic animals or also occur in obese versus non-obese horses
   without asthma. Although this study focused on comparing obese and
   non-obese asthmatic animals, it is important to acknowledge that
   obesity alone could influence neutrophil function and metabolism,
   independently of the asthmatic condition. However, the chronic airway
   inflammation associated with asthma could induce immunometabolic
   responses that may be further exacerbated by obesity. Therefore, the
   differences described here—particularly the heightened inflammatory
   responsiveness and altered metabolic profiles in neutrophils—might be
   specific to the asthmatic context. Future studies including obese and
   lean non-asthmatic animals will help clarify whether obesity exerts
   similar immunometabolic effects in the absence of respiratory disease.
   This distinction is essential, as it would allow us to determine
   whether the obesity-associated neutrophil phenotype observed in this
   study acts as a disease-modifying factor in asthma or represents a
   general feature of obese horses. Finally, the lack of longitudinal data
   limits insights into dynamic changes or responses to therapeutic
   intervention. Future studies with larger cohorts and mechanistic
   approaches are warranted to corroborate and extend these observations.

5. Conclusions

   The findings of this study demonstrate that obesity significantly
   influences the metabolic and inflammatory behaviour of neutrophils in
   horses affected by asthma. Obese horses exhibited elevated systemic
   IL-1β levels, increased circulating neutrophil counts, and heightened
   neutrophil responsiveness to pro-inflammatory stimuli, including
   enhanced oxidative burst and IL-1β gene expression. Metabolomic
   profiling revealed profound alterations in neutrophil metabolism,
   particularly in pathways related to fatty acid and amino acid
   metabolism, as well as the tricarboxylic acid cycle. Elevated
   concentrations of immunomodulatory metabolites such as itaconate and
   citraconic acid suggest that neutrophils in obese animals undergo
   metabolic reprogramming that may contribute to a sustained
   pro-inflammatory state. These results support the hypothesis that
   obesity promotes a distinct and potentially pathogenic neutrophil
   phenotype, which could exacerbate airway inflammation and impair
   disease resolution in equine asthma. Collectively, the data underscore
   the importance of addressing obesity as a key clinical and management
   factor in horses with asthma and highlight the potential of targeting
   immune cell metabolism as a novel therapeutic avenue in veterinary
   medicine.

Author Contributions

   A.A., B.M., R.A.B. and G.M. conceived and designed the experiments.
   V.B.F. and C.H. performed the experiments. P.A. and J.Q. performed the
   GC-MS analysis. A.A., R.A.B., C.H. and G.M. contributed to data
   analysis, writing, and editing of this manuscript. funding acquisition,
   G.M. project administration, G.M. In addition, all authors reviewed
   this manuscript. All authors have read and agreed to the published
   version of the manuscript.

Institutional Review Board Statement

   This study was authorised by the Institutional Animal Care and Use
   Committee, Universidad Austral de Chile #497/2023.

Informed Consent Statement

   Not applicable.

Data Availability Statement

   The data presented in this study are available on request from the
   corresponding author.

Conflicts of Interest

   All authors declare that they have no conflicts of interest.

Funding Statement

   This research was funded by Fondo Nacional de Desarrollo Científico y
   Tecnológico, FONDECYT grant number 1230101 and post-doctoral FONDECYT
   3230482 (ANID).

Footnotes

   Disclaimer/Publisher’s Note: The statements, opinions and data
   contained in all publications are solely those of the individual
   author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI
   and/or the editor(s) disclaim responsibility for any injury to people
   or property resulting from any ideas, methods, instructions or products
   referred to in the content.

References