Abstract

   Neuroinflammation is vital in depression’s onset and development,
   making its relief a key treatment goal. Orientin (ORI), a natural
   flavonoid, is known to modulate inflammation, but whether it can ease
   depression by regulating neuro-inflammation remains uncertain. This
   study aimed to uncover ORI’s antineuroinflammation mechanisms for
   treating depression. It utilized LPS-induced cell and mouse models and
   Chronic Unpredictable Mild Stress (CUMS) model. Enzyme-linked
   immunoassay, Western blotting, and immunofluorescence staining gauged
   ORI’s anti-inflammatory effects. Behavioral tests assessed the impact
   on depressive symptoms. Network pharmacology and molecular biology
   methods probed its action mechanism and anti-inflammation targets. ORI
   effectively curbed inflammation, blocked M1 polarization, and reduced
   the inflammatory mediator release in LPS-induced BV2 cells and mice. In
   LPS-induced and CUMS depression mouse models, ORI notably alleviated
   depression-like behavior and neuroinflammation in the prefrontal cortex
   (PFC). Also, ORI treatment reduced the LPS-induced spike in the
   frequency of spontaneous excitatory postsynaptic currents (sEPSC) in
   PFC neurons. The PI3K/AKT signaling pathway was found to underpin ORI’s
   effects. Overall, ORI shows potential as a natural remedy for
   depression, influencing neuroinflammation and regulating microglial
   polarization and neuronal excitability to improve symptoms.
     __________________________________________________________________

   graphic file with name ao5c02585_0011.jpg
     __________________________________________________________________

   graphic file with name ao5c02585_0009.jpg

1. Introduction

   The robust association between neuroinflammation and various mood
   disorders is extensively recognized as a critical determinant in the
   etiology of mental health issues and resultant disabilities on a global
   scale. Empirical research has elucidated heightened microglial activity
   in brain regions implicated in depression, including the prefrontal
   cortex, anterior cingulate cortex, and insula, during episodes of major
   depression. , The increased activity of inflammatory cytokines or
   microglia has been implicated in the manifestation of depressive
   symptoms. , Evidence suggests that attenuating microglial activation
   can ameliorate behaviors analogous to depression. Therefore, targeting
   neuroinflammation is a crucial tool for alleviating depression-like
   symptoms.

   Microglia play a key role in regulating neuroinflammation and
   maintaining central nervous system (CNS) homeostasis. Microglia display
   a spectrum of activation states contingent upon the specific signals
   they encounter, which can span the range from protective to
   deleterious. In the context of neuroinflammation, activated microglia
   secrete inflammatory mediators such as tumor necrosis factor-α (TNF-α),
   interleukin-1 beta (IL-1β), and inducible nitric oxide synthase (iNOS),
   which can precipitate neuronal dysfunction and degeneration. This
   inflammatory cascade is implicated in the pathogenesis of various
   psychological disorders, including depression. Thus, mitigating
   neuroinflammation is essential in the treatment of depression-like
   symptoms.

   Orientin (ORI) belongs to the family of natural flavonoids and is
   mainly extracted from . As an active compound, it has a variety of
   excellent properties, including neuroprotective, anti-inflammatory,
   analgesic, antiviral, antioxidant, and antibacterial effects. In the
   field of clinical application, orientin shows extremely broad
   prospects. For example, it has positive application value in the
   treatment of cardiovascular diseases, neuropathic pain, and
   inflammatory diseases. In vivo models of inflammation have
   substantiated ORI’s anti-inflammatory effects, thereby endorsing its
   application in traditional medicine for the management of inflammatory
   conditions. ORI has been demonstrated to downregulate the secretion of
   pro-inflammatory cytokines in mast cells. ORI has also been reported to
   alleviate LPS-induced acute lung injury by inhibiting inflammation and
   oxidative stress. Additionally, research has shown that ORI exerts a
   significant neuroprotective effect in rotenone-induced Parkinson’s
   disease by modulating pathways such as Nrf2-ARE, PI3K-AKT, JNK-ERK1/2,
   and TLR4/NF-κB. While previous studies have highlighted the therapeutic
   potential of ORI in the treatment of inflammation-related diseases, its
   specific therapeutic role in depression remains unclear.

   This research aims to bridge the existing gap by employing both acute
   and chronic animal models of depression, in conjunction with an
   LPS-induced BV2 microglial cell model, to elucidate the mechanism of
   action of ORI. The results of this study enhance our understanding of
   ORI’s antidepressant properties, providing valuable insights into its
   potential application as a natural intervention for ameliorating
   depression.

2. Materials and Methods

2.1. Cell Culture

   BV2 cells were grown in high glucose DMEM with 10% FBS, 40 units/mL
   penicillin, and 40 μg/mL streptomycin, and maintained at 37 °C in T25
   flasks with 5% CO[2].

2.2. Cytotoxicity by CCK-8 Assay

   The CCK-8 cell counting kit (code HY-K0301–100T, MCE, USA) was utilized
   to assess the cytotoxic effects of ORI in vitro. BV2 microglia were
   exposed to either a drug-containing solution (0.1%) or varying
   concentrations of ORI (2, 4, 8, 16, 32, 64, 128, or 256 μM) for 24 h,
   followed by incubation with the CCK-8 solution for 30 min. Tecan
   Infinite M200 PRO multimode microplate reader (Tecan, Switzerland) was
   used to determine cell viability at 450 nm.

2.3. Real-Time PCR

   Inflammatory cytokine production was assessed following ORI treatment.
   BV2 microglial cells were pretreated with 0, 2, 8, and 32 μM ORI for 18
   h and then stimulated with 1 μg/mL LPS for 6 h. RNA was extracted using
   TRIzol, and cDNA was synthesized with the Superscript cDNA Premix Kit
   II. The cDNA was analyzed via 40 cycles of real-time PCR on the
   QuantStudio 5 system using primers listed in [35]Table , using GAPDH
   for normalization.

1. Primer Sequences.

   Gene          Forward                  Reverse
   IL-10 GCCTCTTCTCATTCCTGCTTGTGG GTGGTTTGTGAGTGTGAGGGTCTG
   IL-6  TCGCAGCAGCACATCAACAAGAG  AGGTCCACGGGAAAGACACAGG
   IL-1β CTTCTTGGGACTGATGCTGGTGAC AGGTCTGTTGGGAGTGGTATCCTC
   TNF-α TCCCTGGGTGAGAAGCTGAAGAC  CACCTGCTCCACTGCCTTGC
   GAPDH AGAAGGTGGTGAAGCAGGCATC   CGAAGGTGGAAGAGTGGGAGTTG
   [36]Open in a new tab

2.4. Immunofluorescence Staining

   The immunofluorescence staining process of BV2 cells is as follows:
   After fixation with 4% paraformaldehyde, the cells are treated with a
   permeabilization buffer for 10 min and blocked with serum for 30 min.
   Subsequently, they are incubated overnight at 4 °C with primary
   antibodies against Arg-1 (16001-1-AP, 1:500, Thermo) and iNOS
   ([37]AB178945, 1:500, Abcam). After being washed three times with PBS,
   the cells are incubated with antirabbit fluorescent secondary
   antibodies at room temperature for 1 h and then washed again with PBS.
   The cell nuclei are stained with DAPI for 5 min, washed three times
   with PBS, and then the coverslips are mounted. Before the
   immunofluorescence staining of mouse brain tissues, 50 mg/kg
   pentobarbital sodium is intraperitoneally injected after the behavioral
   test. The brain tissues are perfused with normal saline and fixed with
   PFA in the heart. Then, the mouse brain tissues are taken out, fixed in
   PFA overnight, dehydrated in a sucrose solution, and finally frozen
   sections are prepared. The staining steps for the sections are the same
   as those for the cells. Finally, fluorescent images are collected using
   an Olympus microscope, and positive cells are quantitatively analyzed
   using ImageJ software.

2.5. Animals

   In this experiment, 6-week-old male C57BL/6 mice were housed with
   continuous access to food and water under controlled temperature and
   humidity conditions. The mice were acclimated to the laboratory
   environment for 1 week before the experiment. The animal care
   procedures have been reviewed and approved by the Animal Ethics
   Committee of Fourth Military Medical University (approval number:
   20240078) and strictly adhere to ethical principles regarding animal
   welfare.

2.6. Development of an LPS-Induced Depression Model and Administration of ORI
Treatment

   To systematically analyze the intervention mechanism of orientin (ORI)
   pretreatment on lipopolysaccharide (LPS)-induced depression models,
   this study selected 6-week-old male C57BL/6 mice (body weight: 20–23
   g), which were randomly and equally divided into three groups (n = 6
   per group): (I) control group, (II) LPS model group, and (III) LPS + 50
   mg/kg ORI intervention group. During the intervention period, mice in
   the ORI intervention group were intraperitoneally injected with the
   drug daily for 7 consecutive days, while mice in the LPS model group
   were intraperitoneally injected with an equal volume of normal saline
   as a control. On day 7 of the experiment, 30 min after the
   intraperitoneal injection, mice in the LPS model group and the LPS +
   ORI intervention group were intraperitoneally injected with a 10 mg/kg
   LPS solution, and mice in the control group were simultaneously
   injected with an equal volume of PBS buffer. One hour after LPS
   injection, a series of behavioral detection procedures were immediately
   initiated, and all evaluation items were completed in an orderly manner
   within 30 h.

2.7. Establishment and Treatment of a Chronic Unpredictable Mild Stress
(CUMS) Depression Mouse Model

   This long-term protocol involves applying a series of unpredictable
   stressors over 6 weeks, with each stressor randomly administered daily.
   The stressors included: (1) exposure to ice water at 4 °C for 5 min;
   (2) exposure to 85 dB noise for 5 h; (3) physical restraint for 4 h;
   (4) placement in wet bedding for 12 h; (5) exposure to intermittent
   flashing light for 12 h; (6) tail clipping for 5 min, followed by 2
   consecutive days without stimulation. Tail clipping is a type of
   noxious stimulation, and the setting of the interval period increases
   the unpredictability of the stress. During the modeling process,
   orientin was administered intraperitoneally at a concentration of 50
   mg/kg.

2.8. Sucrose Preference Test (SPT)

   On the day of the experiment, 50 mL drinking bottles containing either
   sugar or regular water were placed in the animal cage, allowing the
   mice to choose freely. The positions of the bottles were switched every
   6 h. Consumption of both liquids was recorded over 24 h.

2.9. Open Field Test (OFT)

   The test was conducted in an open arena under bright indoor lighting to
   evaluate the mice’s locomotor and exploratory behaviors. Mice were
   placed in the center of the arena and given a 2-min acclimation period.
   Following acclimation, the distance traveled, time spent in the central
   area, and frequency of entries into the central area were recorded over
   15 min. The arena was cleaned with 75% alcohol between trials to
   eliminate any residual scents.

2.10. Tail Suspension Test (TST)

   The mice were gently held and suspended by their tails using adhesive
   tape, positioned approximately 1–2 cm from the tip. Their behaviors,
   including struggling, swinging, and periods of immobility, were
   carefully monitored and recorded. The duration of each test was 6 min.

2.11. Forced Swimming Test (FST)

   The mice were introduced into a pool, where their water behavior was
   carefully observed. The pool’s depth prevented the mice from standing,
   which forced them to swim. Immobility was characterized by the mouse
   floating with minimal movement required to keep its head above water.
   After a 2-min acclimation period, immobility was recorded for 4 min.

2.12. Western Blotting

   Cell and tissue samples were collected, and proteins were extracted and
   quantified using the BCA protein assay. The proteins were separated by
   electrophoresis, transferred onto membranes, and blocked. Membranes
   were incubated overnight with primary antibodies against TNF-α, IL-6,
   IL-1β, iNOS, Arg-1, and β-actin. The ratios and item numbers are as
   follows: (11948S, 1:1000, CST), (12912S, 1:1000, CST), (12242, 1:1000,
   CST), (ab178945, 1:1000, Abcam), (16001–1-AP, 1:500, Thermo), and
   (A5316, 1:1000, Sigma). After a thorough wash with TBST, the membranes
   were incubated with horseradish peroxidase-conjugated secondary
   antibodies (1:5000, goat antirabbit or goat antimouse). Images were
   captured using the Clinx 6600 Plus imager with an ECL detection
   solution, and band intensities were quantified using ImageJ software
   (NIH).

2.13. Enzyme-Linked Immunosorbent Assay (ELISA)

   Supernatants obtained from animal blood and cell samples were
   collected, followed by the quantification of inflammatory factors using
   specific ELISA kits targeting IL-1β (88-7013, Thermo Fisher), TNF-α
   (88-7324, Thermo Fisher), IL-6 (88-7064, Thermo Fisher), and IL-10
   (88-7105, Thermo Fisher).

2.14. Whole-Cell Patch-Clamp Recordings

   Prefrontal cortex coronal sections (300 μm) were prepared with
   oxygenated ACSF (pH 7.2–7.4) from animals euthanized by cervical
   dislocation. Brain slices were incubated in ACSF at room temperature
   for 1 h before whole-cell patch-clamp recordings. Spontaneous
   excitatory postsynaptic currents (sEPSCs) were recorded from prefrontal
   cortex neurons using whole-cell voltage clamp (V [h] = −70 mV) with 100
   μM picrotoxin. Data were excluded if series resistance changed by over
   15% or resting membrane potential depolarized past – 60 mV.
   Voltage-clamp data were analyzed offline for sEPSC using Minianalysis
   software (v6.0.7).

2.15. Network Pharmacology

   Potential ORI targets, depression-related targets, protein–protein
   interaction (PPI) network, and pathway enrichment analysis were
   performed as described previously.

2.16. Statistical Analysis

   Data were presented as mean ± standard error of the mean (SEM) from
   three different experiments. Statistical differences between groups
   were assessed utilizing one-way ANOVA followed by Tukey’s post hoc
   test, with significance defined as a P-value below 0.05.

3. Results

3.1. ORI Pretreatment Downregulated the Level of LPS-Induced Inflammation in
BV2 Cells

   Microglia, the brain’s immune cells similar to macrophages, play a
   crucial role in the immune response by releasing cytokines and
   chemokines. These cells are highly responsive to injury and stress,
   contributing to sustained neuroinflammation and mental disorders. LPS,
   an endotoxin from the outer membrane of Gram-negative bacteria,
   triggers a substantial inflammatory response. To investigate whether
   ORI could protect microglia from LPS-induced toxicity, BV2 mouse
   microglial cells were treated with various concentrations of ORI, and
   cell viability was measured using the CCK-8 assay. The results showed
   that ORI did not affect BV2 cell viability within the tested dosage
   range ([38]Figure B). Pro-inflammatory cytokines are pivotal in the
   inflammatory process. Real-time PCR ([39]Figure D–G) showed that
   pretreatment with ORI (2, 8, or 32 μM) significantly reduced mRNA
   levels of LPS-induced inflammatory factors, TNF-α (p = 0.0017, p =
   0.0082, and p = 0.0008), IL-1β (p < 0.01, p < 0.01, and p < 0.01), and
   IL-6 (p < 0.01, p < 0.01, and p < 0.01). Additionally, ORI at 8 μM
   increased the mRNA level of the anti-inflammatory factor IL-10 (p =
   0.0105). Cytokine levels in BV2 cells were further analyzed by ELISA
   and Western blotting. ELISA results revealed a significant increase in
   pro-inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, in the
   LPS-treated group compared to the control group, while IL-10 levels
   were notably decreased (p < 0.0001, p = 0.0020, p < 0.0001, p = 0.0033,
   [40]Figure H–K). Western blotting results were consistent with the
   ELISA findings, showing significant reductions in pro-inflammatory
   factors following ORI treatment (p = 0.0315, p = 0.0194, p = 0.0054,
   [41]Figure L,M). These results indicate that ORI effectively inhibits
   the inflammatory response in microglia, reducing the levels of
   pro-inflammatory cytokines.

1.

   [42]1
   [43]Open in a new tab

   ORI pretreatment downregulates LPS-evoked proinflammatory cytokine
   levels in BV2 microglial cells.

   (A) Depict the chemical structure of orientin; (B) BV2 microglia were
   treated with various concentrations of ORI (ranging from 0 to 256 μM),
   and a CCK-8 assay was conducted to evaluate cell viability (with n =
   11–12 per group); (C) outline the detailed procedures for cell
   processing; (D–G) present the real-time fluorescence quantitative PCR
   analyses of the mRNA levels of inflammatory factors; (H–K) demonstrate
   the use of an ELISA kit to measure the levels of inflammatory factors
   in BV2 cells; and (L, M) illustrate the detection of inflammatory
   factor protein expression by Western blotting. *p < 0.05, **p < 0.01
   compared to the control group. ^# p < 0.05, ^## p < 0.01 compared to
   the LPS group.

3.2. ORI Pretreatment Restored the Upregulation of Arg-1 Protein Expression
(M2 Marker) and Downregulation of iNOS Protein Expression (M1 Marker) in
LPS-Induced BV2 Microglial Cells

   Compared to peripheral macrophages, microglia exhibit both similar and
   distinct characteristics in terms of phenotypic polarization,
   contributing to their innate immune function. Upon LPS stimulation,
   microglia predominantly shift to the M1 phenotype, leading to
   upregulation of pro-inflammatory cytokines. In contrast, the M2
   phenotype, which is associated with anti-inflammatory responses, is
   downregulated, thereby contributing to the overall inflammatory
   process. Immunofluorescence results showed an increase in iNOS
   expression in BV2 cells following LPS induction (p = 0.0024, [44]Figure
   B), while ORI (2, 8, and 32 μM) (p = 0.9577, p = 0.0015, p = 0.0044,
   [45]Figure C) treatment significantly decreased iNOS expression. In
   addition, Arg-1 expression was reduced in the LPS group (p < 0.0001,
   [46]Figure D), while M2 microglia (Arg-1 positive) increased after
   treatment with ORI (2, 8, and 32 μM) (p < 0.0001, p < 0.0001, p =
   0.0279, [47]Figure E). Western blotting results corroborated the
   findings from immunofluorescence staining. The expression of iNOS was
   markedly reduced with ORI treatment (2, 8, and 32 μm) (p = 0.0034, p =
   0.0083, and p = 0.0018, [48]Figure F,G), while Arg-1 expression was
   significantly elevated (p = 0.1429, p < 0.0022, p = 0.0005, [49]Figure
   F,G). These results indicated that ORI could effectively inhibit the
   polarization of microglia induced by LPS.

2.

   [50]2
   [51]Open in a new tab

   Effect of ORI on LPS-induced M1/M2 phenotype changes in BV2 cells.

   (A) Provide a flowchart of the cell staining process; (B) display the
   immunofluorescence staining of iNOS in BV2 cells, where iNOS is shown
   in green and DAPI in blue; (C) present the relative fluorescence
   intensity of iNOS (expressed as a fold of the control vector); (D) show
   the immunofluorescence staining of Arg −1 in BV2 cells, with Arg −1
   shown in green and DAPI shown in blue. The scale bar is set at 50 μm.
   (E) Illustrate the relative fluorescence intensity of Arg −1 (expressed
   as a fold of the control vector); (F) detect the expression of M1 and
   M2 markers in BV2 cells by Western blotting; and (G) quantitatively
   analyze the M1/M2 markers by Western blotting. The data are presented
   as means ± SD (n = 3). Statistical significance was denoted as *p <
   0.05 and **p < 0.01 compared to the control group, and ^# p < 0.05 and
   ^## p < 0.01 compared to the LPS group.

3.3. ORI Improved Depression-Like Behavior in the LPS-Induced Mouse Model

   Pro-inflammatory cytokines are key contributors to depression-like
   behavior. Given ORI’s demonstrated ability to significantly inhibit
   LPS-induced inflammation in BV2 cells in vitro, we extended our
   investigation to animal models to further explore its effects.
   Initially, open-field behavior was assessed, showing no significant
   differences in central time and distance between the ORI-treated and
   control groups (p > 0.05, p > 0.05; [52]Figure B,C), indicating no
   presence of anxiety-like behavior. Behavioral tests for depression-like
   symptoms revealed that LPS-treated mice had a significantly lower
   sucrose preference in the sucrose preference test (SPT) compared to the
   control group (p = 0.0015, [53]Figure D,E). Immobility time and bouts
   of immobility were markedly increased in the forced swimming test (FST)
   (p = 0.0011, p = 0.0176, [54]Figure F,G) and tail suspension test (TST)
   (p = 0.0002, p = 0.0226, [55]Figure H,I), suggesting significant
   depression-like behavior in LPS-injected mice. Interestingly, mice
   treated with ORI (50 mg/kg) showed significant improvements in
   depression-like behaviors, as evidenced by improvements in SPT, FST,
   and TST (p = 0.0234, p = 0.0004, p = 0.0003, [56]Figure D–I). These
   findings suggest that ORI can alleviate depression-like behaviors
   triggered by LPS in mice.

3.

   [57]3
   [58]Open in a new tab

   ORI treatment reversed LPS-induced depression-like behavior in mice.

   (A) Describe the animal handling and behavior testing procedures; (B)
   present the original track of the open-field behavior; (C) provide
   statistics on the total distance traveled, central time, and central
   distance in the open-field behavior; (D, E) conduct the sugar water
   preference experiment; (F) illustrate the schematic diagram of the
   forced swimming test; (G) report the time and number of immobility
   episodes in the forced swimming test; (H) present the schematic diagram
   of the tail suspension test; and (I) report the stationary time and the
   number of stationary periods in the tail suspension test. Statistical
   significance was indicated as *p < 0.05 or **p < 0.01 compared to the
   control group, and ^# p < 0.05 or ^## p < 0.01 compared to the LPS
   group. DFH images were generated by the research team.

3.4. ORI Regulated LPS-Induced Excitatory Postsynaptic Currents (sEPSCs) in
the PFC Region and Inhibited the Inflammatory Responses

   To investigate whether LPS-induced inflammation affects neuronal
   excitability, we recorded sEPSC using whole-cell patch clamps
   ([59]Figure A). Results show that, compared with the control group, LPS
   group sEPSC frequency increased significantly (p = 0.0131, [60]Figure
   C,E). Notably, ORI treatment (50 mg/kg) significantly reversed the
   LPS-induced increase in sEPSC frequency (p = 0.0019). However, neither
   LPS nor ORI (50 mg/kg) influenced the amplitude of sEPSC (p = 0.9960, p
   = 0.9568, [61]Figure B,D). These results suggest that ORI effectively
   restores the response of excitatory postsynaptic currents to LPS in the
   prefrontal cortex. To assess the impact of ORI on these cytokines, we
   used ELISA to analyze serum samples and Western blotting to evaluate
   PFC tissue. ELISA results indicated an increase in pro-inflammatory
   cytokines, specifically TNF-α, IL-1β, and IL-6, in the LPS-treated
   group compared to the control group (p = 0.0008, p < 0.0001, p =
   0.0060, [62]Figure F). These findings were confirmed by Western
   blotting analysis (p = 0.0480, p = 0.0145, p = 0.0005, [63]Figure G,H).
   Pretreatment with ORI significantly reduced the expression of these
   pro-inflammatory factors, indicating its potential effectiveness in
   mitigating the release of inflammatory cytokines in the PFC induced by
   LPS.

4.

   [64]4
   [65]Open in a new tab

   ORI regulates LPS-induced excitatory postsynaptic currents (sEPSCs) in
   the PFC of mice and inhibits the inflammatory response in this brain
   region.

   (A) Record the sEPSCs of mouse prefrontal cortex neurons at a holding
   potential of −70 mV; (B, C) present the histogram of the amplitude
   (left) and cumulative frequency (right) of mouse neuron sEPSCs; (D, E)
   summarize the sEPSCs amplitude (left) and frequency (right) of mouse
   neurons (with n = 8 neurons from 3 mice); (F) detect the expression of
   pro-inflammatory factors in the serum of each group using ELISA; (G)
   determine the expression of pro-inflammatory factors in hippocampal
   tissue by Western blotting; (H) Quantify the pro-inflammatory factors
   detected by Western blotting. Values are presented as means ± SD (n =
   3). Statistical significance was denoted as *p < 0.05 or **p < 0.01
   compared to the control group, and ^# p < 0.05 or ^## p < 0.01 compared
   to the LPS group.

3.5. Exploration of Pathways for the Potential Antidepressant Effects of ORI:
ORI Regulates the PI3K/AKT Signaling Pathway in LPS-Induced Mice

   A total of 113 potential targets related to ORI compounds were
   identified from the Swiss Target Prediction and TCMSP databases after
   removing duplicates. Additionally, 2371 targets associated with
   depression were obtained from the DisGeNet and GeneCards databases.
   Details of these targets are provided in the [66]Supporting
   Information. A Venn diagram ([67]Figure A) illustrates the overlap
   between these sources, revealing 67 potential targets linked to both
   ORI and depression. These shared targets were used to construct PPI
   networks ([68]Figure B) utilizing the STRING database, enabling a more
   thorough examination of their roles via GO and KEGG pathway enrichment
   analyses. [69]Figure C displays the top 10 enhanced outcomes for
   biological processes, cellular components, and molecular functions.
   KEGG pathway analysis identified 147 significant signaling pathways,
   with the top 20 highlighted in [70]Figure D, emphasizing the strong
   association with the PI3K/AKT signaling pathway and implying ORI’s
   involvement in the mechanism of depression. Abnormalities in both the
   functional and structural aspects of the PFC have been demonstrated in
   individuals with major depression and those susceptible to the
   condition. The PFC is one of the most commonly affected brain regions
   in depression. Therefore, we investigated the effect of ORI on critical
   proteins in the PI3K/AKT signaling pathway within the PFC tissues of
   mice with LPS-induced depression. As illustrated in [71]Figure E,
   phosphorylation levels of PI3K and AKT in the PFC of LPS-treated mice
   were significantly elevated compared to the control group (p = 0.0429,
   p = 0.0154, [72]Figure E,F). Conversely, the phosphorylation levels of
   GSK3β decreased (p = 0.0011, [73]Figure F), although the total protein
   levels remained constant. Treatment with ORI significantly restored the
   phosphorylation of PI3K, AKT, and GSK3β levels ([74]Figure E,F). These
   observations indicate that ORI alleviates depression-like symptoms in
   LPS-treated mice by modulating the PI3K/AKT signaling pathway.

5.

   [75]5
   [76]Open in a new tab

   Network pharmacology analyses and ORI restore the PI3K/AKT/GSK3β
   signaling pathway in the PFC region.

   (A) The Venn diagram shows the overlapping targets between ORI and
   depression; (B) the protein–protein interaction network was constructed
   using 67 cross–targets, with each node representing a different
   protein; (C) the Gene Ontology enrichment analysis includes biological
   process, cellular component, and molecular function; (D) the Kyoto
   Encyclopedia of Genes and Genomes pathway enrichment analysis was
   performed; (E) illustrate the phosphorylation and total levels of the
   PI3K/AKT/GSK3β proteins; and (F) present the results of the Western
   blot analysis. The values are presented as means ± SD (n = 3).
   Statistical significance was denoted as *p < 0.05 or **p < 0.01
   compared to the control group, and ^# p < 0.05 or ^## p < 0.01 compared
   to the LPS group.

3.6. ORI Pretreatment Reversed Depression-Like Behavior in CUMS Mouse Model

   CUMS represents one of the most comprehensive and potent rodent models
   for exploring depression. To evaluate the therapeutic efficacy of ORI
   in vivo, we established a model of depression based on the CUMS
   paradigm. The outcomes from the SPT, OFT, TST, and FST provide
   compelling evidence for the ability of ORI to alleviate depression-like
   behavior induced by CUMS ([77]Figure ). Specifically, ORI markedly
   restored the decline in sucrose intake observed in the CUMS-inflicted
   SPT (p = 0.0008, [78]Figure D), suggesting a significant improvement in
   anhedonia. Furthermore, ORI reduced the duration of immobility recorded
   in both the TST and FST, indicating a decrease in feelings of despair
   (p = 0.0121, p = 0.0069, [79]Figure B,C). Additionally, ORI enhanced
   exploratory behavior and alleviated anxiety-related symptoms, as
   demonstrated by an increase in the distance moved in the center area
   and the time spent there (p = 0.0034, p = 0.0016), both of which were
   negatively impacted by CUMS ([80]Figure E). Collectively, these
   findings suggest that ORI exhibits an antidepressant effect in models
   of depression induced by both CUMS and LPS.

6.

   [81]6
   [82]Open in a new tab

   ORI treatment reversed depression-like behavior in CUMS mice. (A)
   Describe the animal handling and behavior testing procedures; (B)
   report the stationary time and the number of stationary periods in the
   tail suspension test; (C) provide the time and amount of immobility in
   the forced swimming test; (D) conduct the sugar water preference
   experiment; and (E) provide statistics on the total distance traveled,
   central time, and central distance in the open field behavior.
   Statistical significance was indicated as *p < 0.05 or **p < 0.01
   compared to the control group, and ^# p < 0.05 or ^## p < 0.01 compared
   to the CUMS group.

3.7. ORI Promoted the Transformation of PFC Microglia from M1to M2 Type in
the CUMS Model

   ORI promotes the transformation of prefrontal cortical microglia from
   the M1 type to the M2 type in a CUMS model of depression in mice. To
   further explore whether the antidepressant effects of ORI in the CUMS
   model are mediated through a reduction in inflammatory responses, we
   performed immunofluorescence staining of the PFC. Our findings revealed
   that CUMS led to a decrease in the expression of arginase-1 (Arg-1) and
   a reduction in the proportion of anti-inflammatory (Arg-1-IBa1) cells
   in the PFC, accompanied by an increase in the proportion of inducible
   nitric oxide synthase (iNOS) and proinflammatory (iNOS-IBa1) microglia
   ([83]Figure A–D). Notably, these alterations were reversed following
   the administration of 50 mg/kg of ORI ([84]Figure A–D). These results
   indicate that ORI induces a phenotypic shift in activated microglia in
   the PFC from a pro-inflammatory (iNOS) state to a neuroprotective
   (Arg-1) state. Collectively, these findings suggest that ORI reduces
   the activation of microglia and the expression of inflammatory
   cytokines, which may represent a key mechanism underlying ORI’s
   antidepressant effects.

7.

   [85]7
   [86]Open in a new tab

   ORI transforms the activated microglia in the PFC of CUMS mice from a
   pro-inflammatory phenotype to an anti-inflammatory phenotype. (A)
   Present the immunofluorescence staining results of iNOS and Iba1 in the
   PFC brain region of CUMS mice, with iNOS in green and Iba1 in red; (B)
   report the relative fluorescence intensity of iNOS-positive cells (in
   mm^2); (C) present the immunofluorescence staining results of Arg 1 and
   Iba1 in the PFC brain region of CUMS mice, with Arg 1 in green and Iba1
   in red; and (D) report the relative fluorescence intensity of Arg
   1-positive cells (in mm^2).

4. Discussion

   As a flavonoid monomer with multiple bioactive properties, ,− ORI has
   demonstrated translational potential in inflammation modulation and
   neuroprotection, − particularly given its structural features (e.g.,
   C2–C3 double bond and catechol moiety) that enhance blood–brain barrier
   permeability. In this study, an acute LPS-induced model and a chronic
   unpredictable mild stress (CUMS) model were constructed and combined
   with an in vitro BV2 microglial cell inflammation model to
   systematically explore the antidepressant effect of ORI and its
   underlying mechanisms.

   In the in vitro experiments ([87]Figures and ), LPS stimulation
   significantly induced polarization of BV2 microglia into the M1 type,
   which was manifested by the upregulation of inducible nitric oxide
   synthase (iNOS) expression and the massive release of pro-inflammatory
   cytokines such as interleukin-1β (IL-1β), tumor necrosis factor-α
   (TNF-α), and interleukin-6 (IL-6). This result is consistent with the
   conclusions of previous studies that LPS triggers neuroinflammation
   through activating the Toll-like receptor 4 (TLR4) signaling pathway. ,
   It is worth noting that pretreatment with ORI could significantly
   inhibit the expression of M1 polarization markers and promote the
   transformation of microglia into the M2 type with anti-inflammatory
   properties ([88]Figure ). This is similar to the findings of previous
   reports that curcumin alleviates neuroinflammation by regulating
   microglial polarization, indicating that ORI may exert its
   anti-inflammatory and neuroprotective effects by reshaping the function
   of microglia.

   In the in vivo experiment induced by acute lipopolysaccharide (LPS)
   ([89]Figure ), the mice showed significant behavioral despair in the
   forced swimming test and the tail suspension test and exhibited
   anhedonia in the sucrose preference test. These typical depression-like
   behaviors highly matched the characteristics of the LPS model reported
   in the literature. , After intervention with ORI, the duration of
   behavioral despair of the mice was significantly shortened, and the
   sucrose preference significantly recovered ([90]Figure E), indicating
   that ORI could effectively improve the depression-like symptoms induced
   by acute inflammation. Further analysis of the prefrontal cortex (PFC)
   ([91]Figure ) showed that LPS injection significantly activated the
   microglia in the PFC region, upregulated the expression of
   pro-inflammatory factors, and abnormally increased the frequency of
   excitatory postsynaptic currents, suggesting that the PFC brain region
   was abnormally activated. This finding was consistent with the enhanced
   inflammatory activity observed in specific brain regions of depression
   patients. However, treatment with ORI could reverse these abnormal
   changes, reconfirming its regulatory effect on microglial polarization.
   This was similar to research findings showing that quercetin could
   improve depressive symptoms by inhibiting the inflammatory response in
   the PFC region, indicating that targeting inflammation in the PFC
   region might be a key mechanism through which ORI exerts its
   antidepressant effect.

   To deeply analyze the mechanism of action of ORI, this study utilized
   network pharmacology to predict that ORI is closely related to the
   phosphatidylinositol 3-kinase (PI3K)-protein kinase B (AKT) signaling
   pathway. Western blot experiments confirmed ([92]Figure ) that ORI can
   significantly upregulate the phosphorylation of PI3K and AKT, as well
   as their downstream anti-inflammatory mediators, suggesting that this
   pathway plays a core role in regulating microglial polarization and
   inflammatory responses. This finding aligns with research results
   showing that ORI alleviates liver injury through the PI3K-AKT pathway,
   indicating that this pathway may be a common mechanism through which
   ORI exerts its protective effects on multiple organs.

   In the chronic depression model ([93]Figures and ), treatment with CUMS
   led to persistent depression-like behaviors in mice, including reduced
   activity, anhedonia, and anxiety-like manifestations, which were highly
   similar to the clinical characteristics of human depression. , After
   long-term intervention with ORI, the behavioral indices of the mice
   were significantly improved, suggesting that ORI has a sustained
   therapeutic effect on depression induced by chronic stress. Compared
   with studies on natural products such as ginsenoside Rg1 in the CUMS
   model, ORI exhibited similar antidepressant efficacy. However, its
   unique mechanism involving the regulation of microglial polarization
   and the PI3K-AKT pathway provides new targets for the treatment of
   depression.

   This study still has certain limitations. First, although the
   antidepressant effect of ORI has been verified in the LPS and CUMS
   models, its effects in other models, such as the chronic restraint
   stress model and the olfactory bulbectomy model, still need to be
   further explored. Second, although the PI3K-AKT pathway has shown a
   crucial role in this study, whether ORI coordinately regulates the
   inflammatory response through other signaling pathways, such as NF-κB
   and MAPK, remains to be further investigated. In addition, considering
   the important role of microglia in neuroinflammatory diseases such as
   autism and Alzheimer’s disease, the potential applications of ORI in
   these diseases are worthy of further exploration.

   In conclusion, this study systematically reveals for the first time the
   molecular mechanism by which ORI alleviates neuroinflammation and
   improves depression-like behaviors by regulating the M1/M2 polarization
   of microglia and activating the PI3K-AKT pathway, providing a new
   theoretical basis and potential drug options for the anti-inflammatory
   treatment of depression. Future research can further expand its
   applications in different disease models and deeply analyze its
   multitarget action mechanisms.

5. Conclusion

   In conclusion, ORI demonstrates a significant protective effect against
   depression in both in vitro and in vivo models. The underlying
   mechanism may involve ORI’s capacity to facilitate the transformation
   of microglia from the M1 proinflammatory phenotype to the M2
   anti-inflammatory phenotype through modulation of the PI3K/Akt
   signaling pathway. This modulation subsequently inhibits
   neuroinflammation in the PFC and alleviates depression-like symptoms
   associated with neuroinflammation ([94]Figure ). These findings offer a
   robust theoretical foundation and support ORI as a promising
   therapeutic candidate for the treatment of depression.

8.

   [95]8
   [96]Open in a new tab

   Schematic diagram of the mechanism of action of orientin (ORI) in the
   treatment of depression by reducing the inflammatory response of
   microglia.

   -ORI inhibits M1 polarization in BV2 cells, reduces the release of
   inflammatory substances, and alleviates the inflammatory response.
   After 1 week of ORI treatment, mice exhibited reduced depressionlike
   behavior induced by LPS, potentially through the modulation of the
   PI3K/AKT signaling pathway. It was also found that ORI could improve
   depression-like behavior in CUMS mice. Immunofluorescence staining of
   the PFC brain region showed that the M1 proinflammatory phenotype of
   microglia in the PFC brain region of CUMS mice was decreased after ORI
   administration, while the M2 -anti-inflammatory phenotype was
   increased. Overall, our study suggests that ORI alleviates microglial
   inflammatory responses in the prefrontal cortex, thereby improving
   depressionlike behavior in LPS and CUMS models.

Supplementary Material

   [97]ao5c02585_si_001.pdf^ (124.2KB, pdf)

Acknowledgments