Abstract

Objective

   Based on the special role of mitochondria in tumour energy metabolism.
   We hope to explore the pathogenesis and potential therapeutic targets
   of Hepatocellular carcinoma by analysing the expression of 1136
   mitochondrial proteins in hepatocellular carcinoma and their mechanisms
   in the Human.MitoCarta3.0 database.

Methods

   The expression of 1136 mitochondrial proteins in HCC was analysed by
   the TCGA database. We selected the top eight mitochondrial proteins
   among the highly expressed mitochondrial proteins that had not been
   studied in HCC and were statistically (P < 0.05) significant, according
   to fold change. Protein expression was verified by real-time
   quantitative reverse transcription polymerase chain reaction in tumours
   and adjacent paracancerous tissues of 34 pairs of HCC patients. Further
   in HCC cells, the expression of FDPS, DNA2 and MYO19 was verified.
   Clinical correlations of FDPS, DNA2 and MYO19 were analysed by UALCAN
   and KM-plot databases. Immune correlation of FDPS, DNA2 and MYO19 was
   analysed by TIMER2.0 and Sangerbox3.0 online databases.

Results

   Mitochondrial proteins were expressed on all 24 chromosomes. More than
   2/3 of the mitochondria were 100–600 bp long, of which 204 were
   secondary transmembrane proteins. 1136 mitochondrial proteins, of which
   202 are not included in the TCGA database. Of the 934 mitochondrial
   proteins included in the TCGA database, 706 were highly expressed and
   228 were poorly expressed in HCC. Further validated by HCC tissues and
   cells, the study found that significantly high expression of FDPS, DNA2
   and MYO19 was negatively correlated with the prognosis of HCC patients.
   The results of the immune correlation analysis showed that DNA2 and
   MYO19 may be involved in regulating the infiltration of immune cells.

Conclusion

   934 out of 1136 mitochondrial proteins in the Human.MitoCarta3.0
   database were differentially expressed in HCC, suggesting that
   mitochondrial proteins play an important biological role in the
   development of HCC. Further experimental validation and bioinformatics
   analyses showed that functional mitochondrial proteins are potential
   pathophysiological mechanisms for malignant progression of HCC.
   Mitochondrial proteins, in the future, have the potential to be
   valuable therapeutic targets for HCC.

1. Introduction

   Hepatocellular carcinoma (HCC) is the predominant type of primary liver
   cancer, accounting for approximately 75–85% of cases. HCC is one of the
   major cancers of all malignant tumours in which mortality far outweighs
   morbidity [[32]1,[33]2]. Due to its malignant proliferative nature,
   cancer has always been considered a proliferative disease. More
   recently, there is growing evidence that it is a metabolic disease
   [[34]3,[35]4]. Imbalances in cellular energy metabolism are as
   prevalent in cancer cells as other features of cancer function (growth
   inhibition escape, sustained proliferation, inhibition of apoptosis,
   unrestricted cell replication, induction of neovascularisation and
   invasion and migration) [[36]5,[37]6].

   Metabolic reprogramming is widely recognized as a hallmark of
   malignancies and serves as an important adaptation mechanism for HCC
   cells to microenvironment [[38]6,[39]7]. Targeting energy metabolism
   has become a crucial direction in cancer treatment [[40]8]. As a key
   organelle, mitochondria play an essential role in regulating tumor cell
   metabolism [[41]9]. Mitochondria are functional organelles with a
   double membrane structure, which play a fundamental role in basic
   biological functions such as material metabolism, energy generation,
   ion storage and cell proliferation regulation [[42]10]. First, liver
   cells are rich in mitochondria, which make up 13–20 percent of the
   liver’s volume [[43]11]. Secondly, a large number of studies have found
   that extensive mitochondrial abnormalities are observed in the
   histology of liver fibrosis, cirrhosis, and primary liver cancer
   [[44]10,[45]12,[46]13].

   Mitochondrial proteins participate in controlling the proliferation,
   apoptosis, and metabolic reprogramming of tumor cells, making them
   better adapted to the tumor microenvironment [[47]14]. Mitochondrial
   dynamin proteins, such as mitofusin 1 (MFN1) and mitofusin 2 (MFN2),
   play crucial roles in different types of tumors. Research by Huang et
   al. found that MFN1 is positively correlated with the overall survival
   (OS) of HCC patients [[48]15]. Rehman et al. found that downregulation
   of MFN2 promotes mitochondrial fission, thereby enhancing tumor (lung
   cancer) proliferation, reducing apoptosis, and facilitating malignant
   progression [[49]16]. Studies have shown that the
   mitochondrial-associated protein DNA damage-inducible transcript 4
   (DDIT4) is elevated under stress conditions such as chemotherapy,
   hypoxia, and DNA damage. Abnormally increased DDIT4 is involved in
   various malignant biological behaviors, including tumor drug
   resistance, malignant proliferation, and invasion [[50]17].

   This study focuses on HCC and mitochondrial proteins to excavate the
   biological functions of mitochondria in the development of HCC. First,
   initial screening and validation was performed through relevant common
   databases on mitochondria, tumor and immunity. Then, through further
   experimental validation and mechanism mining, it provides the basis for
   further basic and clinical experiments. We hope that our study will
   provide a new direction for the study of HCC-associated mitochondrial
   proteins and improve the status quo of diagnosis and treatment of HCC,
   in which the mortality rate of HCC is higher than the morbidity rate.

2. Materials and methods

2.1. Workflow

   All the workflows are shown in [51]Fig 1.

Fig 1. Flow chart of the study.

   [52]Fig 1
   [53]Open in a new tab

   GO: Gene Ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes;
   qRT‒PCR: quantitative reverse transcription polymerase chain reaction.

2.2. Mitochondrial protein data download and correlation analysis

   Human MitoCarta3.0: 1136 mitochondrial Genes database
   ([54]https://www.broadinstitute.org/files/shared/metabolism/mitocarta/h
   uman.mitocarta3.0. html) was used to download data related to 1136
   mitochondrial proteins. The expression of 1136 mitochondrial proteins
   in HCC was analysed using the TCGA visualisation database UALCAN
   ([55]http://ualcan.path.uab.edu/). We first obtained the gene sequences
   of the mitochondrial proteins through NCBI
   ([56]https://www.ncbi.nlm.nih.gov). The mitochondrial proteins were
   then characterised for their transmembrane properties through the TMHMM
   2.0 website
   ([57]https://services.healthtech.dtu.dk/services/TMHMM-2.0/).

2.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG)
enrichment analyses

   We performed GO and KEGG enrichment analysis on 706 high expressed
   mitochondrial proteins. GO and KEGG enrichment analysis and image
   visualisation were done through the online database Bioinformatics
   ([58]http://bioinformatics.com.cn/basic_tumor_purity_estimation_by_esti
   mate_t016).

2.4. Collection of tissue specimens

   Thirty-four patients with HCC (≥18 years old) who underwent radical
   surgical treatment at Nantong Third People’s Hospital affiliated with
   Nantong University were included in the study (From February 1, 2021 to
   February 1, 2022). The patients’ HCC tumours and their paired
   paracancerous tissues were collected. Specimens were transferred via
   liquid nitrogen after ex vivo and stored in a −80 °C degree
   refrigerator. The study was approved by the Ethics Committee of the
   Third People’s Hospital of Nantong, affiliated with Nantong University,
   and each subject signed an informed consent form (Ethics Approval No.
   EL2021012).

2.5. Cell lines and culture conditions

   The human normal cell line LO2 and the human HCC cell line Hep3B2.1-7
   were purchased from the Stem Cell Bank of the Chinese Academy of
   Sciences (Shanghai, China), and were uniformly cultured in a humidified
   incubator containing 5% CO[2] at a temperature of 37°C (CO[2]–311,
   Thermo).

2.6. Quantitative reverse transcription polymerase chain reaction (qRT-PCR)
of tissues and cells

   HTseq-Counts gene expression data of 374 HCC patients and 50 normal
   subjects in the TCGA-LIHC25 cohort were downloaded from the UCSC Xena
   database ([59]https://xena.ucsc.edu). The top 20 genes upregulated in
   HCC were selected according to the differential expression ratio to
   make heat maps. The verified genes were excluded, and the first 8
   mitochondrial proteins that were highly expressed in HCC were selected
   for qRT-PCR validation.

   RNAiso Plus (Takara, Beijing, China) was used to extract tissue and
   cellular total RNA. total RNA was reverse transcribed to cDNA according
   to the instructions of PrimeScript RT Master Mix (Takara). gene
   amplification and detection were performed using a TB Green Premix Ex
   Taq II (Takara) and a CFX Connect fluorescence quantitative PCR
   instrument (BIO-RAD, USA). Relative expression was analyzed using the
   comparative cycle threshold (Ct) (2^-ΔΔCt) method. All experiments were
   performed in triplicate. [60]Table 1 lists the glyceraldehyde
   3-phosphate dehydrogenase (GAPDH) and eight mitochondrial protein
   primer sequences.

Table 1. Primer sequences of TOP 8 Mitochondrial protein.

   Primer     Primer sequence (5’--3’)
   GAPDH-F    CAATGACCCCTTCATTGACC
   GAPDH-R    TTGATTTTGGAGGGATCTCG
   PIF1-F     CACGGTTCTGCTTCCAGTCCAAG
   PIF1-R     TCTGCCTGCCTCCACACCTTG
   TOMM40L -F TGTATCCAGGGTGTTCCAGGTGAG
   TOMM40L-R  CTGCCATGATGCCGCTGCTC
   DNA2-F     CGCCTGGTCATCACTGCTTCAC
   DNA2-R     CCTGGCTCTACTGGAACAGAACAC
   FDPS-F     CGGGAGAGGTGGCTGGGTTC
   FDPS-R     TCATTCTGAGGGAGGAGCAAAGGG
   FLAD1-F    CCACCCTCCCTGCTCCAGATAC
   FLAD1-R    TCCGCTCCTCTTCTTCGTTCTCC
   MPV17-F    CTGGAAGGCACATCGGCTCTAAG
   MPV17-R    GCCCACTTTGAGGAGGTTGTCTG
   SLC25A19-F CAGTGAGAAGGAGCAGGAAGTTG
   SLC25A19-R TGATAGGTGTAGGATGGCGTCTG
   MYO19-F    AGCCGCAGTCCAGACCTACC
   MYO19-R    CTCGTCCTCACTGGCTCCTTTG
   [61]Open in a new tab

2.7. Clinical correlation and immunological correlation analysis of FDPS,
DNA2 and MYO19

   The expression levels of FDPS, DNA2 and MYO19 in HCC were analysed by
   UALCAN and the human protein Atlas ([62]https://www.proteinatlas.org).
   UALCAN and KM plot ([63]http://kmplot.com/analysis/) were used to
   analyse the prognostic and clinical relevance of mitochondrial
   proteins. FDPS, DNA2 and MYO19 immune cell correlation and infiltration
   analyses were performed using TIMER 2.0 and Sangerbox 3.0
   ([64]http://www.sangerbox.com/home.html).

2.8. Statistical analysis

   GraphPad Prism 8.0 and SPSS 24.0 are used for data analysis and image
   visualization. All data were presented as the mean ± standard deviation
   (SD). Statistical significance was defined as P < 0.05.

3. Results

3.1. Mitochondrial protein characteristic analysis in HCC

   Most of the 1136 mitochondrial proteins were 100–600 bp long ([65]Fig
   2A), and more than half were expressed on both the inner and outer
   membrane of the mitochondria ([66]Fig 2B), evenly distributed on 24
   human chromosomes ([67]Fig 2C). Verification results at TCGA showed
   that 706 out of 1136 mitochondrial proteins were highly expressed in
   hepatocellular carcinoma ([68]Fig 2D). An online database analysis
   showed that 204 of 1136 mitochondria were transmembrane proteins
   ([69]Fig 2E).

Fig 2. Basic characteristics and expression of mitochondrial proteins in HCC.

   [70]Fig 2
   [71]Open in a new tab

   (A) Amino acid number of mitochondrial proteins; (B) Cellular location
   of mitochondrial proteins; (C). Distribution of mitochondrial proteins
   in human chromosomes; (D). mitochondrial proteins differentially
   expressed in HCC (202 are not included in TCGA); (E). Number of
   transmembrane proteins in mitochondrial proteins.

3.2. KEGG and GO enrichment analysis of mitochondrial protein in HCC

   GO enrichment analysis of the high expressed mitochondrial proteins
   included three categories: cellular component, biological process, and
   molecular function. In the cellular component analysis, the three most
   enriched terms were mitochondrial inner membrane, mitochondrial matrix
   and mitochondrial protein complex. In the biological process analysis,
   mitochondrial gene expression, mitochondrial translation, energy
   derivation by oxidation of organic compounds were the three most
   enriched terms. In the molecular function analysis, structural
   constituent of ribosome, oxidoreductase activity, acting on NAD(P)H and
   oxidoreductase activity, acting on NAD(P)H, quinone were the most
   prominent terms ([72]Fig 3A). KEGG pathway enrichment analysis showed
   that the functions of the high expressed mitochondrial proteins may be
   focused on Oxidative phosphorylation, Non-alcoholic fatty liver disease
   and Diabetic cardiomyopathy ([73]Fig 3B).

Fig 3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG)
enrichment analyses.

   [74]Fig 3
   [75]Open in a new tab

   (A). GO enrichment analysis of 706 mitochondrial proteins highly
   expressed in HCC; (B). KEGG enrichment analysis of 706 mitochondrial
   proteins highly expressed in HCC.

3.3. Expression and prognosis of mitochondrial protein in HCC

   Highly expressed mitochondrial proteins in HCC were selected based on
   TCGA raw data according to fold change (FC). The top 20 mitochondrial
   proteins with FC > 2.5 (MY019, SLC25A19, ACLY, MPV17, RAB24, POLQ,
   PIF1, DNA2, MAVS, DTYMK, RECQL4, MTHFD1L, NT5DC2, HPDL, PYCR1, OX6B2,
   TOMMAOL, FLAD1, FDPS and COX412) were used as study objects to produce
   heat maps ([76]Fig 4A). We selected the first 8 highly expressed
   mitochondrial proteins that had not been validated in HCC (MY019,
   SLC25A19, MPV17, PIF1, DNA2, TOMMAOL, FLAD1 and FDPS) and validated
   them in 34 pairs of HCC tissues, which showed that MY019(FC ≈ 2.7),
   DNA2(FC ≈ 2.5), and FDPS(FC ≈ 1.7) were significantly overexpressed in
   HCC tissues ([77]Fig 4B, P < 0.05). We further verified the expression
   levels of MY019, DNA2 and FDPS in HCC cells. The results showed that
   MY019(FC ≈ 2.0), DNA2(FC ≈ 2.3) and FDPS(FC ≈ 1.9) were significantly
   highly expressed in the human hepatocellular carcinoma cell line
   Hep3B2.1-7 compared to LO2 in normal human hepatocytes ([78]Fig 4C,
   P < 0.05).

Fig 4. Screening of differentially expressed mitochondrial proteins.

   [79]Fig 4
   [80]Open in a new tab

   (A). Heatmap showing the top 20 (order of fold change) mitochondrial
   proteins highly expressed in HCC; (B). qRT-PCR validation of the top 8
   mitochondrial proteins highly expressed in HCC (n = 34); (C). qRT-PCR
   validation of FDPS, DNA2 and MYO19 expression in HCC cells.

3.4. Pan-cancer analysis of FDPS, DNA2 and MYO19

   Pan-cancer analysis showed that FDPS was significantly highly expressed
   in HCC, bladder cancer, breast cancer, colon cancer, esophageal cancer,
   head and neck squamous cell carcinoma, renal clear cell carcinoma, lung
   adenocarcinoma, non-small cell lung carcinoma, gastric adenocarcinoma
   and endometrial cancer. In addition, FDPS was lowly expressed in
   papillary cell carcinoma of the kidney, while there was no difference
   in the expression in thyroid and prostate adenocarcinomas ([81]Fig 5A,
   P > 0.05). In addition to melanoma and thyroid cancer, DNA2 is highly
   expressed in these other tumors ([82]Fig 5B). MYO19 is underexpressed
   in thyroid and renal clear cell carcinoma, and highly expressed in the
   remaining tumors ([83]Fig 5C).

Fig 5. Pan-cancer analysis of FDPS, DNA2 and MYO19.

   [84]Fig 5
   [85]Open in a new tab

   (A). Pan-cancer analysis of FDPS; (B). Pan-cancer analysis of DNA2;
   (C). Pan-cancer analysis of MYO19; (D). FDPS was highly expressed in
   HCC; (E). FDPS protein interaction network diagram; (F). Distribution
   of FDPS in cells; (G). DNA2 was highly expressed in HCC; (H). DNA2
   protein interaction network diagram; (I). Distribution of DNA2 in
   cells; (J). MYO19 was highly expressed in HCC; (K). MYO19 protein
   interaction network diagram; (L). Distribution of MYO19 in cells.

   We further analyzed the multiplicity of change of FDPS, DNA2 and MYO19
   in HCC by the UALCAN database, which were about 3, 3.5 and 3.8,
   respectively ([86]Fig 5D, [87]5G and [88]5J). Explore the cellular
   distribution, major functions and protein interaction networks of the
   three mitochondrial proteins via The human protein Atlas website.FDPS
   is primarily associated with cellular metabolism and interacts with six
   proteins (SLC30A2, SSMEM1, RNF19B, ABHD16A, EIF4ENIF1 and ATXN1)
   ([89]Fig 5E). FDPS was predominantly distributed in the cytoplasm, with
   a small amount expressed in the nucleus ([90]Fig 5F). DNA2 is a key
   enzyme involved in DNA replication and DNA repair in the nucleus and
   mitochondria, and may serve as a target for drug action, and is closely
   related to 4 proteins (PTGES3, CIAO1, MMS19 and CIAO2B) ([91]Fig 5H).
   DNA2 is mainly distributed in mitochondria ([92]Fig 5I). MYO19 is
   localized in the outer mitochondrial membrane and may be involved in
   mitochondrial transport and localization, interacting with three
   proteins (RHOT2, AKAP1 and FBXL4, [93]Fig 5K). In addition, MYO19 was
   predominantly distributed in mitochondria, with a small amount
   expressed in the cytoplasm ([94]Fig 5L).

3.5. Clinical relevance of FDPS, DNA2, and MYO19 in patients with HCC

   We used the UALCAN database to investigate the relationship between
   FDPS, DNA2 and MYO19 and clinical parameters in HCC patients. Patients
   with HCC were divided into subgroups based on age, gender, lymph node
   metastasis status, TP53 mutation status, tumor grade, and individual
   cancer stage. We found significantly elevated levels of FDPS, DNA2, and
   MYO19 expression at all ages ([95]Fig 6A). There were no significant
   differences in FDPS expression levels with respect to patient gender,
   lymph node metastasis status, and TP53 mutation status. The expression
   level of DNA2 was significantly upregulated in women, lymph node
   metastasis and TP53 mutation groups of HCC patients. There were no
   differences in gender, lymph node metastasis, and MYO19. The expression
   of MYO19 was significantly upregulated in HCC patients in the TP53
   mutant group ([96]Fig 6B, [97]6C and [98]6D). According to tumor grade,
   the expression levels of three mitochondrial proteins were
   significantly higher in grades 1, 2, 3 and 4 compared to controls. The
   expression levels of DNA2 and MYO19 were relatively higher in HCC
   patients with tumor grade 3 compared with tumor grades 1 and 2
   (P < 0.05, [99]Fig 6E). The expression levels of DNA2 and MYO19 were
   significantly upregulated in FDPS at stages 1, 2, 3, and 4 according to
   individual cancer stage. Among them, the expression levels of DNA2 and
   MYO19 were upregulated in stages 2 and 3 compared with stage 1
   (P < 0.05, [100]Fig 6F).

Fig 6. Clinical correlation analysis of FDPS, DNA2 and MYO19.

   [101]Fig 6
   [102]Open in a new tab

   (A). Differential expression of FDPS, DNA2 and MYO19 in HCC patients by
   age; (B). Differential expression of FDPS, DNA2 and MYO19 in HCC
   patients by gender. (C). Differential expression of FDPS, DNA2 and
   MYO19 in lymph node metastasis of HCC patients; (D).Differential
   expression of FDPS, DNA2 and MYO19 in TP53 mutations of HCC patients;
   (E).Differential expression of FDPS, DNA2 and MYO19 in various tumour
   grades of HCC patients; (F).Differential expression of FDPS, DNA2 and
   MYO19 expression differences in various tumour stages in HCC patients;
   (G).Correlation analysis of FDPS with AFP, GPC3, PCNA and CD34; (H).
   Correlation analysis of DNA2 with AFP, GPC3, PCNA and CD34; (I).
   Correlation analysis of MYO19 with AFP, GPC3, PCNA and CD34; (J).
   Survival analysis analysis of FDPS with prognosis of HCC patients; (K).
   Survival analysis of DNA2 with prognosis of HCC patients; (L). Survival
   analysis of MYO19 with prognosis of HCC patients.

   Correlation analysis showed that all three mitochondrial proteins were
   significantly positively correlated with AFP, GPC3 and PCNA. However,
   there was no correlation between any of the three proteins and CD34
   ([103]Fig 6G, [104]6H and [105]6I). We used the KM-Plotter database to
   analyze the effect of three mitochondrial proteins on the prognosis of
   HCC patients. HCC patients were categorized into high and low
   expression groups based on median protein expression. Survival analysis
   showed that patients with lower expression of FDPS, DNA2 and MYO19 had
   better overall survival (OS, [106]Fig 6J, [107]6K and [108]6L). Among
   them, patients with lower DNA2 and MYO19 expression also had better
   disease-specific survival (DSS), progression-free survival (PFS) and
   relapse-free survival (RFS) ([109]Fig 6K and [110]6L).

   These results suggest that the mitochondrial proteins FDPS, DNA2 and
   MYO19 are closely associated with clinical parameters and prognosis of
   HCC patients.

3.6. Immune correlation of FDPS, DNA2 and MYO19 in HCC

   We analyzed the immune-related data of FDPS, DNA2 and MYO19 using the
   TIMER database. The results showed no significant correlation between
   FDPS and various immune cell populations ([111]Fig 7A). There was a
   significant correlation between the expression of DNA2 and MYO19 and
   the infiltration of various immune cell populations, including B cells,
   T cells (CD8^+ and CD4^+), neutrophils, macrophages, and dendritic
   cells ([112]Fig 7B and [113]7C). In addition, we observed that copy
   number mutations in DNA2 partially inhibited neutrophil infiltration.
   Copy mutations in MYO19 inhibited infiltration of CD8^+ T cells,
   macrophages, neutrophils and dendritic cells. The results suggest that
   DNA2 and MYO19 may be involved in regulating immune cell infiltration
   ([114]Fig 7D and [115]7E). To further assess the impact of DNA2 and
   MYO19 on patient prognosis and tumor mutational load, we evaluated
   stromal, immune and ESTIMAT scores ([116]Fig 7F and [117]7G). Our
   findings provide evidence that DNA2 and MYO19 are negatively correlated
   with the above three scores. This suggests that increased expression of
   DNA2 and MYO19 accelerates the development of HCC.

Fig 7. Immunocorrelation analysis of FDPS, DNA2 and MYO19.

   [118]Fig 7
   [119]Open in a new tab

   (A) Correlation analysis between FDPS and each immune cell; (B)
   Correlation analysis between DNA2 and each immune cell; (C) Correlation
   analysis between MYO19 and each immune cell; (D) Effect of DNA2 copy
   number mutant fraction on each immune cell; (E) Effect of MYO19 copy
   number mutant fraction on each immune cell; (F) Matrix, immune and
   ESTIMAT scores of DNA2; (G) Matrix, immunity and ESTIMAT scores of
   MYO19.

4. Discussion

   1136 mitochondrial proteins, of which 706 showed high expression in
   HCC, which may be associated with the high proliferative properties of
   the tumor. Statistical analysis in this study revealed that 80% of
   mitochondrial proteins are 100–600 amino acids long. The common belief
   is that the longer the protein, the higher the chance of mutation.
   Proteins between 50 and 500 amino acids long are more stable [[120]18].
   We found that FDPS with a length of 419 amino acids was more stable by
   comparing protein expression in both TP53 mutant and non-mutant groups
   of patients. DNA2 and MYO19 were 1060 and 970 amino acids long,
   respectively, with significant differences in expression between the
   two groups of patients. FDPS is a key enzyme in cholesterol
   biosynthesis and has been found to play an important role in the
   development of several malignant tumors [[121]19,[122]20]. Our study
   found that mitochondrial protein FDPS is highly expressed in HCC and
   negatively correlated with prognosis (OS). Numerous previous studies
   have shown that FDPS is strongly associated with tumor drug resistance
   (For example, FDPS modulates platinum sensitivity in human ovarian
   cancer [[123]21]; Disruption of the FDPS/Rac1 axis increases the
   sensitivity of radiation therapy for pancreatic ductal adenocarcinoma
   [[124]19]). Therefore, we hypothesized that FDPS may exert a biological
   function by modulating chemotherapeutic drug sensitivity in HCC
   patients.

   Mitochondria and immune cells interact closely [[125]22]. Mitochondria
   are functional organelles with a double membrane structure, which play
   a fundamental role in basic biological functions such as material
   metabolism, energy generation, ion storage and cell proliferation
   regulation [[126]10]. Recent studies have shown that mitochondria are
   not only a source of energy but also play a crucial role in regulating
   cell death signaling and innate immunity.[[127]23]. Our findings
   indicate that the expression of mitochondrial MYO19 and DNA2 is
   significantly associated with the tumor infiltration of various immune
   cells, including B cells, T cells (CD8^+ and CD4^+), neutrophils,
   macrophages, and dendritic cells. Based on the results of immune
   correlation analyses, we hypothesize that mitochondrial proteins may
   regulate tumor progression by influencing the immune microenvironment.
   In summary, mitochondrial proteins play crucial biological roles in the
   development and progression of HCC, warranting further basic and
   clinical investigations.

   The mitochondrial repair protein DNA replication deconjugase/nuclease 2
   (DNA2) mediates genome stability. It plays an important role in
   maintaining the functional integrity of mitochondria. Our study showed
   that DNA2 showed high expression in most tumors, including HCC, except
   for melanoma and thyroid tumors. Clinical correlation results showed
   that DNA2 was negatively correlated with OS, DSS, PFS and RFS in HCC.
   With tumor development, the expression of DNA2 gradually increased. In
   summary, DNA2 plays an important role in the malignant progression of
   HCC. In addition, DNA2 expression was associated with multiple immune
   cell infiltrations, indicating a very strong tumor relevance.
   Furthermore, copy number mutations in DNA2 partially inhibited
   neutrophil infiltration and did not affect other immune cell
   infiltration. Studies have shown that neutrophils can infiltrate tumors
   and participate in malignant progression of tumors through their
   phenotypic and functional plasticity [[128]24,[129]25].
   Tumor-associated neutrophils (TAN) with a pro-carcinogenic phenotype
   are involved in all stages of tumorigenesis and development, including
   tumor initiation, metastasis, and immunosuppression [[130]26].
   Increased neutrophil infiltration in solid tumors is usually associated
   with a poor prognosis in patients with tumors [[131]27]. Therefore, we
   hypothesized that DNA2 may accelerate the malignant biological
   progression of HCC by accelerating TAN infiltration through genetic
   mutations.

   Myosin (MYO) is the only known motor of actin. Many studies have
   highlighted their dysregulation in cancer as an important factor
   influencing tumor invasion and apoptosis [[132]28]. Our results showed
   that MYO19 was significantly highly expressed in HCC tissues and cells.
   In addition, MYO19 showed a significant positive correlation with
   antiproliferative cell nuclear antigen (PCNA) (correlation coefficient:
   0.724) and a negative correlation with prognosis. Next, we will focus
   on the effects of MYO19 on the malignant functions of HCC
   proliferation, invasion and apoptosis. As with DNA2, MYO19 expression
   is associated with infiltration of a variety of immune cells.
   Differently, copy number mutations in MYO19 not only partially
   inhibited neutrophil infiltration, but also increased tumor
   infiltration by CD8^+ T cells, macrophages and dendritic cells. Our
   findings indicate that MYO19 promotes the malignant biological
   progression of HCC and may be closely related to the tumor
   microenvironment (TME). Studies have shown that mitochondria play a
   crucial role in regulating the immunity of infiltrating immune cells in
   TME [[133]29].Infiltrating immune cells (T cells, natural killer cells,
   and macrophages) are metabolically reprogrammed by mitochondria to be
   more adaptive to the unfavorable conditions of TME and to enhance their
   antitumor activity [[134]30]. Recent studies have shown that targeting
   mitochondria can inhibit tumor progression by improving immune cell
   function [[135]31,[136]32]. Taken together, targeting the immune strong
   infiltration-associated mitochondrial protein MYO19 may provide a new
   direction for immunotherapy of HCC.

   Our study explored for the first time the expression levels of all
   mitochondrial proteins in HCC. Most mitochondria are less susceptible
   to mutation, have higher stability, and are expected to be promising
   therapeutic targets and biomarkers for HCC. We also validated three
   mitochondrial proteins, MYO19, DNA2 and FDPS, which are closely
   associated with HCC development through cell and tissue experiments. In
   addition, mitochondria are likely to accelerate the malignant
   progression of HCC by affecting the tumor microenvironment/metabolic
   reprogramming, etc. Mitochondrial proteins play an important biological
   importance in HCC disease progression and deserve further
   investigation.

5. Conclusions

   In summary, our study identified a large number of mitochondrial
   proteins that are highly expressed in HCC. In addition, we identified
   three (MYO19, DNA2 and FDPS) mitochondrial proteins that are closely
   associated with poor prognosis of HCC. The specific pathologic
   mechanisms by which mitochondrial proteins influence the development of
   HCC await more detailed studies in the future.

Supporting information

   S1 Data. Raw data.

   (XLSX)
   [137]pone.0329209.s001.xlsx^ (361.3KB, xlsx)

Acknowledgments