Abstract
With the global aging population, skeletal muscle aging has threatened
to elderly health, making dietary interventions for age-related muscle
decline a research priority. Lycium barbarum, a traditional food and
medicinal herb, was used in the study to prepare Lycium barbarum water
(LBW). This experiment was conducted in animals and included four
groups: young control (C-Young), aged control (C-Aged), young
LBW-drinking (G-Young), and aged LBW-drinking (G-Aged). Assessments
covered skeletal muscle mass, cross-sectional area, and exercise
ability to compare health status. The study measured mRNA expression of
Atrogin-1 and MuRF-1 from the Forkhead Box O (FOXO) pathway, advanced
glycation end products (AGEs) and senescence-associated β-galactosidase
(SA-β-gal), oxidative stress levels via superoxide dismutase (SOD),
malondialdehyde (MDA) and glutathione (GSH), inflammatory levels
through interleukin-10 (IL-10) and tumor necrosis factor-alpha (TNF-α),
and applied untargeted metabolomics to profile metabolic alterations.
Optimal LBW was achieved at 80 °C with a 1:10 (w/v) solid-liquid ratio.
In aged mice, long-term LBW administration improved exercise capacity,
reduced muscle atrophy, and increased muscle mass, alongside decreased
aging-related markers, alleviated oxidative stress, and modulated
inflammatory levels. Additionally, metabolomics confirmed age-related
oxidative stress and inflammation. Long-term LBW consumption alleviates
age-related skeletal muscle dysfunction via multi-target regulation,
holding promise as a natural nutritional intervention for mitigating
skeletal muscle aging.
Keywords: Lycium barbarum water, skeletal muscle aging, oxidative
stress, inflammation, aging-related factors, metabolomics analysis
1. Introduction
Aging is an inevitable biological process characterized by progressive
functional decline across multiple organ systems, laying the foundation
for chronic diseases [[36]1]. The global population is aging rapidly,
with adults aged over 65 years old projected to account for 16% of the
world’s population by 2050 [[37]2]. This demographic shift has
heightened interest in nutritional interventions to delay age-related
tissue degeneration, particularly in skeletal muscle—the body’s largest
metabolic organ [[38]3].
Skeletal muscle aging is marked by reduced muscle fiber cross-sectional
area, impaired motor function, and increased fall risk [[39]4,[40]5].
Beyond mobility issues, sarcopenia triggers metabolic disorders such as
type 2 diabetes and dyslipidemia [[41]6], forming a vicious cycle
driven by FOXO-mediated myofiber breakdown and NF-κB-induced chronic
inflammation [[42]7,[43]8]. Epidemiologically, sarcopenia affects
10–27% of Europeans aged ≥60 and up to 41.0% of Asians aged ≥65,
highlighting the urgency for effective nutritional strategies
[[44]9,[45]10].
Natural products have emerged as promising anti-aging agents due to
their multi-target effects and safety. Goji (Lycium barbarum),
extensively cultivated in China, is primarily found in the northwestern
and northern regions [[46]11]. This plant, known for its dual medicinal
and edible uses, boasts a medicinal history of over two millennia and
holds a prestigious place in Chinese medicine [[47]12]. Modern research
has identified that Lycium barbarum is rich in Lycium barbarum
polysaccharides (LBP, comprising 5–8% of its content), carotenoids,
betaine, and polyphenolic compounds, which offer various benefits such
as immune enhancement, anti-cancer activity, hypoglycemic, hypotensive,
hypolipidemic effects, anti-aging, and cosmetic advantages
[[48]13,[49]14,[50]15]. Additionally, Lycium barbarum fruits
significantly boost muscle and hepatic glycogen storage, enhance human
vitality, and exhibit anti-aging properties [[51]16,[52]17,[53]18].
While Lycium barbarum is an economically significant cash crop, current
research on it has largely focused on extracts of specific bioactive
components such as LBP rather than natural aqueous preparations
[[54]19,[55]20]. However, focusing on single-component extracts may
miss synergies among multiple bioactive substances, as natural products
act via combined effects. This has resulted in a relative paucity of
studies regarding the comprehensive anti-aging effects of LBW.
To address this gap, the study aims to optimize the preparation
protocol for Lycium barbarum water (LBW), using mice as models, and
conduct long-term interventions by replacing daily drinking water with
LBW in both young and aged mice groups. LBW aligns with traditional
use—goji is commonly consumed via boiling/soaking, retaining a
comprehensive profile of native components without losses or
alterations from complex extraction (e.g., solvent use) [[56]21]. It
also avoids residual reagent risks, suiting long-term dietary
interventions that simulate real consumption. Furthermore, the present
study focuses on the combined effects of multiple components in LBW,
and this perspective further enhances the novelty of the research. The
study monitored changes in various indexes, assessed motor capacity and
skeletal muscle atrophy-related parameters, and explored the effects of
long-term LBW consumption on skeletal muscle function and its
underlying mechanisms, focusing on oxidative stress, inflammation, and
metabolic pathways that drive skeletal muscle aging. This study not
only enhances understanding of LBW’s anti-aging potential but also
provides a theoretical basis for developing natural nutritional
interventions to mitigate skeletal muscle aging and improve elderly
health, thus holding significant theoretical and practical importance.
2. Materials and Methods
2.1. Materials
Young (8-week-old) and aged (18-month-old) male C57BL/6J mice were
purchased from Vital River Laboratories (Beijing, China). Dried Lycium
barbarum fruits (Ningxia origin) were obtained from official flagship
store of Ningxia Red. Chromatographic grade methanol (batch No.:
10014108, purity ≥ 99.7%), chromatographic grade acetonitrile (batch
No.: 400641646, purity ≥ 99.9%), analytical grade formic acid (batch
No.: XW06418606, purity ≥ 99%), analytical grade phosphoric acid (batch
No.: 100154008), analytical grade trichloromethane (batch No.:
10006818, purity ≥ 99.0%), analytical grade chloroform (batch No.:
[57]HW049401, purity ≥ 99.9%), and analytical grade absolute ethanol
were all purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai,
China). ELISA kits for the detection of advanced glycation end products
(AGEs, batch No.: EHJ-30217m), senescence-associated β-galactosidase
(SA-β-gal, batch No.: EHJ-30337m), superoxide dismutase (SOD, batch
No.: EHJ-30396m), malondialdehyde (MDA, batch No.: EHJ-30395m),
glutathione (GSH, batch No.: EHJ-98364m), interleukin-10 (IL-10, batch
No.: EHJ-47391m), and tumor necrosis factor-α (TNF-α, batch No.:
EHJ-45111m) were supplied by Huijia Biotechnology Co., Ltd. (Shanghai,
China). Hematoxylin was obtained from YD Diagnostics (Seoul, Republic
of Korea), and the frozen section staining kit (batch No.: 99-900-01)
was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
The main instruments and equipment used in this study included:
adjustable-volume pipettes (Model: Research plus) from Eppendorf AG
(Hamburg, Germany); a high-speed refrigerated centrifuge (Model:
CR-GIII) from Hitachi, Ltd. (Tokyo, Japan); a decolorizing shaker
(Model: TS-100), a vacuum pump (Model: GM-0.33A), and a vortex
oscillator (Model: Vortex-Genie 2) from Kylin-Bell Lab Instruments Co.,
Ltd. (Haimen, China); a double-beam UV-visible spectrophotometer
(Model: A560) from AOE Instruments Co., Ltd. (Shanghai, China); a
BIO-GS3 grip strength meter from BIOSEB (Vitrolles, France); a ZB-200
rotarod fatigue tester from Chengdu Techman Software Co., Ltd.
(Chengdu, China); a platform treadmill (Model: Treadmill for Mice, Cat.
No. 39250) from Noldus Information Technology Co., Ltd. (Beijing,
China); and a fully automatic microplate reader (Model: SH-1000LAB)
from Corona Electric Co., Ltd. (Ibaraki, Japan).
2.2. Preparation of LBW
The preparation of LBW was modified from the method described by Zhou
et al. [[58]22], using a single-factor optimization design to determine
optimal conditions. The primary optimization objectives were to
maximize antioxidant activity (see [59]Section 2.3) and the content of
major bioactive components (see [60]Section 2.4). Two independent
variables were evaluated: solid-liquid ratio (Lycium barbarum:distilled
water, w/v) at four levels (1:2, 1:5, 1:10, 1:20) and extraction
temperature at four levels (40 °C, 60 °C, 80 °C, 100 °C). All other
parameters were kept constant: extraction duration (1 h in a water
bath), ultrasonic-assisted extraction (30 min, fixed power 300 W,
frequency 40 kHz), centrifugation (5000 rpm for 10 min), and
re-extraction of residues under identical conditions to ensure maximum
component yield. Each combination of ratio and temperature was tested
in triplicate, using 100 g batches of cleaned Lycium barbarum (uniform
in size and maturity to minimize variability). Briefly, mixtures were
heated, subjected to ultrasonic extraction, centrifuged, and filtered.
Residues were re-extracted, and combined supernatants were concentrated
to half the original volume via rotary evaporation. The resulting LBW
was sterilized (autoclaved at 121 °C for 20 min) and stored at 4 °C
until subsequent experiments.
2.3. Antioxidant Properties
The antioxidant activity of LBW was estimated by superoxide radical,
2,2-Diphenyl-1-picrylhydrazyl (DPPH) and hydroxyl radical scavenging
activity, as described in the previous study [[61]23,[62]24]. In brief,
100 μL of LBW at various concentrations was mixed with 100 μL of 0.2 mM
DPPH solution in methanol. The mixture was incubated in the dark for 30
min at room temperature, and the absorbance was measured at 517 nm. The
scavenging activity was calculated using the Equation (1).
[MATH:
DPPH radical
scavenging activity(<
mo>%)=(1-Aex<
/mi>perimentAcontrol)×100 :MATH]
(1)
ABTS radical cations were generated by reacting 7 mM ABTS solution with
2.45 mM potassium persulfate and incubating in the dark for 16 h. The
ABTS solution was diluted with ethanol to an absorbance of 0.70 ± 0.02
at 734 nm. Then, 10 μL of LBW was mixed with 190 μL of the diluted ABTS
solution, and the absorbance was recorded after 6 min. The scavenging
activity was calculated using the Equation (2).
[MATH:
ABTS radical
cation scavenging activity(%)=(<
mn>1-Aex<
/mi>perimentAcontrol)×100 :MATH]
(2)
The hydroxyl radical scavenging reaction mixture containing 50 μL of 9
mM FeSO[4], 50 μL of 9 mM salicylic acid-ethanol solution, 50 μL of
LBW, and 50 μL of 8.8 mM H[2]O[2] was incubated at 37 °C for 30 min.
The absorbance was measured at 510 nm. The scavenging activity was
calculated as Equation (3).
[MATH:
Hydroxyl radical clearance(%)=<
/mrow>Awa<
/mi>ter−(Asample−Acontrol)Awater<
/mrow>×100 :MATH]
(3)
2.4. Component Analysis of LBW
Following the selection of the optimal LBW ratio with the highest
radical scavenging activity, the basic chemical. composition of the
extract was further analyzed. Analytical methods polysaccharides in LBW
were quantified via phenol-sulfuric acid colorimetry (λ = 490 nm),
following microwave-assisted extraction and glucose calibration.
Anthocyanins were extracted with acidified ethanol (0.1% HCl) and
analyzed by HPLC-C18 (520 nm). Total phenolics used Folin-Ciocalteu
assay (765 nm), while total flavonoids employed NaNO[2]-Al(NO[3])[3]
colorimetry (495 nm). Carotenoids were separated on a C30 column (450
nm) after hexane-acetone extraction. Betaine underwent methanol
extraction, Alumina B SPE purification, and HILIC-NH2 HPLC
(acetonitrile-water 85:15, 195 nm) [[63]25].
2.5. Animal Experiment
The animal experiment protocol involved in this study was reviewed and
approved by the Laboratory Animal Ethics Committee of Jiangnan
University (Wuxi, China), with the approval number JN. No
20240430c0600930[205]. Experiments were conducted in a barrier
environment with strict control of temperature at 25 ± 2 °C, relative
humidity at 55 ± 5%, and a 12-h light/dark cycle. According to
Mitchell, mice aged 18 months were defined as aged mice [[64]26]. In
this experiment, young mice (8 weeks old) and naturally aged mice (≥18
months old) were selected, and divided into four groups: Young Control
Group (C-Young), Aged Control Group (C-Aged), Young LBW Group
(G-Young), and Aged LBW Group (G-Aged). The absence of a positive
control was deliberate: our focus is LBW’s intrinsic effects as a
natural dietary intervention, not efficacy comparisons with known
agents. The four-group design suffices—C-Young vs. C-Aged reveals
age-related muscle changes; intragroup comparisons quantify LBW’s
effects on each age group. This aligns with 3R principles (reducing
animal use) and avoids confounding from mechanistic differences between
LBW (food-derived) and positive controls like pharmaceuticals, ensuring
scientific rigor and ethical compliance.
Specifically, mice were first stratified by age (young/aged); within
each stratum, individuals were allocated to the corresponding control
(Group C) or LBW (Group G) subgroup using a random number generator to
balance baseline characteristics such as body weight. Outcome
assessment was performed by researchers blinded to group assignments to
minimize bias. The sample size in this study (n = 8 per group) was
determined with reference to previous studies on mice models of
skeletal muscle aging. A too small sample size may lead to the
specificity of the sample, while an excessively large sample size is
not in line with animal ethics. Through comprehensive analysis, it was
confirmed that a sample size of 8 mice per group is sufficient to
detect significant differences [[65]27,[66]28]. Mice were housed in
cages at a density of 4 mice per cage ([67]Table 1). All mice had free
access to food and water throughout the trial. In the G-Young and
G-Aged groups, drinking water was replaced with LBW, which was renewed
every 2 days to ensure quality, and the total intervention period
lasted 12 weeks. A 12-week intervention was selected based on two key
considerations: it aligns with the regenerative cycles of skeletal
muscle stem cells (about 2 weeks per cycle), ensuring sufficient
duration to observe cumulative effects on muscle homeostasis [[68]29];
and it approximates long-term human consumption patterns when scaled
via the mouse-to-human lifespan ratio, where 12 weeks in mice
corresponds to about 10 years of regular intake in humans, a timeframe
consistent with dietary intervention studies on age-related muscle
decline [[69]30].
Table 1.
Animal experimental design to explore the healthy effect of long-term
drinking LBW.
Group Age Intervention Methods Numbers of Animals
C-Young 8 Weeks Drinking Water 8
C-Aged ≥18 Months Drinking Water 8
G-Young 8 Weeks LBW 8
G-Aged ≥18 Months LBW 8
[70]Open in a new tab
During the experiment, body weight of mice was recorded weekly, and
food/water intake per cage was measured and normalized to per-mouse
consumption. At the end of the experiment, mice were first anesthetized
via inhalation of 1–1.5% isoflurane followed by blood collection from
the orbital venous plexus, and after blood sampling, mice were
euthanized by cervical dislocation. Collected blood was centrifuged at
3500 r/min for 15 min to isolate serum, which was stored at −80 °C for
subsequent analysis. After taking gastrocnemius muscle (GAS), Tensor
Fasciae Latae (TA) and Soleus (SOL), all other samples were washed and
then transferred into 1.5 mL centrifuge tubes, rapidly frozen in liquid
nitrogen, and stored at −80 °C for subsequent use.
2.6. Section of Skeletal Muscles and Hematoxylin and Eosin-Straining
GAS was embedded in FSC 22 clear frozen section embedding medium,
rapidly frozen in liquid nitrogen-cooled isopentane, and stored at −80
°C for subsequent experiments [[71]31]. Each muscle was sectioned into
8-μm-thick continuous horizontal slices using a cryostat maintained at
−20 °C, with a portion of the mid-belly circumference selected for
processing. The sections were stained with hematoxylin and eosin bought
from Sigma-Aldrich, Inc. (St. Louis, MO, USA), then observed and imaged
under a microscope. The average muscle fiber size was quantified by
measuring the cross-sectional area of at least 100 randomly selected
muscle fibers from no fewer than three sections per muscle. Fiber
boundaries were manually outlined with a calibrated pen, and the area
was automatically calculated using ImageJ software.
2.7. Mice Grip Strength Test
The forelimb grip strength test is recognized as the preferred
non-invasive method for evaluating sarcopenia, as it measures the
maximum contractile force during the animal’s spontaneous activity
[[72]32]. Referencing the grip strength test protocol by Lauretani,
mice were positioned on a small-animal grip strength meter, allowing
their forelimbs to firmly grasp the sensor [[73]33]. The tail was then
pulled horizontally backward at a constant speed to measure the pulling
force. Each mouse underwent three trials, and the maximum value was
recorded.
2.8. Mice Rotarod Fatigue Test
The rotarod test serves as a critical method to assess balance and
coordination in sarcopenic mice. In this experiment, mice were placed
on a rotating rod, and the duration of walking or maintaining balance
on the rod, as well as the number of falls, were recorded to evaluate
motor capacity and coordination [[74]34]. Prior to formal testing, mice
underwent a 3-day acclimation period during which they were placed on
the rotarod with the speed increasing uniformly from 5 rpm to 10 rpm
over 5 min each day. During the formal measurement, mice were placed on
the rotarod set at 30 rpm, and the time until they fell off was
recorded for each of three trials per mouse.
2.9. Mice Treadmill Exercise Test
Mice were first acclimated to the treadmill for 3 days at a constant
speed of 5 m/min for 15 min daily; during the formal test, the
treadmill was set to an initial speed of 5 m/min with a 1 m/min
acceleration until the mice reached exhaustion, at which point the
total running distance and time were recorded to assess exercise
capacity.
2.10. Measurement of Expression Levels of Aging-Related Factors
The contents of SA-β-gal and AGEs were determined using commercial kits
from Huijia Biotechnology, China, following the manufacturer’s
instructions. Briefly, for SA-β-gal detection, mouse skeletal muscle
tissue sections or cultured cells were fixed with 4% paraformaldehyde
at room temperature for 15 min, rinsed with PBS, and then incubated
with a staining solution containing X-gal substrate (pH 6.0) at 37 °C
in the dark for 12–16 h. The proportion of blue-positive cells
(characteristic staining of senescent cells) was observed under an
optical microscope, or enzyme activity was quantified using a
fluorescence probe method. For AGEs measurement, serum or tissue
homogenates (prepared by homogenizing tissues in 1:9 ice-cold saline,
centrifuging at 12,000× g for 20 min at 4 °C) were diluted
appropriately and analyzed using a double-antibody sandwich ELISA.
Samples and standards were added to 96-well plates coated with specific
antibodies, followed by incubation with enzyme-labeled secondary
antibodies, washing steps, and color development with TMB substrate.
Absorbance was measured at 450 nm, and AGEs concentrations were
calculated from standard curves. Tissue results were normalized to
total protein content, while serum results were expressed as ng/mL. All
procedures strictly adhered to the kit protocols to ensure accurate
assessment of senescence markers.
2.11. Measurement of Oxidative Stress and Inflammatory Levels
Oxidative stress markers (SOD, MDA, GSH) and inflammatory cytokines
(IL-10, TNF-α) in serum and skeletal muscle were measured using
commercial ELISA kits bought from Huijia Biotechnology Co., Ltd.
(Shanghai, China) following the protocol described by Wang [[75]35].
Briefly, serum samples were prepared by centrifuging blood at 3500× g
for 15 min at 4 °C, while muscle tissues were homogenized in ice-cold
saline (1:9 w/v), centrifuged at 12,000× g for 20 min, and supernatants
collected. Samples were diluted (1:5–1:10) to ensure readings within
the standard curve range. Assays were performed according to the kit
instructions, including incubation with specific antibodies, washing
steps, and colorimetric detection at 450 nm. Results were normalized to
total protein content (BCA assay) for tissues and expressed as ng/mL
for serum. All samples were analyzed in duplicate, and the intra-assay
coefficient of variation was <10% for quality control.
2.12. Quantitative Real-Time PCR Analysis (qRT-PCR)
Specific experimental procedures were referenced from Pan [[76]36].
Briefly, RNA was extracted from skeletal muscle tissues using TRIzol
reagent (Invitrogen, Carlsbad, CA, USA), followed by cDNA synthesis
with the Prime Script RT system (Takara Bio Inc., Kyoto, Japan). After
cDNA synthesis, the expression levels of the mRNA were also measured
via the ABI 7900 system, using 18S rRNA as the internal reference. The
qRT-PCR primer sequences are listed in [77]Table 2.
Table 2.
Primer sequences.
Gene Forward Primer (5′-3′) Reverse Primer (5′-3′)
18S ACCGCAGCTAGGAATAATGGA CAAATGCTTTCGCTCTGGTC
mAtrogin-1 CGCCACTCCGGGACATAG GAAGTCGTCTGCTGTCTCAAAGG
mMuRF-1 GAGACATCCCCCTATTTCTACCA GCTCAGTCCGCTCATAGCC
[78]Open in a new tab
2.13. Western Blot
Muscle proteins (30 μg) were separated by 10% SDS-PAGE, followed by
transfer onto PVDF membranes. The membranes were probed with
anti-Atrogin-1 (1:1000), anti-MuRF-1 (1:1000), and anti-β-actin
(1:5000) antibodies, respectively. Protein bands were visualized using
an ECL detection system and quantified with ImageJ 1.54 (National
Institutes of Health, Bethesda, MD, USA).
2.14. Unsupervised Metabolomics Analysis
Metabolomics analysis is mainly done by institutions, and the specific
steps are as follows. For sample preparation, quality control (QC)
samples were prepared by pooling equal volumes of all experimental
serum samples and processed using the same protocols as the test
samples and 120 μL aliquots of frozen serum were mixed with 480 μL of
an extraction solution composed of methanol and acetonitrile (2:1 v/v)
[[79]37]. The extraction solution included two standards:
2-chloro-L-phenylalanine and decanoic acid. Samples were vortexed for
120 s and then incubated at 4 °C for 30 min. After centrifugation at
14,000 r/min for 10 min, the supernatant was divided into two 250 μL
aliquots: one for immediate analysis and the other stored for
subsequent use. The aliquot designated for analysis was evaporated to
dryness using a Labconco Centrivap Console, reconstituted in 125 μL of
50% methanol, and recentrifuged at 14,000 r/min for 10 min. The
resulting supernatant was transferred to a 200 μL MicroSert Insert for
analytical processing. Batch correction was performed using a QC
sample-driven median centering algorithm, validated by PCA to eliminate
technical variation while preserving biological differences. The final
data was exported and analyzed and plotted with Majorbio Cloud Platform
(Shanghai Majorbio Bio-pharm Technology Co., Ltd., Shanghai, China).
2.15. Statistical Analysis
Statistical and significance analyses were performed using GraphPad
Prism 8.0 software (GraphPad Software, LLC, San Diego, CA, USA). All
experiments were repeated at least three times, and results are
presented as the mean ± standard error of the mean (SEM). Differences
between two groups were determined using Student’s t-test, while
differences among means of three or more groups were analyzed by
one-way analysis of variance (ANOVA). Statistical significance was set
at p < 0.05, and significant differences were indicated by different
letters (p < 0.05).
3. Result
3.1. Optimization of LBW Preparation
Systematic investigation of the effects of different solid-to-liquid
ratios and extraction temperatures on the antioxidant activity of LBW
revealed that an extraction condition of 1:10 (w/v) solid-to-liquid
ratio at 80 °C yielded the highest scavenging capacities against DPPH,
ABTS, and hydroxyl radicals ([80]Table 3 and [81]Table 4). Statistical
analysis confirmed that this extraction condition not only exhibited
significantly higher radical scavenging rates compared to other
experimental groups but also demonstrated minimal data dispersion,
indicating excellent stability (p < 0.05). These results suggest that
the antioxidant activity of LBW is maximally enhanced under these
parameters, enabling efficient scavenging of biological radicals and
showcasing superior antioxidant performance.
Table 3.
Antioxidant activity of LBW under different brewing material ratios (n
= 4).
Free Radical 1:2 1:5 1:10 1:20
DPPH clearance activity (%) 42.67 ± 5.59 de 57.57 ± 3.43 c 74.94 ± 3.29
a 78.25 ± 6.82 a
ABTS free radical scavenging activity (%) 37.78 ± 2.40 e 42.73 ± 3.29 e
46.27 ± 4.99 d 48.27 ± 5.01 d
Hydroxyl radical scavenging clearance (%) 35.40 ± 4.01 e 54.82 ± 6.77
cd 63.22 ± 4.21 bc 71.75 ± 6.82 ab
[82]Open in a new tab
Significant differences were indicated by different letters (p < 0.05).
Table 4.
Antioxidant activity of LBW at different brewing temperatures (n = 4).
Free Radical 40 °C 60 °C 80 °C 100 °C
DPPH clearance activity (%) 63.60 ± 4.26 b 66.90 ± 6.11 ab 72.79 ± 3.16
a 50.76 ± 6.35 c
ABTS free radical scavenging activity (%) 47.30 ± 1.32 d 50.30 ± 6.19
cd 63.38 ± 2.15 b 46.58 ± 1.91 d
Hydroxyl radical clearance (%) 39.70 ± 3.11 e 61.85 ± 4.57 b 67.40 ±
4.39 a 59.70 ± 3.27b c
[83]Open in a new tab
Significant differences were indicated by different letters (p < 0.05).
After the extraction process of LBW was determined, the specific
components of LBW under the process were further measured ([84]Table
5). It revealed high contents of key bioactive components. The most
active ingredient polysaccharide also matches that mentioned by Masci
[[85]38]. These components not only serve as the material basis for
LBW’s antioxidant properties but also provide a robust guarantee for
the biological activity of LBW used in subsequent animal experiments.
Table 5.
Fundamental Component Analysis (n = 4).
Component Name LBW
Polysaccharide content (mg GLU/g) 71.81 ± 2.76
Anthocyanin content (mg/100 g) 21.13 ± 3.52
Total phenol content (mg GAE/g) 18.80 ± 1.14
Total flavonoid content (mg CAE/g) 2.37 ± 0.39
Carotenoid content (mg/100 g) 9.08 ± 1.22
Betaine content (mg/100 g) 41.31 ± 6.82
[86]Open in a new tab
3.2. Effects of Long-Term LBW Consumption on Mice Motor Function and Body
Weight
From [87]Figure 1A, results showed that aged mice generally had higher
body weights than young mice; however, there were no significant
difference between the C-Aged and G-Aged groups (p = 0.6087), nor
between the C-Young and G-Young groups (p = 0.9998). Thus, it is
concluded that LBW had no direct promoting or inhibitory effect on
mouse body weight regulation.
Figure 1.
[88]Figure 1
[89]Open in a new tab
Effect of long-term LBW consumption on weight and exercise ability in
mice: (A) Final weight (n = 8); (B) Grip strength, (C) Rotary rod drop
time, (D) Running time, (E) Running distance (n = 6 for B–E).
Significant differences were indicated by different letters (p < 0.05).
Motor function was assessed via grip strength, fall latency, and
treadmill performance tests. As shown in [90]Figure 1, LBW consumption
had no significant effect on motor indices in young mice (for grip
strength, p = 0.9269; for fall latency, p = 0.9291; for running time, p
= 0.0889; for running distance, p = 0.1620). In contrast, the G-Aged
exhibited significantly higher mean grip strength, longer rotarod fall
latency, and greater treadmill running time and distance compared to
the C-Aged (p < 0.05). These findings indicate that long-term LBW
intake significantly improves muscle function in aged mice, enhancing
both muscle strength and exercise endurance.
3.3. Effects of Long-Term LBW Consumption on Skeletal Muscle Mass in Mice
Skeletal organ indexes were measured as shown in [91]Figure 2. The
C-Aged group showed significantly reduced indices for gastrocnemius
(GAS), tibialis anterior (TA), and soleus (SOL) muscles compared to
C-Young (for GAS, p < 0.0001; for TA, p = 0.0483; for SOL, p = 0.0037).
Conversely, the G-Aged group displayed a significant increase in TA and
SOL organ indexes approaching those of young healthy mice when compared
to C-Aged. These results indicate that long-term LBW consumption
significantly enhances skeletal organ indexes in aged mice,
contributing to the maintenance of physical health, whereas its effects
on muscle function in young mice are negligible.
Figure 2.
[92]Figure 2
[93]Open in a new tab
Effects of long-term LBW consumption on organ indexes of (A) GAS; (B)
TA; (C) SOL (n = 8). Significant differences were indicated by
different letters (p < 0.05).
Skeletal muscle cross-sectional morphology was observed via H&E
staining, with quantitative analysis of GAS muscle fiber CSA
([94]Figure 3). In young mice, muscle fibers were tightly arranged and
morphologically intact. In contrast, the C-Aged group exhibited
significantly reduced GAS fiber CSA (p = 0.0001), with heterogeneous
fiber size and shape and increased intercellular space, potentially
attributed to muscle fiber atrophy during skeletal muscle aging. Under
LBW intervention, the G-Aged group showed increased muscle fiber CSA (p
= 0.2427). These results indicate that LBW intervention effectively
enhances skeletal muscle mass in aged mice, significantly improves
myofiber structural integrity, and demonstrates substantial potential
for preventing skeletal muscle atrophy.
Figure 3.
[95]Figure 3
[96]Open in a new tab
Effects of long-term LBW consumption on GAS muscle fiber cross-sections
in mice (n = 4): (A) Representative GAS muscle fiber cross-sections;
(B) GAS muscle cross-sectional area. Significant differences were
indicated by different letters (p < 0.05).
3.4. Mechanisms Underlying Effects on Aging-Related Factors
Expression levels of AGEs and SA-β-gal in mice of each group were
detected, and the results were shown in [97]Figure 4. Compared with
C-Young, the C-Aged group exhibited significantly higher AGEs levels in
serum and gastrocnemius muscle (p < 0.005), while the G-Young group
showed no significant change (p = 0.9278, p = 0.7881, respectively). In
contrast, the G-Aged group had significantly lower serum AGEs levels
than the C-Aged group (p = 0.0004), with no significant differences in
AGEs levels between the G-Aged group and C-Young group in both serum
and gastrocnemius muscle (for serum, p = 0.2640; for GAS, p = 0.0437).
Additionally, natural aging led to a significant increase in SA-β-gal
levels in serum and gastrocnemius muscle (p < 0.05), whereas long-term
LBW consumption effectively reduced SA-β-gal levels in these samples.
These findings indicate that long-term LBW intake significantly
decreases the expression of senescence markers in skeletal muscle of
aged mice. Concomitant with the decline in senescence marker
expression, aged mice exhibited positive improvements in functional
indices such as muscle strength and endurance, findings that support a
potential mechanism through which LBW attenuates skeletal muscle aging.
Figure 4.
[98]Figure 4
[99]Open in a new tab
Effects of long-term LBW consumption on age-related marker expression
in mice (n = 6): (A) Serum AGEs levels; (B) Serum β-galactosidase
levels; (C) GAS AGEs levels; (D) GAS β-galactosidase levels.
Significant differences were indicated by different letters (p < 0.05).
As shown in [100]Figure 5, real-time quantitative PCR (qRT-PCR) results
demonstrated that in C-Aged mice, the mRNA expression levels of FOXO
signaling pathway downstream key atrophic factors Atrogin-1 and MuRF-1
were significantly higher than those in the control group (for
Atrogin-1, p = 0.0007; for MuRF-1, p < 0.0001). As core molecules
mediating muscle protein degradation, the abnormally high expression of
Atrogin-1 and MuRF-1 indicated that natural aging induced excessive
activation of the FOXO signaling pathway, thereby leading to skeletal
muscle protein metabolic disorders. In contrast, G-Aged mice exhibited
significantly lower MuRF-1 expression in skeletal muscle compared to
C-Aged mice (p = 0.0052), and Atrogin-1 expression levels more closely
resembled those in the young group (p = 0.7798). As can be seen from
the Western Blot images, the expression levels of MuRf-1 and Atrogin-1
in G-Aged and G-Young were similar, which further proved the
anti-skeletal muscle aging effect of LBW. These results confirm that
LBW intervention effectively inhibits excessive activation of the FOXO
signaling pathway, blocks abnormal expression of atrophic factors,
regulates age-related muscle protein metabolic imbalance at the
molecular pathway level, and thereby alleviates skeletal muscle
atrophy.
Figure 5.
[101]Figure 5
[102]Open in a new tab
Effects of LBW consumption on FOXO signaling pathway expression in mice
(n = 4): (A) mMuRF-1 relative expression; (B) mAtrogin-1 relative
expression; (C) Western blot analysis of MuRF-1 and Atrogin-1 protein
expression. Significant differences were indicated by different letters
(p < 0.05).
3.5. Mechanisms Underlying Effects on Oxidative Stress and Inflammation
Levels
Oxidative stress levels in each group were analyzed by measuring the
contents of superoxide dismutase (SOD), malondialdehyde (MDA), and
glutathione (GSH) in serum and GAS muscle. As shown in [103]Figure 6,
compared with the C-Young group, the C-Aged group displayed
significantly lower levels of SOD and GSH (serum: SOD, p = 0.003; GSH,
p = 0.0013; GAS: SOD, p = 0.0043) and a significantly higher MDA level
in the gastrocnemius muscle (p < 0.0001). In contrast, the G-Young
group only differed significantly from the C-Young group in terms of
serum GSH levels (p = 0.0161). These results indicate that long-term
LBW consumption has no obvious impact on oxidative stress in young
mice. In contrast, the G-Aged group had significantly lower MDA levels
in serum and GAS muscle than the C-Aged group (p < 0.05), with no
significant differences in SOD and GSH levels compared to the C-Young
group (for serum, p values for SOD were 0.1605; for GAS, p values for
SOD and GSH were 0.2126 and 0.4610, respectively). These results
suggest that long-term LBW intake exerts positive effects on skeletal
muscle function by regulating the body’s antioxidant defense system,
reducing oxidative damage, and serving as a key mechanism for improving
muscle performance.
Figure 6.
[104]Figure 6
[105]Open in a new tab
Effects of long-term LBW consumption on oxidative stress in mice (n =
6): (A) Serum MDA levels; (B) Serum SOD levels; (C) Serum GSH levels;
(D) GAS MDA levels; (E) GAS SOD levels; (F) GAS GSH levels. Significant
differences were indicated by different letters (p < 0.05).
Inflammation, one of the most critical biological hallmarks
characterizing the aging process, was analyzed in serum and skeletal
muscle of each group, as shown in [106]Figure 7. LBW intervention
significantly lowered serum levels of the pro-inflammatory cytokine
TNF-α in aged mice (p < 0.0001), indicating that long-term LBW
consumption effectively suppresses aging-associated chronic
inflammation and mitigates persistent inflammatory damage to cellular
and tissue structures at its source. Additionally, LBW intervention
moderately reduced levels of the anti-inflammatory cytokine IL-10,
preventing its excessive elevation—a state that could compromise
essential immune responses (p < 0.0001) [[107]39]. By tempering the
concentrations of inflammatory cytokines, LBW further enhances the
microenvironment of multiple systems in aged mice, thereby retarding
systemic aging.
Figure 7.
[108]Figure 7
[109]Open in a new tab
Effects of long-term LBW consumption on inflammation levels in mice (n
= 6): (A) Serum IL-10 levels; (B) Serum TNF-α levels; (C) GAS IL-10
levels; (D) GAS TNF-α levels. Significant differences were indicated by
different letters (p < 0.05).
3.6. Metabolomics Analysis
Metabolomics results showed high overall correlation between samples,
with all correlation coefficients exceeding 0.9 ([110]Figure 8A).
Notably, parallel samples within the same group exhibited extremely
high correlation, demonstrating minimal overall sample variability and
robust experimental control, which validated the reliability of the
results. In contrast, the correlation coefficients between the C-Aged
and G-Aged groups were below 0.93, indicating that long-term LBW
consumption induced noticeable changes in metabolite profiles, leading
to distinct compositional differences in metabolites between the two
groups.
Figure 8.
[111]Figure 8
[112]Open in a new tab
Effect of long-term LBW consumption on: (A) Correlation Heatmap; (B)
Principal Component Analysis (PCA); (C) OPLS-DA score (C-Aged vs.
C-Young); (D) Pathway Enrichment Analysis (C-Aged vs. C-YOUNG); (E)
PLS-DA SCORE (G-AGED vs. C-Aged); (F) Pathway Enrichment Analysis
(G-Aged vs. C-Aged) (n = 4).
In the PCA score plot, samples were visualized as coordinate points
after dimensionality reduction, where the Euclidean distance between
points reflected metabolic differences ([113]Figure 8B). The sample
points of the C-Aged were highly clustered with minimal dispersion,
indicating a high consistency in metabolic changes induced by aging.
This made the C-Aged group suitable as a control to establish metabolic
baselines and evaluate the effects of long-term LBW intervention. In
contrast, the G-Young and C-Young groups showed nearly overlapping
distributions, suggesting that long-term LBW consumption had no
significant impact on metabolism in young mice.
The volcano plot of C-Aged and C-Young revealed profound metabolic
perturbations associated with natural aging ([114]Figure 8C).
Specifically, a substantial number of metabolites were dysregulated: 46
metabolites were upregulated and 62 were downregulated (replace with
actual counts from plot), which reflected the inherent metabolic
decline during aging. In the further KEGG enrichment analysis of C-Aged
vs. C-Young, HIF-1 signal pathway showed a significant difference (high
Rich Factor, low p-value). HIF-1 signal pathway promotes the production
of oxidative stress and the production of inflammatory factors through
a variety of mechanisms, which further illustrates the production of
oxidative stress response and inflammation by aging from a metabolic
perspective [[115]40,[116]41].
In contrast, [117]Figure 8E demonstrated that long-term LBW consumption
remodels the aged metabolic landscape. A total of 68 metabolites were
upregulated and 45 downregulated in G-Aged mice, with distinct trends
counteracting age-related dysregulation. By comparing [118]Figure 8C,E,
it was obvious that LBW intervention partially reverses natural
aging-induced metabolic chaos—targeting key pathways like oxidative
stress, energy metabolism, and inflammatory metabolite production—to
mitigate age-related decline in skeletal muscle and systemic health.
Notably, KEGG enrichment analysis of the G-Aged versus C-Aged groups
revealed a significant difference in the NF-κB signaling pathway
([119]Figure 8F). The C-Aged group exhibited more pronounced activation
of this pathway, as evidenced by a higher degree of enrichment. This
indicated that the G-Aged group exerted an inhibitory effect on this
classic pro-inflammatory pathway, which could alleviate chronic muscle
inflammation in aged mice, with a statistically significant difference
(p < 0.05) [[120]42]. This is most likely due to the fact that the
optimized LBW is rich in lycium polysaccharides, which inhibit the
activation of the NF-κB pathway and reduce the transcription of
pro-inflammatory factors [[121]43]. Similarly, for the chemokine
signaling pathway, the C-Aged group showed more prominent enrichment,
the difference was statistically significant (p < 0.05). This pathway
difference suggested that LBW could reduce the recruitment and
infiltration of inflammatory cells into muscle tissues, improving the
inflammatory microenvironment [[122]44].
4. Discussion
In this study, we first optimized the processing parameters of LBW to
ensure its antioxidant activity, then used 8-week-old young mice and
18-month-old aged mice as models to investigate the health effects of
long-term LBW consumption. Muscle atrophy is a key determinant of
systemic aging during the aging process, and maintaining skeletal
muscle mass stability is critical for motor function and overall health
[[123]45,[124]46,[125]47]. Our experimental data showed that although
long-term LBW intake had no significant effect on body weight in aged
mice compared with the control group, it significantly increased muscle
mass ratio, enhanced structural integrity, and improved motor capacity
(as reflected by increased grip strength, rotarod fall latency, and
treadmill running distance/time). These results confirm that LBW has
the potential to maintain muscle mass and delay the decline of muscle
function, thereby indirectly reducing the incidence of sarcopenia.
Notably, skeletal muscle function and mass are primarily determined by
myofibers—the core units responsible for muscle contraction, whose
status directly correlates with muscle function [[126]48]. The
significant increase in gastrocnemius myofiber cross-sectional area
observed in this study suggests that myofibers are the cell type most
responsive to LBW intervention. Given the improvements in myofiber
morphology and downstream function induced by LBW, we hypothesize that
myofibers are key target cells through which LBW counteracts
age-related muscle decline.
Elevated levels of AGEs and SA-β-gal serve as important biomarkers of
cellular senescence, while the expression of Atrogin-1 and MuRF-1
regulates muscle function via the FOXO signaling pathway. During aging,
FOXO (particularly FOXO3) regulates Atrogin-1 and MuRF-1 to maintain
muscle protein homeostasis under physiological conditions, but its
excessive activation disrupts this balance and modulates energy
metabolism and anti-apoptotic pathways in a pathological way,
accelerating muscle aging [[127]49]. Oxidative stress and chronic
inflammation are two prominent hallmarks of aging
[[128]50,[129]51,[130]52,[131]53]. This study found that long-term LBW
consumption reduced AGEs and SA-β-gal levels in aged mice, and more
importantly, downregulated Atrogin-1 and MuRF-1 expression by targeting
the overactivated FOXO pathway in aged skeletal muscle—thereby
regulating the FOXO pathway, mitigated skeletal muscle cell senescence
by correcting age-related imbalances in muscle protein metabolism at
the molecular level. Our results demonstrate that LBW specifically
inhibits the pathological overactivation of FOXO in aged muscle, rather
than altering its basal activity in young tissue.
Additionally, LBW effectively decreased oxidative stress and regulated
the levels of inflammation, alleviating cellular and tissue damage and
maintaining systemic homeostasis. Regulation of aging-related factors,
oxidative stress, and inflammation represents the core mechanisms by
which LBW improves skeletal muscle function. Metabolomics analysis
revealed that LBW intervention significantly affected fatty acid
biosynthesis and amino acid metabolism pathways in aged mice,
suggesting a potential role in delaying skeletal muscle aging via
energy metabolism regulation.
Metabolomic analysis further revealed high overall correlation among
samples (all over 0.9), confirming robust experimental reliability.
Long-term LBW consumption significantly remodeled the metabolic profile
of aged mice, with 68 metabolites upregulated and 45 downregulated
versus naturally aged controls. This intervention suppressed activation
of pro-inflammatory pathways like NF-κB and chemokine signaling
pathway, suggesting LBW alleviates aging-related metabolic
abnormalities via multi-pathway regulation.
In summary, long-term intake of LBW exerts anti-skeletal muscle aging
effects by regulating specific signaling pathways and related
molecules: it downregulates the expression of downstream muscle atrophy
factors (Atrogin-1 and MuRF-1) via modulation of the FOXO signaling
pathway; regulates inflammation through the NF-κB pathway and chemokine
signaling pathways, thereby reducing the production of pro-inflammatory
cytokines; and simultaneously decreases aging-related biomarkers (AGEs,
SA-β-gal), improves skeletal muscle morphology, regulates muscle
weight, and enhances motor capacity. These mechanisms collectively
mediate the anti-skeletal muscle aging effects of LBW. The preclinical
findings presented in this study lay a foundation for its subsequent
translation into practical applications in the field of food nutrition.
Compared with similar studies, this experiment uses a natural drinking
water intervention method instead of traditional extract injection or
gavage, which is more in line with the daily dietary intake pattern.
Meanwhile, it breaks through the research limitation of single
components (such as polysaccharides or polyphenols), and through the
synergistic effect of multiple components in natural LBW, it is closer
to the nutritional intervention effect in actual dietary scenarios.
Notably, existing studies have mainly focused on single bioactive
components and elaborated their mechanisms systematically—for instance,
the activation of the Nrf2 antioxidant pathway by LBP has been
validated in multiple experimental models, providing a clear
mechanistic basis for its biological effects [[132]54]. However,
although the present study has demonstrated that LBW exerts
comprehensive anti-skeletal muscle aging effects, several questions
remain unanswered. Specifically, this study has not yet clarified the
synergistic interaction patterns of bioactive components in LBW nor
their specific regulatory sites within pathways. This provides insights
for future research.
Overall, the findings of this study are expected to provide a
preclinical theoretical basis for scientific and effective nutritional
intervention strategies. From the perspective of translational
medicine, based on its “food-medicine homology” property, we confirmed
the safety of LBW through a 12-week mouse study. However, given species
differences, in terms of clinical translation, deriving
human-equivalent doses via body surface area conversion and conducting
small-scale randomized controlled trials (RCTs) in elderly individuals
at risk of sarcopenia can serve as initial feasible steps for bridging
preclinical and clinical evidence.From future industrial perspective,
while basic products like Lycium barbarum puree have been developed,
commercializing LBW as a natural and efficient anti-aging beverage
could fill a market gap, bridging laboratory research and daily
nutrition to realize the societal value of food science innovations.
5. Conclusions
In conclusion, long-term consumption of LBW alleviates age-related
skeletal muscle dysfunction in aged mice by modulating oxidative
stress, inflammation, and muscle atrophy, likely via regulating
aging-related factors (AGEs, SA-β-gal), FOXO-mediated atrophy factors
(Atrogin-1, MuRF-1), and pro-inflammatory pathways (NF-κB, chemokine
signaling). This natural drinking intervention, leveraging
multi-component synergism, provides a practical nutritional strategy
for combating skeletal muscle aging and informs the development of
Lycium barbarum-based functional products.
Author Contributions
Conceptualization, Y.L., L.W. and Y.T.; methodology, Y.T., Q.Z. and
J.W.; Resources, Q.Z., software, Y.T. and J.W.; validation, Y.L., Y.T.
and J.W.; formal analysis, Q.Z. and J.W.; data curation, Q.Z. and Y.T.;
writing—original draft preparation, Y.T. and J.W.; writing—review and
editing, Y.T. and Q.Z.; funding acquisition, Y.L., H.Q. and M.F. All
authors have read and agreed to the published version of the
manuscript.
Institutional Review Board Statement
The animal study protocol was approved by the Laboratory Animal Ethics
Committee of Jiangnan University (Wuxi, China) (protocol code JN. No
20240430c0600930[205] and date of approval: 30 April 2024).
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the
article. Further inquiries can be directed to the corresponding
authors.
Conflicts of Interest
The authors had no known financial interests or personal relationships
that could have influenced the work reported in this manuscript.
Funding Statement
This work was supported by the Ministry of Science and Technology of
China (2022YFF1100502), the Earmarked Fund for China Agriculture
Research System (CARS-08-G19), the Young Elite Scientists Sponsorship
Program by CAST (2020QNRC001), Fundamental Research Funds for the
Central University (JUSRP221001), and the Collaborative Innovation
Center of Food Safety and Quality Control in Jiangsu Province, Jiangnan
University (2022-3-1), Supported by the Research Program of State Key
Laboratory of Food Science and Resources, Jiangnan University (No.
SKLF-ZZB-202514), and the 2024 Special Research Project of Jiangsu
Higher Education Association—AI-Enabled Construction of Textbook System
for the Strategic Emerging and Characteristic Major in Food Nutrition
and Health (Project No.: 2024JCSZ33).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data
contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI
and/or the editor(s) disclaim responsibility for any injury to people
or property resulting from any ideas, methods, instructions or products
referred to in the content.
References