Abstract
Intervertebral disc degeneration (IDD) is characterized by an
inflammatory environment and dysregulation of the extracellular matrix
metabolism (ECM). Improving nucleus pulposus cells (NPCs) condition
first requires a supportive surrounding environment. However, how to
provide an excellent microenvironment before regulating the function of
the NPCs is not yet a complete strategy. In this study, a sequential
drug delivery system is comprised of chitosan hydrogel (G‐CS) loaded
with Angiotensin (1‐7) and mesoporous silica nanospheres (MSN) coating
with α‐mangostin to achieve synergistic effects of anti‐inflammatory
and regulation of metabolic disorders of the ECM in NPCs. The system
first explosively releases outer G‐CSloaded Angiotensin (1‐7) by
exploiting the different solubility characteristics of the two drugs,
which improves the inflammatory environment by inhibiting the
integrated stress response and regulating the macrophage phenotype.
During the second stage, the inner layer of the MSN controlled‐release
loaded α‐mangostin to regulate ECM metabolism and synthesis, slowing
cell aging and apoptosis. Furthermore, α‐mangostin promotes mitophagy
in NPCs by inhibiting the PI3K/AKT/mTOR pathway and activating the
Pink1/Parkin pathway, promoting the clearance of damaged mitochondria.
The proposed drug delivery system represents an innovative and
promising strategy for treating IDD.
Keywords: extracellular matrix, hydrogel, intervertebral disc
degeneration, macrophage polarization, nanospheres
__________________________________________________________________
The G‐CS/MSN drug delivery system enhances intervertebral disc repair
through sequential drug release.
graphic file with name ADVS-12-e07178-g001.jpg
1. Introduction
According to the Global Burden of Disease Study, lower back pain (LBP)
has remained the leading cause of disability for several years.^[
[48]^1 ^] The widespread occurrence of LBP is associated with
diminished quality of life and increased medical expenditures, which
significantly strain healthcare resources.^[ [49]^2 ^] Intervertebral
disc degeneration (IDD) is the primary cause of LBP.^[ [50]^3 ^]
The healthy intervertebral disc (IVD) is a relatively sealed avascular
fibrocartilaginous structure The nucleus pulposus (NP) undergoes
dehydration and degeneration, while the annulus fibrosus becomes
increasingly susceptible to rupture under repetitive mechanical stress
with aging. This process has facilitated the invasion of blood vessels
and the infiltration of inflammatory cells, such as macrophages,
accompanied by the release of inflammatory mediators.^[ [51]^4 ^] The
inflammatory microenvironment has a unique complexity in IVD, which is
accompanied by compromised ECM synthesis, cellular senescence, and
dysfunction. However, the treatment of IDD has mostly been carried out
simultaneously with anti‐inflammatory and cell function restoration in
the past. A combination of therapeutic strategies is required to
restore IVD, and the sequential effects of treatments must be carefully
considered. Since anabolic balance relies on the presence of healthy
NPCs, cell viability is significantly influenced by the
microenvironment,^[ [52]^5 ^] An increasing number of drug studies have
paid attention to the impact of sequential delivery on treatment
outcomes recently.^[ [53]^6 ^] Exploring IVD regeneration also has
gradually begun to focus on step‐by‐step treatment strategies that (i)
counteract inflammation in the microenvironment and (ii) enhance NPC
activity, preserve cell function, and improve ECM metabolism in a
healthy microenvironment. In this study, we integrate drugs to achieve
the aforementioned objectives and develop a nanomaterialbased system
for their sequential release.
Macrophages, which originate from adult bone marrow hematopoietic stem
cells, infiltrate the IVD when it ruptures and is exposed to the immune
system, affecting the course of IDD.^[ [54]^7 ^] Therefore, selectively
promoting the polarization of macrophages and improving the
inflammatory microenvironment is crucial for mitigating IDD
progression. Angiotensin (1‐7) (Ang (1‐7)) is an endogenous
heptapeptide of the renin‐angiotensin system. Previous studies have
demonstrated its crucial role in modulating inflammatory responses
under various pathological conditions, including colitis, pulmonary
fibrosis, hepatic steatosis, and ischemic stroke.^[ [55]^8 ^] Moreover,
Ang (1‐7) can promote the M2 polarization of microglia/macrophages.^[
[56]^9 ^] We hypothesize that Ang (1‐7) administration may improve the
IVD microenvironment by modulating macrophage polarization. α‐mangostin
(A_Man) is a xanthone derivative isolated from mangosteen peel extract
that exhibits a range of pharmacological activities, including
antibacterial, antifungal, anti‐inflammatory, antiallergic,
antioxidant, and anticancer properties.^[ [57]^10 ^] A_Man can protect
lipopolysaccharide (LPS)‐stimulated NPCs from NLRP3
inflammasome‐mediated apoptosis by modulating the NF‐κB pathway.^[
[58]^11 ^] We have confirmed in our experiments that A_Man can
alleviate ECM metabolism dysregulation in the NPCs. And combine A_Man
with Ang (1‐7) to inhibit IDD progression.
Hydrogels and mesoporous silica nanoparticles (MSN) are biomaterials
commonly used for in vivo drug delivery. Chitosan‐based hydrogels offer
several advantages, including a 3D network structure, appropriate
degradation rates, and high water content.^[ [59]^12 ^] Additionally,
chitosan possesses unique adhesive and oxygen‐permeable properties and
is nontoxic and biodegradable,^[ [60]^13 ^] boasting significant
potential for development in the medical field. MSN offers a large
specific surface area and pore volume, controllable particle size, and
good biocompatibility.^[ [61]^14 ^] Additionally, silica can facilitate
sustained drug release by adjusting the pore structure and particle
size of the carrier.^[ [62]^15 ^] Finally, silica nanoparticles can
enhance solubility by offering a larger surface area, which improves
permeability across cell membranes,^[ [63]^16 ^] providing controlled
release systems with options for passive or active targeting.
In this study, we design a novel material that is gelatin–chitosan
(G‐CS) hydrogels encapsulating MSN. We incorporate Ang (1‐7) and A_Man
into the materials to develop a G‐CS@Ang (1‐7)/MSN@A_Man (G‐CS/MSN)
delivery system, which exploits the solubility differences between Ang
(1‐7) and A_Man (with Ang (1‐7) being water‐soluble and A_Man being
lipid‐soluble).^[10b] Our results demonstrate that the G‐CS/MSN
effectively facilitates the regeneration and repair of NP (Scheme [64]1
).
Scheme 1.
Scheme 1
[65]Open in a new tab
Design and schematic illustration of the G‐CS/MSN drug delivery system
for IDD repair. A nanosphere hydrogel system capable of sequentially
releasing two drugs was developed to achieve minimally invasive
intradiscal injection therapy. This system can regulate macrophage
polarization to improve the inflammatory environment, alleviate ECM
metabolic disorders, and enhance autophagy in NPCs.
2. Results
2.1. Preparation and Characterization of G‐CS/MSN
A two‐step process was used to prepare the G‐CS/MSNs (Figure [66]1a).
The hydrogel injected into the IVD must form strong adhesive bonds with
both the annulus fibrosus and the vertebral endplates. This robust
adhesion prevents hydrogel displacement or extrusion during spinal
movement while ensuring uniform mechanical load distribution. Our tests
demonstrate that the G‐CS hydrogel maintains excellent adhesion under
mechanical stresses such as twisting and folding, both in ambient air
and PBS (Figure [67]S1a, Supporting Information). These results suggest
that G‐CS can meet the demanding adhesive requirements within the
complex biomechanical environment of the IVD. The hydrogel also has
remarkable swelling resistance in PBS over varying periods (0, 6, 12,
and 24 h, Figure [68]S1b, Supporting Information). Meanwhile, Adhesion
testing on porcine skin revealed that the hydrogel could withstand
tensile stresses up to 6.5 kPa, confirming its robust mechanical
properties for biomedical applications (Figure [69]S1c, Supporting
Information). Next, we characterized the G‐CS and MSN using electron
microscopy to evaluate their microstructure and surface morphology.
Transmission electron microscopy (TEM) was used to observe the
morphology of the MSN (Figure [70]1b). Scanning electron microscopy
(SEM) was used to observe the overall distribution of surface pores on
the MSN (Figure [71]1c) and G‐CS (Figure [72]1d). MSN surface pores
were evenly distributed, indicating good drug‐loading properties. The
drug loading efficiency of MSN@A_Man and G‐CS@Ang(1‐7) is 51.11% and
80.76%. The SEM images of G‐CS degradation at 3 and 7 days demonstrate
a surface erosion‐dominated degradation mechanism, as shown in Figure
[73]S2 (Supporting Information), indicating its potential for in vivo
degradation and controlled drug release profiles. We next examined the
drug release capacity of the G‐CS/MSN system. The release profiles of
the two drugs in the G‐CS/MSN drug delivery system followed a
sequential pattern (Figure [74]1e). The release curves demonstrated a
biphasic release, with Ang (1‐7) showing an early burst and A_Man
exhibiting more sustained release over time, weather in G‐CS/MSN or
MSN@A_Man (Figure [75]S3, Supporting Information). These curves are
critical for ensuring effective treatment of IDD. We further conducted
rheological testing on G‐CS/MSN. As the experiment progressed, both the
storage and loss moduli of G‐CS/MSN gradually increased until the gel
point was reached (Figure [76]1f). The dynamic viscosity test showed
that G‐CS/MSN exhibited significant shear‐thinning characteristics,
demonstrating its potential for effective injection into the IVD
(Figure [77]1g).
Figure 1.
Figure 1
[78]Open in a new tab
Preparation and characterization of G‐CS/MSN. a) Schematic diagram of
the synthesis process of G‐CS/MSN. b) TEM detection of MSN (scale bar:
20nm, and 10 nm). c) SEM detection of MSN (scale bar: 250nm, and
70 nm). d) SEM detection of G‐CS (scale bar: 20 µm, and 4 µm). e)
Release curves of two drugs in the G‐CS/MSN drug delivery system. f)
Modulus test: storage modulus G′/loss modulus G″. g) The dynamic
viscosity test shows the linear variation of the shear rate.
2.2. G‐CS/MSN Exhibits Excellent Biocompatibility
Excellent biocompatibility of biomaterials is crucial to their
effective functioning. To confirm biocompatibility, we performed MTT
assays and cell live/dead staining to evaluate the effects of
biomaterials on cell proliferation and cytotoxicity (Figure [79]2a).
The results showed no significant differences in the results of MTT for
either macrophages or NPCs when treated with G‐CS@Ang (1‐7), MSN@A_Man,
or G‐CS/MSN at various time points (Figure [80]2b). To further assess
whether these materials exhibit cytotoxicity, we performed live/dead
cell staining (Figure [81]2c). Statistical analysis revealed no
significant differences in the proportion of live versus dead cells
between the groups treated with the three materials and the control
group (Figure [82]2d). Additionally, apoptosis was detected by flow
cytometry, and the results showed that the apoptosis rates of
macrophages and NPCs were less than 3% and 5%, respectively
(Figure [83]2e,h). These results demonstrate that G‐CS@Ang (1‐7),
MSN@A_Man, and G‐CS/MSN exhibited excellent biocompatibility in vitro,
which forms the basis for subsequent experiments. We then extracted and
examined tissue sections from various rat organs, including the heart,
liver, spleen, lungs, and kidneys. Hematoxylin and eosin (H&E) staining
revealed an orderly structure of organ sections and regular cellular
morphology, with no significant signs of toxicity (Figure [84]S4,
Supporting Information). Finally, to investigate the degradation of the
G‐CS hydrogel in rats, we injected CY5‐labeled G‐CS into the IVD. The
hydrogel was monitored using an in vivo animal imaging system, with
rats injected with CY5‐labeled normal saline and non‐injected rats
serving as controls (Figure [85]2f,g). The results showed that G‐CS
degraded rapidly within three days after injection into the IVD,
indicating prime biodegradability and drug release ability.
Figure 2.
Figure 2
[86]Open in a new tab
Biocompatibility of G‐CS@Ang (1‐7), MSN@A_Man, and G‐CS/MSN and
degradation of G‐CS hydrogel. a) Experimental procedure for MTT assays
and live/dead staining (created using BioRender.com). b) MTT assay
results for rat NPCs and macrophages after different treatments (n =
3). c) Live/dead staining of rat NPCs and macrophages following
different interventions (n = 3, scale bar: 400, and 150 µm). d)
Quantitative analysis of live/dead staining images, providing data on
the percentage of live and dead cells. e) Flow cytometry assays
detecting apoptosis in rat NPCs and macrophages after different
treatments (n = 3). f) Experimental procedure for IVIS (created using
BioRender.com). g) IVIS images showing the distribution of CY5‐labeled
G‐CS hydrogel in the intervertebral disc at different time points:
includes images for CTR (negative control, no injection) and NS
(positive control, injection of CY5‐labeled saline) (n = 3). h)
Percentage of apoptotic NPCs and macrophages after different
treatments.
2.3. G‐CS@Ang (1‐7) Alleviates LPS‐Induced M1 Polarization of Rat Macrophages
by Inhibiting the Integrated Stress Response and Promoting the Polarization
of M0 Macrophages Toward M2
To determine the correlation between IDD and macrophages, we collected
NP derived from individuals with varying degrees of degeneration. The
NP was sectioned and subjected to H&E and immunofluorescence (IF)
staining (Figure [87]3a). Compared with Pfirrmann grade II, NP in
Pfirrmann grade IV showed a higher number of M1 macrophages. This
finding is consistent with those of previous studies, which showed that
macrophages accumulated in the NP as the grade of degeneration
increased, with M1 macrophages constituting the dominant portion.^[
[88]^17 ^] Therefore, we wanted to reverse macrophage polarization to
alleviate IDD. Next, we evaluated the effects of Ang (1‐7) and G‐CS@Ang
(1‐7) on macrophage polarization. We used real‐time quantitative
polymerase chain reaction (qPCR) to evaluate the expression level of
M1/M2 polarization marker RNA in macrophages of different treatment
groups (Figure [89]3b). For LPS‐stimulated macrophages, both Ang (1‐7)
and G‐CS@Ang (1‐7) effectively reduced the expression of INOS and IL‐1β
(P < 0.05) but did not significantly increase ARG‐1 and CD206 levels (P
> 0.05). In the treatment of macrophages that are not induced to
polarize, both Ang (1‐7) and G‐CS@Ang (1‐7) effectively reduced the
expression of INOS and IL‐1β and significantly increased the expression
of ARG‐1 and CD206 (P < 0.05). Next, we used IF (Figure [90]3c) and
flow cytometry (Figure [91]3d) to further assess macrophage
polarization. The polarization status was analyzed by comparing the
ratio of CD206^+ to CD86^+ cells (Figure [92]3e; Figure [93]S5,
Supporting Information). Although there is no statistically significant
difference in the data, a clear trend of change can be observed. Ang
(1‐7) and G‐CS@Ang (1‐7) effectively reduced the number of CD86^+
macrophages following LPS stimulation (P < 0.05) and increased the
number of CD206^+ cells in the unstimulated group. Collectively, these
results indicate that Ang (1‐7) and G‐CS@Ang (1‐7) can effectively
reduce the extent of M1 polarization in macrophages and promote the
polarization of M0 macrophages toward the M2 phenotype.
Figure 3.
Figure 3
[94]Open in a new tab
Induction of macrophage polarization by G‐CS@Ang (1‐7). a) MRI images,
H&E, and IF for macrophage surface markers (CD11b, CD206, CD86) in NPCs
from individuals with different grades of disc degeneration (n = 5,
scale bar: 150 µm, and 20 µm). b) qPCR results showed the expression
levels of INOS, IL‐1β, ARG‐1, and CD206 RNA in macrophages after
different treatments (n = 4). c) IF of macrophage surface markers
(CD206, CD86) after different interventions (n = 3, scale bar: 150 µm).
d) Flow cytometry results quantifying the number of CD86^+ and CD206^+
macrophages following different treatments (n = 3). e) Statistical
analysis of the proportion of CD206^+ and CD86^+ macrophages. f)
Western blot results for different treatment groups of eIF2α, p‐eIf2α,
and ATF4. g) Statistical analysis of western blot results (*P < 0.05,
**P < 0.01, ***P < 0.001).
Finally, we investigated the anti‐inflammatory mechanisms of Ang (1‐7).
A key marker of integrated stress response (ISR) activation is eIF2α
phosphorylation at the Ser‐51 site.^[ [95]^18 ^] Western blotting was
performed to analyze the expression of this protein in macrophages
using a small‐molecule ISR inhibitor, ISRIB.^[ [96]^19 ^] After LPS
treatment, the levels of ATF4 and p‐eIF2α/eIF2α were elevated in
macrophages. However, Ang (1‐7) and G‐CS@Ang (1‐7) effectively reduced
the expression of these proteins (Figure [97]3f,g). This indicates that
Ang (1‐7) can mediate ISR to inhibit LPS‐induced proinflammatory
polarization in macrophages.
2.4. MSN@A_Man Effectively Inhibits Inflammation, Improves ECM Metabolism
Dysregulation, and Alleviates NPC Aging and Death
ECM is a crucial component of NP, broadly categorized into ECM
synthesis and degradation. An inflammatory environment in the
degenerated NP can lead to an imbalance between ECM synthesis and
degradation.^[ [98]^20 ^] To verify that A_Man and MSN@A_Man can
effectively counteract inflammatory factors and improve the
microenvironment, we used IL‐1β to mimic the inflammatory environment
in vivo. QPCR was used (Figure [99]4a) to assess the RNA expression of
genes related to ECM synthesis (Col‐2α1, ACAN), degradation (ADAMTS‐5,
MMP‐13), and inflammation (INOS, COX‐2). Western blotting
(Figure [100]4b,d) and IF (Figure [101]4e,g) were used to assess the
protein levels of these indicators. The results showed that both A_Man
and MSN@A_Man improved the reduced expression of ECM synthesis markers
and counteracted the increased expression of degradation and
inflammation markers induced by IL‐1β (P < 0.05). We further stained
the NPCs with Safranin O and Alcian Blue (Figure [102]4c). The
intensity of staining reflects the level of collagen synthesis. The
results indicated that A_Man and MSN@A_Man can effectively mitigate the
decrease in collagen synthesis induced by IL‐1β. β‐gal is often used to
detect senescent cells.^[ [103]^21 ^] We found that A_Man and MSN@A_Man
simultaneously ameliorated cell senescence induced by IL‐1β
(Figure [104]4c). Finally, flow cytometry was performed to assess
apoptosis (Figure [105]4f; Figure [106]S6, Supporting Information). The
results indicated that A_Man and MSN@A_Man effectively improved cell
apoptosis induced by IL‐1β. The above experiments demonstrated that
A_Man and MSN@A_Man have excellent anti‐inflammatory effects and can
effectively improve the dysregulation of ECM metabolism caused by
inflammatory stimuli, alleviating NPC aging and death.
Figure 4.
Figure 4
[107]Open in a new tab
MSN@A_Man maintains ECM metabolism balance and alleviates inflammation
in NPCs. a) qPCR results showing the expression of ECM synthesis
markers (COL‐2α1, ACAN), degradation markers (ADAMTS‐5, MMP‐13), and
inflammation indicators (COX‐2, INOS) after different treatments (n =
4). b) Western blot results for ECM synthesis proteins (COL‐2α1, ACAN),
degradation proteins (ADAMTS‐5, MMP‐13), and inflammation markers
(COX‐2, INOS) following different interventions (n = 3). c) Safranin O,
Alcian Blue, and β‐gal staining of NPCs after various treatments (n =
3, scale bar: 250 µm, and 150 µm). d) Quantitative analysis of western
blot data. e) IF of COL‐2α1, MMP‐13, and INOS in NPCs after different
treatments (n = 3, scale bar: 80 µm). f) Flow cytometry results
assessing the apoptosis of NPCs following different interventions (n =
3). g) Statistical analysis of fluorescence intensity from IF analysis
(*P < 0.05, **P < 0.01, ***P < 0.001).
2.5. MSN@A_Man Inhibits Inflammation‐Mediated Activation of the PI3K/AKT/mTOR
Signaling Pathway and Promotes the Ubiquitin‐Dependent Pink1/Parkin Pathway,
Enhancing Mitophagy
We performed RNA sequencing to understand the molecular mechanisms by
which MSN@A_Man alleviates ECM metabolic disorders. The Venn diagram
showed that 16391 genes were co‐expressed in the three groups of cells
(Figure [108]5a). Differential gene analysis was then conducted. We
performed pairwise comparisons between the CTR, IL‐1β, and IL‐1β+A_Man
groups. Volcano plots revealed 370 upregulated genes and 560
downregulated genes in the control versus IL‐1β comparison and 37
upregulated genes and 47 downregulated genes in the IL‐1β versus
IL‐1β+A_Man comparison, with |log2FC| ≥ 1 and P ≤ 0.01
(Figure [109]5b). The cluster heat map showed genes associated with
changes in NPCs and depicted multiple changes in gene expression across
the three groups (Figure [110]5c). These results indicated a broad
range of differences in gene expression. Next, we performed Gene
Ontology enrichment analysis on the differentially expressed genes
between IL‐1β and IL‐1β+A_Man groups (Figure [111]5d). The results
showed that A_Man improved various aspects of NPCs biology, including
biological processes, cellular components, and molecular functions
following inflammatory stimulation. Finally, we conducted Kyoto
Encyclopedia of Genes and Genomes (KEGG) enrichment (Figure [112]5e)
and Gene Set Enrichment Analysis (GSEA) enrichment (Figure [113]5f)
analyses on the differentially expressed genes between the IL‐1β and
IL‐1β+A_Man groups. These results revealed that A_Man had a significant
regulatory effect on the PI3K/AKT/mTOR pathway. Previous studies have
shown that IL‐1β can activate the PI3K/AKT/mTOR pathway, which inhibits
chondrocyte proliferation and promotes chondrocyte apoptosis.^[
[114]^22 ^] We also detected key proteins in the PI3K/AKT/mTOR pathway
using western blotting (Figure [115]5g–j). The results showed that both
A_Man and MSN@A_Man inhibited activation of the PI3K/AKT/mTOR pathway
by reducing the phosphorylation of PI3K, AKT, and mTOR proteins (P <
0.05).
Figure 5.
Figure 5
[116]Open in a new tab
MSN@A_Man antagonizes IL‐1β‐induced cellular pathways. a) Venn diagram
showing the overlap of differentially expressed genes across different
treatment groups. b) Volcano plot illustrates the significance and
fold‐change of differentially expressed genes between treatment groups.
c) Heatmap showing the expression levels of differentially expressed
genes across various treatment conditions. d) GO enrichment analysis of
differentially expressed genes between IL‐1β and IL‐1β+A_Man groups. e)
KEGG pathway enrichment analysis for differential genes between IL‐1β
and IL‐1β+A_Man groups. f) GSEA showing enrichment of differential
genes in the mTOR pathway between IL‐1β and IL‐1β+A_Man groups. g)
Western blot detection of key proteins in the PI3K/AKT/mTOR pathway,
including p‐PI3K, PI3K, p‐AKT, AKT, p‐mTOR, and mTOR, in different
treatment groups (n = 3). h–j) Quantitative analysis of western blot
data for proteins in the PI3K/AKT/mTOR pathway (*P < 0.05, **P < 0.01,
***P < 0.001).
Autophagy is a conserved cellular metabolic pathway that maintains
intracellular stability, plays a crucial regulatory role in
inflammation, and affects the pathological progression of inflammatory
diseases.^[ [117]^23 ^] The PI3K/AKT/mTOR pathway is widely recognized
as a fundamental intracellular signaling pathway involved in normal
cell physiology and cancer pathology that inhibits autophagy when
activated.^[ [118]^24 ^] We previously demonstrated that A_Man and
MSN@A_Man effectively inhibit the PI3K/AKT/mTOR pathway. KEGG
enrichment (Figure [119]5e) analyses also indicated that A_Man has a
significant impact on regulating autophagy in NPCs. Flow cytometry was
used for JC‐1 analysis (Figure [120]6a) to verify the protective effect
on cells under inflammation. After IL‐1β stimulation, the proportion of
mitochondrial aggregates decreased, whereas the proportion of monomers
increased, with CCCP^+ serving as a positive control (Figure [121]S7,
Supporting information). Both A_Man and MSN@A_Man effectively reduced
the proportion of monomers in the NPCs (P < 0.05) (Figure [122]6g).
According to the IF of JC‐1, the fluorescence intensity of
mitochondrial aggregates decreased after IL‐1β stimulation, whereas
that of monomers increased, indicating severe mitochondrial
fragmentation. The fluorescence of aggregates was significantly
enhanced from that in the IL‐1β group, and the mitochondrial morphology
appeared more regular and intact after the addition of A_Man or
MSN@A_Man (Figure [123]6d; Figure [124]S8, Supporting information).
This confirmed the protective effect of A_Man or MSN@A_Man on
mitochondria. Our subsequent investigation into mitochondrial and
autophagy‐related proteins revealed that both A_Man and MSN@A_Man
effectively enhanced the conversion of LC3‐I to LC3‐II while
suppressing SQSTM1/p62 expression, thereby ameliorating mitophagy
activation. Furthermore, both A_Man and MSN@A_Man can antagonize
IL‐1β‐induced mitochondrial damage, as evidenced by elevated expression
levels of Mfn‐2 and TOM20 in NPCs (Figure [125]6j; Figure [126]S9,
Supporting Information). Next, we investigated the expression of key
pathway proteins (Parkin, Pink1) in mitophagy in NPCs using western
blotting and IF (Figure [127]6b,c,k; Figure [128]S9, Supporting
Information). The results showed that IL‐1β suppressed the expression
of the aforementioned proteins, whereas A_Man or MSN@A_Man counteracted
the effects of IL‐1β, leading to increased expression of Parkin and
Pink1 proteins (P < 0.05). Co‐localization fluorescence staining was
performed with MitoTracker and LysoTracker to further verify the
changes of mitophagy. Both A_Man and MSN@A_Man significantly increased
the co‐localization area (P < 0.05) (Figure [129]6e; Figure [130]S10,
Supporting information). To observe the phenomenon of mitophagy in the
NPCs more clearly, we conducted TEM to observe the mitochondrial
structure (Figure [131]6i). Mitochondria in NPCs showed significant
shrinkage, loss of cristae, and prominent pigment deposition (green
arrows) after IL‐1β stimulation compared to the control group (red
arrows: normal mitochondria). In contrast, A_Man and MSN@A_Man groups
exhibited restored mitochondrial morphology with a higher number of
autophagolysosomes (yellow arrows). ROS staining was also performed
(Figure [132]6f,h), which showed that the addition of A_Man or
MSN@A_Man effectively reduced the intracellular ROS content from that
in the IL‐1β group (P < 0.05). The above experiments collectively
demonstrate that MSN@A_Man can improve inflammation‐mediated
mitochondrial structural and functional damage and enhance mitophagy.
Figure 6.
Figure 6
[133]Open in a new tab
MSN@A_Man enhances mitochondrial autophagy through the Pink1/Parkin
pathway in NPCs. a) Flow cytometry analysis of JC‐1 staining to assess
mitochondrial membrane potential changes under different treatments (n
= 3). b) IF of key proteins involved in mitochondrial autophagy (Parkin
and Pink1) under different interventions (n = 3, scale bar: 20, and
150 µm). c) Statistical analysis of the fluorescence intensity of
Parkin and Pink1 from IF. d) IF staining images of JC‐1 under various
treatment conditions (n = 3, scale bar: 10 µm). e) Co‐localization IF
staining of MitoTracker and LysoTracker to observe
mitochondrial–lysosome interactions under different treatments (n = 3,
scale bar: 10 µm). f) IF showing ROS levels under different treatment
conditions (n = 3, scale bar: 10 µm). g) Quantitative analysis of JC‐1
flow cytometry data. h) Statistical analysis of ROS fluorescence
intensity. i) TEM images showing mitochondrial morphology and
structure; red arrows indicate normal mitochondria with clear cristae,
green arrows indicate mitochondrial shrinkage and pigmentation, and
yellow arrows indicate autophagic lysosomes (n = 3, scale bar: 50 nm).
j) Western blot detection of LC3, SQSTM1, TOM20, and Mfn2 expression
levels in nucleus cells under different treatments (n = 3) k) Western
blot detection of Parkin and Pink1 expression levels in nucleus cells
under different treatments (n = 3) (*P < 0.05, **P < 0.01, ***P <
0.001).
2.6. G‐CS/MSN Counteracts Inflammatory Stimuli, Improves ECM Metabolic
Disorders, Alleviates Cellular Aging, and Reduces Cell Death
Previously, we demonstrated the functions of these biomaterials. We
innovatively used nanomaterials engineering to combine the two drugs to
achieve the sequential release of the two medications for
anti‐inflammation and repair IVD. The effect of the combined G‐CS@Ang
(1‐7)/MSN@A_man (G‐CS/MSN) on cells was verified. We used a co‐culture
system with macrophages in the upper chamber and NPCs in the lower
chamber to simulate in vivo intercellular interactions (Figure
[134]7a). QPCR results showed that G‐CS@Ang (1‐7), MSN@A_Man, and
G‐CS/MSN effectively counteracted inflammatory stimuli, enhanced ECM
synthesis (Figure [135]7b), reduced degradation(Figure [136]7c), and
alleviated inflammation (INOS, COX‐2) (Figure [137]7d). G‐CS/MSN
demonstrated superior effectiveness to the other two groups (P < 0.05).
Western blot analysis of protein expression levels (Figure [138]7e–h)
confirmed the PCR results. Apoptosis was assessed by flow cytometry.
The results showed that G‐CS@Ang (1‐7), MSN@A_Man, and G‐CS/MSN
effectively improved IL‐1β‐induced cell apoptosis, with G‐CS/MSN
demonstrating the most pronounced effect (Figure [139]7i,m). We also
performed Safranin O and Alcian Blue staining to assess collagen
synthesis, and β‐gal staining to evaluate cellular senescence
(Figure [140]7j). Consistent with previous results, G‐CS/MSN
significantly enhanced collagen synthesis and alleviated
inflammation‐induced cell senescence. Finally, we used IF staining to
further examine the protein expression of COL‐2α1, MMP‐13, and INOS in
NPCs and compared the fluorescence intensity of these markers across
the different groups. The results showed that G‐CS/MSN was more
effective than the other two groups in enhancing COL‐2α1 expression and
reducing MMP‐13 and INOS expression (Figure [141]7k,l).
Figure 7.
Figure 7
[142]Open in a new tab
G‐CS/MSN effectively counteracts inflammatory stimuli and maintains ECM
metabolic balance in the macrophage/NPC co‐culture system. a)
Co‐culture system setup (created using BioRender.com). b–d) qPCR
analysis of the RNA expression of NPCs. e) Western blotting to assess
protein expression levels of NPCs. f–h). Quantitative analysis of
Western blot results. i). Flow cytometry analysis of apoptosis in NPCs
under different interventions (n = 3). j) Safranin O, Alcian Blue, and
β‐gal staining of NPCs under various treatments (n = 3, scale bar: 250
µm, and 150 µm). k) Statistical analysis of fluorescence intensity from
IF (n = 3, scale bar: 80 µm). l) Quantitative analysis of IF. m)
Quantitative analysis of flow cytometry results for apoptosis (*P <
0.05, **P < 0.01, ***P < 0.001).
These results indicate that our designed G‐CS@Ang (1‐7)/MSN@A_Man
system, through sequential drug release, effectively exhibited
anti‐inflammatory properties, improved ECM metabolic disorders induced
by inflammation, inhibited cell apoptosis, and regulated cell aging.
The next step involved conducting in vivo experiments to validate the
efficacy of this material in repairing IDD.
2.7. G‐CS/MSN Effectively Promotes IVD Repair In Vivo
We used a rat tail vertebral puncture model to verify whether G‐CS/MSN
can promote repair and regeneration of the IVD. The rats were treated
according to different groups, and computed tomography (CT) and
magnetic resonance imaging (MRI) scans were performed at four and eight
weeks. We calculated the disc height index (DHI) (Figure [143]S11,
Supporting information) and assessed the IDD grade.^[ [144]^25 ^] We
also collected IVD segments from the model, performed histological
sectioning at eight weeks (Figure [145]8a), and then conducted
histological scoring for different regions. CT revealed a significant
reduction in disc height in the IDD group. In contrast, the G‐CS@Ang
(1‐7) and MSN@A_man groups exhibited varying degrees of disc height
recovery. Notably, the G‐CS/MSN group demonstrated superior disc height
restoration compared with the other two groups at both four and eight
weeks (Figure [146]8b,d). MRI‐T2WI was used to observe the degree of
NPC degeneration (Figure [147]8b,e). The results showed varying degrees
of recovery in the NP in G‐CS@Ang (1‐7), MSN@A_man, and G‐CS/MSN
groups. However, the G‐CS/MSN group exhibited a significantly lower
level of IVD degeneration than the other two groups.
Figure 8.
Figure 8
[148]Open in a new tab
In vivo imaging results and evaluation of G‐CS/MSN in rats. a)
Procedural flow for in vivo experiments in rats (created using
BioRender.com). b) CT and MRI images of the punctured disc segments
four and eight weeks after treatment (n = 5). c) H&E, Safranin O/Fast
Green, Sirius Red, and polarizing microscope images of disc sections
after eight weeks (n = 5, scale bar: 1.5 mm, 0.5 mm). d) Quantitative
analysis of DHI at different time points for each treatment group. e)
Quantitative assessment of the disc degeneration grade at different
time points for each treatment group. f) Heatmap showing changes in
histological scores across different treatment groups (*P < 0.05, **P <
0.01, ***P < 0.001).
We further examined the histology of NP, annulus fibrosus, and collagen
expression in the IVD using various techniques, including H&E staining,
Safranin O/Fast Green staining, Sirius Red staining, and polarized
microscopy (Figure [149]8c). We also calculated histological scores to
assess tissue repair and regeneration (Figure [150]8f). The sham group
exhibited a clear disc structure with well‐rounded NP, orderly internal
arrangement, and well‐defined boundaries. The annulus fibrosus was
evenly distributed around NP with natural and clear boundaries.
Safranin O/fast green staining revealed abundant red‐stained
proteoglycans in NP, whereas the annulus fibrosus and bone displayed
high levels of blue‐stained collagen. Sirius Red staining, combined
with polarized microscopy, showed that the annulus fibrosus
predominantly contained collagen types COL‐1 (yellow) and COL‐3
(green), whereas NP primarily consisted of COL‐2, which did not show
significant color under polarized microscopy. In the IDD group, IVD
showed significant degeneration, with most of the NP area replaced by
fibrous structures. The internal structure of the NP was disorganized,
and the boundaries were unclear. The IVD in the G‐CS@Ang (1‐7),
MSN@A_Man, and G‐CS/MSN groups showed varying degrees of recovery.
However, the G‐CS/MSN group demonstrated superior results to the other
two groups in terms of NP morphology, area, annulus fibrosus
morphology, and boundary clarity. This indicated that G‐CS/MSN was more
effective in promoting IVD regeneration and repair in vivo.
Subsequently, the tissue sections were stained to assess relevant
indicators. The IDD group showed reduced COL‐2α1 expression and
increased levels of MMP‐13 and INOS in IVD. In contrast, the G‐CS@Ang
(1‐7), MSN@A_Man, and G‐CS/MSN groups all demonstrated increased
COL‐2α1 expression and decreased MMP‐13 and INOS levels. Among these,
the G‐CS/MSN exhibited the most effective regulation (Figure
[151]9a,b,d). The macrophage‐specific marker F4/80 was used for IHC
staining of macrophages. The results revealed a significant presence of
macrophages in the NPCs of the IDD group, whereas no noticeable
macrophage aggregation was observed in the treatment groups.
Figure 9.
Figure 9
[152]Open in a new tab
Histopathological analysis of rat nucleus pulposus tissue. a) IF of
COL‐2α1 and MMP‐13 in different treatment groups (n = 5, scale bar:
50 µm). b) IF of INOS in different treatment groups (n = 5, scale bar:
75 µm). c) Immunohistochemical staining images of F4/80 in different
treatment groups (n = 5, scale bar: 1.5 mm). d) Heatmap showing the
fluorescence intensity of different indicators across the treatment
groups.
In summary, G‐CS/MSN protects the integrity of the IVD by improving the
inflammatory environment and ECM metabolic disorders, halting the
progression of IDD, and promoting regeneration and repair of the IVD
through sequential drug release.
3. Discussion
Chitosan, a naturally derived polysaccharide featuring a β‐1,4‐linked
glucosamine structure analogous to hyaluronic acid, serves as a
critical component in both the ECM and synovial fluid of articular
cartilage. Owing to its exceptional biocompatibility, tunable
biodegradability, and low immunogenicity, chitosan has been extensively
utilized as a scaffold material in tissue engineering applications.^[
[153]^26 ^] The thermoresponsive properties of gelatin (exhibiting
low‐temperature sol state and body temperature‐induced gelation) make
it an ideal candidate for injectable biomaterials to fill irregular IVD
cavities conformally.^[ [154]^27 ^] Through physical or chemical
crosslinking (e.g., genipin), chitosan‐gelatin composite hydrogels can
form highly hydrated 3D network structures capable of achieving
compressive modulus comparable to native IVD. This approach
simultaneously circumvents the stress‐shielding effect associated with
excessive modulus in traditional synthetic biomaterials.^[ [155]^28 ^]
MSN, compared with traditional carriers (e.g., liposomes or polymer
microspheres), exhibits unique advantages in drug‐loading capacity,
controlled release kinetics, and microenvironment responsiveness,
offering a novel strategy for precision therapy of IDD.^[ [156]^29 ^]
By combining the advantages of G‐CS and MSN with sequential drug
loading, we developed a G‐CS/MSN dual‐delivery system, providing a
novel strategy to prevent IDD.
A multistage treatment strategy is more effective for repairing IDD, in
which anti‐inflammatory drugs are followed by drugs that improve NPCs
activity and function, providing a healthy environment for NPCs and
enhancing treatment effectiveness.^[ [157]^5 ^] The phased treatment
strategy is increasingly becoming the focus of disc regeneration
therapy. We developed a G‐CS/MSN medicine delivery system designed to
sequentially release therapeutic agents, improve the inflammatory
environment within degenerated intervertebral discs, inhibit disc
degeneration, and promote NPC regeneration. Additionally, we validated
the potential of two drugs, Ang (1‐7) and A_Man, in intervertebral disc
repair.In vivo, G‐CS initially degrades and releases Ang (1‐7), which
modulates macrophage polarization and improves the inflammatory
environment. Subsequently, the MSN encapsulated within the hydrogel is
released, and enabling the sustained release of A_Man. This
prolonged‐release corrects ECM metabolic imbalances in the NP, prevents
cellular aging and death, promotes autophagy, and ultimately halts disc
degeneration, promoting regeneration and repair of IDD.
Inflammation is the adaptive response of the body to mechanical,
biochemical, or immune‐mediated stimuli. However, prolonged chronic
inflammation within the IVD results in persistently elevated cytokine
levels, which directly disrupt the balance of protein metabolism.^[
[158]^30 ^] This is also a contributing factor to inflammatory aging.
The inflammatory process was initially thought to originate from
macrophages, the primary cells of the innate immune system.^[ [159]^31
^] Nevertheless, inflammation is now recognized as being induced and
promoted by various age‐related processes,^[ [160]^32 ^] macrophage
plasticity is a key factor in chronic inflammation.^[ [161]^33 ^]
Attention should be paid to the influence of the microenvironment
composed of macrophages on NPCs. In vivo, M1 macrophages secrete
pro‐inflammatory cytokines such as TNF‐α, IL‐1β, IL‐6, and MCP‐1,
whereas M2 macrophages secrete anti‐inflammatory and tissue
repair‐promoting factors such as IL‐4, IL‐10, and TGF‐β.^[ [162]^34 ^]
The disruption of this polarization balance is regarded as one of the
key factors underlying the alteration of the IVD microenvironment.
Regulating the microenvironment could control macrophage polarization,
activation, and plasticity via complex gene networks and signaling
cascades. Under inflammatory conditions, NPCs undergo significant
metabolic alterations and may even experience abnormal cell death. In
degenerated NPCs, the expression of p38 MAPK isoforms α, β, and δ is
markedly activated. P38α and P38β play a critical role in inducing the
release of GM‐CSF and IFNγ, which subsequently promote M1 polarization
of macrophages, thereby exacerbating the inflammatory microenvironment
in IDD.^[ [163]^7a ^] Moreover, degenerated NPCs activate the MAPK‐ERK
and PI3K‐AKT pathways, thereby upregulating the expression of MCP‐1 and
MMP‐3. This process promotes M1 macrophage recruitment and exacerbates
IDD.^[ [164]^35 ^] This dual‐targeting approach disrupts the
self‐perpetuating loop of inflammation and tissue breakdown, offering a
synergistic therapeutic advantage in preventing IDD. In our study, we
demonstrated that Ang (1‐7) effectively promoted the polarization of M0
macrophages into M2 macrophages and counteracted LPS‐induced M1
polarization. Additionally, Ang (1‐7) alleviated the impact of the
inflammatory environment on ECM metabolic dysregulation in co‐cultures
of macrophages and NPCs. It holds significant potential as a
therapeutic approach for the treatment of IDD. Through in vitro
NPCs‐macrophage coculture systems and in vivo experiments, we
demonstrated that Ang (1‐7) can effectively prevent the progression of
IDD by modulating macrophage phenotypic switching. Further mechanistic
investigations have also been conducted to elucidate this process. The
ISR is a complex mechanism by which cells respond to various external
pressures and stimuli. ISR activation regulates metabolic processes,
protein synthesis, cell survival, and apoptosis when cells encounter
adverse conditions, such as oxygen deprivation, nutrient deficiency, or
DNA damage.^[ [165]^36 ^] Ang (1‐7) could counteract M1 macrophages
polarization by inhibiting eIF2α phosphorylation and reducing ATF4
expression, suppressing the ISR. However, the detailed mechanisms
require further investigation. Encapsulating Ang (1‐7) in G‐CS
hydrogels allows for controlled drug release, which enhances the
initial improvement in the inflammatory environment and establishes a
strong foundation for disc repair.
The extracellular matrix (ECM) is a complex 3D network structure that
comprises gel‐like molecules including collagen, elastin, integrin, and
proteoglycans,^[ [166]^37 ^] which constitute the microenvironment and
are closely linked to cell survival, regeneration, repair, and immune
response.^[ [167]^38 ^] The gradual depletion of notochordal‐like and
chondrocyte‐like nucleus pulposus (NPCs) leads to an imbalance in ECM
metabolism during IDD. The proliferation of fibrochondrocyte‐like NPCs
and excessive production of collagen type I frequently contribute to
ECM metabolism dysregulation and the development of sclerosis.^[
[168]^39 ^] Therefore, protecting NPCs and maintaining ECM stability
are crucial steps for improving IDD. In our designed G‐CS/MSN drug
delivery system, A_Man was gradually released from MSN to address ECM
metabolic disorders in NPCs. A_Man is a principal oxygenated
anthraquinone purified from dietary plants,^[ [169]^40 ^] exhibiting
excellent biocompatibility. We revealed that A_Man inhibits activation
of the PI3K/AKT/mTOR pathway and enhances mitochondrial autophagy. The
PI3K/AKT/mTOR pathway is a classic pathway in humans with substantial
applications because of its potential roles in initiating inflammatory
responses,^[ [170]^41 ^] regulating cell survival and apoptosis,^[
[171]^42 ^] and mediating autophagy.^[ [172]^43 ^] Mitochondrial
dysfunction is a major factor contributing to the aging phenotype of
NPCs.^[ [173]^44 ^] When mitochondrial function is disrupted by various
conditions, such as high mechanical load and oxidative stress,^[
[174]^45 ^] damaged mitochondria must be promptly isolated and
selectively removed.^[ [175]^46 ^] Therefore, mitophagy is essential
for maintaining mitochondrial and cellular homeostasis.^[ [176]^47 ^]
We found that A_Man effectively promoted mitophagy by activating the
ubiquitin‐dependent Pink1/Parkin pathway. Meanwhile, A_Man improved
mitochondrial membrane potential and reduced ROS expression in NP.
RNA‐sequencing results indicated that A_Man is associated with TGF‐β
activation, highlighting its significant potential in improving and
repairing IVD. Loading A_Man onto MSN not only addressed the difficulty
of delivery but also provided a controlled release.
This study has some limitations. Although we validated some of the
mechanisms of action of these two drugs, we did not thoroughly
investigate their downstream targets, which will be the focus of future
work. Nevertheless, we demonstrated for the first time the significant
efficacy of Ang (1‐7) and A_Man in treating IDD. Additionally, we
designed a G‐CS/MSN sequential drug release system that boasts unique
material properties and anti‐inflammatory and anti‐aging effects both
in vitro and in vivo, providing a new approach to the treatment of IDD.
4. Conclusion
In this study, we propose an approach for the treatment of IDD, which
exploits the different solubility properties of two drugs combined with
bionanomaterials to create a sequential drug delivery system. In the
first release phase, the outer layer of G‐CS releases Ang (1‐7), which
suppresses ISR, regulates macrophage polarization, and improves the
inflammatory environment within the disc. In the second phase, MSN
releases A_Man, which improves ECM metabolism, and reduces cellular
aging and apoptosis. Meanwhile, A_Man promotes mitophagy by inhibiting
the PI3K/AKT/mTOR pathway and activating the ubiquitin‐dependent
Pink1/Parkin pathway. This G‐CS/MSN drugs delivery system offers a
novel direction for treating IDD.
5. Experimental Section
Synthesis of MSN—Preparation of Polymer Solution
To obtain a polymer solution, a mixture of tetraethyl orthosilicate
(TEOS, 1.62 g, 7.79 mmol) and phenyl triethoxysilane (0.45 g,
1.86 mmol) was added to triethanolamine (14.3 g, 95.6 mmol).
Emulsification Process
The polymer solution was quickly added to a preheated solution of
cetyltrimethylammonium chloride (0.586 g, 1.83 mmol) and ammonium
fluoride (NH4F, 0.1 g, 2.7 mmol) in water (21.7 g, 1.21 mmol) at 60 °C,
and stirred vigorously for 20 min while cooling to room temperature.
Crosslinking Reaction
One quarter of TEOS (totaling 192.2 mg, 0.922 mmol) was added to the
emulsion every 3 min, and the reaction mixture was stirred at room
temperature for 30 min. Finally, TEOS (38.3 mg, 184 µmol) and
3‐(triethoxysilyl) propyl succinic anhydride (56.2 mg, 184 µmol) were
added, and the resulting mixture was stirred at room temperature
overnight.
Recovery and Washing of Microspheres
The final reaction mixture was centrifuged (12 000 rcf, 20 min) to
collect the MSN, which were then redispersed in anhydrous ethanol. The
subsequent reaction of MSN was carried out in an ethanol solution
(100 mL) containing 2 g of ammonium nitrate (NH4NO3), with refluxing at
90 °C for 45 min. After centrifugation (12 000 rcf, 15 min) and
redispersion in ethanol, refluxing was repeated. Once the reaction
mixture had cooled to room temperature, the MSN were collected by
centrifugation (12 000 rcf, 15 min) and washed twice with 100 mL of
anhydrous ethanol.
Freeze‐Drying
The washed microspheres were placed in a freeze‐dryer to remove
moisture, resulting in stable dry microspheres.
Drug Loading
The MSNs (10 mg) were evenly dispersed in 5 mL of ultrapure water for
later use. A total of 5 mg of A_Man was fully dissolved in 2 mL of
methanol, which was then slowly dripped into ultrapure water containing
the nanoparticles and stirred for 24 h. Methanol was allowed to
evaporate slowly, and the resulting mixture was freeze‐dried to obtain
MSN@A_Man.
Preparation of G‐CS/MSN
Gelatin (40 mg) was completely dissolved in 2 mL of ultrapure water,
followed by the addition of 100 mg of chitosan. The prepared
drug‐loaded nanoparticles were added and stirred evenly. Finally,
200 µL of genipin solution (10 mg/mL) and 200 µL of Ang (1‐7) solution
(10 mg/mL) were added, stirred thoroughly, and allowed to sit until
gelation occurred, yielding G‐CS@Ang (1‐7)/MSN@A_Man.
Physicochemical and Multifunctional Property Characterization of G‐CS/MSN
The MSN particle size was observed by TEM, and the surfaces of MSN and
G‐CS were observed by SEM. Rheological properties, including the energy
storage modulus (G′), loss modulus (G″), and shear rate, were
determined using a rheometer (HAAKE MARS 40, Germany).
Calculation of Drug Release Rate
Physiological saline or phosphate‐buffered saline (PBS) was chosen as
the release medium, and the pH was adjusted to 7.4 to simulate
physiological conditions. A certain amount of hydrogel microspheres was
placed in a dialysis bag (MWCO = 1000), which was immersed in the
release medium, maintaining a constant temperature of 37 °C while
stirring at 100 r min^−1 on a magnetic stirrer. At predetermined time
points, 3.0 mL of the release medium was withdrawn, and an equal volume
of PBS was added. The concentration of the released drug was analyzed
by UV–vis spectrophotometry. All release measurements were conducted in
triplicate, and the average values were plotted. The amount of drug
released was compared to the initial amount of drug, and the release
rate was calculated using the following Equation ([177]1):
[MATH: Er=Ve∑1n−1Ci+V0Cnm
mi>drug
:MATH]
(1)
where Er is the cumulative drug release; Ve is the volume of replaced
PBS; V0 is the total volume of release medium; Ci is the concentration
of release medium during the ith sampling; m[drug] is the total drug
mass; and n is the number of times PBS was replaced.
[MATH:
ReleaseRate=Amoun
tofDrugRelea
mi>sedIniti
alAmoun
mi>tofDrug
×100% :MATH]
(2)
Drug Loading Efficiency
The 3.6 mg MSN was uniformly dispersed in 5 mL of ultrapure water as a
stock solution. Subsequently, 2.15 mg A_Man was completely dissolved in
2 mL of methanol and slowly dripped into the MSN‐containing aqueous
solution under continuous stirring. After 24 h of stirring with gradual
evaporation of methanol, the MSN@A_Man was obtained through
centrifugation and drying, yielding 5.44 mg of final product. The drug
loading efficiency (LE) was calculated using the following formula:
(5.44 mg – 3.6 mg) / 3.6 mg × 100% = 51.11%.
[MATH: LE%,w/w=Mas<
mi>sofdruginmicro
mi>spheresMassofmicro
mi>spheres×100% :MATH]
(3)
The determination of drug loading efficiency in G‐CS@Ang(1‐7) was
performed following previously reported methods. For detailed
procedures, please refer to the protocol described in the
aforementioned publication, which will not be reiterated here.^[
[178]^48 ^]
Cell Isolation and Culture Seeding
In this study, NPCs were extracted from four‐week‐old male
Sprague‐Dawley rats. After sacrificing the rats using excess carbon
dioxide, the rats were disinfected with 75% alcohol for 15 min.
Complete nucleus pulposus tissue was extracted by surgical clipping and
placed in a clean Petri dish. The collected nucleus pulposus tissue was
digested with trypsin (0.25%) for 30 min, then digested with type II
collagenase (0.2%) for 4 h. After centrifugation, the precipitate was
washed twice with PBS. NPCs were cultured in Dulbecco's Modified Eagle
Medium (DMEM)/F‐12 medium containing 10% fetal bovine serum (FBS),
100 µg/ml penicillin, and 100 µg mL^−1 streptomycin. All cell cultures
were maintained in a 5% CO[2] incubator at 37 °C, The first three cell
passages (P1‐P3) were utilized for in vitro studies to ensure optimal
cell viability and phenotypic stability. All experimental procedures
were approved by the Ethics Committee of Shandong University Hospital.
Macrophages were also extracted from four‐week‐old male Sprague‐Dawley
rats. After sacrifice, the rats were disinfected with 75% alcohol for
15 min, and the complete femur and tibia were surgically clipped out.
Both ends of the bones were cut off and placed in a clean petri dish,
then the bone marrow cavity was repeatedly rinsed with DMEM. The
collected bone marrow was added to DMEM medium containing 10% FBS,
100 µg mL^−1 penicillin, and 100 µg mL^−1 streptomycin then transferred
to a cell incubator for culture at 37 °C with 5% CO[2]. After 24 h, the
initial liquid was changed to absorb the non‐adherent cells, and fresh
DMEM medium containing 30 ng mL^−1 M‐CSF, 10% FBS, 100 U mL^−1
penicillin, and 100 µg mL^−1 streptomycin was added. The liquid was
changed every two days during cell culture.
After the cells were cultured to 70–80%, IL‐1β (10 ng mL^−1) or LPS
(100 ng mL^−1) was added according to the experimental design. After
incubation for one day, the relevant drugs or materials were added, and
incubation was continued for 4–5 days. Finally, the relevant indicators
were detected.
MTT Assay
The initial cell density was set to 4 × 10^4. After culturing the cells
in the extraction medium for the designated number of days (0, 2, 4, 6,
and 8 days), the samples were collected and washed three times with PBS
to remove non‐adherent cells. Then, 100 µL of 5 mg mL^−1 MTT solution
and 900 µL of DMEM medium were added to each well, followed by
incubation at 37 °C for 4 h. After removing all liquid, 1 mL of
formazan dissolving solution was added, and the mixture was gently
shaken for 10 min. From each sample well, 200 µL of liquid was
transferred to a 96‐well plate, and the optical density value at 490 nm
was measured using a microplate reader. Each group was sampled and
measured three times to ensure accuracy.
Live/Dead Cell Staining
The experiment was performed using a Calcein/PI Cell
Viability/Cytotoxicity Assay Kit (Beyotime, China). Briefly, NPCs and
macrophages were cultured in a 24‐well plate with different stimuli for
four days. The cells were then stained with calcein‐AM/PI for 30 min.
Samples were observed under a fluorescence microscope (Nikon, Ti2‐U,
Japan).
Cell Apoptosis Assessment
An Annexin V‐FITC Apoptosis Detection Kit (Beyotime, China) was used in
this experiment. Briefly, NPCs and macrophages were cultured in a
six‐well plate with different stimuli for four days. Cells were stained
with Annexin V‐FITC to detect apoptotic cells then analyzed using a
flow cytometer (FACSCalibur +Sort, BD, USA).
Macrophage Polarization Flow Cytometry
Macrophages were cultured in a six‐well plate, and the appropriate
treatments were applied for four days. Macrophages were scraped off and
labelled with APC‐CD11b/c, PE‐CD206, or FITC‐CD86. The labeled cells
were detected using a flow cytometer (BD FACS Celesta, BD, USA).
Real‐Time Quantitative Polymerase Chain Reaction
qPCR was performed to identify the fold changes in gene expression
related to macrophage polarization (CD206, ARG‐1, IL‐1β, INOS) and NPC
ECM synthesis, degradation (COL‐2α1, ACAN, MMP‐13, ADAMTS‐5), and
inflammation (COX‐2, INOS). β‐actin was used as a housekeeping gene.
Briefly, NPCs and macrophages were cultured in six‐well plates and
subjected to different treatments for four days. Total RNA was
extracted from NPCs using TRIzol reagent (Invitrogen, USA) under
different experimental conditions. The total RNA concentration was
measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific,
MA, USA). According to the instructions, RNA from each sample was
reverse transcribed into cDNA using Hifair AdvanceFast 1st Strand cDNA
Synthesis SuperMix for qPCR (DNA digester plus) (Yeasen, China). qPCR
was performed using Hieff qPCR SYBR Green Master Mix (No Rox) (Yeasen,
China). According to the amplification curve, the number of cycles (Ct
value) required to reach the threshold fluorescence intensity was
obtained, and the relative content of the target gene was 2^−ΔΔCt. The
primers used for each gene are listed in Table [179]1 .
Table 1.
Primers used in qPCR.
Gene Primer sequence (F, forward; R, reverse; 5′‐3′)
COL‐2α1
F: AGGAGACAGAGGAGAAGCT
R: CTTGAGGACCCTGGATTCC
ACAN
F: CACTTTACTCTTGGTCTTTGTG
R: AGTGAGTTGTCATGGTCTG
MMP‐13
F: ACCCAGCCCTATCCCTTGAT
R: TCTCGGGATGGATGCTCGTA
iNOS
F: CACCTTGGAGTTCACCCAGT
R: ACCACTCGTACTTGGGATGC
COX‐2
F: AATCGCTGTACAAGCAGTGG
R: GCAGCCATTTCTTTCTCTCC
ADAMTS‐5
F: ACAACCAGCTAGGTGATGAC
R: AATGATGCCCACATAAATCCTC
CD206
F: GAGGACTGCGTGGTGATGAA
R: CATGCCGTTTCCAGCCTTTC
Arg‐1
F: AAGACAGGGCTACTTTCAGGAC
R: ACCTTCCCGTTTCGTTCCAA
IL‐1β
F: CCAGGATGAGGACCCAAGCA
R: TCC CGACCATTGCTGTTTCC
β‐actin
F: CTCTGTGTGGATTGGTGGCT
R: CGCAGCTCAGTAACAGTCCG
[180]Open in a new tab
Western Blot
Western blotting was used to detect the expression of related proteins.
NPCs were cultured in six‐well plates at a density of 5 × 10^5
cells well^−1. After treatment and culturing for five days, the cells
were lysed in RIPA lysis buffer supplemented with a 1% protease
inhibitor mixture or a 1% phosphatase inhibitor mixture and homogenized
in a tube on ice for 30 min. After centrifugation at 13 500 rpm for
30 min, the supernatant was collected and stored at –80 °C. Before
SDS‐PAGE, the protein concentration in the supernatant was measured
using a BCA Protein Assay Kit (Beyotime, China). Protein blotting was
performed using equal amounts of different protein samples from each
individual sample based on the properties of the different antibodies.
After transferring the proteins to polyvinylidene fluoride membranes,
the membranes were blocked with 5% nonfat milk in Tris‐buffered saline
containing 0.05% Tween 20 for 2 h (the phosphorylation antibody was
blocked with 5% BSA for 2 h). The membranes were then incubated
overnight with anti‐β‐actin (1:50 000, AC026, abclone, China),
anti‐ATF4(1:1000, 60035‐1‐Ig, proteintech, China), anti‐Col2α1(1:500,
A19308, abclone, China), anti‐Acan (1:1000, A8536, abclone, China),
anti‐eIF2α (1:1000, A0764, abclone, China), anti‐MMP13 (1:1000, A1606,
abclone, China), anti‐ADAMTS5 (1:1000, A2836, abclone, China),
anti‐mTOR (1:5000, 66888‐1‐Ig, proteintech, China), anti‐PI3K (1:1000,
CY5224, abways, China), anti‐INOS (1:1000, 18985‐1‐AP, proteintech,
China), anti‐COX‐2 (1:1000, 12375‐1‐AP, proteintech, China), anti‐AKT
(1:1000, CY5551, abways, China), anti‐PINK1 (1:1000, 23274‐1‐AP,
proteintech, China), anti‐Parkin (1:1000, 14060‐1‐AP, proteintech,
China), anti‐Phospho‐mTOR (1:2000, 67778‐1‐Ig, proteintech, China),
anti‐Phospho‐PI3K (1:1000, CY6427, abways, China), anti‐Phospho‐AKT
(1:2000, 66444‐1‐Ig, proteintech, China), and anti‐Phospho‐eIF2α
(1:1000, AP0692, abclone, China). anti‐LC3B (1:1000, 14600‐1‐AP,
proteintech, China), anti‐SQSTM1 (1:1000, 29503‐1‐AP, proteintech,
China), anti‐TOM20 (1:1000, 11802‐1‐AP, proteintech, China), anti‐MFN2
(1:1000, 12186‐1‐AP, proteintech, China), The membrane was incubated
with HRP‐conjugated Goat anti‐rabbit IgG (H+L) (1:50 000, AS014, rabbit
monoclonal, Abclone, China) and immunoreactive proteins were detected
using enhanced chemiluminescence. Images were captured using the
Bio‐Rad ChemiDoc Touch Imaging System, and protein band density was
analyzed using ImageJ software. The density values obtained from
different target proteins on the same blot were normalized to β‐actin
loading controls to calculate the final ratios.
Immunofluorescence (IF)
The cells were inoculated and added to the different treatment groups.
NPCs/macrophages were incubated overnight with different primary
antibodies (anti‐Col2α1 (1:100, A19308, abclone, China), anti‐MMP13
(1:100, A1606, abclone, China), anti‐INOS (1:100, 18985‐1‐AP,
proteintech, China), anti‐PINK1 (1:100, 23274‐1‐AP, proteintech,
China), and anti‐Parkin (1:100, 14060‐1‐AP, proteintech, China)) at 4
°C, then fluorescently labeled, and their cytoskeleton and nucleus were
stained with appropriate Alexa Fluor 488 labeled secondary antibodies
(K1034G‐AF488, Solarbio, China), TRITC Phalloidin (CA1610, Solarbio,
China), and DAPI (S2110, Solarbio, China). Slides were then sealed with
an anti‐quenching agent. Stained cells were observed and photographed
using a confocal laser microscope (Olympus, Olympus SpinSR10, Japan) or
luminescence microscope (Nikon, ZCKP02024640, Japan).
Alcian Blue Staining
Fresh slides were prepared and fixed in MeOH for 5 min, then rinsed
with distilled water and air‐dried slightly. Alcian staining solution
(Beyotime, China) was added, and the cells were stained for 30 min,
then rinsed twice with distilled water for 1 min each. An Alcian
counterstaining solution was applied for 30–60 s. Finally, the slides
were rinsed with water and observed under a microscope while wet.
β‐gal Staining
1 mL of β‐galactosidase staining fixative (Beyotime, China) was added
to each well and fixed the cells at room temperature for 15 min. After
fixation, the fixative was removed and the cells were washed three
times with PBS for 3 min each. After removing the PBS, 1 mL of staining
working solution was added to each well and incubated the solution
overnight at 37 °C. Images were captured using a standard optical
microscope.
Safranin O Staining
Fresh slides were prepared and fixed in MeOH for 5 min, then rinsed
with distilled water and air‐dried slightly. Safranin O staining
solution (Beyotime, China) was added, and the cells were stained for
30 min then rinsed twice with distilled water for 1 min each. While
still wet, images were observed and captured using a microscope.
JC‐1 Staining and Flow Cytometry
According to the JC‐1 fluorescent probe kit (Beyotime, China), when the
mitochondrial membrane potential is high, JC‐1 accumulates in the
mitochondrial matrix and forms polymers that emit red fluorescence
under a fluorescence microscope. When the mitochondrial membrane
potential is low, JC‐1 does not accumulate in the mitochondrial matrix
and remains as a monomer, emitting green fluorescence. In this study,
changes in the mitochondrial membrane potential were detected based on
shifts in fluorescence color.
Mitochondrial Lysosome Co‐Localization Staining
Mitochondria were labeled using MitoTracker (Beyotime), and lysosomes
were labeled using Lysotracker (Beyotime). After imaging, the Pearson
correlation coefficient R was calculated to represent the
co‐localization correlation between mitochondria and lysosomes.
ROS Staining
According to the instructions of the ROS assay kit (Beyotime, China),
after culturing and treating the NPCs, ROS staining solution was added
for staining. Images were captured by confocal microscopy.
Co‐Culture of Macrophages and NPCs
Macrophages were absorbed and inoculated on the surface of the sample,
which was placed in the upper chamber of the model. The upper chamber
of the model was transferred into the pore plate containing NPCs, and
detection was performed after adding different treatments for culture.
Construction of the In Vivo Animal Model of IDD
Animal experiments were approved by the Animal Ethics Committee of Qilu
Hospital, Shandong University (ethical approval: DWLL‐2023‐140), and
all procedures were conducted in accordance with the guidelines of the
Animal Ethics Committee. The experiments were performed in a sterile
environment using four‐week‐old Sprague‐Dawley rats. The rats were
anesthetized with inhaled isoflurane, then a 26G needle was inserted
into the center of the intervertebral disc (C3‐4) under X‐ray guidance.
The needle was rotated 360° within the disk and held in place for 30 s
before removal. The Sham group only penetrated the skin. The IDD group
did not inject drugs. After three days, 5 µL of G‐CS@Ang (1‐7),
MSN@(A_Man), or G‐CS/MSN was injected into the puncture site of the
disc using the syringe. All procedures strictly adhered to sterile
requirements and were repeated five times.
Imagine Evaluation of Animal Experiments
At four and eight weeks postoperatively, MRI and micro‐CT were
performed on rat tails. Micro‐CT imaging was performed using a Bruker
SkyScan 2211 system (Belgium). Additionally, a 3.0 T MRI system (Intera
Achieva, Philips, Netherlands) was used to scan the rat tails. The
intervertebral DHI was calculated using ImageJ 1.52k software,
according to the formula DHI = 2 × (A + B + C) / (D + E + F + G + H +
I), which involves identifying grayscale values corresponding to the
intervertebral discs in a blinded manner. The modified Pfirrmann
grading system was employed to assess disc degeneration based on disc
structure and signal intensity.
Hydrogel Degradation Experiment
The cy5‐labeled hydrogel was appropriately injected into the
intervertebral discs of rats, and the fluorescence intensity changes at
the intervertebral discs were detected on days 0, 3, 7, 10, and 14
using a non‐invasive small‐animal live optical imaging system (IVIS
Spectrum) to explore hydrogel degradation in the rat model.
Histological Evaluation of Animal Experiments
The discs were collected four and eight weeks after treatment. The
samples were fixed in 4% paraformaldehyde and decalcified slowly and
steadily using EDTA (0.5 M, Servicebio, China). After decalcification,
the tissues were dehydrated and embedded in paraffin, and the paraffin
blocks were cut into 4‐µm slices on the coronal plane. The slices were
stained with H&E and Safranin O‐fast green solutions, Sirius red stain,
and polarized light scanning (VS200.Olympus, Japan). The degree of disc
degeneration was assessed using a histological grading scale based on
five categories of disc changes: moderate disc degeneration with a
score of 6–11 and severe disc degeneration with a score of 12–15.
RNA Sequencing
The number of differentially expressed genes in control, IL‐1β, and
IL‐1β+A_Man groups, the fold change of NPC inflammation‐related genes,
KEGG enrichment of up/downregulated pathways, and Gene Ontology
enrichment of cell function were examined by RNA sequencing.
Statistical Analysis
In this study, statistical analyses were conducted using SPSS 19 (SPSS
Science Inc., Chicago, Illinois) and Prism 6.0 (GraphPad Software, La
Jolla, CA, USA). All quantitative data were obtained from at least
three independent parallel samples and expressed as the mean ± standard
deviation. Comparisons between control and treatment groups were
performed using a two‐tailed Student's T‐test. For experiments with
more than two groups, one‐way ANOVA was applied, followed by Tukey's
post‐hoc test. In cases of non‐parametric data or lack of homogeneity
of variance, the Kruskal‐Wallis H test was employed, with subsequent
pairwise comparisons using the Nemenyi test. A P‐value of less than
0.05 was considered statistically significant.
Ethical Statement
All animal experiments in this study were performed in accordance with
institutional guidelines and approved by the Laboratory Animal Centre
of Qilu Hospital of Shandong University (DWLL‐2023–139). The study of
human tissue was approved by the institutional review board of Qilu
Hospital of Shandong University (KYLL‐2022(ZM)−1051).
Conflict of Interest
The authors declare no conflict of interest.
Author Contributions
X.K., R.H., and P.Z. contributed equally to this work. X.K., R.H.,
P.Z., L.C., L.J., C.L., and Z.W. designed the research. X.K., R.H.,
P.Z., L.L., Q.L., K.S., and H.G. performed the experiments. X.K., J.Z.,
and S.L. analyzed the data. X.K. and R.H. wrote this paper.
Supporting information
Supporting Information
[181]ADVS-12-e07178-s001.docx^ (3.4MB, docx)
Acknowledgements