Abstract

Introduction

   Osteosarcopenic fractures, an emerging geriatric syndrome characterized
   by sarcopenia-osteoporotic fractures coexistence, delayed fracture
   healing, and elevated risk of re-fracture. Limited research has
   investigated the mechanisms by which skeletal muscle satellite cells
   (SMSCs) promote muscle regeneration and osteoporotic fracture healing.
   The aim of this study was to investigate the impact of a traditional
   herbal decoction (HD), the Invigorate the Spleen and Tonify the Kidney
   Formula, on SMSC regulation, muscle regeneration, and fracture healing.

Method

   Using conditional knockout mice, the role of SMSCs in promoting
   fracture healing and mitigating sarcopenia was evaluated by visualizing
   the fracture area and surrounding muscle tissue. The signaling pathways
   involved were comprehensively analyzed using a combination of Western
   blotting, real-time PCR analysis, immunohistochemical staining, and
   immunofluorescent staining. And the key elements and compounds
   facilitating osteogenesis and myogenesis were identified using HPLC and
   network pharmacology analysis.

Results

   This study demonstrated that the herbal decoction mediates the
   β-catenin signaling pathway, mobilizes SMSCs to migrate to the fracture
   area, facilitates their osteogenic and myogenic differentiation, and
   enhances osteoporotic fracture healing. Knockdown of β-catenin in SMSCs
   in Pax7-Cre^ERT2/+;β-catenin^fx/fx conditional knockout mice led to
   sarcopenia and osteoporosis. Additionally, the herbal decoction
   significantly increased bone mass, repaired bone microstructure, and
   promoted muscle fiber remodeling around fractures in mice.

Conclusions

   These findings provide the first evidence that the HD, as a β-catenin
   agonist, not only promotes fracture healing by modulating the
   osteogenic and myogenic effects of SMSCs but also ameliorates
   sarcopenia. This study offers practical evidence supporting the formula
   as a promising therapeutic candidate for treating osteosarcopenic
   fractures.

Supplementary Information

   The online version contains supplementary material available at
   10.1186/s13287-025-04642-6.

   Keywords: Osteosarcopenia, Osteoporotic fracture, Skeletal muscle stem
   cells, Herbal decoction, β-catenin

Introduction

   Osteosarcopenic fractures, an emerging geriatric syndrome characterized
   by sarcopenia-osteoporotic fractures coexistence. Sarcopenia is a
   common condition characterized by the progressive loss of skeletal
   muscle mass and function, leading to reduced physical mobility,
   diminished quality of life, and an increased risk of negative effects
   like fractures, falls, and premature death [[44]1]. Fractures are also
   a severe complication of osteoporosis. Osteoporotic fractures (OPFs),
   also known as fragility fractures, are among the most prevalent global
   conditions [[45]2]. The balance between bone formation and bone
   resorption, which is crucial for maintaining skeletal integrity, is
   tightly regulated by osteoclasts, osteoblasts, and osteocytes [[46]3].
   A breakdown of this balance can lead to pathologically altered bone
   quality and structure [[47]4, [48]5]. No pharmacological agents
   currently address osteosarcopenic fractures.

   In 2017, an estimated 2.68 million new fragility fractures occurred in
   six European countries (United Kingdom, Italy, France, Germany, Sweden,
   and Spain), highlighting that more than 0.3 billion individuals
   aged ≥ 50 years worldwide may face an increased risk of osteoporotic
   fractures by 2040 [[49]6, [50]7]. While surgical intervention is the
   primary therapeutic approach for treating OPFs, reducing mortality and
   improving physical function in many patients [[51]8]. While the
   importance of muscle-derived signals in bone formation is increasingly
   recognized, the specific cellular and molecular mechanisms mediating
   this crosstalk, remain incompletely understood [[52]9]. Given the
   substantial social and economic burden associated with OPFs, improving
   treatment strategies for high-risk populations is essential.
   Specifically, regulating mesenchymal stem cell (MSC) differentiation to
   promote bone regeneration is critical for improving therapeutic
   outcomes in bone diseases.

   In contrast to the extensively studied bone marrow mesenchymal stem
   cells, the effect of skeletal muscle satellite cells (SMSCs) in
   facilitating fracture healing remains underexplored. SMSCs are situated
   in the muscle fibres between the plasma membrane and the basement
   membrane [[53]10]. While typically quiescent, SMSCs exhibit mesenchymal
   stem cell activity following stimulation [[54]11, [55]12]. Paired box 7
   (Pax7) is a critical molecular marker for SMSC formation during
   embryogenesis [[56]13]. Additionally, 5-bromodeoxyuridine (BrdU), a
   thymidine analog, is widely used in studies related to cell
   proliferation [[57]14]. Although SMSCs have been reported to
   differentiate into osteoblasts, research on this topic remains limited
   [[58]15, [59]16]. Notably, prior findings have shown that SMSCs promote
   osteoporotic fracture healing via β-catenin, suggesting its potential
   as a therapeutic target [[60]17].

   β-catenin signaling is often dysregulated in individuals with muscle
   deficiencies (e.g., myopathy and atrophy) due to genetic or epigenetic
   factors [[61]18, [62]19]. β-catenin interacts with myogenic
   differentiation (MyoD) and activates target genes [[63]20].
   Additionally, WNT5a, a crucial WNT ligand, can inhibit adipogenic
   differentiation of progenitor cells through the positive regulation of
   β-catenin signaling, enhancing their pro-myogenic effects [[64]21].
   β-catenin is also a critical regulator of skeletal homeostasis and
   development, with its dysregulation reported during aging [[65]22,
   [66]23].

   For this study, a traditional Chinese herbal decoction (HD), the
   Invigorate the Spleen and Tonify the Kidney Formula, was selected as a
   β-catenin agonist. HD has demonstrated potential in modulating SMSCs
   and promoting fracture healing while offering convenience and
   biological compatibility. However, its mechanism remains unclear.

   This study utilized Pax7-Cre^ERT2/+;β-catenin^fx/fx conditional
   knockout(cKO) mice to specifically knock out β-catenin in SMSCs. In
   vivo experiments were conducted to investigate the correlation between
   muscle and bone and to observe the effects of HD on the bone and muscle
   of cKO mice. The objective of this work was to elucidate the mechanism
   by which HD-mediated β-catenin signaling regulates SMSCs to promote
   myogenic and osteogenic differentiation for treating osteosarcopenic
   fractures.

Material and methods

Mouse experiments and ethical statement

   Thirty-two 1-month-old C57BL/6 mice were obtained from the Shanghai
   Model Organisms Center, Inc. They were screened based on their specific
   pathogen-free (SPF) grade and maintained under standard conditions with
   freely available water and food. The mean weight of the animals was
   recorded as 31.9 ± 4.5 g.

   Crossing the C57BL/6 J-background Pax7 Cre^ERT2/+ mice with
   β-catenin^fx/fx mice resulted in the generation of Pax7
   Cre^ERT2/+;β-catenin^fx/fx mice. Genotyping was performed using agarose
   gel electrophoresis of genomic DNA extracted from the tails of
   3-week-old mice (Supplemental Fig. [67]1A). Body weights and general
   health signs were monitored for all groups before fracture modeling,
   with no significant differences observed (Supplemental Fig. [68]1B and
   1C).

Fig. 1.

   [69]Fig. 1
   [70]Open in a new tab

   HD mediates β-catenin to promote fracture healing. (A) Micro-CT 3D
   reconstruction at 7 dpf and 14 dpf. Bar, 1 mm. (B) Micro-CT
   quantitative analysis at 7 dpf and 14 dpf. Results are shown as
   mean ± SEM (n = 5). *P < 0.05, **P < 0.01. (C) The tibial fracture site
   by H&E staining, was treated for 7 dpf and 14 dpf. Bar, 500 μm. (D)
   RT-PCR results of tibialis posterior muscle-related genes in the OVX
   compound fracture model mice. Results are shown as mean ± SEM (n = 5).
   *P < 0.05, **P < 0.01, ***P < 0.001. (E) The tibial fracture site by
   Alcian Blue/hematoxylin and orange G staining after treatment for 7 dpf
   and 14 dpf. Bar, 500 μm. (F) Immunohistochemical β-catenin staining: At
   7 dpf and 14 dpf, the fracture sites of each group were stained. (G)
   Immunofluorescence staining (Pax7 + Brdu) of the posterior tibial
   muscle showed that the positive expression of SMSCs in the
   OVX-Decoction and OVX-Positive group was significantly higher than that
   of OVX-Vehicle group

   Animal experiments were conducted following the guidelines of the
   "Guide for the Care and Use of Laboratory Animals" issued by the
   National Institutes of Health (NIH). The experimental protocols were
   approved by the Animal Ethics Committee of Shanghai University of
   Traditional Chinese Medicine (Ethics Approval No: PZSHUTCM190329005).

Experimental groups

   Individual identification of the 30 C57BL/6 female mice was achieved
   via toe clipping and subsequent numbering from 1 to 30. Randomization
   was performed using SPSS 24.0 software, creating three distinct groups:
   Vehicle, Decoction, and Positive. Every group consists of two points in
   time (7 and 14 days post-fracture [dpf], n = 5).

   Additionally, a total of 20 litter-negative β-catenin^fx/fx mice
   comprised the Con-Vehicle group and 60 Pax7 Cre^ERT2/+;β-catenin^fx/fx
   mice were randomly divided into TM-Vehicle, TM-Decoction, and
   TM-Positive. The assessment takes place at two points in time (7 dpf
   and 14 dpf) for each group(n = 10).

Model establishment and evaluation of osteoporosis

   To activate Pax7 CreERT2/ + in the TM group, 1-month-old mice received
   intraperitoneal injections of tamoxifen (100 mg/kg dissolved in corn
   oil) once daily for five consecutive days. Preliminary micro-computed
   tomography (micro-CT) showed that knockdown of β-catenin in SMSCs
   resulted in a significantly reduction in bone mineral density (BMD) in
   the TM group (P < 0.001; Supplemental Figs. [71]1D and 1E). Bone
   microstructure at the tibial plateau was also significantly
   impaired(Supplemental Figs. [72]1F).

Construction of an OPF model

   Thirty 3-month-old female C57BL/6 mice underwent ovariectomy (OVX) to
   induce osteoporosis, followed by experimental procedures three months
   post-surgery. Tibial fracture modeling was performed under isoflurane
   anesthesia in a sterile environment. The procedure involved hair
   removal and skin sterilization with iodine [[73]24]. Muscle and fascia
   were bluntly stripped, and a Kirschner wire was inserted into the
   proximal tibia. Transverse osteotomy was then performed, and the tibia
   was stabilized using the Kirschner wire. Finally, the incision was
   closed in layers (Supplemental Fig. [74]1E).

Drug formulation

   The herbal decoction was prepared and identified by pharmacists at
   Longhua Hospital following standard procedures (Table [75]1). According
   to the Chinese Medical Pharmacopoeia, all herbs were steeped in 12 L of
   water for 30 min, boiled for 40 min, and then filtered. The residue was
   reboiled in 8 L of water for another 40 min and filtered again. The
   filtrates were combined and prepared for oral administration.
   Pre-experimentally, OVX surgery was performed on 3-month-old female
   mice, and postoperatively, the treatment group was subjected to a
   compound intervention experiment with different doses (high, medium and
   low), and we found that the medium-dose group of the herbal decoction
   was the optimal group (Supplemental Figs. [76]1G).

Table 1.

   Composition of herbal decoction
   Latin name Chinese name Amount (g) Lot No Place of origin Company
   Codonopsis Pilosula Dangshen 12 190,822–1 Shanxi, China
   Shanghai WanShiCheng Chinese Medicine Co. Ltd
   Drynaria Fortunei Gusuibu 9 2,019,062,802 Chongqing, China
   Shanghai DeHua Chinese Medicine Co. Ltd
   Acanthopanax Senticosus Ciwujia 12 20,200,811 Changbai, China
   Linjiang Tranquil Local Product Shop
   Epimedium Brevicornum Yinyanghuo 9 2,019,082,006 Gansu, China
   Shanghai DeHua Chinese Medicine Co. Ltd
   Salvia Miltiorrhiza Danshen 12 200,706 Shandong, China
   Shanghai Hongqiao traditional Chinese medicine decoction pieces Co., Lt
   d
   Angelica Pubescens F. Biserrata Duhuo 9 20,200,515–1 Hubei, China
   Shanghai WanShiCheng Chinese Medicine Co. Ltd
   [77]Open in a new tab

   The voucher specimens were deposited at Longhua Hospital, affiliated
   with Shanghai University of TCM

   Dosing was determined using the "Methods of Pharmacology of New Chinese
   Medicines," with the conversion formula for mice as follows: the dose
   of mice = 1/70*10*weight*number*day. Mice received 0.2 mL/day by gavage
   for 7 or 14 days, beginning the second day after tibial fracture
   modeling. In the Decoction group, mice were administered the herbal
   decoction. The Positive group received Strong Bone Capsules, an
   anti-osteoporosis drug containing total flavonoids (National Drug
   Standard: WS3-891(Z-176)-2004(Z)). The Vehicle group received 0.9%
   saline. Free access to water for all groups.

X-ray and micro-CT

   The left tibia was carefully dissected, with adjacent muscles removed,
   and immersed in buffered formalin before being replaced with 75%
   ethanol for micro-CT scanning. X-ray images of the left tibia were
   captured at 55 kVp and 71 μA. Quantitative bone histomorphometric
   analyses included trabecular trabecular number (Tb.N), thickness
   (Tb.Th), connectivity density (Conn.Dens), and bone volume/total volume
   (BV/TV).

Histopathological examination

   Muscle tissue was fixed in a fixative for 24 h, dehydrated, embedded in
   paraffin, and sectioned sagittally and horizontally (4 μm thick).
   Decalcified femoral sections were stained with hematoxylin and eosin
   (H&E) and Masson's stain. After confirming decalcification by X-ray,
   tibial sections were dehydrated, embedded in paraffin, and subjected to
   continuous sagittal sectioning (4 μm thick). These sections were
   stained with H&E, Alcian blue/hematoxylin and orange G (ABHO),
   Safranin-fast green, and subjected to immunofluorescence and
   immunohistochemistry. Target areas were analyzed using Olympus VS120-SL
   image analysis software after scanning the entire film.

Real-time PCR analysis

   Muscle tissue was ground into a powder in its frozen state. β-actin is
   the reference gene. The following primer sets (all sequences 5′–3′)
   were used: Runx2-F, AACGATCTGAGATTTGTGGGC; Runx2-R,
   CCTGCGTGGGATTTCTTGGTT; Osteocalcin(OC)-F, GACCGCCTACAAACGCATCTA;
   OC-R:GACAGGGAGGATCAAGTCCCG; Pax7-F, CGATTAGCCGAGTGCTCAGA;
   Pax7-R:GGAGGTCGGGTTCTGATTCC; Engrailed 1(EN1)-F, CCGGTGGTCAAGACTGACTC;
   EN1-R, CCGCTTGTCTTCCTTCTCGT; Axin2-F, ATAAGCAGCCGTTCGCGATG; and
   Axin2-R, CTCTCTTAAGTCAGCAGGGGC. Relative quantity by the 2^−ΔΔCt
   method.

Immunohistochemical staining

   Deparaffinized slices were soaked in methanol:H₂O₂ (1:9) for 15 min,
   followed by collagen extraction using collagenase from Clostridium
   histolyticum. Sections were incubated in a 37 °C thermostat for 15 min.
   It was blocked with 5% bovine serum albumin (BSA) for 20 min and then
   incorporated rabbit anti-β-catenin and goat anti-rabbit IgG antibodies.
   The avidin/biotin enzyme complex peroxidase was added for 15 min, and
   the sections were visualized using a 3,3′-diaminobenzidine color
   development solution under an Olympus VS120-SL microscope at
   20 × magnification.

Immunofluorescent staining

   Dewaxed sections underwent antigen retrieval using collagenase from
   Clostridium histolyticum. Slides were stagnated with 5% BSA for 20 min
   and cultured overnight with rabbit primary antibodies: (Pax7: 1% BSA
   1:200), BrdU (BrdU: 1% BSA 1:200), MyoD (MyoD: 1% BSA 1:200) and Sca1
   (Sca1: 1% BSA 1:200). Anti-rabbit IgG (488: 5% BSA 1:500 + 555: 5% BSA
   1:500) was added, and the sections were stained for 1 h (in the dark).
   Visualized under an Olympus VS120-SL microscope.

Muscle wet weight coefficient

   Prior to tissue harvesting, mice were weighed. Harvesting procedure:
   The muscles of the operated hindlimb, including the gastrocnemius,
   soleus, and tibialis posterior muscles, were dissected. The wet weight
   of each individual muscle was recorded. Subsequently, the ratio of each
   muscle's wet weight to the terminal body weight was calculated.

Western blot

   Posterior tibial muscles were extracted post-treatment, weighed, and
   preserved at − 80 °C. Proteins were extracted using the BCA method and
   stored at − 20 °C. Equivalent protein amounts were isolated by 8–12%
   SDS-PAGE and moved to PVDF. After blocking with 5% BSA in PBST, primary
   antibodies (β-catenin 1:4000, MyoD1 1:4000, MEF2C 1:4000, GAPDH 1:4000)
   were incubated overnight in 1% BSA. Membranes were then incubated with
   secondary antibodies (1% BSA, 1:1000/1:10,000) for 2 h.

HPLC-Q-TOF of herbal decoction

   HD components were characterized using an Agilent 1290 UPLC system
   coupled with an Agilent Q-TOF 6545 LC/MS. The mobile phase consisted of
   solvent A (acetonitrile) and solvent B (water with 0.1% formic acid) at
   a flow rate of 0.3 mL/min. Separation was performed on a Waters
   CORTECS® UPLC® T3 column (2.1 × 100 mm, 1.6 μm) at 30 °C. Data were
   analyzed using MassHunter Workstation Qualitative Analysis Software
   (version B.07.00).

Network pharmacology

   Active ingredients of herbal components (e.g., Codonopsis pilosula,
   Drynaria fortunei, Epimedium brevicornum, and Salvia miltiorrhiza) were
   identified using the TCMSP database ([78]https://tcmsp-e.com/) with
   oral bioavailability ≥ 30% and drug-likeness (DL) ≥ 0.18. Candidate
   genes were obtained using the BATMAN-TCM database
   ([79]http://bionet.ncpsb.org.cn/batman-tcm/) with score cutoff > 0.99
   and P < 0.05. Duplicate targets were removed, and standardized gene
   names were verified with the UniProt database
   ([80]https://www.uniprot.org/). Disease-related targets were identified
   by searching for "osteoporotic fracture" in GeneCards
   ([81]https://www.genecards.org/) and OMIM ([82]https://www.omim.org/).
   Drug-component-target networks were constructed using Cytoscape 3.9.1
   software.

GO enrichment analysis and KEGG pathway analysis

   Drug-disease crossover genes were analyzed in the DAVID database
   ([83]https://david.ncifcrf.gov/) for Gene Ontology (GO) terms,
   including biological process (BP), cellular component (CC), and
   molecular function (MF). The top 10 BP, CC, and MF terms, and the top
   20 KEGG pathways related to osteoporotic fractures, were selected
   (P < 0.01).

Other agents

   Strong bone capsule (cat. #Z20030007) was purchased from Beijing
   Qihuang Pharmaceutical Co., Ltd. (Beijing, China); RIPA Lysis Solution
   (cat. #P0013B), SDS-PAGE protein loading buffer(cat. #P0015L), BeyoECL
   star (cat. #P0018AS), SDS-PAGE electrophoresis solution(cat. #P0014D),
   SDS-PAGE gel kit (cat. #P0012AC) and Western Transfer Film (cat.
   #P0021B) were from Beyotime (Shanghai China); MASSON kit (cat. #G1006)
   and GD fixative (cat. #G1111) were from Servicebio (Wuhan, China); Anti
   GAPDH antibody (cat. #ab181602), Anti β-catenin antibody(cat. #ab6302),
   Goat anti rabbit (cat. #ab205718), Anti BrdU antibody (cat. #ab6326),
   Anti Sca1 antibody (cat. #ab25031) and Anti-Pax7 antibody (cat.
   #ab187339) were from Abcam (UK); Anti MYOD antibody was purchased from
   Novus (UK) (cat. #NBP1-54,153); Tamoxifen (cat. #T5648), Clostridium
   histolyticum (cat. #C6885), Eosin (cat. #E4009-5G), Hematoxylin (cat.
   #H-3136), Alcian Blue (cat.#A5268), Orange G (cat. #1936–15-8),
   Phloxine B (cat. #18,472–87-2), Dimethyl sulfoxide (DMSO) (sigma
   amresco cat.#67–68-5), Albumin BovineV (sigma Roche
   cat.#10,735,078,001) and Trypsin (cat. #T7409) were from Sigma (USA);
   ABC-HRP Kit (cat. #PK-6100), Antifade Mounting Medium with DAPI (cat.
   #H-1200) and DAB Substrate Kit (cat. #SK-4100) were from Vectorlabs
   (USA); Anti-rabbit IgG (H + L) 555 (cat. #4413/4409) and Anti-rat IgG
   (H + L) 488 (cat. #4413) were from Cell Signaling Technology (CST)
   (USA).

Statistical analysis

   Data are expressed as mean ± standard error. Assuming a 30%
   biologically significant difference with 10–20% variability, α and
   1 − β values were set at 0.05 and 0.8, respectively. No animals or
   samples were excluded from the analysis. For group comparisons, one-way
   ANOVA with Least Significant Difference (LSD) post-hoc tests was used
   for data passing normality tests; otherwise, the Kruskal–Wallis test
   followed by Dunn's Multiple Comparison Test was applied. Analyses were
   performed using SPSS 24.0, with P < 0.05 considered significant
   (*P < 0.05, **P < 0.01, ***P < 0.001). Graphical representations were
   created using GraphPad Prism 8.

Results

HD mediates β-catenin to promote OPF healing

   Following pharmaceutical intervention in a conventional OVX mouse model
   of compound fractures, micro-CT scanning visualized bone callus
   structure and enabled three-dimensional reconstruction mapping.
   Comparative analysis showed that, relative to the OVX-Vehicle group,
   all drug-treated groups exhibited enhanced bone callus generation and
   maturation at 7 and 14 days post-fracture (dpf). Notably, the HD group
   demonstrated the most pronounced effect (*P = 0.0226, **P < 0.01,
   Fig. [84]1A and 1B). Histological examination using HE staining
   revealed that at 7 dpf, OVX-Decoction and OVX-Positive groups promoted
   cartilaginous callus formation at fracture sites, whereas minimal scab
   formation was observed in the saline control group. By 14 dpf, enhanced
   callus remodeling was evident in the drug-treated groups, while callus
   formation had only commenced in the OVX-Vehicle group (Fig. [85]1C).

   RT-PCR analysis of tibialis posterior muscle showed that the
   OVX-Decoction group significantly upregulated the expression of Runx2,
   a bone formation-related signaling gene (**P < 0.01, Fig. [86]1D).
   Additionally, enhanced expression levels of Pax7, a marker gene for
   myogenic stem cells, and Engrailed 1 (EN1), a transcription factor
   regulating cell development, were observed. The treatment also promoted
   the expression of Axin2, a key downstream target of β-catenin
   (**P < 0.01, ***P < 0.001, Fig. [87]1D). ABHO staining at the fracture
   site indicated that all groups facilitated chondrocyte (cartilaginous
   callus) formation at fracture ends within 7 dpf. By 14 dpf, callus
   remodeling was evident in the OVX-Decoction and OVX-Positive groups,
   accompanied by a substantial presence of apoptotic chondrocytes and
   increased osteoblast populations (Fig. [88]1E). Immunostaining for
   β-catenin revealed pronounced cytoplasmic and nuclear β-catenin
   expression in chondrocytes within the bone callus across all treatment
   groups (Fig. [89]1F). Immunofluorescence double staining for Pax7 and
   BrdU in the gastrocnemius muscle showed that early HD intervention
   enhanced Pax7 expression in skeletal muscle, indicating increased SMSC
   proliferation and enhanced repair of bone and muscle injuries
   (Fig. [90]1G). These results suggest that HD promotes healing of
   fractures by facilitating the β-catenin and regulating chondrocyte and
   osteoblast proliferation and differentiation.

Knockdown of β-catenin in SMSCs with sarcopenia

   In terms of the muscle wet weight coefficient, the TM-Vehicle group
   displayed significantly lower values compared to the Con-Vehicle group
   at 7 dpf (*P = 0.0248, ***P < 0.001). By 14 dpf, the TM-Decoction and
   TM-Positive groups showed increased muscle wet weight ratios relative
   to the TM-Vehicle group, with the TM-Decoction group demonstrating
   significantly greater effectiveness (*P = 0.0405). HD treatment
   improved muscle wet weight in β-catenin knockout conditions but did not
   surpass levels in the Con-Vehicle group, suggesting that β-catenin is a
   key signaling pathway in HD-mediated effects (Fig. [91]2A and 2B). H&E
   staining results at 7 dpf revealed larger muscle interspaces in the
   TM-Vehicle, TM-Decoction, and TM-Positive groups compared to the
   Con-Vehicle group in both cross-sectional and sagittal views.
   Conversely, muscle fibers were more compact in the Con-Vehicle group
   than in the TM groups. By 14 dpf, muscle relaxation improved in the
   TM-Decoction and TM-Positive groups, though not to the level observed
   in the Con-Vehicle group (Fig. [92]2C and 2D).

Fig. 2.

   [93]Fig. 2
   [94]Open in a new tab

   Knockdown of β-catenin in SMSCs with sarcopenia. (A) The muscle
   coefficient ratio of the four groups. (B) Statistical results of muscle
   coefficient ratio of four groups. Results are shown as mean ± SEM
   (n = 10). *P < 0.05, ***P < 0.001. (C) H&E staining of the left soleus
   muscles (cross-section). Bar, 50 μm. (D) H&E staining of the left
   soleus muscle (longitudinal section). Bar, 50 μm. (E) β-catenin
   immunohistochemical staining of the left soleus muscle of the four
   groups. The retest of the knockout efficiency of the TM group. Bar,
   50 μm. (F) Related quantitative analysis of β-catenin
   immunohistochemical staining at 7dpf. Results are shown as mean ± SEM
   (n = 10). ***P < 0.001. (G) Related quantitative analysis of β-catenin
   immunohistochemical staining at 14dpf. Results are shown as mean ± SEM
   (n = 10). ***P < 0.001. (H) Immunofluorescence staining (MyoD + BrdU)
   of the posterior tibial muscle on the model side at 7 dpf. Bar, 20 μm

   Immunohistochemical staining for β-catenin in muscle showed lower
   protein expression in the TM groups compared to the Con-Vehicle group.
   HD treatment upregulated β-catenin expression at 14 dpf, but levels
   remained significantly lower in the TM group relative to the
   Con-Vehicle group, confirming the knockdown of β-catenin
   (Fig. [95]2E–2G). Immunofluorescence staining revealed that HD
   treatment promoted the expression of MyoD and BrdU, indicating enhanced
   muscle cell proliferation and repair capacity, although the effect was
   comparable to that of the Con-Vehicle group (Fig. [96]2H and
   Supplemental Fig. [97]2A). These findings suggest that β-catenin
   knockdown in SMSCs may lead to sarcopenia.

Up-regulation of β-catenin regulates SMSCs and promotes myogenic
differentiation

   Masson's staining in horizontal and sagittal planes revealed that at 7
   dpf, collagen fiber deposition was markedly increased in the
   Con-Vehicle and TM-Positive groups compared to the TM-Vehicle and
   TM-Decoction groups. At 14 dpf, no significant differences were
   observed in horizontal plane staining results, while sagittal plane
   results displayed significantly more intense collagen staining in the
   Con-Vehicle, TM-Decoction, and TM-Positive groups. These findings
   suggested that After knocking out β-catenin, HD did not significantly
   promote the formation of collagen fibres in the muscles near the
   fracture site (Fig. [98]3A and 3B). In the tibialis posterior muscle,
   β-catenin expression was significantly reduced in the three TM groups
   compared to the Con-Vehicle group (***P < 0.001), indicating efficient
   gene knock down. At 14 dpf, β-catenin expression increased in both
   TM-Decoction and TM-Positive groups, though the TM-Decoction group
   exhibited less pronounced effects than the TM-Positive group
   (Fig. [99]3C and 3D). Detection of myogenic differentiation markers,
   MyoD1 and MEF2C, demonstrated improvements in both TM-Decoction and
   TM-Positive groups at 14 dpf, with the TM-Decoction group showing the
   most significant effects (Fig. [100]3E).

Fig. 3.

   [101]Fig. 3
   [102]Open in a new tab

   Up-regulation of β-catenin regulates SMSCs and promotes myogenic
   differentiation. (A) Masson’s staining of left soleus muscles
   (cross-section). Bar, 50 μm. (B) Masson’s staining of left soleus
   muscles (longitudinal section). Bar, 50 μm. (C) Western blot analysis
   of muscle β-catenin knockout efficiency and detection of myogenic
   differentiation indicators MEF2C and MyoD1. (D) Muscle β-catenin
   analysis of Western blot. Results are shown as mean ± SEM (n = 6).
   ***P < 0.001. (E) Myogenic differentiation analysis of Western blot.
   Results are shown as mean ± SEM (n = 6). *P < 0.05, **P < 0.01. (F)
   RT-PCR results of tibialis posterior muscle-related genes in the Pax7
   Cre^ERT2/+;β-catenin^fx/fx compound fracture model mice. Results are
   shown as mean ± SEM (n = 6). *P < 0.05, **P < 0.01, ***P < 0.001. (G)
   Immunofluorescence staining (Pax7 + Sca1) of the posterior tibial
   muscle on the model side at 7 dpf. Bar, 20 μm

   Muscle RT-PCR analysis revealed statistically significant reductions in
   β-catenin downstream targets TCF1, AXIN1, and AXIN2 in the TM group
   compared to the Con-Vehicle group (***P < 0.001). Additionally, the
   expression of myogenic-related genes MYOD1, Myogenin, and MYF5 was
   reduced in the TM group and showed no significant increase in either
   the TM-Decoction or TM-Positive groups (**P < 0.01, ***P < 0.001,
   Fig. [103]3F). Pax7, a critical molecular marker of SMSCs, exhibited
   remarkable expression increases in TM-Decoction, as observed in
   Pax7 + Sca1 and Pax7 + BrdU staining (Fig. [104]3G and Supplemental
   Fig. [105]2B-2D). These findings indicated that β-catenin played a
   crucial role in the complex modulation of SMSC proliferation and
   differentiation by HD.

Knockdown of β-catenin in SMSCs results in osteoporosis and delayed bone
healing

   At 7 dpf, X-rays revealed a clear fracture line in all groups. At 14
   dpf, the TM-Vehicle group showed no significant callus connection at
   the fracture site, while the fracture line in the Con-Vehicle group
   began to blur, and abundant callus formation was observed at the
   fracture ends. Both the TM-Decoction and TM-Positive groups exhibited
   partial improvements (Fig. [106]4A). Micro-CT analysis at 7 dpf showed
   no marked differences in 3D reconstruction images among the groups
   (Fig. [107]4B). However, quantitative analysis revealed significantly
   lower BV/TV values in the TM-Vehicle group compared to the Con-Vehicle
   group (Fig. [108]4C). At 14 dpf, 3D reconstruction images displayed
   obvious callus formation in the Con-Vehicle group, with minor
   improvements in the TM-Decoction and TM-Positive groups, though neither
   exceeded the Con-Vehicle group. Quantitative analyses demonstrated
   significantly lower BV/TV, Conn-Dens, and Tb.Th values in the
   TM-Vehicle versus the Con-Vehicle group (***P < 0.001). Differences
   between the TM-Decoction and TM-Positive groups and the TM-Vehicle
   group were statistically significant (**P < 0.01; *P < 0.05), yet
   remained below the Con-Vehicle group (Fig. [109]4D).

Fig. 4.

   [110]Fig. 4
   [111]Open in a new tab

   Knockdown of β-catenin in SMSCs results in osteoporosis and delayed
   bone healing. (A) X-ray scan of the left tibia at 7 dpf and 14 dpf. (B)
   Micro-CT 3D reconstruction at 7 dpf and 14 dpf. Bar, 1 mm. (C) Micro-CT
   quantitative analysis at 7 dpf. Results are shown as mean ± SEM
   (n = 10). *P < 0.05, **P < 0.01, ***P < 0.001. (D) Micro-CT
   quantitative analysis at 14 dpf. Results are shown as mean ± SEM
   (n = 10). *P < 0.05, **P < 0.01, ***P < 0.001. Analysis of tibial
   fracture site by H&E staining, treated for 7 dpf (E) and 14 dpf (F).
   Bar, 500 μm. Analysis of tibial fracture site by Alcian
   Blue/hematoxylin and orange G staining after treatment for 7 dpf (G)
   and 14 dpf (H). Bar, 500 μm

   H&E staining at 7 dpf showed callus formation at fracture ends in the
   Con-Vehicle, TM-Decoction, and TM-Positive groups, but no callus
   formation in the TM-Vehicle group (Fig. [112]4E). At 14 dpf, cartilage
   callus increased in the TM-Decoction and TM-Positive groups, while the
   Con-Vehicle group displayed substantial callus formation(Fig. [113]4F).
   ABHO staining at 7 dpf revealed relatively less chondrocytes formation
   in the TM-Vehicle group, while the Con-Vehicle, TM-Decoction, and
   TM-Positive groups exhibited chondrocytes proliferation at fracture
   sites (Fig. [114]4G). By 14 dpf, residual chondrocytes persisted in the
   Con-Vehicle, TM-Vehicle, and TM-Decoction groups, whereas chondrocytes
   were largely absent in the TM-Positive group, accompanied by
   substantial hard callus formation (Fig. [115]4H). H&E and ABHO
   pathological staining demonstrated that β-catenin knockdown in SMSCs
   caused significant delays in callus formation, cartilage development,
   and osteogenesis. These findings suggested that β-catenin knockdown in
   SMSCs could result in osteoporosis and delayed bone healing.
   Concomitantly, unlike observations in OVX mice, HD failed to
   significantly potentiate osteoporotic fracture healing upon β-catenin
   knockdown in SMSCs. This inverse evidence indicates that HD likely
   mediates its pro-healing effects in osteoporosis through
   β-catenin-dependent mechanisms.

Up-regulation of β-catenin controls the osteogenic differentiation of SMSCs
and enhances the recovery of OPF

   Safranin-fixed Green staining revealed a significant increase in
   cartilage formation in the TM-Decoction and TM-Positive groups at 14
   dpf. Meanwhile, cartilage was also observed in the Con-Vehicle group,
   but no significant cartilage was formed in the TM-Vehicle group
   (Fig. [116]5A). Immunohistochemical staining for osteoprotegerin (OPG)
   demonstrated visible callus areas and remarkable OPG-positive staining
   in the cytoplasm of the Con-Vehicle group at 7 dpf, significantly
   differing from the TM-Vehicle, TM-Decoction, and TM-Positive groups
   (***P < 0.001; Fig. [117]5B and 5C). By 14 dpf, the TM-Decoction and
   TM-Positive groups exhibited notably higher OPG levels comparing with
   the TM-Vehicle group (***P < 0.001; Fig. [118]5C).

Fig. 5.

   [119]Fig. 5
   [120]Open in a new tab

   Up-regulation of β-catenin regulates osteogenic differentiation of
   SMSCs and promotes healing of OPF. (A) Analysis of tibial fracture site
   by Safranin-fixed green staining, treated for 7 dpf and 14 dpf. Bar,
   500 μm. (B) Immunohistochemical OPG staining of the fracture sites in
   each group at 7 dpf and 14 dpf. Bar, 50 μm. (C) Immunohistochemical OPG
   staining quantitative analysis at 7 dpf and 14 dpf. Results are shown
   as mean ± SEM (n = 10). *P < 0.05, **P < 0.01, ***P < 0.001. (D)
   Immunofluorescence staining of tibial fracture site (Pax7 + Sca1) at 14
   dpf. Bar, 50 μm. (E) Immunofluorescence staining of tibial fracture
   site (Pax7 + BrdU) at 14 dpf. Bar, 50 μm. (F) Immunofluorescence
   staining analysis at 14 dpf. Results are shown as mean ± SEM (n = 6).
   ***P < 0.001

   Double immunofluorescence staining revealed co-expression of Pax7 and
   Sca1 at tibial injury sites, suggesting that HD promoted SMSC
   expression by 14 dpf. In the TM-Vehicle group, only Pax7 expression was
   observed, indicating that HD upregulated SMSCs in damaged muscles at
   the early stage, though not surpassing the Con-Vehicle group
   (Fig. [121]5D). Additionally, Pax7 and BrdU double staining showed that
   HD significantly enhanced SMSC proliferation at 14 dpf compared to the
   TM-Vehicle group, achieving similar effects to the Con-Vehicle group
   (***P < 0.001; Fig. [122]5E-5F). These findings suggested that
   β-catenin is a critical signaling pathway through which HD treatment
   promotes SMSC growth and division in OPF, although other potential
   pathways may also contribute and require further investigation.

Active compound analysis by herbal decoction

   Active compound analysis of HD was conducted using HPLC-Q-TOF,
   producing ion chromatograms in negative (Fig. [123]6A) and positive
   modes (Fig. [124]6B). The analysis identified 44 peaks, of which 27
   compounds were confirmed by comparison with standard compounds, while
   17 were preliminarily identified (Table [125]2). Key compounds
   included:
     * Salvia Miltiorrhiza: Caffeic acid 3-O-β-D-glucoside, Salvianolic
       acid B, and 15 others.
     * Epimedium Brevicornum: Icariin, Magnoflorine, and 11 others.
     * Angelica Pubescens F. Biserrata: Osthole, Angenomalin, and 7
       others.
     * Codonopsis Pilosula: Codonopsine, Chlorogenic acid, and 3 others.
     * Rhizoma Drynariae: Naringin, Neoeriocitrin, and 1 other.
     * Acanthopanax Senticosus: Eleutheroside B2, Eleutheroside E.

Fig. 6.

   [126]Fig. 6
   [127]Open in a new tab

   UPLC-Q-TOF/MS analysis of HD ingredients. (A) Representative ion
   chromatogram of ISTK in the negative mode. (B) Representative ion
   chromatogram of HD in the positive mode. (C) Hotspot maps of active
   compounds in orthopedic-related diseases were analyzed through the
   Pubmed search engine until March 2023

Table 2.

   The mass information and source of identified compounds in herbal
   decoction by high-performance liquid chromatogAPBhy quadrupole
   time-of-flight mass spectrometry (HPLC–Q-TOF)
   No Identification Formula Mass Rt(min) Error(ppm) Classification
   1 Uridine* C9H12N2O6 244.07 3.00 1.1 /
   2 cGMP C10H12N5O7P 345.05 4.34 1.4 /
   3 Adenosine* C10H13N5O4 267.10 4.70 − 3.2 /
   4 Guanosine* C10H13N5O5 283.09 6.91 0.8 /
   5 Danshensu* C9H10O5 198.05 8.86 0.9 SM
   6 Codonopsine C14H21NO4 267.15 9.41 1.3 CP
   7 Protocatechuicacid-3-O-glucoside C13H16O9 316.08 9.43 1.5 SM
   8 3,4-Dihydroxybenzaldehyde* C7H6O3 138.03 10.28 0.8 EB、SM、AS
   9 Neochlorogenic acid* C16H18O9 354.10 10.66 2.0 CP、EB
   10 Caffeic acid 3-O-β-D-glucoside C15H18O9 342.10 11.00 3.9 SM、DF
   11 Eleutheroside B2 C23H30O14 530.16 11.43 2.5 AS
   12 Chlorogenic acid* C16H18O9 354.10 12.31 3.4 CP、EB
   13 Syringin* C17H24O9 372.14 12.39 1.6 CP、AS
   14 Cryptochlorogenic acid* C16H18O9 354.10 12.80 2.6 CP、EB
   15 Magnoflorine* C20H24NO4 +  342.17 14.82 − 0.3 EB
   16 Eleutheroside E* C34H46O18 742.27 17.45 1.8 AS
   17 Neoeriocitrin* C27H32O15 596.17 18.78 3.5 DF
   18 Nodakenin* C20H24O9 408.14 20.36 3.1 APB
   19 Salvianolic acid I C27H22O12 538.11 20.40 2.2 SM
   20 Naringin* C27H32O14 580.18 20.98 4.5 DF
   21 Rosmarinic acid* C18H16O8 360.08 22.28 3.6 SM
   22 Salvianolic acid E* C36H30O16 718.15 22.28 1.7 SM
   23 Lithospermic acid* C27H22O12 538.11 23.19 1.3 SM
   24 Salvianolic acid B* C36H30O16 718.15 24.71 2.5 SM
   25 Salvianolic acid Y* C36H30O16 718.15 26.38 2.9 SM
   26 Epimedin A C39H50O20 838.29 27.97 0.4 EB
   27 Epimedin B C38H48O19 808.28 28.37 2.9 EB
   28 Epimedin C* C39H50O19 822.29 28.82 1.8 EB
   29 Icariin* C33H40O15 676.24 29.13 3.9 EB
   30 Angelol A* C20H24O7 376.15 30.40 4.5 APB
   31 Angelol C C20H26O7 378.17 30.84 0.1 APB
   32 Angelol E C20H26O7 378.17 31.14 0.1 APB
   33 Anhydroicaritin-3-O-rhamnodide(1–2)-furanacid-7-O-glucoside
   C39H48O19 820.28 31.53 3.0 EB
   34 Angelol B C20H24O7 376.15 31.94 1.1 APB
   35 Angelol D C20H24O7 376.15 32.58 0.0 APB
   36 Angelol F C20H26O7 378.17 32.91 0.7 APB
   37 Angenomalin C14H12O3 228.08 36.25 − 1.5 APB
   38 Baohuoside I* C27H30O10 514.18 38.28 3.9 EB
   39 3-Hydroxytanshinone IIB C19H18O5 326.12 38.73 − 2.5 SM
   40 Isocryptotanshinone* C19H20O3 296.14 39.21 0.5 SM
   41 Osthole* C15H16O3 244.11 39.69 − 3.4 APB
   42 Cryptotanshinone C19H20O3 296.14 40.84 0.5 SM
   43 Tanshinone I* C18H12O3 276.08 40.93 − 1.6 SM
   44 Tanshinone II A* C19H18O3 294.13 42.16 0.0 SM
   [128]Open in a new tab

   ^*Identified with the reference compounds. CP: Codonopsis Pilosula. DF:
   Drynaria Fortunei. AS: Acanthopanax Senticosus. EB:
   Epimedium Brevicornum. SM: Salvia Miltiorrhiza.
   APB:Angelica Pubescens F. Biserrata

   A PubMed literature review (March 2023) revealed extensive
   documentation of these compounds in bone-related research, particularly
   Icariin (308 articles), followed by Naringin (138), Chlorogenic acid
   (62), Osthole (51), and Salvianolic acid B (46). These findings
   emphasized the relevance of HD's active components in bone healing
   (Fig. [129]6C).

Pharmacological analysis and target identification

   Web-based pharmacological analysis identified:
     * Codonopsis Pilosula: 17 components.
     * Drynaria Fortunei: 15 components.
     * Epimedium Brevicornum: 23 components.
     * Salvia Miltiorrhiza: 59 components.
     * Acanthopanax Senticosus: 17 components.
     * Angelica Pubescens F. Biserrata: 50 components.

   GeneCards and OMIM databases identified 889 osteoporotic
   fracture-related targets. After de-duplication, 143 intersecting
   drug-osteoporotic fracture targets were identified (Fig. [130]7A). A
   drug-ingredient-target network with 283 nodes and 1,084 edges
   highlighted quercetin, luteolin, kaempferol, ursolic acid, and
   beta-sitosterol as core ingredients (Fig. [131]7B). Protein–protein
   interaction networks revealed IL6, AKT1, STAT3, TNF, TP53, IL1B, EGFR,
   INS, SRC, and NFKB1 as core targets (Fig. [132]7C).

Fig. 7.

   [133]Fig. 7
   [134]Open in a new tab

   Network pharmacology analysis. (A)Venn diagram, after taking the
   intersection of the target of action of the drug with the target genes
   of OPF, 143 intersecting target genes of OPF and the drug were obtained
   as the interacting target genes for the drug treatment of OPF. (B)
   Drug-ingredient-target prediction results. Using the
   drug-ingredient-target data, and importing the files into Cytoscape
   3.9.1 for graphing, the graph includes 283 nodes and 1084 edges. (C)
   The obtained 143 intersecting target genes were imported into the
   String ([135]https://string-db.org/) database for protein–protein
   interaction prediction, with the species set to HomoSapiens and the
   confidence level set to 0.7. The network file was saved in TSV format,
   and the TSV file was imported into Cytoscape 3.7.2 software to draw the
   protein interaction network. (D) GO enrichment analysis. Drug-disease
   intersection genes were taken and GO gene function enrichment analysis
   was performed using the DAVID database, and a total of 638 GO entries
   were screened, with P < 0.01 as the standard screening. (E) 503
   biological process (BP) major entries were significantly enriched for
   HD treatment of OPF; 48 entries were related to cellular components
   (CC); and 87 entries were related to molecular function (MF). (F) KEGG
   pathway enrichment analysis. (G) Pathway enrichment analysis was
   performed using the DAVID database, and a total of 172 pathways related
   to HD for osteoporotic fracture were enriched, and 150 pathways related
   to HD and treatment of osteoporotic fracture were screened according to
   **P < 0.01

GO and pathway enrichment analysis

   GO gene function enrichment identified 638 entries (P < 0.01):
     * Biological Processes (503): Positive regulation of gene expression,
       signaling, apoptotic processes, and inflammatory responses.
     * Cellular Components (48): Nucleus, cytoplasm, extracellular
       exocytosis, chromatin.
     * Molecular Functions (87): Protein binding, DNA-binding
       transcription factor activity, cytokine activity (Fig. [136]7D and
       7E).

   Pathway enrichment analysis identified 172 pathways (P < 0.01), with
   150 significantly associated with osteoporotic fractures, including
   IL-17, tumor necrosis factor, PI3K-Akt, osteoclast differentiation,
   MAPK, Toll-like receptor, and neurotrophic factor signaling pathways
   (Fig. [137]7F and 7G).

Discussion

   This study demonstrated that HD prevented the significant reduction in
   bone volume and deterioration of bone microarchitecture in
   Pax7-Cre^ERT2/+;β-catenin^fx/fx cKO mice. HD modulated the β-catenin
   signaling pathway, promoted the migration of SMSCs to the fracture
   site, enhanced their differentiation into osteoblasts, and stimulated
   the activation of chondrocytes and osteoblasts at the OPF site.
   Additionally, HD improved spleen and stomach function, enhancing
   compound absorption, and facilitated the repair of surrounding muscles
   at the fracture site, collectively accelerating OPF healing.
   Interestingly, β-catenin knockout in SMSCs resulted in sarcopenia and
   osteopenia. HD stimulation improved fracture healing and remodeling of
   skeletal muscle fibers, indicating that HD regulated SMSCs to play a
   critical role in β-catenin-mediated osteosarcopenia fracture healing
   (Fig. [138]8).

Fig. 8.

   [139]Fig. 8
   [140]Open in a new tab

   Herbal compounds regulate skeletal muscle satellite cells and play a
   vital role in the healing of osteoporotic fractures mediated by
   β-catenin. When β-catenin is knocked out in SMSCs, sarcopenia and
   osteopenia are observed. Conversely, when β-catenin is promoted by HD,
   it promotes fracture healing and skeletal muscle fiber remodeling

   Unlike previous research focused primarily on bone-specific mechanisms,
   this study emphasized the muscle changes surrounding fractures and
   found that HD not only promoted fracture healing by regulating
   osteogenesis and myogenesis of SMSCs through the β-catenin signaling
   pathway but also improved sarcopenia. This dual regulation of muscle
   and bone contributes to more efficient healing. Previous studies
   highlighted the significant potential of medicinal plants in
   osteoporosis prevention and treatment by regulating programmed cell
   death [[141]25], underscoring their role as complementary and
   alternative therapies with reduced costs, minimal side effects, and
   broader applications. The specific composition and efficacy of HD
   further substantiate this potential.

   For example, Icariin regulated osteogenesis and lipogenesis in stem
   cells through miR-23a-mediated pathway activation of Wnt/β-catenin,
   promoting osteogenesis while inhibiting lipogenesis [[142]26].
   Naringin@mesoporous bioactive glass nanoparticles (MBG) modified with
   β-cyclodextrin (CD-MBG) enhanced the transformation of macrophages to
   the M2 phenotype, creating an immune microenvironment conducive to
   osteogenesis while suppressing osteoclastogenesis [[143]27].
   Chlorogenic acid, identified as a potent inhibitor of Integrin-Binding
   Sialoprotein-receptor binding, effectively suppressed bone metastasis
   of estrogen-positive tumors, indicating its potential in preventing
   bone recurrence in such patients [[144]28]. Additionally, our team
   previously demonstrated that Osthole mitigated osteoclast formation by
   stimulating β-catenin-OPG signaling activation [[145]29]. Studies have
   also shown that SMSCs mediate osteoporotic fracture healing via
   β-catenin regulation, highlighting their therapeutic potential
   [[146]17].

   Moreover, Salvianolic acid B, encapsulated in hydrogel alongside bone
   marrow mesenchymal stem cells, significantly delayed disc degeneration
   [[147]30]. Rosmarinic acid enhanced osteoblast differentiation,
   mineralization, and bone formation on titanium surfaces through the
   RANKL/RANK/OPG pathway [[148]31, [149]32]. Combined treatment of
   Cryptotanshinone with Temsirolimus suppressed JAK/STAT, MAPK/ERK, and
   PI3K/Akt/mTOR pathways, inducing tumor cell apoptosis, and effectively
   combating osteosarcoma [[150]33]. Danshensu demonstrated
   anti-osteogenic effects by suppressing JNK and ERK pathways, while also
   exhibiting significant anti-inflammatory properties [[151]34, [152]35].

   In contrast to previous research, this study is the first to use
   conditional knockout mice to assess the role of the traditional herbal
   remedy compound and elucidate its underlying mechanisms. The
   intervention with HD showed improved OPF healing in the TM-Decoction
   group; however, the results were not comparable to those observed in
   the Con-Vehicle group. This finding suggests that HD facilitates
   fracture healing through the β-catenin pathway and potentially other
   cellular mechanisms. Multiple studies have indicated that miR-122
   hinders the proliferation and differentiation of osteoblasts in
   osteoporotic rats [[153]36]. Bone morphogenetic proteins (BMPs)
   regulate normal satellite cell activity, balancing proliferation and
   differentiation before the activation of Noggin, which counteracts BMPs
   and promotes terminal differentiation [[154]37, [155]38]. Additionally,
   it has been shown that ARC may inhibit osteoclastogenesis by inhibiting
   receptor activator of nuclear factor-κB ligand (RANKL), calcium
   signaling, and NFATc1. It also increases the activity of reactive
   oxygen species (ROS) enzymes via the Nrf2/Keap1/antioxidant response
   element pathway [[156]39, [157]40]. Genetic disruption of Jagged-1/2
   ligands and the Rbpj transcription factor within alpha Smooth Muscle
   Actin (αSMA)-expressing osteoblast progenitors revealed that
   Jagged-mediated Notch signaling in this lineage is essential for
   BMP-induced calvarial bone regeneration, as its inhibition impaired
   osteoblast progenitor expansion, reduced vascularization, and caused
   sustained inflammation [[158]41]. And losartan treatment significantly
   improves bone morphology in OI mouse models by reducing Transforming
   Growth Factor β (TGFβ) levels, suppressing osteoclast activity, and
   increasing cortical and trabecular bone volume [[159]42].

   The accumulation of ROS in bone tissues due to oxidative stress
   associated with aging accelerates the senescence and impaired function
   of osteoblasts [[160]43]. Furthermore, signaling pathways involving
   nuclear factor-kappa B, mitogen-activated protein kinases [[161]44],
   protein kinase B [[162]45], vitamin D [[163]46], and the special
   AT-rich sequence-binding protein 2 (SATB2) [[164]47], have been shown
   to facilitate the healing of osteoporotic fractures. Oxidative stress
   and inflammation also contribute to bone fracture healing [[165]48],
   warranting further investigation.

   Future studies should explore whether HD modulates the osteogenic
   differentiation of SMSCs through other critical osteogenic signaling
   pathways, such as BMPs, Smad4, and c-Jun. Additionally, follow-up
   studies to clarify the pharmacokinetics of HD are needed to establish
   clinical application guidelines. Given the numerous components
   identified within HD, optimizing the compound's composition ratio is
   essential. Future investigations should also include an analysis of
   additional signaling pathways using network pharmacology.

   In summary, treatment with HD significantly improved the muscle wet
   weight coefficient in the osteosarcopenia futures model of
   Pax7-Cre^ERT2/+; β-catenin ^fx/fx cKO mice. It enhanced muscle firmness
   and facilitated the formation of collagen fibers near fracture sites.
   Furthermore, HD stimulated the proliferative activity of SMSCs,
   promoting callus formation and accelerating fracture healing. These
   findings provide the first evidence that the HD, as a β-catenin
   agonist, not only promotes fracture healing by modulating the
   osteogenic and myogenic effects of SMSCs but also ameliorates
   sarcopenia. This study offers practical evidence supporting the formula
   as a promising therapeutic candidate for treating osteosarcopenic
   fractures.

Supplementary Information

   [166]Additional file1 (PDF 3600 KB)^ (3.5MB, pdf)

Acknowledgements