Abstract Currently, the therapy of intervertebral disc degeneration (IDD) mostly focuses on basic molecular causes. Research on the alterations of metabolites in the intervertebral disc prior to and following intervertebral disc degeneration (IDD) remains inadequate, with even less therapeutic options available for metabolites. In contrast to traditional investigations of molecular mechanisms, it has been shown that a reciprocal relationship exists between the nutritional metabolism of the intervertebral disc and the molecular mechanisms of degeneration. Impaired energy metabolism in deteriorated nucleus pulposus cells exacerbates numerous degenerative phenotypes within the cells. This work investigated the metabolic alterations in the intervertebral disc after the creation of inflammatory degeneration models and illustrated the therapeutic benefits of α-ketoglutarate (AKG) on degenerated nucleus pulposus cells. This study introduces the first demonstration of a metal-organic framework (MOF)-based delivery system (Mn-MIL-100@AKG) for α-ketoglutarate (AKG) aimed at treating intervertebral disc degeneration (IDD), revealing a unique mode of mitophagy control through the HIF-1α-BNIP3-LC3B axis. Our study elucidated the critical function of autophagy regulation via the HIF-1α-BNIP3-LC3B axis in mitigating NPC degeneration and established a MOF-based AKG drug delivery system, offering a novel approach for the treatment of IDD. Graphical abstract [39]Image 1 [40]Open in a new tab Highlights * • The research on the anti-aging effect of AKG has been broadened and the important role of AKG in IDD has been identified. * • First MOF-based delivery system for AKG in IDD treatment. * • AKG rescues metabolic dysfunction via HIF-1α-BNIP3-LC3B axis. * • Orthotopic injection addresses the limitations of conventional delivery methods. 1. Introduction Intervertebral disc degeneration (IDD) is a prevalent musculoskeletal degenerative disorder and a primary contributor to chronic lower back pain, significantly diminishing patients' quality of life and imposing substantial economic burdens on society [[41]1]. Seventy percent of adults will encounter lower back discomfort at least once in their lives, with severe instances perhaps resulting in impaired mobility [[42]2,[43]3]. The threat posed by IDD to quality of life and the depletion of social medical resources is significant. The pathogenesis of intervertebral disc degeneration (IDD) is influenced by a multitude of intricate factors, encompassing genetic, epigenetic, and environmental elements, with the corresponding molecular pathways remaining incompletely elucidated [[44]4]. α-Ketoglutarate serves as a crucial step in the tricarboxylic acid cycle [[45]5]. As the α-keto acid of glutamate, it is essential to amino acid metabolism and serves as a vital ligand for transaminase activities. It directly or indirectly facilitates a range of catabolic and anabolic pathways [[46]5,[47]6]. It prolongs the lifespan of short-lived organisms by inhibiting ATP synthase and TOR [[48]7]. Furthermore, the administration of exogenous α-ketoglutarate enhances the survival rate of mice and postpones aging [[49]8], establishing a theoretical foundation for the critical connection between α-ketoglutarate, aging, and inflammation. Consequently, we investigated the possible functions of AKG in the management of IDD. In the last twenty years, metal-organic framework (MOF) materials have been extensively utilized as multifunctional catalysts across several domains, particularly in biomedical research [[50]9,[51]10]. Owing to their substantial adsorption capacity, actively developed porous surfaces, and propensity for facile functionalization with pH and ion sensitivity, MOF materials have been extensively selected by researchers as delivery agents, significantly augmenting the therapeutic efficacy of drug molecules at targeted sites [[52]11,[53]12]. This study examined the critical function of AKG in the metabolic processes of NPCs and identified the significance of the HIF-1α-BNIP3-LC3B axis, mediated by AKG, in the regulation of mitochondrial activity in NP cells. Consequently, we synthesized Mn-MIL-100@AKG, which comprises Mn[2]O[7] and benzene-1,3,5-tricarboxylic acid (BTC). Molecular and cellular tests indicated that it can successfully mitigate the senescence and degeneration phenotype of NP cells and diminish oxidative stress. We consistently noticed a decrease in tissue inflammation and regenerative healing of the intervertebral disk. Consequently, Mn-MIL-100@AKG may offer a novel approach for the management of IDD. 2. Methods * 1. Cell Culture Nucleus pulposus (NP) tissues were extracted and divided into fragments within sterile containers. The tissues were then exposed to enzymatic digestion in 0.2 % Type II collagenase for 4 h. After two washing with phosphate-buffered saline (PBS) and subsequent centrifugation, the pellet was resuspended in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) enriched with 15 % fetal bovine serum (HYCEZMBIO) and incubated in a 5 % CO2 atmosphere at 37 °C. The medium was changed every three days. In the static pressure model, as previously described, NP cells were cultured in plates and placed in a pressure apparatus within a humidified environment at 37 °C. Mixed air (0.5 % CO2 and 99.5 % compressed air) was supplied into the apparatus, which can attain a static pressure of 1.0 MPa. * 2. Cell Viability NPCs were cultivated in six-well plates overnight and then exposed to various treatments for another overnight duration. A live and dead cell assay kit (Proteintech, China, PF00007), comprising calcein AM/PI, was employed following the manufacturer's guidelines. The cells were incubated in darkness at 37 °C for 30 min. Ultimately, they were analyzed utilizing a fluorescence microscope. NPCs were injected at a density of 8 × 10^3 cells per well in 96-well plates. After several treatments, a CCK8 (Beyotime, China) working solution was prepared by mixing CCK8 solution with serum-free medium in a 1:9 ratio, according to the manufacturer's guidelines, and incubated with the cells in the dark at 37 °C for 2 h. The absorbance at 450 nm was measured. * 3. Metabolomic Profiling Nucleus pulposus tissues (n = 3/group) were homogenized in 500 μL of a methanol:water:chloroform mixture (2:1:1, v/v) utilizing a Precellys 24 homogenizer (Bertin Technologies). Subsequent to centrifugation (14,000×g, 10 min, 4 °C), the supernatant was subjected to vacuum drying and subsequently reconstituted in 100 μL of 50 % methanol with 0.1 % formic acid. LC-MS analysis was conducted using a Q Exactive HF-X Hybrid Quadrupole-Orbitrap Mass Spectrometer (Thermo Scientific) in conjunction with a Vanquish UPLC system. Chromatographic separation was accomplished utilizing an ACQUITY UPLC BEH C18 column (1.7 μm, 2.1 × 100 mm) with a gradient of 0.1 % formic acid (A) and acetonitrile (B) at a flow rate of 0.3 mL/min. Mass spectrometry data were obtained in full scan mode (m/z 50–1500) with positive/negative ion switching. Raw data were analyzed with Compound Discoverer 3.1 (Thermo), and metabolites were identified against HMDB with a mass tolerance of 5 ppm. Multivariate analysis (PLS-DA) and pathway enrichment were performed using MetaboAnalyst 5.0. * 4. Immunofluorescence and Mitochondrial Staining and Quantification of mitochondrial mean branch length NP cells grown in 12-well plates were fixed using 4 % paraformaldehyde for 30 min and subsequently permeabilized with Triton X-100 (0.2 %, 30 min). The samples underwent two washes in PBS and were subsequently blocked with 2 % goat serum for 1 h. The samples were subsequently treated with the primary antibody overnight, followed by incubation with a secondary antibody conjugated to FITC or Cy3. Following the labeling of cell nuclei with DAPI (0.1 g/ml for 5 min), fluorescence pictures were obtained using either a fluorescence microscope (Olympus, BX53) or a confocal microscope (Nikon A1R SI Confocal, Japan). NP cells cultivated in 12-well plates were extracted from the cell culture medium and treated with pre-warmed Mito-Tracker Green staining solution at 37 °C for 15–45 min. Following the removal of the Mito-Tracker Green staining solution, pre-warmed new cell culture media was introduced. The cells were subsequently examined utilizing a fluorescence microscope or a laser confocal microscope. Quantification of mitochondrial mean branch length was performed using the Mitochondria Analyzer plugin (v1.5) in Fiji. Confocal microscopy-derived 16-bit TIFF images were spatially calibrated (μm/pixel ratio) and background-subtracted (rolling ball radius: 50 pixels) prior to binarization with adaptive thresholding (Niblack or Phansalkar algorithm; window size = 15, SD factor = 0.5 – parameters optimized for tubular structure preservation). Mitochondrial networks were skeletonized after excluding fragments <0.05 μm^2, with branch length analysis incorporating pruning of short branches (cutoff: 0.2 μm) to minimize noise. All branch lengths were exported to CSV files, and topological accuracy was validated via skeleton overlay. Mean Branch Length (MBL) was calculated from ≥30 cells per group across 3 independent replicates using Python's SciPy library, presented as mean ± SEM. * 5. Western Blot (WB) For protein extraction, cells were subjected to RIPA buffer supplemented with the protease inhibitor PMSF (Beyotime). The isolated proteins underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and were subsequently transferred to a PVDF membrane. The strips were obstructed with 5 % skim milk and subsequently incubated with the primary antibody overnight. The primary antibodies employed are: COL2A1 (1:1000), MMP3 (1:1000), TNF-α (1:1000), p53 (1:1000), p16 (1:1000), HIF-1α (1:1000), BNIP3 (1:1000), Bcl-2 (1:1000), LC3B (1:1000), and GAPDH (1:1000). Following washing with the solution, the strips were incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies (Proteintech) and subsequently detected using a chemiluminescence system. Band intensities were quantified utilizing ImageJ 1.8 software (National Institutes of Health, USA). * 6. RNA Extraction and RT-PCR Total RNA was extracted from cultivated cells using TRIzol reagent (Invitrogen) for reverse transcription and RT-qPCR, following the manufacturer's guidelines. The primers utilized for RT-qPCR are as follows: Human-MMP3: CACTCACAGACCTGACTCGGTT AAGCAGGATCACAGTTGGCTGG Human-COL2A1: CCTGGCAAAGATGGTGAGACAG CCTGGTTTTCCACCTTCACCTG Human-β-Actin: CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT Human-CDNK2A: GCCCAACGCACCGAATAGTT GCTGTAACTGGAGCCGAAGT Human-BNIP3: CAGGGCTCCTGGGTAGAACT CTACTCCGTCCAGACTCATGC Human-ATG7: CAGTTTGCCCCTTTTAGTAGTGC CCAGCCGATACTCGTTCAGC Human-ACAN: CAGTGAGACGTCCGCCTATC GGTACTTGTTCCAGCCCTCC Human-HIF-1α: GAACGTCGAAAAGAAAAGTCTCG CCTTATCAAGATGCGAACTCACA Human-LC3B: CCGCACCTTCGAACAAAGAG TCTCCTGGGAGGCATAGACC Human-TP53: GAGGTTGGCTCTGACTGTACC TCCGTCCCAGTAGATTACCAC Human-TNF-α: GTGCTTGTTCCTCAGCCTCT CACCCTTCTCCAGCTGGAAG Human-BCL2: ACAGGGTACGATAACCGGGA CATCCCAGCCTCCGTTATCC * 7. Reactive oxygen species (ROS) scavenging efficiency in mitochondria and cells NPCs were inoculated at a density of 8 × 10^^3 cells per well in 96-well plates. Upon full cell attachment, the cells were exposed to H2O2 (120 mM) for 30 min, thereafter treated with PBS, MOF, AKG, and MOF-MIL-100@AKG, and incubated for 12 h. DCFH-DA (Beyotime, China) and Mito-Sox (Yeasen Biotechnology, China) were utilized to assess cellular ROS (cROS) and mitochondrial ROS (mROS) following the manufacturer's protocol, incubated in the dark at 37 °C for 20 min, and subsequently washed three times with PBS to eliminate excess dye. The cells were subsequently examined using an inverted fluorescent microscope (Carl Zeiss, USA). * 8. Senescence-associated GLB1/β-galactosidase (SA-GLB1/β-gal) staining The Senescence β-galactosidase staining kit (Beyotime, C0602) or fluorescein di(β-D-galactopyranoside) (FDG; MedChemExpress, HY-101895) was utilized to stain SA-GLB1. The cells on the plate were rinsed with PBS (Thermo Fisher Scientific 10,010,023) and subsequently fixed with β-galactosidase staining fixative at ambient temperature for 15 min. Following the application of the cell fixative, the cells were washed with PBS three times, each for a length of 5 min. The cells in each well were subjected to the staining working solution at 37 °C without CO2 for 12 h. An inverted phase-contrast optical microscope (Olympus, Japan) was employed for observation. An aliquot of reaction buffer was added to each well for the fluorescence staining of SA-GLB1. Thereafter, 2 mM FDG was introduced to each well, and the plate was maintained in darkness at 37 °C for 24 h without CO2 enrichment. Images were acquired and examined utilizing a fluorescence microscope (Olympus, Japan). All experiments were conducted a minimum of three times. * 9. RNA extraction, sequencing, and analysis Total RNA was extracted from NPC using TRIzol reagent (Thermo Fisher Scientific 15,596,026). The A260/A280 absorbance ratio and RNA Integrity Number (RIN) of RNA samples were evaluated using the Nanodrop ND-2000 (Thermo Fisher Scientific, USA) and the Agilent Bioanalyzer 4150 (Agilent Technologies, USA). The PE library was created using the mRNA-sequencing Library Preparation Kit (ABclonal, RK20350). mRNA was extracted from 1 μg of total RNA using oligo(dT) magnetic beads and subsequently fragmented in the first strand synthesis reaction buffer. Subsequently, using the mRNA fragment as a template, the first strand of cDNA was synthesized with random primers and reverse transcriptase (RNase H), followed by the production of the second strand of cDNA employing DNA polymerase I, RNase H, buffer, and dNTPs. Synthetic double-stranded cDNA fragments were ligated with adaptor sequences for polymerase chain reaction amplification. Subsequent to the purification of PCR products, the Agilent Bioanalyzer 4150 was utilized to assess library quality. The NovaSeq 6000 sequencing platform (Illumina, USA) was utilized for sequencing with paired-end 150 bp reads. The Illumina platform generated data that were employed for bioinformatics analysis. * 10. Animal Experiments Male Sprague-Dawley rats, aged 6 weeks, were acquired from Hunan Slyk Jingda Laboratory Animal Co., Ltd. The intervertebral disc injection animal model study protocol received permission from the Institutional Animal Care and Use Committee (IACUC) at Huazhong University of Science and Technology, Tongji Medical College (approval number: 4084). This research was performed in compliance with the principles of the Declaration of Helsinki. Prior to the implementation of the IDD model, Sprague-Dawley rats (6 weeks old, 450–500g) were sedated via intraperitoneal injection of 50 mg/kg pentobarbital. The rats' caudal area was verified using palpation, and the tail vertebrae were identified using experimental X-ray radiography. Subsequently, the tail vertebrae were disinfected with povidone-iodine, and an equivalent volume of the experimental substance was administered into the 2nd and 4th intervertebral discs of the tail using a No. 7 needle. The rats were euthanized using carbon dioxide anesthesia four weeks later, and the tail intervertebral disc tissues were harvested. Histological investigation was conducted with an H&E staining kit and a safranin O & quick green staining kit. * 11. X-ray and MRI Rats underwent X-ray evaluation utilizing an in vivo MS FX PRO imaging system (Bruker). The intervertebral disc height was quantified utilizing ImageJ 1.8 software, and the disc height index (DHI) was computed as previously outlined. Alterations in DHI were employed to evaluate intervertebral disc degeneration and were computed utilizing the subsequent formula: DHI percentage equals DHI post divided by DHI pre, multiplied by 100 %. DHI post refers to the DHI following surgery, while DHI pre denotes the DHI preceding surgery. Furthermore, magnetic resonance imaging (MRI) was conducted with a BRUKER BioSpec system, and the intervertebral disc signal was evaluated by sagittal T2-weighted images, reflecting alterations in water content. The severity of intervertebral disc degeneration was evaluated utilizing the Pfirrmann grading system based on T2-weighted slice images, as previously outlined. * 12. Synthesis of Mn-MIL-100@AKG The synthesis of Mn-MIL-100 involved the reaction of a high-valent manganese precursor (Mn2O7) with benzene-1,3,5-tricarboxylic acid (BTC) in a solvent mixture comprising dimethylformamide (DMF), deionized water, and ethanol. Mn2O7 and BTC were initially dissolved in the solvent system and agitated until fully dissolved. The mixture was heated to 60 °C to promote dissolution, if required. The solution was subsequently combined, and the pH was calibrated to 6–7. The solution was then placed in a high-temperature, high-pressure reaction vessel, heated to 150 °C, and allowed to react for 24 h. After the reaction concluded, the product was allowed to cool to ambient temperature, thereafter undergoing separation using vacuum filtration. The resultant material was thoroughly cleaned with deionized water and ethanol to eliminate unreacted metal salts and solvents. The product was subsequently dried at 80 °C for 12 h to guarantee the total elimination of solvent and water. Activation of Mn-MIL-100: The Mn-MIL-100 sample was subjected to activation by being placed in a vacuum drying oven at 120 °C for 12 h, with a nitrogen flow to avert any interaction with ambient moisture. Composite Preparation: An α-ketoglutaric acid solution was formulated and subsequently combined with the activated Mn-MIL-100. The mixture was permitted to react at temperatures between 25 °C and 40 °C for 24 h, ensuring consistent loading of α-ketoglutaric acid onto the MOF. Post-reaction, the composite material was isolated via centrifugation or vacuum filtration and extensively rinsed many times with deionized water or ethanol to eliminate residual solvents and unreacted components. The washed composite was subsequently dried in a vacuum oven at 40 °C for 12 h in a nitrogen atmosphere to guarantee the total elimination of solvent and water. The morphology of MOF-MIL-100@AKG is examined using a high-resolution field emission scanning electron microscope (Zeiss, Sigma 300, Germany). The positions, quantities, and intensities of the diffraction peaks were measured utilizing an X-ray diffractometer (Rigaku SmartLab SE, Japan). * 13. Calculation of Drug Loading A specified mass of the drug carrier complex MOF-MIL-100@AKG was measured and deposited into sealed storage vials. One hundred milliliters of ethanol was introduced into each vial, thereafter subjected to sonication for 40 min. Following sonication, the mixes were permitted to settle. A 10 mL volume of the supernatant was subsequently extracted and filtered using a 0.22 μm polyethersulfone (PES) syringe filter. The central portion of the filtrate was gathered. The filtrate's absorbance was quantified at 254 nm utilizing a UV–Vis spectrophotometer (UV-1800PC, Shanghai Mapada Instruments Co., Ltd.). The ibuprofen concentration in the liquid and the medication loading were determined using a previously established standard curve and the subsequent equation: [MATH: N=(mamb)∗100% :MATH] Where: N represents the drug loading; m[a] denotes the mass of AKG within the drug carrier; and m[b] signifies the total mass of the drug carrier. * 14. In Vitro Drug Dissolution To replicate the in vitro release characteristics of MOF-MIL-100@AKG under physiological (pH 7.4) and acidic (pH 5.5) conditions, two aliquots of a specified amount of MOF-MIL-100@AKG were inserted into dialysis bags. Each bag contained 4 mL of phosphate-buffered saline (PBS) at pH 7.4 or pH 5.5, respectively. The dialysis bags were sealed at both ends and submerged in 100 mL of the appropriate PBS solution. The liquids were agitated gently with a magnetic stirrer. At specified time intervals, 5 mL aliquots of the fluid external to the dialysis bags were extracted for absorbance analysis. An equivalent volume (5 mL) of the respective PBS solution was promptly added to the external solution to preserve a consistent volume. Absorbance was quantified at 254 nm, and the results were documented. The cumulative release rate was subsequently computed. * 15. Statistical Analysis All values are presented as the mean ± standard deviation (SD). Statistical analysis was conducted utilizing one-way ANOVA for multiple comparisons, succeeded by Tukey's post hoc test or two-tailed t-test via GraphPad Prism software. Statistical significance was established at ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 in all instances. 3. Result * 1. Inhibition of Carbohydrate Metabolism in Degenerated Nucleus Pulposus Cells: We performed metabolomic sequencing on the metabolic pattern shifts in nucleus pulposus cells during degeneration. The results showed that, compared to normal nucleus pulposus cells, inflammatory degenerated nucleus pulposus cells induced by TBHP had lower levels of carbohydrate metabolism ([54]Fig. 1A). Since the TCA cycle is the central part of carbohydrate metabolism, the levels of its intermediates have a significant impact on the overall level of carbohydrate metabolism [[55]13,[56]14]. Therefore, we chose to replenish the intermediates of the TCA cycle to explore the metabolic changes in IDD. Fig. 1. [57]Fig. 1 [58]Open in a new tab Exogenous AKG exhibits a protective effect in degenerated nucleus pulposus tissue. (A) KEGG pathway enrichment analysis of cell metabolism in normal and degenerated nucleus pulposus tissue. (B) CCK-8 assay results for degenerated nucleus pulposus cells after exogenous addition of key intermediates in the tricarboxylic acid cycle (n = 4). (C) CCK-8 assay results for degenerated nucleus pulposus cells subjected to oxidative stress using a graded dose of TBHP (n = 3). (D) CCK-8 assay results following the addition of AKG at varying concentrations to the TBHP-induced degeneration model (n = 3). (E–F) Western blotting and quantification of key proteins related to catabolic and anabolic metabolism in the AKG rescue model (n = 3). (G–H) Immunofluorescence and quantification of catabolic and anabolic metabolism markers in the AKG rescue model (n = 3). (I) RT-qPCR analysis of catabolic and anabolic metabolism-related mRNA expression in the AKG rescue model (n = 3). (J–K) Representative ROS fluorescence images and quantification in the AKG rescue model (n = 3). (L) Representative β-gal images and quantification (n = 3). (Compared to the control group, ns, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001). Among the replenished metabolites, AKG showed the most significant rescue effect ([59]Fig. 1B). AKG has been reported to have a positive regulatory effect on extending the lifespan of short-lived animals and alleviating the aging process [[60]7,[61]15], but no studies have yet explained the role of this molecule in nucleus pulposus cells. CCK8 assay results indicated that AKG could significantly rescue the death of nucleus pulposus cells induced by TBHP and restore cell proliferation. * 2. Supplementation of AKG Rescues TBHP-Induced Degeneration of Nucleus Pulposus Cells: Based on the above results, we paid special attention to AKG. After determining the appropriate concentration of TBHP with CCK8, we added AKG to the TBHP-induced inflammatory degeneration model ([62]Fig. 1C and D). From the protein level and RNA level, we observed that the markers of catabolic metabolism in nucleus pulposus cells were significantly downregulated, while the indicators of anabolic metabolism were upregulated ([63]Fig. 1E, F, I), indicating that AKG has a positive effect on the metabolic balance of the nucleus pulposus cell matrix. At the same time, immunofluorescence results further confirmed our idea ([64]Fig. 1G and H). Considering that TBHP can cause oxidative damage to the mitochondria of nucleus pulposus cells [[65]16], leading to degeneration, we measured the level of reactive oxygen species (ROS) in nucleus pulposus cells ([66]Fig. 1J and K), and the results proved that AKG can effectively reduce the ROS level in nucleus pulposus cells. Finally, β-galactosidase staining confirmed the senostatic efficacy of AKG, demonstrating its significant attenuation of TBHP-induced cellular senescence([67]Fig. 1L). This represents the multifaceted rescue effect of AKG. * 3. Preparation and Characterization of MOF-MIL-100@AKG: Our in vitro experimental results have given us confidence in the ability of AKG to resist the aging and degeneration of nucleus pulposus cells, but further in vivo experiments are needed to validate our hypothesis. Considering that AKG, as a small molecule metabolite, can be converted to 2HG in acidic environments and lose its original structure [[68][17], [69][18], [70][19]], and the traditional method of orally administering foods with high concentrations of AKG requires a considerable amount of time [[71]20,[72]21], and the intervertebral disc, being a nutrition-restricted organ, does not easily achieve immediate metabolic changes [[73][22], [74][23], [75][24]], we believe it is necessary to construct a delivery system that can meet the needs of a small molecule carrier, overcome acidic environments, and be injectable. Based on these requirements, we constructed Mn-MIL-100@AKG ([76]Fig. 2A). Mn-MIL-100 was selected for its high porosity, pH-responsive cargo release, and intrinsic antioxidant properties, which synergized with AKG to mitigate oxidative stress in degenerated nucleus pulposus cells. The basic morphology was characterized using SEM and XRD ([77]Fig. 1A–B). The drug release rate of the system was measured under normal and acidic conditions to mimic the acidic environment in the intervertebral disc ([78]Fig. 1C). After preparing this system, we reviewed its biocompatibility. By co-culturing with cells for 1, 3, and 7 days, we observed satisfactory cell survival rates ([79]Fig. 2B). Additionally, through Calcein/PI staining, we further confirmed that the material has good biocompatibility ([80]Fig. 2C and D). In vivo toxicity studies revealed no significant histological changes in major organs (heart, liver, spleen, lung, kidney) following Mn-MIL-100@AKG administration, confirming its biocompatibility for clinical use ([81]Fig. 2E). By utilizing the loose and porous nature of MOFs to embed AKG within, and the MOF itself has excellent antioxidant properties, which can further consolidate the alleviation of oxidation damage induced by TBHP. * 4. MOF-MIL-100@AKG Alleviates Oxidative Stress and Degeneration of Nucleus Pulposus Cells in Vitro: Fig. 2. [82]Fig. 2 [83]Open in a new tab Synthesis and biocompatibility of Mn-MIL-100@AKG. (A) Schematic illustration of the synthesis process for Mn-MIL-100@AKG.(by Biorender) (B) CCK-8 assay results for the addition of Mn-MIL-100@AKG at varying concentrations to the TBHP model (n = 3). (C–D) Cell viability and death assays, along with quantification, for Mn-MIL-100 and Mn-MIL-100@AKG (n = 3). (E) Representative H&E and Safranin-O/Fast Green staining images of heart, liver, spleen, lung, and kidney tissues from rats to assess organ toxicity in vivo (n = 3). (For interpretation of the references to colour in this figure legend, the reader is