Abstract

   Recent studies found that treatment with an anti-T-cell immunoglobulin
   mucin-1 (TIM1) monoclonal antibody (RMT1-10) regulated immune responses
   by inducing regulatory B cells (Bregs). However, the role of these
   cells in myocardial ischemia-reperfusion injury (IRI) is unknown. This
   study aimed to investigate the protective effect of RMT1-10 on
   myocardial IRI and its potential mechanism. We established a myocardial
   IRI model, and Triphenyl tetrazolium chloride staining, Terminal
   deoxynucleotidyl transferase nick-end-labeling, hematoxylin and eosin,
   and transmission electron microscopy were performed to examine the
   myocardial infarction size, myocardial cell apoptosis, and
   cardiomyocyte morphology and structure. The data showed that RMT1-10
   could alleviate myocardial IRI, increase the number of TIM1^+Bregs and
   interleukin 10 (IL-10) secretion, and regulate the expression of
   inflammatory factors after myocardial IRI. However, treatment with
   RMT1-10 and Anti-CD20 abrogated the protective effect of RMT-10. In
   addition, RMT1-10 treatment inhibited T cells but significantly
   activated Tregs after IRI, while RMT1-10 combined with Anti-CD20
   abolished this effect on Tregs. Furthermore, sequencing analysis showed
   marked expression changes among genes related to several classical
   signaling pathways in response to RMT1-10. Taken together, these
   findings indicated that RMT1-10 could increase the number of TIM1^+
   Bregs and regulate IL-10-mediated inflammatory reactions, activate
   Tregs to inhibit inflammation, and might regulate the above-mentioned
   signaling pathways to protect against myocardial IRI.

   Subject terms: Cell biology, Immunology

Introduction

   Myocardial ischemia has become a leading cause of morbidity and
   mortality worldwide [[44]1], causing arrhythmia, cardiac dysfunction,
   myocardial infarction, and even sudden death. In recent years,
   reperfusion techniques, such as thrombolytic therapy and first
   percutaneous coronary intervention, have been developed, which have
   significantly reduced mortality and the infarct size, and improved
   cardiac function [[45]2]. However, reperfusion itself can also cause
   damage to the structure or function of the heart, leading to myocardial
   ischemia reperfusion injury (IRI) [[46]3]. The occurrence of myocardial
   IRI will expand the infarct size; lead to the accumulation of
   inflammatory cells; seriously damage vascular endothelial function;
   cause obvious metabolic dysfunction, arrhythmia, and myocardial cell
   apoptosis; and aggravate myocardial infarction [[47]4, [48]5].
   Therefore, it is important to analyze the relevant molecular mechanisms
   of myocardial IRI and provide research ideas and a theoretical basis
   for the development of effective therapies.

   T-cell immunoglobulin mucin-1 (TIM1) is a member of the TIM protein
   family, which directly couples phosphotyrosine-dependent intracellular
   signaling pathways and provides co-stimulatory signals for T cell
   activation [[49]6]. TIM1 is a co-stimulatory molecule that is expressed
   on both activated CD4^+ cells and polarized T helper 2 (Th2) cells in
   vitro [[50]7, [51]8]. TIM1 plays an important role in effector
   differentiation of CD4^+ cells and is an effective regulator of the T
   cell effector response [[52]9, [53]10]. Its expression is much higher
   in all major B cell subsets than in T cells, particularly on
   IL-10-expressing regulatory B cells (Bregs), and is considered a marker
   of IL-10^+ Bregs [[54]11, [55]12]. Dysregulated IL-10^+ TIM1^+ Breg
   populations have been associated with inflammatory diseases in humans
   [[56]13]. Recent studies have shown that the anti-TIM1 monoclonal
   antibody, RMT1-10, could increase the number of TIM1^+ Bregs in a mouse
   pancreatic transplantation model, produce IL-4 and IL-10, promote the
   Th2 cell response, inhibit inflammation, and reduce immune rejection.
   RMT1-10 could also increase the secretion of cytokines by coupling TIM1
   [[57]11]; however, when TIM1 is defective or mutated in B cells, IL-10
   is defective, and pro-inflammatory cytokine expression increases. In a
   mouse liver IRI model, RMT1-10 treatment significantly inhibited
   hepatocyte apoptosis [[58]14]. In addition, in cerebral IRI, RMT1-10
   treatment could also effectively inhibit the inflammatory response,
   thereby reducing brain injury [[59]15]. However, the effect of RMT1-10
   in myocardial IRI was not investigated.

   In the present study, using TIM1^+ Bregs as the target, we investigated
   the protective effect of RMT1-10 on myocardial IRI using an in vitro
   TIM1^+ Breg cell co-culture system and a myocardial IRI model in vivo.
   We further revealed the mechanism of RMT1-10 activation of TIM1^+
   Bregs. These data not only enrich the molecular mechanism theory of the
   RMT1-10-mediated increase in TIM1^+ Breg cell numbers and IL-10
   secretion, but also provide a theoretical basis for TIM1 as a novel
   target for the treatment of myocardial IRI.

Results

RMT1-10 alleviates myocardial IRI

   To determine the effect of RMT1-10 on myocardial IRI, we established a
   C57BL/6J mouse myocardial IRI model, as shown as in Fig. [60]1A.
   Triphenyl tetrazolium chloride (TTC) staining was used to observe the
   changes in the myocardial infarction volume in the mice, showing that
   the myocardial infarction size of the IRI group was larger than that of
   the Sham operation group, while RMT1-10 treatment could reduce the
   myocardial infarction size. Terminal deoxynucleotidyl transferase
   nick-end-labeling (TUNEL) staining also showed that the number of
   apoptotic cells was increased after IRI treatment in comparison with
   that in the Sham group; however, RMT1-10 treatment reversed the
   increase in apoptotic cells induced by IRI (Fig. [61]1B). Furthermore,
   hematoxylin and eosin (HE) analysis showed that the mice in the Sham
   group had normal cardiomyocyte morphology, whereas the IRI group had
   severe deformation, discontinuity, or necrosis of the tissue structure.
   RMT1-10 treatment could reduce this IRI-induced damage (Fig. [62]1C).
   The results of transmission electron microscopy (TEM) analysis showed
   that the myocardial cells in the Sham group had a clear structure,
   obvious myofibrils, regular arrangement, clear hierarchy, and normal
   and complete mitochondria. In the IRI group, the myofibrillar
   arrangement was irregular, myofilaments were dissolved, the
   mitochondrial volume increased, and rupture, necrosis, myocardial cell
   vacuolation, and swelling were observed. RMT1-10 treatment could reduce
   these pathological changes induced by IRI (Fig. [63]1D). Detection of
   myocardial injury markers (creatine phosphokinase-MB (CK-MB); lactate
   dehydrogenase (LDH), and the cardiac troponin T/I ratio (cTnT/I)) in
   serum indicated that LDH, the activity of CK-MB, and cTnT/I were
   increased in the IRI group, whereas RMT1-10 treatment could reduce them
   (Fig. [64]1E).

Fig. 1. RMT1-10 alleviates myocardial IRI.

   [65]Fig. 1
   [66]Open in a new tab

   A TTC staining of the changes in the myocardial infarction volume in
   the different groups. B, C TUNEL and HE staining to determine
   myocardial cell apoptosis and the changes in cardiomyocyte morphology.
   D Electron microscopy detection of cardiomyocyte structures in the
   Sham, IRI, and IRI + RMT1-10 groups. ###P < 0.001 vs. sham,
   ***P < 0.001 vs. IRI. E ELISA, LDH assays, and cTnT/I detection for the
   expression of CK-MB, LDH, and cTnT/I in serum. ###P < 0.001 vs. Sham,
   **P < 0.01,***P < 0.001 vs. IRI.

RMT1-10 increased the number of TIM1^+Bregs and regulated the expression of
inflammatory factors after myocardial IRI-induction

   To further analyze the effect of RMT1-10 on inflammatory factors,
   peripheral blood samples, myocardial immune cells, and spleen cells
   (after removing red blood cells) were acquired from the different
   treatment groups. We then examined the changes in the numbers of TIM1^+
   Bregs (TIM1^+ CD19^+) using flow cytometry. The number of TIM1^+ Bregs
   increased after myocardial IRI in the blood, heart, and spleen;
   however, a larger increase was observed after RMT1-10 intervention in
   the IRI model mice in comparison with that in the IRI group (Fig.
   [67]2A). The activity of myeloperoxidase (MPO), used to assess the
   degree of neutrophil infiltration and inflammatory reaction in the
   mice, was increased in the IRI group, but was reduced after RMT1-10
   treatment (Fig. [68]2B). Enzyme-linked immunosorbent assay (ELISA) and
   quantitative real-time reverse transcription PCR (qRT-PCR) were used to
   further analyze the expression levels of interleukin (IL)-10, tumor
   necrosis factor alpha (TNFα), and IL- 6 in peripheral blood serum and
   spleen cells, respectively. RMT1-10 treatment enhanced the expression
   of anti-inflammatory factors, such as IL-10, and reduced the expression
   of pro-inflammatory factors, such as TNFα and IL-6, compared with those
   in the IRI group (Fig. [69]2C, D).

Fig. 2. RMT1-10 increased the number of TIM1^+ Bregs and regulated the
expression of inflammatory factors after myocardial IRI-induction.

   [70]Fig. 2
   [71]Open in a new tab

   A Flow cytometry analysis of the changes of TIM1^+ Bregs (TIM1^+
   CD19^+) in the different treatment groups (Sham, IRI, and
   IRI + RMT1-10) in the spleen, heart, and blood. ***P < 0.001 vs. Sham,
   ###P < 0.001 vs. IRI. B The MPO activity in the different groups.
   ###P < 0.001 vs. Sham, ***P < 0.001 vs. IRI. C ELISA determination of
   the serum levels of IL-10, TNFα, and IL-6 in the different groups. D
   qRT-PCR was used to determine the expression levels of Il-10, Tnfa, and
   Il-6 in the different groups of spleen cells (with red blood cells
   removed).

   The diagram of establishing the model and the gating strategies for
   TIM1^+ Bregs in the spleen, heart, and blood are shown in Supplementary
   Fig. [72]1A, B. Next, we checked the relationship between TIM1
   expression and myocardial IRI. After myocardial IRI, the level of TIM1
   in cardiomyocytes increased slightly, while RMT1-10 treatment further
   promoted the expression of TIM1 and reduced the apoptosis and necrosis
   of cardiomyocytes, thus playing a protective role against myocardial
   IRI (Supplementary Fig. [73]1C).

Anti-CD20 alleviates the protective effect of RMT1-10 in myocardial IRI

   TIM1 is expressed on Bregs that express IL-10 in all major B cell
   subsets and is considered a marker of IL-10^+Bregs [[74]16]. To explore
   the protective effect of TIM1^+ Bregs on myocardial IRI, we established
   a B-cell-specific defective mouse model by treating the mice with an
   Anti-CD20 antibody, then established the myocardial IRI model in these
   mice, and treated them with RMT1-10 to further observe the extent of
   myocardial injury in the different treatment groups. TTC staining
   showed that the myocardial infarction volume increased after treatment
   with Anti-CD20 combined with RMT1-10 (Fig. [75]3A). TUNEL and HE
   staining also proved that combined Anti-CD20 and RMT1-10 treatment
   increased the number of apoptotic myocardial cells and cardiomyocyte
   injury, respectively (Fig. [76]3B, C). Myocardial ultrastructure was
   observed using TEM, which showed that mitochondrial fission was
   increased in the Anti-CD20 + IRI + RMT1-10 group (Fig. [77]3D).
   Moreover, we found that LDH, the activity of CK-MB, and cTnT/I were
   increased in the Anti-CD20 + IRI + RMT1-10 group in comparison with
   those in the IRI + RMT1-10 group (Fig. [78]3E). The above data
   demonstrated that the protective effect of RMT-10 vanished after
   treatment with Anti-CD-20.

Fig. 3. Anti-CD20 reverses the protective effect of RMT1-10 in myocardial
IRI.

   [79]Fig. 3
   [80]Open in a new tab

   A The myocardial infarction volume, as determined by TTC in the IRI,
   IRI + RMT1-10, and Anti-CD20 + IRI + RMT1-10 groups. B, C TUNEL and HE
   staining for myocardial cell apoptosis and changes in cardiomyocyte
   morphology in the IRI, IRI + RMT1-10, and Anti-CD20 + IRI + RMT1-10
   groups. D Electron microscopy analysis of the cardiomyocyte structure
   in the IRI, IRI + RMT1-10, and Anti-CD20 + IRI + RMT1-10 groups.
   ***P < 0.001 vs. IRI, ###P < 0.001 vs. IRI + RMT1-10. E ELISA, LDH
   assays, and cTnT/I detection of the levels of CK-MB, LDH, and cTnT/I in
   serum. **P < 0.01,***P < 0.001 vs. IRI, ###P < 0.001 vs. IRI + RMT1-10.

Anti-CD20 reduces the number of TIM1^+ Bregs and enhances the expression of
inflammatory factors after co-treatment with RMT1-10 in myocardial IRI

   We then performed detailed phenotypic and functional characterization
   of these TIM1^+ Bregs. As shown in Fig. [81]4A, the number of TIM1^+
   Bregs was reduced in the blood, heart, and spleen after myocardial IRI
   in the Anti-CD20 + IRI + RMT1-10 group in comparison with those in the
   IRI + RMT1-10 group. The activity of MPO was downregulated after
   RMT1-10 treatment under IRI conditions; however, it increased after
   co-treatment with Anti-CD20 and RMT1-10 (Fig. [82]4B). Compared with
   those in the IRI + RMT1-10 group, the level of IL-10 decreased, and
   TNFα and IL-6 levels increased in the Anti-CD20 + IRI + RMT1-10 group
   (Fig. [83]4C, D).

Fig. 4. Anti-CD20 reduces the number of TIM1^+ Bregs and enhances the
expression of inflammatory factors after co-treatment with RMT1-10 in
myocardial IRI.

   [84]Fig. 4
   [85]Open in a new tab

   A The changes in the number TIM1^+ Bregs (TIM1^+ CD19^+) in the
   different treatment groups as determined by Flow cytometry analysis.
   ***P < 0.001 vs. IRI, ###P < 0.001 vs. IRI + RMT1-10. B Detection of
   MPO activity in the different groups. **P < 0.01 vs. IRI, ##P < 0.01
   vs. IRI + RMT1-10. C C. ELISA determination of the serum levels of
   IL-10, TNFα, and IL-6 in the different groups. ***P < 0.001 vs. IRI,
   ###P < 0.001 vs. IRI + RMT1-10. D qRT-PCR was used to determine the
   expression levels of Il-10, Tnfa, and Il-6 in the different groups of
   spleen cells (with red blood cells removed). **P < 0.01 vs. IRI,
   #P < 0.05, ###P < 0.001 vs. IRI + RMT1-10.

RMT1-10 treatment increases TIM1^+ Bregs and IL-10 secretion in vitro

   The above data preliminary confirmed that RMT1-10 could alleviate
   myocardial IRI by increasing the number of TIM1^+ Bregs and regulating
   inflammatory factors in vivo. To further reveal the effect of RMT1-10
   in vitro, we isolated mouse spleen B cells, T cells, and primary
   cardiomyocytes (sham and IRI) using magnetic beads and co-cultured them
   with RMT1-10. We then observed the changes in cardiomyocyte activity,
   IL-10 expression, and the number of TIM1^+ Bregs (TIM1^+ CD19^+). The
   results showed that cardiomyocyte cell viability was reduced after IRI,
   while RMT1-10 treatment could significantly increase it (Fig. [86]5A).
   The levels of IL-10 and TIM1^+ Bregs increased transiently after
   myocardial IRI, whereas RMT1-10 intervention significantly increased
   them (Fig. [87]5B, C). These results indicated that RMT1-10 could
   promote the secretion of IL-10 by TIM1^+ Breg cells.

Fig. 5. RMT1-10 treatment increases TIM1^+ Bregs and IL-10 secretion in
vitro.

   [88]Fig. 5
   [89]Open in a new tab

   A CCK-8 analysis of myocardial cell viability in the Control, IRI, and
   IRI + RMT1-10 groups. ***P < 0.001 vs. Control, ###P < 0.001 vs. IRI. B
   The levels of IL-10 in the supernatant, as detected by ELISA. C Flow
   cytometry detection of TIM1^+ Bregs (TIM1^+ CD19^+). **P < 0.01 vs.
   Control, ###P < 0.001 vs. IRI.

   The homologous interaction between Breg cells and T cells is considered
   to control the induction of Treg cells [[90]17–[91]19]. After RMT1-10
   treatment, there was a significant increase in Treg cells
   (CD4^+CD25^+Foxp3^+) (Supplementary Fig. [92]2A). When the B cells were
   removed by treatment with Anti-CD20 antibodies, RMT1-10 treatment could
   not increase the number of Treg cells (CD4^+CD25^+Foxp3^+) after IRI
   (Supplementary Fig. [93]2B). TIM1^+ Bregs were co-cultured with CD4^+
   naive T cells and CD8^+ naive T cells, separately. Flow cytometry
   detection of the differentiation of Th1 (CD4^+ T and CD8^+ T) subsets
   showed that T cells differentiated significantly into CD4^+ cells
   (Supplementary Fig. [94]2C). The above data indicated that TIM1^+ Bregs
   could promote the secretion of immunomodulatory cytokine IL-10, thus
   further regulating Tregs, inhibiting the inflammatory response, and
   alleviating myocardial IRI.

The molecular mechanism by which RMT1-10 promotes the proliferation of TIM1^+
Bregs and the secretion of IL-10

   To further investigate the signaling pathways through which RMT1-10
   increases the number of TIM1^+ Bregs and the secretion of IL-10, we
   carried out mRNA sequencing analysis in the Sham, myocardial IRI, and
   RMT1-10 + IRI groups. Subsequently, a volcano plot showed the
   upregulated and downregulated genes map between the sham and IRI
   groups, and between the IRI and IRI + RMT1-10 groups (Fig. [95]6A, B).
   Intersection analysis of the downregulated genes between the Sham and
   IRI groups and the upregulated genes between the IRI and IRI + RMT1-10
   groups identified 45 genes. Intersection analysis of the upregulated
   genes between the Sham and IRI groups and the downregulated genes
   between the IRI and IRI + RMT1-10 groups identified 125 genes (Fig.
   [96]6C, D). This information was processed in a heat map (Fig. [97]6E).

Fig. 6. The molecular mechanism by which RMT1-10 promotes the proliferation
of TIM1+ Bregs and the secretion of IL-10.

   Fig. 6
   [98]Open in a new tab

   A, B Differentially expressed genes among the different groups, as
   analyzed using a volcano map. C, D Venn diagrams of the upregulated and
   downregulated genes among the sham, IRI, and IRI + RMT1-10 groups. E
   Heat map analysis of the differentially expressed genes. F GO
   enrichment analysis of the differentially expressed genes.

   We also provided a PCA graph to demonstrate that the differences
   between groups are greater than those within groups (Supplementary Fig.
   [99]4).

RMT1-10 protects myocardial IRI via the EGFR pathway

   We further used Kyoto Encyclopedia of Genes and Genomes (KEGG)
   enrichment analysis to analyze the above differentially expressed
   genes, which showed that they were enriched in many signaling pathways.
   We selected several classical signaling pathways, such as the epidermal
   growth factor receptor (EGFR) signaling pathway, the Janus kinase
   (JAK)-signal transducer and activator of transcription (STAT) signal
   pathway, the mitogen activated protein kinase (MAPK) signaling
   pathways, and the phosphatidylinositol-4,5-bisphosphate 3-kinase
   (PI3K)-protein kinase B (AKT) signaling pathway for further analysis
   (Fig. [100]7A, Supplementary Fig. [101]3). We detected related protein
   levels in the Sham, IRI, and IRI + RMT1-10 groups, which showed that
   phosphorylated ((p)-EGFR), p-STAT3, p-extracellular regulated kinase
   1/2 (ERK1/2), and p-AKT levels were upregulated after IRI, while these
   indicator proteins were downregulated after RMT1-10 treatment (Fig.
   [102]7B).

Fig. 7. RMT1-10 protects myocardia against IRI via the EGFR pathway.

   [103]Fig. 7
   [104]Open in a new tab

   A KEGG enrichment analysis of the differentially expressed genes. B
   Western Blotting detection of the levels of EGFR, STAT3, ERK1/2, and
   AKT.

Discussion

   Myocardial IRI is related to apoptosis and necrosis of cardiomyocytes,
   which reduces the chance of a cure after thrombolytic therapy, and
   involves inflammation, oxidative stress, calcium overload, and other
   factors [[105]20, [106]21]. In this study, we investigated the
   protective effect of TIM1 on myocardial IRI. TIM1 was found recently to
   be predominantly expressed on Bregs [[107]11, [108]22]. Binding of TIM1
   by low-affinity RMT1-10 promoted immune tolerance via IL-10-expressing
   B cells, and treatment with RMT1-10 also increased TIM1^+ Breg numbers
   and the percentage of TIM1^+ Bregs expressing IL-10 and IL-4, thereby
   preserving Tregs but inhibiting CD4^+ Th1 cell expansion [[109]11,
   [110]23]. TIM1 plays an important role in regulating the function of
   Bregs, inhibiting the inflammatory response, and maintaining
   self-tolerance. However, the role of TIM1^+ Bregs in myocardial IRI has
   not been investigated. Our data showed that there was a transient
   increase in TIM1 expression in myocardial tissue at 24 h after
   myocardial IRI, and the number of TIM1^+ positive cells increased,
   mainly B cells. Furthermore, the expression of TIM1 in Bregs was
   significantly upregulated after RMT1-10 treatment in a mouse model of
   myocardial IRI. These results suggested that the activation of TIM1^+
   Bregs could protect against myocardial IRI in mice, and the effect of
   RMT1-10 could increase the number of TIM1^+ Bregs, thereby reducing
   myocardial IRI.

   Bregs are associated with suppressing excessive inflammation [[111]24,
   [112]25]. They can inhibit the differentiation of Th1 and Th17 cells by
   inhibiting the production of pro-inflammatory cytokines in dendritic
   cells [[113]26]. In addition to expressing IL-10, Bregs also express
   other immunomodulatory cytokines, including transforming growth
   factor-β (TGFβ) and IL-35 [[114]27, [115]28]. By producing TGFβ,
   lipopolysaccharide (LPS)-activated B cells can induce CD4^+ apoptosis
   and non-reactive CD8^+ T cells [[116]29]. In addition, IL-35 is
   associated with Breg-mediated immunosuppression and can improve immune
   tolerance by inducing Treg proliferation and inhibiting the Th17
   response [[117]30, [118]31]. It has also been reported that human Bregs
   are crucial in maintaining invariant natural killer T (iNKT) cell
   homeostasis [[119]32, [120]33]. Therefore, Bregs play many roles in
   suppressing the immune response and have the ability to target multiple
   immune system cells, thus playing a pleiotropic role. Our data showed
   that IL-10 secretion was slightly upregulated after myocardial IRI in
   mice, but the difference was not obvious; however, RMT1-10 treatment
   significantly upregulated the expression of IL-10. These results
   suggested that RMT1-10 could promote IL-10 secretion from TIM1^+ Bregs.

   Deficiency of IL-10^+ Bregs would further aggravate the development of
   various inflammatory immune diseases [[121]28]. Transgenic mice that
   lacked B cells (specifically B cells that produce IL-10) show chronic
   inflammation because of defects in the development and function of
   Bregs [[122]34, [123]35]. In mice and humans, Bregs support the
   regulation of various phenotypes by distorting T cell differentiation.
   The importance of B cells in maintaining Tregs can be inferred from
   earlier studies that showed that Tregs were significantly reduced in
   B-cell-deficient mice [[124]36]. Mice with B-cell-specific IL-10
   deficiency also exhibited Treg cell deficiency, which was associated
   with the growth of pro-inflammatory T cells after autoimmune induction
   [[125]37]. Therefore, we further detected immune cells of mice after
   myocardial IRI, which showed that the number of Tregs
   (CD4^+CD25^+Foxp3^+) increased after myocardial IRI + RMT1-10, while
   after treatment with Anti-CD20 combined with RMT1-10, the percentage of
   Tregs (CD4^+CD25^+Foxp3^+) was reduced.

   RMT1-10 can upregulate the number of TIM1^+ Bregs and increase the
   secretion of cytokines by binding to TIM1; however, when TIM1 is
   defective or mutated in B cells, IL-10 will be defective, and
   pro-inflammatory cytokine expression will increase [[126]11, [127]38].
   We also found that in the IRI model, after RMT1-10 treatment, the EGFR
   signaling pathway, JAK-STAT signal pathway, MAPK signaling pathways,
   p-EGFR in the PI3K-AKT signaling pathway, p-STAT3, p-ERK1/2, and p-AKT
   were significantly downregulated. Thus, RMT1-10 is likely to act via
   the EGFR JAK/STAT/MAPK/PI3K-AKT signaling pathways to promote mature B
   cells to increase the number of TIM1^+ Breg and the secretion of IL-10
   to regulate inflammation, thus protecting against myocardial IRI.
   However, the specific pathway that plays a leading role still needs to
   be further identified in future studies. To directly test causality, we
   have initiated follow-up studies using Pharmacological inhibitors
   (e.g., AG1478 for EGFR, Stattic for STAT3) to determine if RMT1-10’s
   effects are abolished; cell-specific knockout models (e.g.,
   AAV9-Cre-mediated STAT3 deletion in cardiomyocytes). We will report
   these results in a future publication focused on mechanistic
   dissection. Although our data support TIM1⁺ Bregs as a primary target
   of RMT1-10, we cannot exclude potential modulation of other TIM1⁺
   immune populations. Future studies incorporating comprehensive immune
   profiling will clarify the selectivity of RMT1-10 across cell types.
   This will be a key focus of our future work, including:
   Multi-parametric flow cytometry to dissect TIM1⁺ cell subsets and
   adoptive transfer experiments of TIM1⁺ Bregs versus TIM1⁺ T cells to
   compare their functional roles.

Conclusions

   Our findings showed that RMT1-10 could protect against myocardial IRI,
   possibly by regulating the EGFR/JAK/STAT/MAPK/PI3K-AKT signaling
   pathways. These results suggest strategies to develop TIM1^+ Breg
   cellular therapy and identify potential therapeutic targets to modulate
   TIM1^+ Breg function in myocardial IRI.

Materials and methods

Animals

   C57BL/6J mice (6–8 weeks old, Male) were purchased from the Charles
   River Laboratory (Beijing, China). All mice were housed in an
   environmentally controlled room under a 12 h light/dark cycle with ad
   libitum access to food and water.

Myocardial IRI model

   A total of 24 C57BL/6J mice were randomly divided into four groups
   (n = 6): Sham, IRI, IRI + RMT1-10 (500 µg anti-mouse TIM1 (BioXCell,
   Lebanon, NH, USA; RMT1-10, i.p. on day 1 before myocardial IRI, and
   300 µg on days 0 and 1)), IRI + RMT1-10+ Anti-CD20 (BioXCell,
   250 μg/200 μl PBS); Sterile anti-mouse CD20 and isotype control
   monoclonal antibodies (mAbs) were injected through lateral tail veins
   on day 14 and 7 before myocardial IRI. First, the mice were
   anesthetized using 3% pentobarbital sodium injection, the surgical area
   was disinfected, the skin was cut between the third and fourth ribs on
   the left side of the sternum, and the heart was exposed. Next, a 6-0
   suture needle was applied at 1 mm below the lower edge of the atrial
   ear through the surface of the heart, and the anterior descending
   branch of the left coronary artery (LAD) was then subjected to pressure
   ligation. Electrocardiography (ECG) showed that the ST segment
   continued to be elevated, indicating successful induction of myocardial
   ischemia. The thoracic cavity was closed using a simple suture. The
   thoracic cavity was opened again after 30 min of ischemia, and the
   ligature line was cut. The surface of the heart turned from pale to
   red, and the elevated part of the ST segment on ECG returned to the
   baseline, indicating successful reperfusion. The tracheal intubation
   was pulled out after the mouse awoke, and the mouse was placed in a
   thermal blanket overnight. At 2 weeks post-surgery, the mice were
   killed by intraperitoneal injection of 2% isoflurane. Their hearts were
   removed and processed for further experiments. All histopathological
   analyses (HE, TUNEL, and TEM) were performed specifically in the
   infarct zone.

Primary cardiomyocyte extraction and culture

   The heart was removed from the mature C57BL6/J mice. The myocardium was
   snipped and digested until the myocardium became translucent, then the
   digestion was terminated. The resulting cardiomyocyte suspension was
   centrifuged, the supernatant was discarded, the cells were washed with
   Dulbecco’s modified Eagle’s medium (DMEM)-F12 and 15% FBS Brdu (fetal
   bovine serum-bromodeoxyuridine), filtered into a petri dish, and
   cultured in an incubator for 2 h. Subsequently, fibroblasts were
   removed by differential adhesion separation to obtain cardiomyocytes.

Triphenyl tetrazolium chloride (TTC) staining

   The myocardial tissue sections were obtained from the mid-left
   ventricular (LV) level (papillary muscle plane) and apical third, then
   cut transversely into 2 mm thick slices. Slices were incubated at 1%
   TTC (Solarbio Life Science, Beijing, China) at 37 °C for 10 min to
   identify non-infarct and infarct areas.

Terminal deoxynucleotidyl transferase nick-end-labeling (TUNEL) staining

   Myocardial tissue was cut into 0.5 cm^3 pieces and fixed using 4%
   paraformaldehyde phosphate. The slices at a thickness of 10 μm were
   prepared by routine dehydration, wax dipping, and embedding. The
   percentage of apoptotic cells was determined using an in situ cell
   death detection kit (TUNEL; Roche, Basel, Switzerland) following the
   supplier’s protocol. The apoptotic cells were observed under a light
   microscope. Normal myocardial nuclei appeared blue, and apoptotic
   nuclei appeared brown. The apoptosis rate was calculated from not less
   than 500 myocardial nuclei.

Transmission electron microscopy (TEM)

   After IRI, the heart was removed, and samples were taken from the free
   wall of the left ventricle using a double-sided blade. The ventricular
   muscle was cut into small pieces (1 mm^3) and fixed with glutaraldehyde
   phosphate buffer at 4 °C for 24 h. Ultrathin sections of 50–70 nm were
   prepared by routine dehydration, immersion, embedding, and staining.
   The ultrastructure of the cardiomyocytes was observed under a
   transmission electron microscope.

Hematoxylin and eosin (HE) staining and Immunohistochemical analysis

   The paraffin-embedded sections on slides were deparaffinized and
   hydrated using an ethanol gradient. For the HE analysis, the sections
   were stained with hematoxylin for 5 min and subsequently with eosin for
   2 min. For the immunohistochemical analysis, the sections were stained
   with anti-TIM1 antibody (1:500, Abcam, Cambridge, MA, USA (ab15580))
   overnight at 4 °C. Then, the sections were reacted with horseradish
   peroxidase (HRP) and detected using a Diaminobenzidine (DAB) substrate
   kit (Abcam, ab64238). Finally, the sections were observed under a light
   microscope.

Enzyme-linked immunosorbent assay (ELISA)

   The expression of myosin and creatine kinase isoenzyme (CK-MB) was
   detected using ELISA, and the ratio of cardiac troponin to troponin I
   (cTnT/I) and Myeloperoxidase (MPO) was determined using cTnT/I and MPO
   detection Kits, following the supplier’s protocol.

Cytotoxicity lactate dehydrogenase (LDH) analysis

   A Cytotoxicity LDH Assay Kit-WST (Dojindo, Kumamoto, Japan) was used to
   determine cytotoxicity based on LDH released by damaged cells,
   following the supplier’s protocol.

Co-culture of B cells, T cells, and primary cardiomyocytes

   CD4^+ naïve T (CD8^+ naïve T) and TIM1^+ Breg (TIM1^+ CD19^+ B cells)
   were flow sorted from the peripheral blood mononuclear cells (PBMCs) of
   mice. CD4^+ naïve T (CD8^+ naïve T) were co-stimulated with anti-CD3
   (5 µg/ml)/anti-CD28 (5 µg/ml) antibodies (1 h), and TIM1^+ CD19^+ B
   cells were stimulated with anti-IL-10 neutralizing antibodies
   (10 µg/ml) or/and anti-TGF-β (10 µg/ml) for 3 days. Then, these two
   types of cells were placed in the upper chamber for co-culture.
   Cardiomyocytes were isolated and seeded in the lower chamber of a
   24-well plate at a density of 5 × 10⁴ cells per well for adherent
   culture. The cells were treated with TIM1 monoclonal antibody
   (RMT1-10). After treatment, cells were harvested from the lower
   chamber, and cardiomyocyte activity was analyzed.

Isolation of immune cells

   T cells (CD4^+ naïve T and CD8^+ naïve T cells) and B cells were
   isolated from mouse splenocytes using a Dynabeads Untouched Mouse CD4
   Cell Isolation Kit, a Dynabeads Untouched™ Mouse CD8 Cell Isolation
   Kit, and a Dynabeads® Mouse CD43 Untouched™ B Cell Isolation Kit,
   respectively (Miltenyi Biotec, Bergisch Gladbach, Germany).

Flow cytometry analysis

   The percent of TIM-^+ Bregs (TIM1^+ CD19^+) and Tregs (CD4^+ CD25^+
   Foxp3^+) was determined using Flow cytometry analysis. Isolated cells
   were treated with anti-TIM1, anti-CD19, anti-CD4, anti-CD25,
   anti-forkhead box O3 (Foxp3) antibodies. The data were acquired using a
   Cytek Aurora 3000 spectral flow cytometer (Cytek, Fremont, CA, USA) and
   analyzed using FlowJo software v10.7.1 (Treestar, Ashland, OR, USA).

Cell counting kit 8 (CCK-8) analysis

   Primary myocardial cells were seeded into 96-well plates at a density
   of 3 × 10^3 cells/well. Cell viability was examined with a CCK-8 assay
   (Dojindo). Briefly, 10 μL of CCK-8 solution was added to each well and
   incubated for 3 h. An MRX II microplate reader (Dynex Technologies,
   Chantilly, VA, USA) was used to determine the absorbance at 450 nm.

Western blotting analysis

   First, different groups of cells were treated using cell lysis buffer,
   and 40 μg protein were separated using 10% sodium dodecyl
   sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by
   transfer of the separated protein onto polyvinylidene fluoride (PVDF)
   membranes (Millipore, Billerica, MA, USA). The membranes were blocked
   using Tris-buffered saline (TBS) with 0.1% Tween 20 (TBS-T) containing
   5% bovine serum albumin for 2 h at 37 °C. The membranes were washed
   three times with TBS-T, followed by overnight incubation at 4 °C with
   primary antibodies recognizing epidermal growth factor receptor (EGFR),
   signal transducer and activator of transcription 3 (STAT3),
   extracellular regulated kinase 1/2 (ERK1/2), and protein kinase B (AKT)
   (diluted 1:1000 in TBS-T). The next day, the membranes were incubated
   with HRP-conjugated secondary antibodies for 2 h at 37 °C.
   Glyceraldehyde-3-phosphate dehydrogenase (GADPH) was detected as an
   internal control. The protein bands were detected using
   chemiluminescence (GE Healthcare, Piscataway, NJ, USA) and were
   quantified based on the optical density of each band using Image J
   (NIH, Bethesda, MD, USA).

Quantitative real-time reverse transcription PCR (qRT-PCR)

   RNA from all samples was extracted using TRIzol (Thermo Fisher
   Scientific, Waltham, MA, USA), which was reverse-transcribed into cDNA
   using a Prime-Script RT reagent kit (Takara Biotechnology, Dalian,
   China). The qPCR step of the qRT-PCR protocol used the cDNA as the
   template and the 2× SYBR Green PCR Master Mix (Takara Biotechnology)
   following the supplier’s guidelines. Real-time PCR was performed using
   an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA,
   USA). Relative gene expression levels were analyzed using the
   comparative 2^−ΔΔCt method. All the experiments were repeated at least
   three times.

Il-10

   Forward: 5′-GAAGACCCTCAGGATGCGGC -3′;

   Reverse: 5′-AAGAGACCCGACACCGGACA -3′

Tnfa

   Forward: 5′- GCCAACCAGGCAGGTTCTGT -3′;

   Reverse: 5′- TAGGCACCGCCTGGAGTTCT -3′

Il-6

   Forward: 5′- GCCCTCTGGCGGAGCTATTG -3′;

   Reverse: 5′- AAGGCCGTGGTTGTCACCAG -3′

Sequencing analysis

   Splenic B cell mRNA was sequenced by NOVO GENE Co., Ltd. (Beijing,
   China).

Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway
enrichment analysis

   The differentially expressed genes among the groups were subjected to
   GO enrichment analysis to clarify molecular functions and biological
   processes, and KEGG pathway enrichment analysis to predict key
   pathways.

Statistical analysis

   Experimental data are expressed as the mean ± standard deviation (SD).
   Comparisons between two groups were carried out using Student’s t-test
   or one-way analysis of variance, followed by the Tukey post-hoc test
   comparison for multiple groups. The statistical analyses were carried
   out using GraphPad Prism 9.0 software (GraphPad Software, San Diego,
   CA, USA). Statistical significance was accepted at P < 0.05.

Supplementary information

   [128]Supplementary Figure legends^ (18.6KB, docx)
   [129]Original data 1^ (739.5KB, docx)
   [130]Original data 2^ (567.3KB, docx)
   [131]Supplement Figure 1^ (17.7MB, tif)
   [132]Supplement Figure 2^ (5.7MB, tif)
   [133]Supplement Figure 3^ (3.6MB, tif)
   [134]Supplement Figure 4^ (937.8KB, tif)

Author contributions

   Dajin Chen, Wei Chen, and Qunjun Duan conceptualized and planned the
   study; Weijun Yang and Minjian Kong performed the experiments; Haifeng
   Cheng and Aiqiang Dong analyzed the data; Qunjun Duan and Dajin Chen
   wrote the manuscript. All authors have read and approved the final
   version of the manuscript.

Funding

   This work was supported by the National Natural Science Foundation of
   China [grant number 82070275] and the Zhejiang Provincial Nature
   Science Foundation of China [grant number LR20H160001and LY23H020003].

Data availability

   We declare that all data support the conclusions of the study, and all
   raw data will be made available upon request.

Competing interests

   The authors declare no competing interests.

Ethics approval and consent to participate

   All animal experiments were conducted in accordance with the National
   Institutes of Health Guide for the Care and Use of Laboratory Animals
   (NIH Publications, No. 8023, revised 1978) and the ARRIVE guidelines.
   These experiments were approved by the Second Affiliated Hospital of
   Zhejiang University’s Medical Ethics Committee and Medical Faculty
   Ethics Committee. Informed consent was obtained from all individual
   participants included in the study.

Consent for publication

   All authors have consented to the publication of this manuscript here.

Footnotes

   Publisher’s note Springer Nature remains neutral with regard to
   jurisdictional claims in published maps and institutional affiliations.

   These authors contributed equally: Cong Zeng, Jianchuan Qi.

Contributor Information

   Wei Chen, Email: wei_chen@zju.edu.cn.

   Dajin Chen, Email: zju2001@zju.edu.cn.

   Qunjun Duan, Email: qunjunduan@hotmail.com, Email: qjduan@zju.edu.cn.

Supplementary information

   The online version contains supplementary material available at
   10.1038/s41420-025-02725-0.

References