Abstract
Glial scar formation is a major obstacle to regeneration after spinal
cord injury. Moreover, it has been shown that the astrocytic response
to injury differs between species. Gekko japonicas is a type of reptile
and it shows differential glial activation compared to that of rats.
The purpose of the present study was to compare the proliferation and
migration of astrocytes in the spinal cords of geckos and rats after
injury in vitro. Spinal cord homogenate stimulation and scratch wound
models were used to induce astrocytic activation in adult and embryonic
rats, as well as in adult geckos. Our results indicated that astrocytes
from the adult rat were likely activated by mechanical stimulation,
even though they showed lower proliferation abilities than the
astrocytes from the gecko under normal conditions. Furthermore, a
transcriptome analysis revealed that the differentially expressed genes
in astrocytes from adult rats and those from geckos were enriched in
pathways involved in proliferation and the response to stimuli. This
implies that intrinsic discrepancies in gene expression patterns might
contribute to the differential activation of astrocytes between
species.
Introduction
After spinal cord injury, regeneration and functional recovery of the
damaged area always fails in adult mammals. Major reasons for the
constant failure include the weak ability of axons to regenerate, as
well as the glial scar [[41]1–[42]3]. Many recent studies have
suggested that the injured axons of embryonic or adult members of
warm-blooded species are still capable of regeneration when glial
scarring is inhibited [[43]4]. This indicates that the astroglial
response is crucial for successful regeneration of the spinal cord.
Following spinal cord injury, activated astroglia up-regulate the
expression of intermediate filament proteins (such as glial fibrillary
acidic protein [GFAP]), proteoglycans, and other molecules that are
inhibitory to axon growth. Furthermore, the reactive astrocytes deposit
extracellular matrix molecules (e.g., chondroitin sulfate
proteoglycan[CSPG]) and form the glial scar [[44]5]. Early astroglial
activation plays an important role in the repair process because it
helps re-establish homeostasis by insulating the injury site and
restoring the integrity of the blood-brain barrier [[45]6]. However,
when a glial scar is formed, it also presents a physical and
biochemical barrier that inhibits damaged axons from regenerating and
reestablishing functional connections.
Astroglial activation is differentially responsive depending on the
species. For example, in zebrafish, astrocytes can migrate and bridge
the axon, thus extending through the lesion site after spinal cord
transection [[46]7]. In amphibians, regenerating axons can also pass
through the glial scar after injury [[47]8]. This phenomenon was found
not only in lower vertebrates, but also in fetal or embryonic mammals
[[48]9]. These studies imply that astrocytes might promote an
environment that permits axon extension in lower vertebrates and
embryonic mammals, while in adults, astrocytes produce an environment
that increases scar formation and inhibits neurite growth.
In the current study, we wanted to understand the mechanisms that
underlie the different astrocytic responses to injury. Astroglial
activation has been investigated in fish, amphibians, and mammals;
however, few studies have been conducted in reptiles. Gekko japonicus
is a member of the reptile family, and is a feasible animal model for
studying regeneration because of its remarkable capacity for tail
restoration [[49]10]. Here, we observed that the astrocytic responses
to spinal cord injury in geckos were different from those in rats. To
elucidate the mechanisms underlying these variable astroglial
responses, we isolated astrocytes from adult geckos (A-Gecko AS), adult
rats (A-Rat AS), and embryonic rats (E18-Rat AS), and analyzed the
factors released, as well as the extracellular matrix of the different
astrocytes in an in vitro wound healing model. We further investigated
transcriptomes of the three groups of astrocytes (A-Gecko AS, A-Rat AS,
E18-Rat AS) in hopes that we might discover the molecules and signaling
pathways that contribute to the variability of astroglial activation
between different species.
Materials and Methods
Animal and injury model
Adult Sprague–Dawley rats, embryonic Sprague–Dawley rats (E18), and
adult G. japonicas were obtained from the Experimental Animal Center of
Nantong University. The G. japonicas used in this study were mature
individuals and all were 3±0.5g in weight with an average total body
length (snout to vent) of 5.2 cm, including males and females. They
were freely fed with mealworms and water and housed in an
air-conditioned room with a controlled temperature (22–25°C) and
saturated humidity. All experimental protocols applied to the animals
were approved by the Laboratory Animal Care and Use Committee of our
medical school. Animal models of spinal cord injury were established
using procedures described previously [[50]11]. Briefly, rats were
anesthetized with 1% pentobarbital sodium, and a laminectomy was
applied at the T9 to T10 spinal segment level. The dura was removed and
the T10 spinal segment was completely transected using ophthalmic
scissors. Geckos received a complete spinal cord transection at the
L10–11 lumbar vertebrae level using the same procedure. The severed
ends of the cord typically retracted 3–5 mm (rats) or 1–2 mm (geckos)
and were inspected under a surgical microscope to ensure complete
transection. Incisions were then closed, and animals were placed in a
temperature- and humidity-controlled chamber overnight. Animals were
returned to their cages and allowed to recover for 1 or 4 weeks before
being sacrificed. For sham-operated controls, animals underwent a
laminectomy without transection.
Immunohistochemistry and Nissl staining
Control and injured animals were sacrificed at scheduled times
post-injury, and were perfused intracardially with 4% paraformaldehyde
(PFA) in 0.1 mol/L phosphate buffer solution (PBS). Spinal cords were
removed and post-fixed overnight at 4°C. Fixative was then replaced
with 20% sucrose for 2–3 days and then 30% sucrose for 2–3 days.
Following cryoprotection, spinal cords were embedded in optimum cutting
temperature compound (Sakura Finetek Tissue-Tek, USA), and 10-μm frozen
cross-sections of the spinal cord (2 mm above or below the injury
epicenter) were prepared. Sections were blocked in 10% goat serum with
0.3% TritonX-100 and 1% (w/v) bovine serum albumin for 2 h at room
temperature, followed by overnight incubation at 4°C with polyclonal
anti-GFAP antibody (1:200; Dakocytomation, CA, USA). The next day,
sections were reacted with fluoresce in isothiocyanate
(FITC)-conjugated secondary antibodies for 2 h at room temperature, and
then examined with a DMR fluorescent microscope (Leica Microsystems,
Wetzlar, Germany). For Nissl staining, prepared frozen sections were
mounted onto poly-l-lysine-coated slides, dehydrated with ethanol, and
then treated with xylene for 5 min. After being washed with
double-distilled water, sections were incubated with 1% cresyl violet
(Sigma-Aldrich, St. Louis, MO, USA) solution for 5 min at 50°C and then
dehydrated with ethanol.
Astrocyte culture
Primary astrocytes were prepared from the spinal cords of both adult
and E18 rats, as well as from adult geckos. Spinal cords without the
meninges were enzymatically dissociated and the dispersed cells were
seeded on a 6-cm dish with a density of 1 × 10^5 cells/mL in Dulbecco's
Modified Eagle's Medium (DMEM)/F-12 medium with 10% fetal bovine serum
(FBS) and 1% P-S (Penicillin 100 units/mL, Streptomycin 100 μg/mL). The
osmotic pressure of the culture media for rats was 300–350 mmol/kg
[[51]1, [52]2]. All of the same components were used for the rat and
gecko culture procedures, except that the osmotic pressure of the
culture media for the geckos was 200–260 mmol/kg. Cultures were
incubated with 5% CO[2] at 37°C for rats or at 30°C for geckos.
Astrocyte cultures were examined for cell cycle by flow-cytometric
analysis after synchronization by serum deprivation for 48 h [[53]12].
Synchronized astrocytes of passage 3 were used in this study. The
purity of the astrocytes isolated from geckos and rats was determined
with GFAP immunostaining, and their proliferation rates were evaluated
with bromodeoxyuridine (BrdU) incorporation assays.
Models of astrocytic activation
Spinal cord homogenate (SCH) stimulating model
Spinal cords from geckos and rats without the meninges were placed into
sterile dishes, rinsed with ice-cold PBS, and homogenized in serum-free
DMEM (100 μg/mL) on ice. The tissue was then centrifuged at 12000 rpm
for 15 min at 4°C, and the supernatant was obtained as spinal cord
homogenate (SCH). SCH was then quantified by the BCA protein assay kit
(Pierce, Rockford, IL, USA), and the final concentrations of 5.0 and 50
μg/mL were used to stimulate cultured astrocytes in a 96-well dish.
After the 24-h treatment, cell proliferation was detected by
BrdU-enzyme-linked immunosorbent assays (ELISAs).
Scratch wound model
A scratch wound was made by scraping the cell monolayer with a sterile
100-μL pipette, as described previously [[54]13, [55]14]. We changed
the culture medium immediately after scraping to prevent the medium
from being conditioned with cell debris and factors released from the
detached cells. Wounded cultures were then incubated in DMEM/F-12 and
10% FBS for 4, 24, or 48 h until the following studies were conducted.
At the indicated times, migrating cells at the wound area were
photographed using a DMR inverted microscope (Lexica Microsystems,
Germany), and the percentage of wound healing was measured using
Image-Pro Plus version 6.2 software (Media Cybernetics, Rockville, MD,
USA). Assays were performed three times using triplicate wells.
BrdU-ELISA assay
BrdU labeling solution (10μL/well) was added into 100μLof culture media
(final concentration was 10 μM BrdU). Cells were then re-incubated for
24 h and run through the Cell Proliferation ELISA protocol using the
BrdU Kit (Roche, USA). Optical density (OD) values were obtained by
measuring the absorbance at 450 nm with a micro-plate reader (BioTek,
Winooski, VT, USA). Measurements were repeated at least three times.
Immunofluorescence
After scraping the culture, astrocytes were fixed by 4% PFA at
different time points, and incubated with primary antibodies (anti-GFAP
antibody, 1:500; Dakocytomation; or anti-chondroitin sulfate antibody
[CS-56], 1:200, Abcam) at 4°C overnight. Astrocytes were then rinsed
with PBS, and incubated with a secondary antibody (FITC-goat
anti-rabbit polyclonal, TRITC-goat anti-mouse polyclonal, Sigma) for 2
h at room temperature. Nuclei were counterstained with 4',
6-diamidino-2-phenylindole. To measure the proliferation of astrocytes,
BrdU (1:1000) was added to the culture medium at the different time
points after the scraping injury (12, 24, and 48 h). Procedures were
performed according to instructions described in the
5-Bromo-2′-deoxy-uridine Labeling and Detection Kit I (Roche, USA).
Representative sections were then observed with epifluorescence using a
Leica microscope.
Cell cycle and cell migration assays
The cell cycle assay was performed as described in our previous study
[[56]15]. Briefly, cells (5 × 10^5) were trypsinized, fixed in cold 70%
ethanol for at least 1 h, and stored at -20°C. The fixed cells were
then washed with PBS, treated with RNase (1 mg/mL), and stained with
propidium iodide (50 mg/mL) for 30 min at 4°C, after which DNA content
analysis was performed on an EPICS ELITE flow cytometer (Beckman
Coulter, USA). The cell cycle distribution was analyzed using ModFit
LT2.0 software. Astroctye migration was examined using 6.5 mm transwell
chambers with 8-μm pores (Costar, Cambridge, MA, USA). A 100-μL medium
containing dissociated astrocytes of 2 × 10^4 was then transferred to
the top chambers of each transwell, and 600 μL of complete medium was
added into the lower cell-free chambers. After allowing the cells to
migrate for 16 h, non-migrated cells on the upper surface of each
membrane were cleaned with a cotton swab. Cells adhering to the bottom
surface of each membrane were stained with 0.1% crystal violet, imaged,
and counted using a DMR inverted microscope (Leica Microsystems,
Germany). Assays were performed three times using triplicate wells.
RNA sequencing assays of cultured astrocytes from adult rats, geckos, and E18
rat spinal cords
RNA sequencing for differentially expressed genes
Total RNA was extracted by the Trizol reagent (Invitrogen, USA) from
astrocytes of adult rats, geckos, and E18 rat spinal cords, which were
cultured using the methods described above. Beads with oligo (dT) were
used to isolate poly(A) mRNA after the total RNA was collected.
Fragmentation buffer was then added to cut the mRNA into short
fragments, which were used as templates. Random hexamer primers were
used to synthesize first-strand cDNA, while second-strand cDNA was
synthesized using a mixture of buffer, dNTPs, RNase H, and DNA
polymerase I. Short fragments were purified with QiaQuick polymerase
chain reaction (PCR) extraction kits and resolved with elution buffer
for end repair and the addition of poly(A). Next, the short fragments
were connected with sequencing adaptors. For amplification with PCR, we
selected suitable fragments as templates based on agarose gel
electrophoresis. Finally, libraries were sequenced using
IlluminaHiSeq2000 (Illumina, USA).
Using the SOAP program (BGI-Shenzhen, China) [[57]16], clean reads were
mapped to the reference genomes and gene sequences. No more than five
mismatches were allowed in the alignment. Proportions of the clean
reads were then mapped back to the genome and genes, providing an
overall assessment of the sequencing quality.
Annotation of the transcriptome was obtained by blasting the reference
sequences that we already had. We defined gene coverage as the
percentage of a gene covered by the reads, which was equivalent to the
ratio of the number of bases in a gene covered by unique mapping reads
to the number of total bases in that gene. The calculation of gene
expression used the reads per kilobase of transcript per million reads
mapped (RPKM) method [[58]17], as follows:
[MATH:
RPKM=106CNL/103 :MATH]
There were 5230 differentially expressed genes (DEGs) between the cells
from the embryonic rat and the cells from the adult rat, including 54
DEGs without any annotation. These DEGs were used as a benchmark for
examining possible expression patterns in the three sample groups.
Gene ontology (GO) and functional enrichment analyses
GO and functional enrichment analyses mapped all genes to GO terms in
the database ([59]http://www.geneontology.org/) by calculating gene
numbers for every term [[60]18]. We then used an ultra-geometric test
to find significantly enriched GO terms in the target gene list
compared to the genomic background using the following formula:
[MATH: P=1−∑i=0m−1<
mrow>(Mi
)(N−M
n−i)
(Nn
) :MATH]
where N denotes the total number of genes with a GO annotation, and n
is the number of target genes in N. M indicates the total number of
genes that are annotated to certain GO terms, and m is the number of
target genes in M. The calculated p-value went through Bonferroni
correction with a threshold-corrected p-value of ≤0.05. GO terms
fulfilling this condition were considered to have significantly
enriched GO terms.
Kyoto encyclopedia of genes and genome-based (KEGG) pathway enrichment
analyses
The Kyoto encyclopedia of genes and genome-based (KEGG) pathway is the
major public pathway-related database. We used the pathway enrichment
analysis to identify significantly enriched metabolic pathways or
signal transduction pathways in the target gene list compared with the
whole genomic background [[61]19]. We employed the same formula that
was used for the GO analysis, but N was the number of all genes in the
KEGG annotation, n was the number of genes in N, M was the number of
all genes annotated to specific pathways, and m was the number of genes
in M.
Real-time quantitative PCR analysis
The total RNA was isolated from cells using the methods described
above. The first-strand cDNA was synthesized using an Omniscript
Reverse Transcription Kit (Qiagen, Netherlands) in a 20-μL reaction
system containing 2 μg total RNA. The 1-μL aliquot of the first-strand
cDNA was amplified using primers designed to investigate the expression
of target genes by real-time PCR. The reaction mixtures included 10 μL
of 2× Fast Evagreen qPCR Master Mix (Biotium, USA), 2 μL of 10× ROX
(Biotium), gene-specific primers at a final concentration of 0.5 μM,
and 1 μL of cDNA. Real-time PCR was performed in a StepOne real-time
PCR system (ABI Applied Biosystems, USA). The thermal cycling program
consisted of 2 min at 96°C, followed by 45 cycles of 15 s at 96°C and 1
min at 60°C. Data collection was performed during the 60°C extension
step. To account for variability in the total RNA input, the expression
of the target genes was normalized to that of the EF1α gene. In
addition, a negative control without first-strand cDNA was prepared.
The relative expression was calculated using the comparative 2^−ΔΔCt
method.
Statistical analysis
Data are expressed as the mean ± the standard deviation (SD).
Differences between groups were analyzed by one-way analyses of
variance (ANOVAs) using the SPSS software (IBM, USA). Statistical
significance was set at p< 0.05. In this study, each experiment was
repeated at least three times.
Results
Differences between adult G. japonicus and adult rats in terms of astroglial
activation following spinal cord injury
In all animals, the spinal cord was transected at the superior border
of the intumescentia lumbalis. In G. japonicus this region was on the
10^th lumbar vertebra, while in the rat this area was on the 9^th
thoracic vertebra. Cross sections from tissue located one vertebra away
from the injury site were prepared for Nissl and GFAP staining. Nissl
staining was employed to observe gray and white matter morphology in
the proximal and distal stumps. GFAP, an intermediate filament, was
used because of its involvement in the formation of glial scars
[[62]20]. In adult rats, GFAP expression continuously increased until 4
weeks after spinal cord injury, while in G. japonicus GFAP expression
was higher at 1 week after SCI and decreased 4 weeks after the
operation ([63]Fig 1). The results are consistent with the previous
reports about the GFAP expression pattern after spinal cord transection
[[64]21, [65]22], and indicate that astroglial activation was
attenuated in adult G. japonicus compared to in adult rats.
Fig 1. Gliosis after spinal cord injury is different in rats and Gekko
japonicus.
[66]Fig 1
[67]Open in a new tab
Nissl staining (A, B) and glial fibrillary acidic protein (GFAP)
immunehistochemical analysis (C, D) of adult geckos (A, C) and adult
rats (B, D) after spinal cord transection (n = 6 per group). GFAP
staining is shown in panels C and D. GFAP expression in activated
astroglia was observed at 1 week post-injury in both adult geckos and
rats. In geckos, the GFAP level was weakened at 4 weeks post-injury,
while GFAP in adult rats was still strong 4 weeks post-injury.
The different astrocytic responses to external stimuli between species may
have endogenous origins
Spinal cord injury induced astrocytic activation in all of the animal
models used, however, differences were observed between astrocytes
derived from G. japonicus and those derived from adult rats ([68]Fig
1). We wanted to explore the cause of this difference; more
specifically, whether it was caused by the astrocytes or by an external
stimulus. It is well known that astrocytes are activated following
spinal cord injury [[69]23]. Therefore, we prepared SCHs from both
adult geckos and adult rats, which served as the external stimuli, and
further tested whether these homogenates could stimulate the cell
proliferation of astrocytes in G. japonicus or in rats. The SCHs (with
concentrations of 5 and 50 μg/mL) of adult geckos were applied to
astrocytes from adult geckos or adult rats, while the SCHs (with
concentrations of 5 and 50 μg/mL) of adult rats were applied to
astrocytes from adult geckos or adult rats. A BrdU-ELISA assay was then
used to determine the cell proliferation of gecko and rat astrocytes
after SCH treatment. The OD values were also obtained.
Given that the proliferation rates of rat and gecko astrocytes might be
different, the capacity of these astrocytes to respond to the extrinsic
stimulus should be evaluated with the ratio (proliferation rate after
treatment/proliferation rate before treatment) variation. The OD values
of the adult rat astrocytes (A-Rat AS) were normalized to 1, and the OD
values in the A-Rat AS treated with SCH were calculated by dividing by
the OD value of control A-Rat AS. The data for the cell proliferation
in gecko astrocytes upon SCH treatment were handled in the same way. As
shown in [70]Fig 2, we found that the proliferation of A-Rat AS
increased in a dose dependant manner when treated with rat SCHs
(control = 1 ± 0.15, SCH [5 μg/mL] = 1.29 ± 0.09, SCH [50 μg/mL] = 1.56
± 0.13). However, no difference was observed when adult gecko
astrocytes (A-Gecko AS) were treated with rat SCHs (control = 1 ± 0.17,
SCH [5 μg/mL] = 1.01 ± 0.07, SCH [50 μg/mL] = 1.02 ± 0.06). A-Rat AS
also showed differences when they were treated with gecko SCHs (control
= 1 ± 0.07, SCH [5 μg/mL] = 1.24 ± 0.11, SCH [50 μg/mL] = 1.40 ± 0.08).
However, treating A-Gecko AS with gecko SCHs yielded no difference
(control = 1 ± 0.07, SCH [5 μg/mL] = 1.02 ± 0.06, SCH [50 μg/mL] = 1.10
± 0.08). In sum, these results show that the proliferation of rat
astrocytes was promoted by different concentrations of SCHs (5 and 50
μg/mL) from either adult rats or geckos, while no notable changes were
observed when gecko astrocytes were treated with the SCHs of adult rats
or geckos ([71]Fig 2). Thus, we speculate that the different astrocytic
responses to the external SCH stimuli might be due to the endogenous
properties of the astrocytes themselves.
Fig 2. Spinal cord homogenates (SCHs) stimulated the proliferation of rat
astrocytes, but not gecko astrocytes.
[72]Fig 2
[73]Open in a new tab
Different concentrations of SCHs from adult rats stimulated the
proliferation of cultured adult rat astrocytes (A-Rat AS), but had no
effect on the proliferation of cultured adult gecko astrocytes (A-Gecko
AS) (A). SCHs from Gekko japonicus stimulated the proliferation of
A-Rat AS, but had no effect on A-Gecko AS (B). The optical density (OD)
value was measured, and data are represented as the mean ± the standard
deviation (SD). Data were normalized, as described in the results. **p
< 0.01 vs. control; *p < 0.05 vs. control; ns = no significant change
vs. the control.
In vitro activation of gecko astrocytes differs from the astrocytic
activation of adult rats
Next, we investigated whether astrocytic activation in geckos and rats
differed when using the in vitro wound healing model. The above data
indicate that the intrinsic properties of astrocytes from geckos are
different from those of rats, suggesting phylogenetic discrepancies in
the astrocytes from different species. It is well known that the
ability to regenerate after spinal cord injury is observed not only in
lower vertebrates, but also in fetal or embryonic mammals. Thus, we
also wanted to know if astrocytes from embryonic rats (E18-Rat AS) are
more similar to the A-Gecko AS or to the A-Rat AS.
In order to address this, we performed scratch assays combined with
BrdU to evaluate the capacity of proliferation and/or migration of
different astrocytes that contribute to gliosis after spinal cord
injury. As shown in Fig [74]3A and [75]3B, 4 h after we induced a
scratch wound, A-Gecko AS exhibited no significant difference in the
percent of wound healing (12.3% ± 1.9) compared to the rat astrocytes
(A-Rat AS = 10.1% ± 1.7; E18-Rat AS = 8.8% ± 1.4). This pattern changed
at 24 h after the scratch wound introduced. A-Gecko AS exhibited
obvious delays in the percent of wound healing (A-Rat AS = 65.3% ± 4.5,
E18-Rat AS rat = 48.7% ± 3.8, and A-Gecko AS = 17.6% ± 2.0). After 48
h, when the adult rat astrocytes fully covered the wounded zone (90% ±
3.3), the A-Gecko AS had just begun to occupy the wounded region (33.7%
± 3.8). The migration abilities of E18-Rat AS were between those of
adult rats and geckos, and showed 71.3% (± 5.1) recovery.
Fig 3. Astrocytic responses from adult and embryonic rats and geckos after in
vitro scratch wound.
[76]Fig 3
[77]Open in a new tab
The responses in adult rat astrocytes (A-Rat AS) were different from
that of astrocytes from embryonic rats (E18-Rat AS) and adult geckos
(A-Gecko AS). (A) Representative images of wound healing combined with
BrdU assays at 4, 24, and 48 h. A-Gecko AS showed obvious delays in
covering the wound and decreased proliferation abilities compared with
A-Rat AS. For E18-Rat AS, the capacity for proliferation and migration
was between that of adult rats and geckos. (B) Graph showing the
percentage of cell migration in the cleaned space at 4, 24, and 48 h
after the scratch wounding. (C) Graph showing the percentage of
BrdU-positive cells that migrated into the cleaned space at 4, 24, and
48 h after the scratch wounding. Data are represented as the mean ± SD.
**p < 0.01, *p < 0.05 vs. A-Rat AS. (D, E) the expression of GFAP and
CSPG after scratch injury. GFAP expression in astrocytes from the adult
rat, embryonic rat, and adult gecko increased following injury. The
extent of the increase was highest in A-Rat AS, and lowest in A-Gecko
AS. In addition, GFAP expression ceased to increase after 24 h in
E18-Rat AS and A-Gecko AS, while GFAP expression remained high in A-Rat
AS. CSPG expression was observed in all three groups, but did not show
obvious variations after injury.
Results of the BrdU assay showed (Fig [78]3A and [79]3C) that, at 4 h
after the scratch wound, there was no difference in labeling between
the astrocytes of all three groups (adult rat = 8.6% ± 1.2; E18 rat =
7.5% ± 1.3; adult gecko = 8.7% ± 1.1). At 24 and 48 h after injury, the
percentages of BrdU-positive cells in A-Rat AS (55.6% ± 5.1 and 91.8% ±
7.0, respectively) were significantly increased compared to the A-Gecko
AS (38.8% ± 4.6 and 70.6% ± 5.4, respectively). Thus, at 24 and48 h
after scratch injury the proliferation of A-Gecko AS was reduced by
30.2% and 23.1%, respectively, when compared to the proliferation of
A-Rat AS. However, no significant changes in astrocytic proliferation
were observed between adult rats and E18 rats after the scratch wound
(at 24 and 48 h, percentage of proliferating A-Rat AS = 55.6% ± 5.1 and
91.8% ± 7.0, respectively; E18-Rat AS = 49.0% ± 5.8 and 89.2% ± 7.0,
respectively).
Increased expression of the intermediate filament GFAP and
extracellular matrix molecules (such as CSPG) is a well-known index of
astrocytic activation [[80]2]. Therefore, we determined the expression
patterns of these two molecules in astrocytes derived from all three
animal models after the scratch injury. We found that GFAP expression
in the three groups increased, and that the extent of the increase was
highest in the A-Rat AS, and lower in the E18-Rat and A-Gecko AS
([81]Fig 3D). In addition, GFAP expression ceased to increase after 24
h in E18-Rat and A-Gecko AS, while GFAP expression remained high in
A-Rat AS after 24 h. CSPG is known to contribute to glial scar
formation after injury, thus acting as a barrier against new axonal
growth into the damaged site. However, in the in vitro scratch model,
CSPG expression (shown in [82]Fig 3E) was observed in all three groups,
and did not show obvious variations after injury.
Under normal culture conditions in vitro, gecko astrocytes had more cells in
the S stage of the cell cycle and showed poorer migratory abilities than rat
astrocytes
After the scratch injury, we observed that A-Rat AS proliferated and
migrated more rapidly than A-Gecko AS. Thus, we wondered whether this
was also the case under normal conditions. In order to address this, we
performed flow cytometry and transwell assays to evaluate the cell
cycles of astrocytes and their migration capacities under normal
conditions. Cell cycle analysis showed that cultured astrocytes from
adult rats, E18 rats, and adult geckos presented with 9.35% ± 0.03,
24.05%± 0.05, and 14.47% ± 0.07, respectively, of their cells in the S
stage. In the transwell assay, the number of migrated astrocytes from
adult rat spinal cords was about 3 times that of E18 rats and 18 times
that of adult geckos (E18-Rat AS = 32.7% ± 5.4 and A-Gecko AS = 5.5% ±
1.8; shown in [83]Fig 4). These results suggest that, under normal
conditions, astrocytes from adult gecko spinal cords have higher
proliferation and lower migration than astrocytes in rats. These
results raised an interesting question. Given that A-Rat AS have lower
proliferation abilities, but exhibit greater improvement in response to
external stimuli, we wondered whether astrocytes from different species
or different development stages possess different gene expression
patterns.
Fig 4. Under normal conditions, astrocytes from geckos showed poor migration
abilities compared to astrocytes from rats.
[84]Fig 4
[85]Open in a new tab
A–C show representative transwell images of cresyl violet staining in
astrocytes from the adult rat (A-Rat AS) (A), embryonic rat E18-Rat AS
(B), and adult gecko (A-Gecko AS) (C). (D) Graph showing transferred
cells of three kinds of astrocytes, data are represented as the mean ±
SD, compared to A-Rat AS, **p<0.01.
Transcriptome analysis of astrocytes from adult rats, adult geckos, and
embryonic rats
RNA sequencing-based global transcriptome analysis provides a
comprehensive view of the expression pattern of cells and tissues
[[86]24]. Here, we investigated the transcriptomes of astrocytes
derived from adult rats, adult geckos, and E18 rat spinal cords, and
aimed to determine differences in their expression profiles. We
presumed that if differences were identified, they might contribute to
the differential response to injury observed between the species.
Comparing data across species is always challenging owing to
differences in their genetic background. Therefore, comparisons were
focused on DEGs between astrocytes from adult and embryonic rats. We
also aimed to determine which of the DEG expression profiles (adult
versus embryonic) was more similar to A-Gecko AS. We first identified
5230 DEGs between the astrocytes from adult and embryonic rats. Among
these DEGs, 1585 genes showed higher or lower expression (more than
2-fold differences) in A-Rat AS versus E18-Rat AS and A-Gecko AS
([87]S1 File). A KEGG analysis of these 1585 genes showed that the most
frequently involved pathways were those relating to cancer,
arrhythmogenic right ventricular cardiomyopathy, axon guidance, and
tight junction formation ([88]Table 1). Moreover, a GO term enrichment
comparison revealed that the biological processes of development, cell
adhesion, and responses to stimuli were significantly enriched in the
DEGs ([89]Fig 5). These data indicate that astrocytes from adult rats
and G. japonicus respond differently because of intrinsic
discrepancies. Moreover, these findings suggest that A-Gecko AS share
characteristics with E18-Rat AS.
Table 1. The Kyoto encyclopedia of genes and genome-based (KEGG) pathway
enrichment assay of differentially expressed genes between astrocytes from
adult geckos, embryonic rats, and adult rats.
KEGG pathway Gene counts
Metabolism 20
Propanoate metabolism 8
Inositol phosphate metabolism 12
Environmental Information Processing 117
Wnt signaling pathway 28
Hedgehog signaling pathway 11
TGF-beta signaling pathway 17
Phosphatidylinositol signaling system 17
ECM-receptor interaction 19
Cell adhesion molecules (CAMs) 25
Cellular Processes 94
Focal adhesion 36
Adherens junction 17
Tight junction 26
Gap junction 15
Organismal Systems 97
Leukocyte transendothelial migration 28
Vascular smooth muscle contraction 21
Aldosterone-regulated sodium reabsorption 9
Long-term depression 13
Axon guidance 26
Human Diseases 184
Pathways in cancer 57
Colorectal cancer 15
Glioma 12
Melanoma 14
Small cell lung cancer 15
Non-small cell lung cancer 12
Hypertrophic cardiomyopathy (HCM) 19
Arrhythmogenic right ventricular cardiomyopathy (ARVC) 21
Dilated cardiomyopathy (DCM) 19
[90]Open in a new tab
Differentially expressed genes (DEGs) between astrocytes from adult and
embryonic rats were identified first. Among these DEGs, 1585 genes were
further investigated for higher or lower expression levels (more than 2
folds) in astrocytes from adult and embryonic rats, as well as
astrocytes from adult geckos. The table shows the most frequently
involved pathway of these 1585 genes (determined by the KEGG analysis).
Italicized bold pathways belong to the top five most frequent involved
pathways.
Fig 5. The gene ontology (GO) term enrichment analysis of differentially
expressed genes (DEGs).
[91]Fig 5
[92]Open in a new tab
DEFs between astrocytes from adult geckos, embryonic rats, and adult
rats were examined. 5230 DEGs between the astrocytes from adult and
embryonic rats were identified. Among these DEGs, 1585 genes showed
higher or lower expression (more than 2-fold differences) in astrocytes
from the adult rat versus astrocytes from the ebryonic rat and adult
gecko. Pie charts show the GO term and its relation to various
biological processes, molecular functions, and cellular components.
Cell signaling via fibroblast growth factor receptors (FGFRs) is known
to mediate a variety of cellular responses including cell
proliferation, differentiation, and migration [[93]25]. Additionally,
to confirm the RNA sequencing-based global transcriptome analysis, we
chose FGFR1 and FGFR2 as the representative genes involved in scar
formation/proliferation, and we confirmed their changes using real-time
quantitative PCR ([94]Fig 6). All primers were list in [95]Table 2. The
results showed that the expression of FGFR1 or FGFR2 mRNA in A-Gecko AS
is lower than the expression of FGFR1 and FGFR2 in A-Rat and E18-Rat
AS, which is consistent with the data in the RNA sequencing-based
global transcriptome analysis. The gene expressions of three kinds of
astrocytes were evaluated by the value of the reads per kilobase of
transcript per million reads (RPKM). The RPKMs of FGFR1 were
154.2603955, 52.41731918, and 12.38431737 in A-Rat AS, E18-Rat AS and
A-Gecko AS respectively, and those of FGFR2 were 26.09732716,
6.926015988, and 0.594580287 in the above astrocytes (supplied in
[96]S1 File).
Fig 6. Relative fibroblast growth factor receptor 1 (FGFR1) and FGFR2 mRNA
expression.
[97]Fig 6
[98]Open in a new tab
The expression of FGFR1 and FGFR2 in cultured adult rat astrocytes
(A-Rat AS), embryonic rat astrocytes (E18-Rat AS), and adult gecko
astrocytes (A-Gecko AS) was examined. The EF1α gene served as an
internal control. Graphic representation of the real-time PCR results
in different astrocytes; **p < 0.01.
Table 2. DNA sequences of primers used for real time quantitative PCR in this
study.
Gene Name Sequence (5'→3')
Rat EF1α sense 5'- gcggggacaagaaggtcat -3’
Rat EF1α antisense 5'- tacggcagtctggtgtacaaat-3’
Rat FGFR1 sense 5'- gcacctgaggcattgtttga -3'
Rat FGFR1 antisense 5'- gcttgtccattcgatgaccc -3'
Rat FGFR2 sense 5'- gcagttggtggaagacttgg -3'
Rat FGFR2 antisense 5'- ataaggcatggggtctggag-3'
Gecko EF1α sense 5'- gatggaaagtgacccgca -3'
Gecko EF1α antisense 5'-gaggaagacgcagaggtttg-3'
Gecko FGFR1 sense 5'-ggtcctttggtgttctgctg -3'
Gecko FGFR1 antisense 5'-gaaggaacagcatgccaaca -3'
Gecko FGFR2 sense 5'-gcagttggtggaagacttgg -3'
Gecko FGFR2 antisense 5'-ataaggcatggggtctggag -3'
[99]Open in a new tab
Discussion
Lower vertebrates and developing higher mammals have the potential to
regenerate injured or lost tissues, including tissues within the
central nervous system. However, this capability decreases with
evolution and development, and is thus very limited in adult mammals.
Moreover, the underlying mechanisms of tissue regeneration are still
poorly understood. Previous studies have indicated that the presence of
more progenitor cells, less cell death, and fewer glial scars increase
the regenerative capacity after spinal cord injury in adult lower- and
embryonic higher-vertebrates [[100]9, [101]26]. Glial scarsare composed
of activated astrocytes and inhibitory matrix molecules. In the current
study, we compared the activation and proliferation of astrocytes from
adult rats, embryonic rats, and adult geckos after in vitro injury. We
found that A-Rat AS were much more sensitive to injury than E18-Rat AS
and A-Gecko AS. While the molecular mechanisms of astrogenesis are not
completely understood, it is widely accepted that external factors such
as cytokines (small molecules released after cell injury) are the major
cause of glial scar formation [[102]27]. Moreover, it has been shown
that these molecules can directly or indirectly lead to astrocytic
activation. Our study indicated that the properties of astrocytes are
important for astrogliosis, as astrocytes can initiate astrogliosis. To
our knowledge, this is the first comparative study of astrogliosis
between mammals and reptiles. Moreover, we found that the phylogeny and
developmental stage both showed discrepant astrocytic responses to an
external stimulus. These results suggest that modulating the astrocytic
response could prove useful for treating injuries to the central
nervous system.
To further illustrate the intrinsic properties of astrocytes from the
various animal models, we performed transcriptome analyses and found
that A-Gecko AS shared similar expression patterns with E18-Rat AS. GO
term and KEGG pathway enrichment analyses of astrocytic DEGs revealed
that these genes were involved in cellular behaviors such as migration,
proliferation, and the response to stimuli. These data support the view
that astrocytes from lower species exhibit different responses to
injury. Moreover, this discrepancy could explain the greater
regenerative capacity of some animals after spinal cord injury. The
various properties of the astrocytic response to injury revealed in
this study are extremely compelling, especially when compared to
astrocytes under normal conditions. Thus, future studies will need to
validate the roles of the DEGs obtained from activated astrocytes in
order to employ these genes to in vitro and/or in vivo models of
astrogliosis.
Supporting Information
S1 File. DEGs of 1585 genes, KEGG analysis and GO term enrichment in
A-Rat AS versus E18-Rat AS and A-Gecko AS.
(XLSX)
[103]Click here for additional data file.^ (202.6KB, xlsx)
Data Availability
All relevant data are within the paper and its Supporting Information
files.
Funding Statement
This study was supported by the grants to ML from NSFC (31171007), NSF
of Education department of Jiangsu province (11KJA180004), and the
Starting Foundation for Returned Overseas Chinese Scholars, the funding
from PAPD of Jiangsu Higher Education Institutions; and a grant from
NSFC (31071874) to YL. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the
manuscript.
References