Abstract Recently, several thousand people have been killed by the Ebolavirus disease (EVD) in West Africa, yet no current antiviral medications and treatments are available. Systematic investigation of ebolavirus whole genomes during the 2014 outbreak may shed light on the underlying mechanisms of EVD development. Here, using the genome-wide screening in ebolavirus genome sequences, we predicted four putative viral microRNA precursors (pre-miRNAs) and seven putative mature microRNAs (miRNAs). Combing bioinformatics analysis and prediction of the potential ebolavirus miRNA target genes, we suggest that two ebolavirus coding possible miRNAs may be silence and down-regulate the target genes NFKBIE and RIPK1, which are the central mediator of the pathways related with host cell defense mechanism. Additionally, the ebolavirus exploits the miRNAs to inhibit the NF-kB and TNF factors to evade the host defense mechanisms that limit replication by killing infected cells, or to conversely trigger apoptosis as a mechanism to increase virus spreading. This is the first study to use the genome-wide scanning to predict microRNAs in the 2014 outbreak EVD and then to apply systematic bioinformatics to analyze their target genes. We revealed a potential mechanism of miRNAs in ebolavirus infection and possible therapeutic targets for Ebola viral infection treatment. __________________________________________________________________ The genus Ebolavirus belongs to the family Filoviridae and order Mononegavirales, where the members of this genus are called ebolaviruses[44]^1. The Ebolavirus (EBOV, formerly designated “Zaire ebolavirus”) is one of the five known Ebolaviruses. EBOV cause Ebolavirus disease (EVD) in humans and other mammals. EVD is a type of hemorrhagic fever having a high case fatality rate[45]^2. From March 2014 to October 2014, the Ebola outbreak in West Africa has sickened 8,399 people, killing 4,033 of them[46]^3. This is the largest EBOV outbreak in the history[47]^4. Each month, several thousand people from affected areas travel to the North America, and even more travellers enter and leave Europe, other parts of Africa, and Asia[48]^5. Such air travel situations increase the possibility of EVD transmission. The United States and France have reported that several patients tested positive for Ebola[49]^3,[50]^4,[51]^5,[52]^6. Moreover, no current antiviral medications are available for EBOV[53]^7, and no effective EVD treatment exists at this time[54]^8. MicroRNAs (miRNAs) are small regulatory non-coding RNAs, ranging from 19 to 24 nucleotides, that post-transcriptionally regulate target gene expression by inhibiting the translation of mRNA transcripts or cleaving them[55]^9,[56]^10,[57]^11,[58]^12. While encoded not only by cellular genomes but also by viral genomes[59]^13,[60]^14,[61]^15, miRNAs play a vital role in numerous cellular processes, including cell metabolism, viral infection, and antiviral immune response[62]^16,[63]^17. Viral miRNAs are mostly identified by traditional cloning from virus-infected cells[64]^18,[65]^19,[66]^20. Computational prediction and hybridization analysis are also applied to viral miRNA identification[67]^21,[68]^22. For known viral miRNAs, the majority of them are encoded by DNA viruses while only a few derived from RNA viruses[69]^23,[70]^24. To date, the RNA virus-encoded miRNAs have been identified in a few retroviruses including bovine leukemia vius (BLV)[71]^25,[72]^26, human immunodeficiency virus (HIV)[73]^25, West Nile virus (WNV)[74]^27, Dengue virus[75]^28 and hepatitis A virus (HAV)[76]^23. Recently, Liang et al.[77]^24 have identified two EBOV miRNAs, which means that EBOV can encode functional miRNAs. Unlike the method used by Liang et al.[78]^24, based on bioinformatics whole genome-wide scanning and screening, we predicted the potential mature 2014 EBOV miRNAs, their target genes, and related signaling pathways. To the best of our knowledge, this is the first paper to systemic genome-wide analyze and predict the potential non-coding RNAs in the 2014 outbreak EBOVs along with their target genes. The results show several target genes regulated by the possible miRNAs may have important functions in human immune and antiviral response systems. Our research helps to further assess the roles of the 2014 outbreak EBOV miRNAs and their potential targets during viral infection and virus-host interactions, and thus to speed up the process of effective EVD treatment development. Results Alignment of EBOV whole genomes and prediction of mature EBOV miRNAs As shown in [79]Fig. 1A, we first aligned the complete genome sequences of the 102 human EBOV strains acquired from the 2014 outbreak[80]^29. The mutation sites were all highlighted in different colors[81]^30. Four real microRNA precursor candidates, with the names of EBOV-pre-miRNA-T1, EBOV-pre-miRNA-T2, EBOV-pre-miRNA-T3 and EBOV-pre-miRNA-T4, were picked out. Their sequences are listed in [82]Table 1. EBOV-pre-miRNA-T1 is 136-base long, EBOV-pre-miRNA-T2 is 80-base long, EBOV-pre-miRNA-T3 is 99-base long, and EBOV-pre-miRNA-T4 is 99-base long. Their locations were marked in [83]Fig. 1B. The start position of EBOV-pre-miRNA-T1 is 653, while its end position is 788. EBOV-pre-miRNA-T2 is located between the position of 4373 and of 4452. EBOV-pre-miRNA-T3 is at the range between 488 and 586. EBOV-pre-miRNA-T4 is located from the position of 479 to 568. Seven different mature EBOV miRNA candidates were predicted using the four EBOV miRNA precursor candidates. The sequences of the eight mature EBOV miRNAs are listed in [84]Table 2, where EBV-miR-T3-5p has the same sequence with EBV-miR-T4-5p. Their lengths are all 22-base long. By aligning and blasting the seven miRNAs, including EBV-miR-T1-5p, EBV-miR-T1-3p, EBV-miR-T2-5p, EBV-miR-T2-3p, EBV-miR-T3-5p, EBV-miR-T3-3p, EBV-miR-T4-5p and EBV-miR-T4-3p, to other species of viral or host miRNAs, only EBV-miR-T3-5p has some similar miRNAs. We analyzed the conservation between EBV-miR-T3-5p and its similar miRNAs, which is described in the [85]Table 3. A flowchart describing the computational prediction of the putative miRNAs is shown in [86]Fig. 2. Figure 1. [87]Figure 1 [88]Open in a new tab The 102 complete genome sequences alignment of the 2014 outbreak EBOV. (A) Full alignment map of all 102 EBOV complete genomes. (B) Locations and putative target sites of the four real miRNA precursor candidates. Table 1. The predicted pre-miRNAs in EBOV. Pre-miRNA Strand Start Position End Position Length Sequence (5′-3′) EBOV-pre-miRNA-T1 Plus 653 788 136 UUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUAC AAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAA EBOV-pre-miRNA-T2 Plus 4373 4452 80 AACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUU GUAAACGUU EBOV-pre-miRNA-T3 Plus 488 586 99 GGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAA CAGGGGAUUGUUCGGCAAAGAGUCAUCC EBOV-pre-miRNA-T4 Plus 479 568 99 GGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAA CAGGGGGUUGUUCGGCAAAGAGUCAUCC [89]Open in a new tab Table 2. The predicted mature miRNAs in EBOV. The EBV-miR-T3-5p and EBV-miR-T4-6p have the same sequences, which are highlighted in grey color. graphic file with name srep09912-t2.jpg [90]Open in a new tab Table 3. Alignment of Query (EBV-miR-T3-5p) to mature miRNAs. graphic file with name srep09912-t3.jpg [91]Open in a new tab Figure 2. Figure 2 [92]Open in a new tab Workflow of the 2014 outbreak EBOV-encoded miRNA prediction. The MiPred algorithm was used to identify genuine pre-miRNAs, and the MatureBayes tool was used to predict the mature miRNA sequences. Structures of potential EBOV pre-miRNAs and mature miRNAs In order to achieve more accurate prediction, we predicted the primary, secondary, and tertiary structure of the four potential EBOV pre-miRNAs[93]^31,[94]^32. RNAfold was used to predict consensus secondary structures of the pre-miRNAs. Attempts to fold these pre-miRNAs, along with their flanking sequences, into the expected hairpin structures were successful in candidates EBOV-pre-miRNAs-T1, EBOV-pre-miRNAs-T2, EBOV-pre-miRNAs-T3 and EBOV-pre-miRNAs-T4, while other pre-miRNAs failed to fold into any form of stable RNA structures because that they could only give rise to stem-loops that were too short to be authentic pre-miRNA stem-loops. These findings led us to believe that EBOV-pre-miRNAs-T1, EBOV-pre-miRNAs-T2, EBOV-pre-miRNAs-T3 and EBOV-pre-miRNAs-T4 are indeed authentic EBOV pre-miRNAs. The optimal secondary structures in dot-bracket notation with a minimum free energy of −39.4 kcal/mol of EBOV-pre-miRNA-T1, −18.8 kcal/mol of EBOV-pre-miRNA-T2, −33.51 kcal/mol of EBOV-pre-miRNA-T3 and −31.91 kcal/mol of EBOV-pre-miRNA-T4 are given in [95]Fig. 3A,B shows the predicted hairpin structures of confirmed EBOV pre-miRNAs. Hairpins longer than 100 nt were truncated; these hairpins are indicated by a double slash preceding the stem. Furthermore, the 3D structures of the potential EBOV pre-miRNAs were computationally predicted. Even though EBOV-pre-miRNA-T3 and EBOV-pre-miRNA-T4 have similar 2D structures[96]^31, they own different 3D structures ([97]Fig. 3C). The positions of possible mature miRNAs were colored in second and tertiary structures ([98]Figs. 3B,C)[99]^32. For EBOV-pre-miRNAs-T1, EBOV-pre-miRNAs-T2, EBOV-pre-miRNAs-T3 and EBOV-pre-miRNAs-T4 alternative predictions, which are likely to represent the authentic stem-loop structures recognized and cleaved by Drosha are shown underneath the minimal energy structures. Figure 3. [100]Figure 3 [101]Open in a new tab Predicted hairpin structures of potential EBOV pre-miRNAs. (A) The primary structures of the four EBOV pre-miRNAs. (B) The secondary structures of the four EBOV pre-miRNAs. (C) The tertiary structures of the four EBOV pre-miRNAs. Bioinformatics analysis of mature EBOV miRNAs and prediction of their target genes Based on the sequences of the seven EBOV miRNAs, EBV-miR-T1-5p, EBV-miR-T1-3p, EBV-miR-T2-5p, EBV-miR-T2-3p, EBV-miR-T3-5p, EBV-miR-T3-3p, EBV-miR-T4-5p and EBV-miR-T4-3p, their target genes were searched by TargetScan[102]^33 and the other miRNA regulation database (the integration database of miRecords, TarBase, starbase, and miR2Disease)[103]^34,[104]^35,[105]^36,[106]^37. All these potential mature miRNAs have total 138 possible target genes in human genome ([107]Table 4). Interestingly, the genes P11, EFNA3, FKRP, AMBRA1, HEPACAM, HCCA2, LPHN1 and PHF21B were all targeted by at least two potential mature EBOV miRNAs. Table 4. The list of possible target genes. Gene Name Gene ID Human Symbol ABCC13 150000 ABCC13 (ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene) ADNP2 22850 ADNP2 (ADNP homeobox 2) ADRA2B 151 ADRA2B (adrenoceptor alpha 2B) ADTRP 84830 ADTRP (androgen-dependent TFPI-regulating protein) AHR 196 AHR (aryl hydrocarbon receptor) ALDH3B1 221 ALDH3B1 (aldehyde dehydrogenase 3 family, member B1) AMBRA1 55626 AMBRA1 (autophagy/beclin-1 regulator 1) AMICA1 120425 AMICA1 (adhesion molecule, interacts with CXADR antigen 1) ARFIP1 27236 ARFIP1 (ADP-ribosylation factor interacting protein 1) ARHGAP27 201176 ARHGAP27 (Rho GTPase activating protein 27) ATXN10 25814 ATXN10 (ataxin 10) BEST4 266675 BEST4 (bestrophin 4) C2orf27A 29798 C2orf27A (chromosome 2 open reading frame 27A) CA7 766 CA7 (carbonic anhydrase VII) CA9 768 CA9 (carbonic anhydrase IX) CABP7 164633 CABP7 (calcium binding protein 7) CBX4 8535 CBX4 (chromobox homolog 4) CCL21 6366 CCL21 (chemokine (C-C motif) ligand 21) CCND2 894 CCND2 (cyclin D2) CEP55 55165 CEP55 (centrosomal protein 55kDa) CERS3 204219 CERS3 (ceramide synthase 3) CNN2 1265 CNN2 (calponin 2) CPSF7 79869 CPSF7 (cleavage and polyadenylation specific factor 7, 59kDa) CRAMP1L 57585 CRAMP1L (Crm, cramped-like (Drosophila)) CRYAA 1409 CRYAA (crystallin, alpha A) CTDSPL2 51496 CTDSPL2 (CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2) CYB561 1534 CYB561 (cytochrome b561) DCLK2 166614 DCLK2 (doublecortin-like kinase 2) DEAF1 10522 DEAF1 (DEAF1 transcription factor) DMWD 1762 DMWD (dystrophia myotonica, WD repeat containing) EFNA3 1944 EFNA3 (ephrin-A3) EGFLAM 133584 EGFLAM (EGF-like, fibronectin type III and laminin G domains) EIF2AK4 440275 EIF2AK4 (eukaryotic translation initiation factor 2 alpha kinase 4) ELF3 1999 ELF3 (E74-like factor 3 (ets domain transcription factor, epithelial-specific )) ELFN2 114794 ELFN2 (extracellular leucine-rich repeat and fibronectin type III domain containing 2) ELOVL2 54898 ELOVL2 (ELOVL fatty acid elongase 2) ENDOU 8909 ENDOU (endonuclease, polyU-specific) EVI5 7813 EVI5 (ecotropic viral integration site 5) EXOSC6 118460 EXOSC6 (exosome component 6) FAM20C 56975 FAM20C (family with sequence similarity 20, member C) FAM213B 127281 FAM213B (family with sequence similarity 213, member B) FASN 2194 FASN (fatty acid synthase) FBXL7 23194 FBXL7 (F-box and leucine-rich repeat protein 7) FKRP 79147 FKRP (fukutin related protein) FLJ46026 400627 FLJ46026 (FLJ46026 protein) FOXK1 221937 FOXK1 (forkhead box K1) G2E3 55632 G2E3 (G2/M-phase specific E3 ubiquitin protein ligase) GCOM1 145781 GCOM1 (GRINL1A complex locus 1) GMEB2 26205 GMEB2 (glucocorticoid modulatory element binding protein 2) GNAT1 2779 GNAT1 (guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1) GPR64 10149 GPR64 (G protein-coupled receptor 64) GRB10 2887 GRB10 (growth factor receptor-bound protein 10) GTPBP1 9567 GTPBP1 (GTP binding protein 1) HDAC5 10014 HDAC5 (histone deacetylase 5) HENMT1 113802 HENMT1 (HEN1 methyltransferase homolog 1 (Arabidopsis)) HEPACAM 220296 HEPACAM (hepatic and glial cell adhesion molecule) HES3 390992 HES3 (hes family bHLH transcription factor 3) JARID2 3720 JARID2 (jumonji, AT rich interactive domain 2) JRK 8629 JRK (Jrk homolog (mouse)) KIAA1244 57221 KIAA1244 (KIAA1244) KIAA1598 57698 KIAA1598 (KIAA1598) LINGO1 84894 LINGO1 (leucine rich repeat and Ig domain containing 1) LOC284395 284395 LOC284395 (uncharacterized LOC284395) LOC388022 388022 LOC388022 (uncharacterized LOC388022) LOC388942 388942 LOC388942 (uncharacterized LOC388942) LOC401134 401134 LOC401134 (uncharacterized LOC401134) LOC440600 440600 LOC440600 (uncharacterized LOC440600) LOC441455 441455 LOC441455 (makorin ring finger protein 1 pseudogene) LPGAT1 9926 LPGAT1 (lysophosphatidylglycerol acyltransferase 1) LPHN1 22859 LPHN1 (latrophilin 1) LRRC27 80313 LRRC27 (leucine rich repeat containing 27) MAPKAPK3 7867 MAPKAPK3 (mitogen-activated protein kinase-activated protein kinase 3) MBIP 51562 MBIP (MAP3K12 binding inhibitory protein 1) MMP25 64386 MMP25 (matrix metallopeptidase 25) MOB2 81532 MOB2 (MOB kinase activator 2) MOB3A 126308 MOB3A (MOB kinase activator 3A) MOB3B 79817 MOB3B (MOB kinase activator 3B) MRE11A 4361 MRE11A (MRE11 meiotic recombination 11 homolog A (S. cerevisiae)) MTMR11 10903 MTMR11 (myotubularin related protein 11) MTMR6 9107 MTMR6 (myotubularin related protein 6) MUM1 84939 MUM1 (melanoma associated antigen (mutated) 1) MVB12B 89853 MVB12B (multivesicular body subunit 12B) NAP1L4 4676 NAP1L4 (nucleosome assembly protein 1-like 4) NFKBIE 4794 NFKBIE (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon) NLGN4X 57502 NLGN4X (neuroligin 4, X-linked) NPLOC4 55666 NPLOC4 (nuclear protein localization 4 homolog (S. cerevisiae)) NT5E 4907 NT5E (5′-nucleotidase, ecto (CD73)) NUBP2 10101 NUBP2 (nucleotide binding protein 2) PAQR4 124222 PAQR4 (progestin and adipoQ receptor family member IV) PBXIP1 57326 PBXIP1 (pre-B-cell leukemia homeobox interacting protein 1) PDPK1 5170 PDPK1 (3-phosphoinositide dependent protein kinase 1) PHF20 51230 PHF20 (PHD finger protein 20) PHF21B 112885 PHF21B (PHD finger protein 21B) POLR2M 81488 POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) PPP4C 5531 PPP4C (protein phosphatase 4, catalytic subunit) PRKAB2 5565 PRKAB2 (protein kinase, AMP-activated, beta 2 non-catalytic subunit) PRKY 5616 PRKY (protein kinase, Y-linked, pseudogene) PTPRT 11122 PTPRT (protein tyrosine phosphatase, receptor type, T) RABEP1 9135 RABEP1 (rabaptin, RAB GTPase binding effector protein 1) RAPH1 65059 RAPH1 (Ras association (RalGDS/AF-6) and pleckstrin homology domains 1) RBM15B 29890 RBM15B (RNA binding motif protein 15B) RBMS3 27303 RBMS3 (RNA binding motif, single stranded interacting protein 3) RECQL5 9400 RECQL5 (RecQ protein-like 5) RHBDL1 9028 RHBDL1 (rhomboid, veinlet-like 1 (Drosophila)) RIPK1 8737 RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1) RNF185 91445 RNF185 (ring finger protein 185) RNF31 55072 RNF31 (ring finger protein 31) S100A10 6281 S100A10 (S100 calcium binding protein A10) SAMD4B 55095 SAMD4B (sterile alpha motif domain containing 4B) SCRT1 83482 SCRT1 (scratch family zinc finger 1) SELPLG 6404 SELPLG (selectin P ligand) SETD8 387893 SETD8 (SET domain containing (lysine methyltransferase) 8) SGTA 6449 SGTA (small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha) SLITRK1 114798 SLITRK1 (SLIT and NTRK-like family, member 1) SOCS4 122809 SOCS4 (suppressor of cytokine signaling 4) STC2 8614 STC2 (stanniocalcin 2) SYNGR1 9145 SYNGR1 (synaptogyrin 1) TBL2 26608 TBL2 (transducin (beta)-like 2) THOC3 84321 THOC3 (THO complex 3) TM9SF4 9777 TM9SF4 (transmembrane 9 superfamily protein member 4) TMEM63A 9725 TMEM63A (transmembrane protein 63A) TRIM35 23087 TRIM35 (tripartite motif containing 35) UPP1 7378 UPP1 (uridine phosphorylase 1) USP45 85015 USP45 (ubiquitin specific peptidase 45) UTS2B 257313 UTS2B (urotensin 2B) VAX2 25806 VAX2 (ventral anterior homeobox 2) VPS37B 79720 VPS37B (vacuolar protein sorting 37 homolog B (S. cerevisiae)) WASF2 10163 WASF2 (WAS protein family, member 2) WFIKKN2 124857 WFIKKN2 (WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2) XDH 7498 XDH (xanthine dehydrogenase) YY1AP1 55249 YY1AP1 (YY1 associated protein 1) ZCCHC24 219654 ZCCHC24 (zinc finger, CCHC domain containing 24) ZFP91 80829 ZFP91 (ZFP91 zinc finger protein) ZMIZ2 83637 ZMIZ2 (zinc finger, MIZ-type containing 2) ZNF444 55311 ZNF444 (zinc finger protein 444) ZNF672 79894 ZNF672 (zinc finger protein 672) ZNF767P 79970 ZNF767P (zinc finger family member 767, pseudogene) ZNF804A 91752 ZNF804A (zinc finger protein 804A) [108]Open in a new tab Using the GO and DAVID databases[109]^38,[110]^39, identified proteins were clustered into groups based on their biological processes, molecular function, and cellular compartment. Such clustering allowed us to determine how the differentially expressed proteins were distributed according to biological process ([111]Fig. 4A), molecular function ([112]Fig. 4B) and cellular compartment ([113]Fig. 4C). Clusters with the biological process included proteins that are involved in immune system process (GO:0002376), multicellular organismal process (GO:0032501) and response to stimulus (GO:0050896), which are important for human antiviral response ([114]Fig. 4A). This analysis grouped proteins into nine molecular functional classes ([115]Fig. 4B), which were associated with transcription regulation, such as transporter activity (GO:0005215), translation regulator activity (GO:0045182), protein binding transcription factor activity (GO:0000988) and enzyme regulator activity (GO:0030234). Protein clusters were then further categorized into six subcellular distributions according to the cellular compartment ([116]Fig. 4C). [117]Fig. 4D shows the pathway enrichment analysis of the target genes. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed using the DAVID bioinformatics tool[118]^40,[119]^41. The top enriched pathways are listed here (p-value < 0.01). [120]Fig. 4D clearly shows that these proteins are functionally closely related, and are involved in multiple pathways. Inflammation are mediated by chemokine and cytokine signaling pathway ([121]P00031), PDGF signaling pathway ([122]P00047), Purine metabolism ([123]P02769), PI3 kinase pathway ([124]P00048) and Ras Pathway ([125]P04393), which are important in human immune response to virus infection. Figure 4. [126]Figure 4 [127]Open in a new tab Bioinformatic analysis of target gene prediction and related signaling pathways of the potential mature miRNAs in EBOV. The predicted target gene of potential mature EBOV miRNAs were classified by the GO and DAVID databases based on biological process (A), molecular function (B) and cellular compartment (C). (D) The pathway enrichment analysis of candidate genes. Top enriched pathways are listed (p value < 0.01). (E) The gene regulation network analysis of the potential target genes. (F) The detail information of target genes of miRNA EBV-miR-T3-5p, EBV-miR-T2-3p, EBV-miR-T2-3p and EBV-miR-T2-5p. The gene regulation network (GRN) of the target genes[128]^42,[129]^43 is shown in the [130]Fig. 4E. We find that the possible target genes, HDAC5 and JARID2[131]^44, are important epigenetic factors in transcription regulation, which have strong interaction with the transcription regulator in human cells, such as Histone h3, STAT1, CTCF, CCND2 and CTCF. It is illustrated that the EBOV down-regulated the epigenetic factor to large-scale epigenetic alterations in the host gene expressions[132]^45, which will damage the normal molecular regulation in immune signaling and thus disorder human immune system to block the anti-viral response. The target proteins, NFKBIE and RIPK, are the key co-regulator with IL22 and IFNG or the part of complex of NFκB in human immune system[133]^46,[134]^47. It also suggests that the EBOV affects the signaling pathway of immune system by the non-coding RNA to inhibit the infection response. Further network analysis was conducted to see the potential biological pathways and processes in which these differentially expressed proteins were involved. In addition, [135]Fig. 4F illustrates the detail information of target genes which play key roles in important immune and epigenetic responses. Signaling pathway analysis of the target genes According to our gene regulation network analysis, NFKBIE and RIPK1 are two target genes of possible mature miRNAs, EBOV-miR-T1-5p and EBOV-miR-T2-3p, which plays important roles in immune system. [136]Fig. 5A,B show the cytotoxin-associated target genes. NFKBIE[137]^48 and RIPK[138]^49 genes are both involved in the NF-κB and TNF signaling pathways ([139]Fig. 5C,D). NFKBIE encodes IκB epsilon (IκBε), a member of the IκB family. Its binding to NF-κB inhibits the nuclear translocation of NF-κB[140]^50. RIPK1, Receptor-interacting protein 1, is a key effector molecule in the TNFα-induced activation of the transcription factor NF-κB[141]^51. The signaling pathway analysis shows that the TNF-a–mediated NF-kB signaling pathway plays a key role in inflammatory response ([142]Fig. 5C,D). Through analyzing the molecular mechanism in the NF-kB and TNF signaling pathways, those two pathways were discovered to participate in the host immune response, thus they are also attractive targets of viral pathogens[143]^52. The EBOV coding possible miRNAs, EBOV-miR-T1-5p and EBOV-miR-T2-3p, may be silence and down-regulate the NFKBIE and RIPK1, which are the central mediator of those pathways. In addition, the EBOV exploits the non-coding RNA to inhibit the NF-kB and TNF factor to evade the host defense mechanisms that limit replication by killing infected cells, or to conversely trigger apoptosis as a mechanism to increase virus spreading. NF-kB is activated by multiple families of viruses, including HIV-1, HTLV-1, hepatitis B virus (HBV), hepatitis C virus (HCV), EBV, and influenza virus[144]^53. This activation may serve several functions of promoting viral replication, preventing virus-induced apoptosis, and suprressing the immune response to the invading pathogen[145]^54. The genes NF-kB and TNF are affected by synthetic dsRNAs. It suggests that viruses that generate dsRNA replicative intermediates employ a common mechanism to enhance viral replication. The EBOV glycoprotein (GP) and the other viral proteins also induce the NF-kB and TNF signaling pathways[146]^55. The miRNA and target gene details of EBV-miR-T1-5p and EBV-miR-T2-3p are listed in [147]Fig. 5E. The target gene of EBV-miR-T1-5p is named NFKBIE with ID No. 4794, and 1053-bp long. The target gene of EBV-miR-T2-3p is named RIPK1 with ID No. 8737, and 1848-bp long. Normally when a virus enters a human body, the target genes mentioned above should increase their expression levels. Based on our analysis, once EBOV enters the human body, the miRNAs EBV-miR-T1-5p and EBV-miR-T2-3p down-regulate the target genes of NFKBIE and RIPK1 to evade host innate immune responses and finally leads to multiple organ dysfunction syndrome (MODS). Figure 5. [148]Figure 5 [149]Open in a new tab Signaling pathway analysis of the potential mature EBOV miRNA target genes. (A) The associated genes of Edema, □-kappaB kinase/ NF-kappaB cascade and replication of virus. (B) The associated genes of cell death of kidney cell lines, failure of heart, congestive heart failure, hepatorenal syndrome and cell death of cardiomyocytes. (B) TNF signaling pathway. (C) NF-κB signaling pathway. (D) Detail information of target gene NFKBIE. (E) Detail information of target gene RIPK1. EBOV miRNA regulated the expression of target genes NFKIBIE, RIPIK1, HDAC5 and JARID2 The miRNA mimics was synthesized and transfected into Hela cells for 24 h/37 °C. The results showed that EBOV-miRNA mimics directly regulate the expression of target genes, NFKIBIE, RIPIK1, JARID2 and HDAC5, in Hela cells. Real time (RT)-PCR was used to quantify and compare the mRNA expression of target genes in the transfected Hela cells with the EBOV-miRNA mimics and the scramble mimics as negative control. The transfection efficiency of miRNA mimics, including miR-T1-3p, miR-T2-5p, miR-T3-3p, miR-T4-3p and their mixed miRNA (MIX miRNA), and the scrambled miRNA mimics were detected by fluorescence activated cell sorter (FACS), which were more than 80% ([150]Fig. 6A). The RT-PCR analysis indicated that expression of NFKIBIE was significantly down-regulated by 1.526 times in miR-T1-5p mimics-transfected Hela cells and the expression of RIPIK1 and JARID2 were down-regulated by miR-T2-3p mimics with 1.947 times and 2.25 times separately ([151]Fig. 6B). Interestingly, in the transfected Hela cells with miR-T3-5p mimics, the expression of HDAC5 is increasing compared with the transfected Hela cells with scrambled miRNA mimics ([152]Fig. 6B). We also found that the mRNA expression of NFKIBIE were inhibited by miR-T1-3p, miR-T3-5p, miR-T4-3p and MIX miRNA mimics, while all EBOV-miRNA mimics significantly can block the expression of RIPK1 ([153]Fig. 6C). Such results illustrated that these miRNA may have important functions in human immune and antiviral response systems. Figure 6. [154]Figure 6 [155]Open in a new tab Transfection efficiency of EBOV-miRNA mimics and effect of the EBOV-miRNA mimics on the expression of target genes in Hela cells. (A) Transfection efficiency 24 h post-transfection in Hela cells as percentage of fluorescent dye labeled miRNA positive cells. (B) Relative expression levels of NFKIBIE, RIPK1, HDAC5 and JARID2, which were regulated by EBOV-miRNA mimics miR-T1-5p, miR-T2-3p and miR-T3-5p, respectively. (C) Relative expression levels of NFKIBIE and RIPK1, which were regulated by six EBOV-miRNA mimics and their mixed miRNA (MIX miRNA). *: P < 0.05, **: P < 0.01, ***: P < 0.001. Label “NC” means negative control. Conclusion From March 2014 to October 2014, the largest EBOV outbreak in the history has killed several thousand people in West Africa, yet no current specific treatment is validated for EBOV. miRNAs has been demonstrated to circulate in a highly stable, cell-free form in body fluids thus circulating miRNAs can be used as non-invasive biomarkers for molecular diagnostics and prognostics[156]^24. Since the majority of known viral miRNAs are encoded by DNA viruses, RNA-virus-encoded miRNAs remains controversial. Recently, despite that several novel miRNAs have been experimentally identified in the West Nile virus (WNV)[157]^28, Dengue virus (DENV)[158]^56, hepatitis A virus (HAV)[159]^23, the viral miRNAs in numerous viruses have been identified using computational prediction followed by experimental validation[160]^23,[161]^57,[162]^58,[163]^59. This year H. Liang et al.[164]^24 have successfully identified two EBOV miRNAs, which provide new evidence that EBOV can encode functional miRNAs. In this paper, based on the whole genome alignment of the 2014 outbreak EBOVs[165]^29, which is different from the analysis method of Liang et al.[166]^24, we predicted and experimentally verified seven mature EBOV miRNAs and their regulated target genes. By analyzing the signaling pathways of the target genes, we hypothesized that EBOV miRNAs, especially EBV-miR-T1-5p and EBV-miR-T2-3p, down-regulate the target genes of NF-KB and TNF expression which are involved in virus-cell interaction, immune escape, and cell apoptosis[167]^48,[168]^49. As viruses evolve under the highly selective pressures of the immune system, they acquire the capacity to target critical steps in the host cell life, hijacking vital cellular functions to promote viral pathogenesis. Many viruses have evolved mechanisms to target the NF-kB pathway to facilitate their replication, cell survival, and evasion of immune responses. In addition, some viruses use the NF-kB pathway either for its anti-apoptotic properties to evade the host defense mechanisms or to trigger apoptosis as a mechanism of virus spread. Not surprisingly, recent studies focusing on the interrelations between NF-kB and virus pathogenesis reveal that many viral products bypass signal-induced stimulation and/or receptor-proximal steps to directly interface with the IKK complex. Continuous activation of NF-kB as a consequence of viral persistence in some instances leads to oncogenic transformation, which is an area of increasing scientific study and fascination. It is noteworthy that this is the first paper to describe a strategy that the EBOV non-coding RNA may be evolved to modulate the NF-kB and TNF signaling pathways, to enhance viral replication, host cell survival, and evasion of immune responses. According to our prediction results, the EBOV-miRNA mimics of miR-T1-5p can significantly inhibit the expression of NFKIBIE, while the miR-T2-3p mimics can block the expression of RIPK1 significantly. Such results illustrated that these miRNA may have important functions in human immune and antiviral response systems. Ongoing research will undoubtedly continue to reveal other novel interactions between viruses and the NF-kB pathway that will permit a more precise molecular dissection of this parasitic fatal attraction. Considering that the target genes regulated by our predicted miRNAs play key roles in human immune response, we highlight our prediction work raises the hope of quickly finding an effective EBOV disease treatment. Materials and Methods EBOV whole genome sequencing To show the genome-wide nucleotide and amino acid signatures, we retrieved full genome sequences (as of October 22, 2014) from the genome browser at NCBI Database. One-hundread-and-two human EBOV genomes were derived from the 2014 outbreak[169]^29,[170]^30. Multiple genome-wide alignments The multiple sequence alignment tools ClustalW and MUSCLE were applied for the alignment of the EBOV genomes. The alignments were then analyzed to identify the characteristic sites as potential signatures to distinguish different virus genomes and proteins[171]^30. Bioinformatics prediction of the miRNAs A flowchart describing the computational prediction of the putative miRNAs is shown in [172]Fig. 2. Briefly, the viral genome was scanned for stem-loop structures of miRNA precursor (pre-miRNA) using VMir[173]^60 ([174]http://www.hpi-hamburg.de/research/ departments-and-research-groups/antiviral-defense-mechanism/software-do wn- load.html), a computational analyzer program for the prediction of putative pre-miRNAs. The complete genome sequences of 138 different human EBOV strains were acquired from the PubMed, where 102 human EBOV strains belong to 2014 EBOV outbreak. VMir predictions were carried out using the default parameters. The putative pre-miRNAs that satisfied the filter parameters of a VMir score ≥150 and a window count ≥35 were selected for further assessment. Then, the source code of MiPred[175]^61 was used to distinguish real and pseudo miRNA precursors from the obtained sequences with a prediction confidence equal to or greater than 70%. Subsequently, mature miRNA sequences were predicted from the pre-miRNA stem-loops. Then we used the MatureBayes tool[176]^62 to extend the prediction coverage of the mature miRNAs. The default conditions were used for the MatureBayes tool. Prediction of Novel Viral miRNA Targets Human target genes of novel EBOV miRNAs were predicted using TargetScan[177]^33 custom miRNA prediction methods. Putative targets within the viral genome were predicted using TargetScan Perl script[178]^34,[179]^36,[180]^37,[181]^60. Gene ontology (GO) analysis GO analysis of the significant probe list was performed using PANTHER ([182]http://www.pantherdb.org/)[183]^38,[184]^39, using text files containing the Gene ID list and accession numbers of the Illumina probe ID. All data analysis and visualization of differentially expressed genes were conducted using R 2.4.1 ([185]www.r-project.org). In addition, the DAVID Functional Annotation Bioinformatics Microarray Analysis tools ([186]http://david.abcc.ncifcrf.gov/) were used to study the biological function of the regulated genes. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis Kyoto Encyclopedia of Genes and Genomes (KEGG)[187]^40,[188]^41 is a collection of online databases dealing with genomes, enzymatic pathways, and biological chemicals. The PATHWAY database records networks of molecular interactions in the cell that includes organism-specific network maps ([189]http://www.genome.jp/kegg/). A total of 9 pathways, involving 49 genes, were collected from KEGG. Constructing Gene Regulation Network The integrated regulatory network was constructed based on systematic integration of various high-throughput datasets[190]^42,[191]^43. The target genes associated with candidate miRNAs were selected from miRNA regulation database (the integration database of miRecords, TarBase, starbase, and miR2Disease) and TFs associated with those target genes were selected from Transcriptional Regulatory Element Database (TRED). The integrated target genes-TF regulatory network was constructed by using Cytoscape software ([192]http://cytoscape.org/), which is an open source software for visualizing complex networks and integrating these networks with any type of attribute data. Cell culture and transfection Hela cells at 37 °C and 5% CO[2] in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Hyclone, USA) . Synthetic duplex EBV-miRNA mimics, scramble oligonucleotides used as negative control (NC) (GenePharma, Shanghai, China) at a final concentration of 50 nM were introduced into Hela cells by siPORT™ NeoFX™ transfection agent (AM4511, Applied Biosystems Inc., USA). according to the manufacturer’s instructions. Cells were harvested at 24 hours after transfection. RNA extraction and quantitative real-time PCR analysis The harvested cells were placed in TRIzolH Reagent (Invitrogen, Carlsbad,CA), and total RNAs were extracted according to the TRIzol manufacturer’sinstructions. Total RNA (3 μg) was primed by oilgodT and converted intocDNA using SuperScript III (Invitrogen). The SYBR green-based real-time PCR was performed in Light Cycle 2.0 System(Roche) and Relative quantification of mRNA was measured using 2-ΔΔCt method which normalized to GAPDH. Each PCR assay was performed in a final volume of 20 ul, containing 2 ul of DNA template, 25 pmol of each type-specific primer set, 2X Maxima SYBR Green (Thermo Scientific), Reactions were incubated at 50 °C for2 minutes, followed by PCR amplification under the following conditions: 95 °C for10 minutes, 95 °C for 30 seconds, 57 °C for 30 seconds, 72 °C for 30 minute for a total of 40 cycles, Following the PCR step, a melt curve analysis was performed by increasing the temperature from 65 °C to 95 °C at increments of 0.1 °C/s for each fluorescence reading. The primer sequences for qPCR analysis were as follows: GAPDH, forward 5′-AGAAGGCTGGGGCTCATTTG-3′ and reverse 5′- AGGGGCCATCCACAGTCTTC-5′; NFKBIE, forward 5′- TGCCAACAGATGGCCCATAC-3′ and reverse 5′- TGTTCTTTTCACTAGAGGCACCA-3′; RIPK1, forward 5′-TGGGCGTCATCATGAGGAAG-3′ and reverse 5′-CGCCTTTTCCATGTAAGTAGCA-3′ ; MAPKAP3, forward 5′- ATGAGAACATGCACCATGGCAAGC-3′ and reverse 5′- GGGCAATGTTATGGCTGTGCAGAA -3′; HDAC5, forward 5′- TTCTTTGGACCAGAGTTCCC-3′ and reverse 5′- GTTGGGTTCAGAGGCTGTTT-3′; JARID2, forward 5′- GAGCATGTGTTTCAGCAAGG-3′ and reverse 5′- CTTCTCTTCCACTAGCCTCCAG-3′ Flow cytometry Green fluorescence after fluorescent dye labeled miRNA delivery into Hela cells were assessed in an Accuri C6 BD Biosciences flow cytometer, excited by an argon 480 nm laser and detected by use of a 520 nm optical filter. The mean fluorescence intensity (MFI) data were collected from these cell populations. All data was analyzed with a minimum of 15000 events setting the respective negative control to less than 1% in BD CFlow software. Post-transfection in Hela cells as percentage of fluorescent dye labeled miRNA positive cells. Additional Information How to cite this article: Teng, Y. et al. Systematic Genome-wide Screening and Prediction of microRNAs in EBOV During the 2014 Ebolavirus Outbreak. Sci. Rep. 5, 9912; doi: 10.1038/srep09912 (2015). Acknowledgments