Abstract

   In addition to its well-known role as an adipostat in adult mammals,
   leptin has diverse physiological and developmental actions in
   vertebrates. Leptin has been shown to promote development of
   hypothalamic circuits and to induce mitosis in different brain areas of
   mammals. We investigated the ontogeny of leptin mRNA, leptin actions on
   cell proliferation in the brain, and gene expression in the preoptic
   area/hypothalamus of tadpoles of Xenopus laevis. The level of leptin
   mRNA was low in premetamorphic tadpoles, but increased strongly at the
   beginning of metamorphosis and peaked at metamorphic climax. This
   increase in leptin mRNA at the onset of metamorphosis correlated with
   increased cell proliferation in the neurogenic zones of tadpole brain.
   We found that intracerebroventricular (i.c.v.) injection of recombinant
   Xenopus leptin (rxLeptin) in premetamorphic tadpoles strongly increased
   cell proliferation in neurogenic zones throughout the tadpole brain. We
   conducted gene expression profiling of genes induced at 2 h following
   i.c.v. injection of rxLeptin. This analysis identified 2,322 genes
   induced and 1,493 genes repressed by rxLeptin. The most enriched Kyoto
   Encyclopedia of Genes and Genomes term was the canonical Wnt/β-catenin
   pathway. Using electroporation-mediated gene transfer into tadpole
   brain of a reporter vector responsive to the canonical Wnt/β-catenin
   signaling pathway, we found that i.c.v. rxLeptin injection activated
   Wnt/β-catenin-dependent transcriptional activity. Our findings show
   that leptin acts on the premetamorphic tadpole brain to induce cell
   proliferation, possibly acting via the Wnt/β-catenin signaling pathway.

   Keywords: leptin, neurogenesis, Xenopus, metamorphosis, Wnt/β-catenin

Introduction

   Leptin is a protein hormone secreted by adipocytes that signals energy
   stores to the adult brain. The plasma concentration of leptin
   fluctuates in proportion to fat mass, and leptin acts on feeding
   control centers in the hypothalamus to suppress food intake and
   increase whole body metabolism ([27]1). Leptin (lep) and its receptor
   (LepR) are widely expressed, and the hormone has been shown to have
   pleiotropic actions in physiology and development of diverse vertebrate
   species ([28]2, [29]3). The actions of leptin are mediated by the long
   form of the LepR (LepRb), which engages several intracellular signaling
   pathways, especially the Janus kinase 2/signal transducer and activator
   of transcription (JAK2/STAT) ([30]4, [31]5) and phosphoinositide
   3-kinase (PI3K) signaling pathways ([32]6, [33]7).

   Recent findings support that leptin has important roles in neurological
   development, especially development of leptin-responsive feeding
   control circuits in the hypothalamus. Leptin-deficient mice (ob/ob)
   have reduced brain weight, volume, and DNA content that can be restored
   by injecting leptin ([34]4, [35]8). Leptin induces mitosis in several
   brain areas in rodents ([36]8–[37]10), and in tissue culture ([38]11,
   [39]12), and this role for leptin is likely related to the brain size
   defects seen in ob/ob mice. The hormone also promotes formation of
   neuronal projections among hypothalamic nuclei involved with feeding
   ([40]13–[41]16).

   In rodents, serum leptin concentration increases markedly in the
   neonate, then declines in the juvenile adult ([42]17–[43]19). This
   “postnatal leptin surge” may play a critical role in the development of
   the hypothalamic feeding control circuit ([44]13, [45]15, [46]16).
   Cells in the ventricular zone (VZ)/subventricular zone (SVZ) of the
   third ventricle (3V) of neonates express functional LepR; LepR mRNA
   expression declines in the VZ/SVZ through development then appears in
   the arcuate nucleus and ventromedial hypothalamus ([47]18). The LepR is
   expressed within the VZ of the 3V in embryonic/fetal brain ([48]18,
   [49]20) and these neural progenitor/stem cells (NSCs) may be precursors
   of hypothalamic feeding control and hypophysiotropic neurons of the
   adult ([50]21).

   Genes for lep have now been isolated from numerous mammalian species,
   birds, reptiles, amphibians, and fishes ([51]2, [52]3, [53]22). Our
   earlier findings in Xenopus support that the adipostat function of
   leptin was present in the earliest tetrapods ([54]23, [55]24). By
   contrast, a role for leptin in feeding and energy balance in fishes
   remains unresolved ([56]2, [57]3). Like mammals, tadpoles of Xenopus
   laevis develop competence to respond to leptin signaling during the
   postembryonic developmental period of metamorphosis (Melissa Cui Bender
   and Robert J. Denver, unpublished data). We found that functional LepR
   is expressed in regions surrounding the 3V of premetamorphic tadpole
   brain, suggesting that leptin can act within tadpole neurogenic zones.
   In the current study, we investigated whether leptin can promote
   mitosis in developing Xenopus tadpole brain by administering
   recombinant Xenopus leptin (rxLeptin) to premetamorphic tadpoles by
   intracerebroventricular (i.c.v.) injection, then we analyzed cells in M
   phase of the cell cycle using immunohistochemistry (IHC) for
   phosphorylated histone 3 (pH3). We also conducted a gene expression
   screen for early (2 h after i.c.v. rxLeptin injection) leptin-induced
   transcriptional changes in tadpole preoptic area/hypothalamus. This
   screen identified the canonical Wnt/β-catenin signaling pathway as the
   major intracellular signaling pathway induced by leptin in
   premetamorphic tadpole brain. Using electroporation-mediated (EM) gene
   transfer of a Wnt/β-catenin-responsive reporter plasmid into tadpole
   brain, we provide additional evidence that leptin activates functional
   Wnt/β-catenin signaling.

Materials and Methods

Animal Care and Use

   We obtained X. laevis tadpoles from in-house breeding and raised them
   in dechlorinated tap water maintained at 21–23°C with a 12L:12D
   photoperiod. Tadpoles were fed frog brittle twice daily (NASCO, Fort
   Atkinson, WI, USA) and developmental stages were determined using the
   Nieuwkoop–Faber (NF) staging table ([58]25). We anesthetized NF stage
   50 X. laevis tadpoles (premetamorphic tadpoles) in a buffered solution
   of 0.002% benzocaine (Sigma) before administering i.c.v. injection of
   rxLeptin [produced as described by Crespi and Denver ([59]23)], or
   plasmid injections for EM gene transfer (described below). For i.c.v.
   injection, we used a Drummond microinjector to deliver 50–150 nL of
   solution containing 0.6% saline, rxLeptin (20 ng/g BW) or plasmid DNA,
   plus 0.01% fast green dye to the area of the 3V as described previously
   ([60]23, [61]24, [62]26). We chose this dose of rxLeptin based on our
   previously published work that showed that i.c.v. injection caused a
   dose-dependent suppression of food intake in the Western spadefoot
   toad, with 20 ng/g BW rxLeptin causing maximal suppression ([63]23).
   Animals were killed by immersion in 0.1% benzocaine for 2 min before
   tissue harvest. All procedures involving animals were conducted under
   an approved animal use protocol (PRO00006809) in accordance with the
   guidelines of the Institutional Animal Care and Use Committee at the
   University of Michigan.

RNA Isolation for Gene Expression Analyses

   For developmental analysis of lep mRNA, we extracted total RNA from
   whole animals beginning at NF stage 45. For NF stages 45–54, we pooled
   three animals per replicate and for NF stages 58–66, one animal per
   replicate (n = 5–6/NF stage). We also dissected and isolated total RNA
   from the portion of the carcass containing the fat pads (we removed
   tail and other organs; we refer to this as “adipose tissue”), liver,
   brain, and gut from tadpoles throughout metamorphosis (NF stages 50,
   54, 58, 62, 66) for analysis of lep mRNA (n = 6/NF stage). For analysis
   of gene expression by microarray and reverse transcriptase quantitative
   real-time PCR (RTqPCR), we injected tadpoles i.c.v. with 0.6% saline or
   rxLeptin (20 ng/g BW), and 2 h later, we killed the animals, removed
   the brain, and microdissected the middle region of the brain
   (n = 6/treatment; the region of the diencephalon containing the
   preoptic area and hypothalamus, the neuroendocrine and feeding control
   regions of the brain) ([64]27). We isolated RNA using the Trizol
   reagent (Invitrogen) following the manufacturer’s instructions.

   For RTqPCR analysis of gene expression, we developed SYBR Green assays
   that spanned exon–exon boundaries for each gene. We treated 1 µg total
   RNA with 1.5 U RNase-free DNase I (Roche, Indianapolis, IN, USA) to
   digest contaminating genomic DNA, then reverse-transcribed the RNA into
   cDNA using 250 ng random hexamers and Superscript II Reverse
   Transcriptase (Invitrogen) following the manufacturer’s instructions
   [see also Ref. ([65]28, [66]29)]. Minus RT controls were included.
   Oligonucleotides used for RTqPCR are given in Table [67]1. We conducted
   quantitative, real-time PCR using the ABsolute™ Blue qPCR SYBR Green
   Low Rox Mix (ABgene), and reactions were run on an ABI 7500 Fast qPCR
   machine. Relative quantities were determined using standard curves
   generated with pooled cDNAs.

Table 1.

   Sequences of oligonucleotide used to validate microarray results by
   SYBR Green reverse transcriptase quantitative real-time PCR.
   Gene name Forward                        Reverse
   ctnnb1    5′ GAATTGGCCACTCGAGCAA 3′      5′ ACCTGGTCCTCGTCATTAAGC 3′
   sox8      5′ GGGCAAACTGTGGCGTTTA 3′      5′ CTCAGCCTCCTCCACAAAGG 3′
   socs3     5′ AGAACCTACGCATCCAGTGTGA 3′   5′ GGCACTTCGTGGGTCAGTCT 3′
   arrb2     5′ TCAGTCAGACAATACGCAGACATC 3′ 5′ GCCACCGGGCCACTTGTAC 3′
   dab2      5′ CAGCAGCTGCCACTGGAA 3′       5′ ATTGTTGTGCGTGAGAGTTTAC 3′
   mad2l1    5′ AAGAACTTGCAACCGTTAAACT 3′   5′ TCACGAACAATGCCGTCTTTC 3′
   rpL8      5′ TTTGCTGAAAGAAATGGCTACATC 3′ 5′ CACGGCCTGGATCATGGA 3′
   [68]Open in a new tab

IHC for pH3 and Phosphorylated STAT3 (pSTAT3)

   We analyzed the effects of i.c.v. injection of rxLeptin on mitosis in
   the premetamorphic tadpole brain using IHC for pH3. The serine 10 at
   the amino terminus of H3 is phosphorylated during late G2 through M
   phase of the cell cycle and is therefore used to detect dividing cells
   [for X. laevis brain: ([69]30–[70]32)]. We administered two i.c.v.
   injections of 0.6% saline or rxLeptin (200 ng/g BW) ([71]23) into the
   region of the 3V of NF stage 50 tadpoles; the second injection was 24 h
   after the first, and tadpoles were killed 48 h after the first
   injection (i.e., 24 h after the second injection). We then processed
   brains for IHC for pH3 following the method of Denver et al. ([72]30).
   Briefly, we prepared 10 µm thick transverse cryosections through entire
   tadpole brains and immunostained sections with a rabbit antiserum
   against human pH3 (1:500; Cat. #0650 EMD Millipore, Billerica, MA,
   USA). Primary immune complexes were detected using a secondary antibody
   conjugated with Cy3 (1:500, Jackson ImmunoResearch Laboratories, Inc.,
   West Grove, PA, USA). For IHC for pSTAT3, a marker for activated LepR,
   we administered i.c.v. injections of 0.6% saline or rxLeptin (20 ng/g
   BW) ([73]24) to NF stage 50 tadpoles and collected brains 1 h later for
   fixation and sectioning. We conducted IHC for pSTAT3 on Xenopus brain
   as described previously ([74]24) using an antiserum generated against a
   phosphopeptide AP[pY]LK from mouse STAT3 (Tyr705; 1:200; Cat. # 9131,
   Cell Signaling), which is 100% conserved with X. laevis STAT3 ([75]24,
   [76]33). Images of immunostained slides were captured using an Olympus
   XI-81 microscope, and the total number of pH3 positive cells per brain
   was counted. Five brains were analyzed per treatment. Xenopus
   neuroanatomy is based on Tuinhof et al. ([77]34) with modifications by
   Yao et al. ([78]35).

DNA Microarray Analysis of Gene Expression after i.c.v. rxLeptin Injection

   We conducted DNA microarray analysis on total RNA isolated from the
   preoptic area/hypothalamus of NF stage 54 X. laevis tadpoles (~0.2 g
   BW) 2 h after i.c.v. injection of 0.6% saline or rxLeptin (20 ng/g BW).
   We isolated total RNA from microdissected brain regions of three
   replicate pools (three brains per pool) per treatment. Samples were
   hybridized to the Affymetrix GeneChip Xenopus laevis Genome 2.0 Array
   (n = 3/treatment) at the Affymetrix and Microarray Core Facility at the
   University of Michigan. We selected a subset of the induced genes to
   cover a range of expression values (fold change) for validation by
   RTqPCR (Table [79]1).

Microarray Data Background Correction, Normalization, and Expression
Quantification

   We used the Robust Multichip Average method ([80]36) from the Affy
   package (v1.52.0) ([81]37) to calculate background-corrected,
   normalized expression values. Genefilter (v1.56.0) ([82]38) was used to
   remove uninformative probesets (internal control probesets, or
   probesets with low variance or background level expression values).

Microarray Data Differential Expression Analysis and Annotation

   Principal component analysis plots of the normalized, filtered samples
   showed samples of the same treatment (saline or rxLeptin) clustered
   together, and that the two treatments clustered separately. We used the
   limma package (v3.30.2) ([83]39) to apply empirically derived array
   weights to individual samples, which were then used to calculate
   differential expression values ([84]40). Annotations for each gene were
   added using the annotation file supplied by Affymetrix for the X.
   laevis Genome 2.0 Array.

Gene Ontology (GO) and Pathway Analysis

   Gene ontology term enrichment analysis was conducted using a log[2]
   fold change (log[2]FC) ranked list from limma, containing genes with a
   Benjamini and Hochberg (BH)-corrected p-value, or false-discovery rate
   (FDR) <0.05, as input into clusterProfiler (v3.2.4) ([85]41). This
   analysis determines which molecular function, biological process, or
   cellular component GO terms are positively or negatively enriched in
   rxLeptin-treated samples compared with saline-treated controls, at a
   p-value < 0.05, while taking into account the magnitude and direction
   of change. Due to the hierarchical and redundant nature of GO terms, we
   obtained a summarized list of GO terms using Revigo to remove redundant
   terms ([86]42).

   We conducted Kyoto Encyclopedia of Genes and Genomes (KEGG) ([87]43)
   pathways enrichment analysis using a log[2]FC ranked list of all
   differential gene expression data from limma (FDR < 0.05) as input into
   clusterProfiler (v3.2.4) ([88]41). An additional KEGG module (highly
   annotated functional units of a metabolic network) enrichment analysis
   was conducted using the same log[2]FC ranked list as input into
   clusterProfiler (v3.2.4). Gene expression values for KEGG pathways were
   plotted on the respective pathways using the pathview package (v1.14.0)
   ([89]44).

   Enriched biological processes GO terms, KEGG pathways, and KEGG modules
   were displayed using the Enrichment Map application (v2.2.0) ([90]45)
   in Cytoscape (v3.4.0) ([91]46).

EM Gene Transfer and In Vivo Reporter Assay

   We used EM gene transfer ([92]30, [93]47–[94]50) and i.c.v.
   microinjection of 0.6% saline or rxLeptin (20 ng/g BW) to investigate
   whether leptin can activate the Wnt/β-catenin signaling pathway in
   tadpole brain in vivo. We divided NF stage 50 tadpoles into three
   groups for bipolar electroporation. Tadpoles were electroporated with a
   DNA mixture containing pRenilla-null (50 ng/µL; for dual-luciferase
   assay normalization), pCMV-eGFP (500 ng/µL; to visualize transfection
   efficiency), and one of the following firefly luciferase reporter
   vectors (each at 1 μg/μL): pGL4.23 empty (negative control),
   GAS-luciferase (positive control for leptin activity) ([95]23, [96]24)
   or pGL4.23-6TCF (reporter of activated canonical Wnt/β-catenin
   signaling). The pGL4.23-6TCF vector contains six T cell factor (TCF)
   sites upstream of a minimal promoter driving luciferase expression, and
   therefore reports activation of the canonical Wnt/β-catenin signaling
   pathway (gift of Dr. Ken Cadigan). A separate group of tadpoles
   received pGL4.23-6TCF, pRenilla-null, and pCMV-EGFP plus a
   constitutively active β-catenin expression vector pcDNA3-S33Y β-catenin
   ([97]51) (gift of Dr. Eric Fearon) or an empty vector (pCMVneo-empty).
   Plasmid concentrations for electroporation are based on Yao et al.
   ([98]52). Twenty-four hours after EM gene transfer we screened tadpoles
   for strong GFP expression, and then separated them into eight groups:
   pGL4.23-empty reporter, saline, or rxLeptin; GAS-luciferase, saline, or
   rxLeptin; pGL4.23-6TCF, saline, or rxLeptin; pGL4.23-6TCF,
   pCMVneo-empty, or pcDNA3-S33Y β-catenin. Tadpoles receiving i.c.v.
   injections were given saline or rxLeptin (20 ng/g BW). Two hours after
   injection, tadpoles were killed and brains harvested for
   dual-luciferase assay following the protocol described by Yao et al.
   ([99]52). We had a sample size of eight tadpoles per treatment.

Data and Statistical Analysis

   We analyzed data for gene expression by RTqPCR, pH3 cell counts and
   dual-luciferase assay data by one-way ANOVA or by unpaired Student’s
   t-test (p < 0.05). Derived values were log[10]-transformed before
   statistical analysis. Fisher’s least squares difference post hoc test
   was used to separate the means following ANOVA. We used the SYSTAT 13.0
   computer program (SPSS Inc.).

Results

Ontogeny of lep mRNA in Tadpoles during Metamorphosis, and Effects of
rxLeptin on Mitosis in Premetamorphic Tadpole Brain

   Whole body lep mRNA increased 3.3-fold between stages 48 and 50, which
   is immediately before the onset of metamorphosis (p < 0.001, ANOVA;
   Figure [100]1A). The mRNA level increased further (7.6-fold) from
   stages 50 to 54, and remained elevated throughout metamorphosis and in
   the postmetamorphic frog (NF stage 66). The pattern of changes in lep
   mRNA in adipose tissue during metamorphosis was similar to whole body
   (Figure [101]1B; p = 0.002, ANOVA). By contrast, lep mRNA decreased in
   liver (p = 0.001) and was low and unchanged in brain throughout
   metamorphosis (Figure [102]1B). These findings, and other results from
   our laboratory support that fat tissue is the major source of lep mRNA
   in the tadpole (Melissa Cui Bender and Robert J. Denver, unpublished
   data). This developmental pattern of lep mRNA paralleled changes in
   cell proliferation in tadpole brain during metamorphosis (Figure
   [103]2A) ([104]30). Injection of rxLeptin strongly increased
   pH3-immunoreactivity (35-fold; p < 0.0001; Student’s unpaired t-test)
   in cells within the VZ/SVZ throughout the tadpole brain (Figures
   [105]2B,C). Also, i.c.v. rxLeptin injection (1 h) induced the
   appearance of pSTAT3 immunoreactivity (pSTAT3-ir) in the VZ/SVZ in the
   region of the 3V (Figure [106]2D), supporting the expression of
   functional LepR in these cells. The inset in Figure [107]2D shows a
   high magnification view of the VZ/SVZ with elongated cells undergoing
   migration out of the neurogenic zone.

Figure 1.

   [108]Figure 1
   [109]Open in a new tab

   Transcription of the lep gene is activated during tadpole
   metamorphosis. (A) Whole body lep mRNA increases during tadpole
   metamorphosis. (B) Developmental changes in lep mRNA in four tadpole
   tissues during metamorphosis. We analyzed lep mRNA by reverse
   transcriptase quantitative real-time PCR. Note that the scales of the
   graphs in panel (B) are not directly comparable to the graph in panel
   (A) since the samples were analyzed in separate assays using a relative
   quantification method (see [110]Materials and Methods). Means with the
   same letter are not significantly different [p < 0.05; Fisher’s least
   squares difference test; n = 5–6/Nieuwkoop–Faber (NF) stage].

Figure 2.

   [111]Figure 2
   [112]Open in a new tab

   Leptin induces mitosis in premetamorphic tadpole brain. (A) Changes in
   cell proliferation in tadpole brain throughout metamorphosis analyzed
   by BrdU incorporation [data are modified from Denver et al. ([113]30);
   reproduced with permission]. (B) Quantification of pH3 positive cells
   in tadpole brain following intracerebroventricular injection of saline
   or recombinant Xenopus leptin (rxLeptin) (200 ng/g BW). Tadpoles were
   given two injections, the second 24 h after the first, and then they
   were killed 48 h after the first injection. *Denotes a statistically
   significant difference (p < 0.05; Student’s unpaired t-test). (C)
   Images of transverse sections of the region of the telencephalon
   [lateral ventricle (lv)] and anterior preoptic area [location of
   neurosecretory neuron cell bodies; third ventricle (3V)] of tadpole
   brain stained for pH3. Scale bars = 120 µM. (D) Induction of pSTAT3
   immunoreactivity in cells located in the ventricular zone
   (VZ)/subventricular zone (SVZ) of premetamorphic (Nieuwkoop–Faber stage
   50) tadpole brain by rxLeptin (20 ng/g BW; 1 h). The inset shows a
   higher magnification view of the VZ/SVZ with elongated cells undergoing
   migration out of the neurogenic zone.

i.c.v. rxLeptin Injection Induces Rapid Transcriptional Responses in Early
Premetamorphic (NF Stage 54) Tadpole Brain

   To investigate the molecular basis for leptin action on tadpole brain,
   we conducted microarray analysis on the region of the diencephalon
   containing the preoptic area/hypothalamus of NF stage 54 tadpoles at
   2 h following i.c.v. injection of 0.6% saline or rxLeptin injection
   (20 ng/g BW). The transformed log ratio (M) and mean average (A) plot
   (MA plot) in Figure [114]3A shows that the data are normally
   distributed, with a zero-centered transformed log ratio. Additionally,
   this plot shows that genes with a significant BH-adjusted p-value
   (FDR < 0.05), plotted in red, are distributed evenly across MA
   expression levels, indicating an ability to detect differentially
   expressed genes at any range of expression. This plot also indicates
   that an absolute log2 fold change (log2FC) as low as ~0.5 can be
   detected with confidence (FDR < 0.05). This analysis identified 2,322
   induced and 1,493 repressed genes (Table S1 in Supplementary Material).
   The top 20 induced and repressed genes are given in Tables [115]2 and
   [116]3, respectively. The microarray dataset has been deposited in the
   Gene Expression Omnibus archive at the National Center for
   Biotechnology Information (GEO accession #[117]GSE97243).

Figure 3.

   [118]Figure 3
   [119]Open in a new tab

   Analysis of microarray data from preoptic area/hypothalamus of saline
   or recombinant Xenopus leptin (rxLeptin)-injected
   [intracerebroventricular (i.c.v.) 20 ng/g BW; 2 h] Nieuwkoop–Faber
   stage 54 tadpoles. (A) Transformed log ratio and mean average plot
   [log[2] fold change (log[2]FC) vs. average expression] of saline vs.
   rxLeptin-injected tadpole mRNA levels (see [120]Materials and Methods).
   Dots represent genes: red = genes with a false-discovery rate <0.05;
   blue = top 20 differentially expressed and annotated Xenopus laevis
   genes; black = all other genes. (B) Biological processes, pathways, and
   modules affected by i.c.v. rxLeptin injection. Enrichment map of
   enriched biological process gene ontology terms (redundancy reduced,
   p < 0.05), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways
   (p < 0.05), and KEGG modules. Circular node color reflects positive
   (red) or negative (blue) enrichment. Node color intensity reflects the
   degree of enrichment relative to the most highly enriched in either
   direction. Lines (green) represent significant genetic information
   shared between connected nodes (above 50%), and line thickness
   represents the degree of shared information.

Table 2.

   Top twenty genes with annotation induced by recombinant Xenopus leptin
   in premetamorphic tadpole brain.
   Gene symbol Gene title Entrez gene ID log[2] fold change Adjusted
   p-value
   LOC100036815/cxcl8 Hypothetical protein LOC100036815/interleukin-8
   100036815 2.63 0.00001
   ctnnb1 Beta-catenin protein 399274 2.32 0.00013
   ube2d3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog) 403384 2.23
   0.00018
   lpar4 Lysophosphatidic acid receptor 4 779407 2.07 0.00018
   aplp2 Amyloid beta (A4) precursor-like protein 2 431790 2.03 0.00018
   set/TAF-Ibeta1 SET nuclear oncogene///TAF-Ibeta1 379599///399349 1.94
   0.00014
   brd2 RING3 protein 779057 1.94 0.00028
   mbd3 Methyl-CpG binding domain protein 3 398135 1.87 0.00018
   dhcr7 7-Dehydrocholesterol reductase 379273 1.87 0.00028
   gca Grancalcin, EF-hand calcium binding protein 444080 1.84 0.00014
   idh3a Isocitrate dehydrogenase 3 (NAD+) alpha 444419 1.75 0.00017
   gna11 Guanine nucleotide binding protein (G protein), alpha 11 (Gq
   class) 380535///779103 1.74 0.00026
   pin1 Peptidylprolyl cis/trans isomerase, NIMA-interacting 1 503670 1.72
   0.00018
   mad2l1 MAD2 mitotic arrest deficient-like 1 380433 1.72 0.00074
   phyhipl Phytanoyl-CoA 2-hydroxylase interacting protein-like 447238
   1.70 0.00037
   psat1 Phosphoserine aminotransferase 1 494700 1.67 0.00013
   nrn1-A Neuritin 1-A 373709 1.66 0.00025
   ifrd1/MGC69123 Interferon-related developmental regulator 1
   379667///494857 1.63 0.00019
   tifa TRAF-interacting protein with forkhead-associated domain 734184
   1.62 0.00026
   irf1 Interferon regulatory factor 1 398826 1.60 0.00007
   [121]Open in a new tab

Table 3.

   Top twenty genes with annotation repressed by recombinant Xenopus
   leptin in premetamorphic tadpole brain.
   Gene symbol Gene title Entrez gene ID log[2] fold change Adjusted
   p-value
   gtf2h2/MGC81060 General transcription factor IIH subunit 2 443754 −1.55
   0.00027
   sfrs3 Splicing factor, arginine serine-rich 3 380152 −1.51 0.00018
   muc19 Mucin 19, oligomeric 378670 −1.50 0.00018
   tmem14a Transmembrane protein 14A 444418 −1.30 0.00613
   xcirp2 Cold-inducible RNA binding protein 2 379484 −1.22 0.00391
   prss3 Protease, serine, 3 447093 −1.16 0.01023
   tef Thyrotrophic embryonic factor 379940 −1.14 0.00018
   hsp90aa1.1/MGC82579 Heat shock protein 90 kDa alpha family class A
   member 1 444024 −1.12 0.00030
   myh4 Similar to myosin, heavy polypeptide 4, skeletal muscle 399414
   −1.09 0.00145
   LOC100037078 Hypothetical protein LOC100037078 100037078 −1.09 0.01290
   pcca Propionyl Coenzyme A carboxylase, alpha polypeptide 734347 −1.04
   0.00330
   dnajc8 DnaJ (Hsp40) homolog, subfamily C, member 8 447089 −1.03 0.00224
   dhx.8S/MGC80994 DEAH-box helicase 8 S homolog 444315 −1.03 0.00145
   LOC397871 Larval beta II globin 397871 −1.02 0.00106
   MGC85304 MGC85304 protein 447105 −1.02 0.00207
   MGC99235 MGC99235 protein 447690 −1.01 0.00053
   MGC64236 Hypothetical protein MGC64236 379516 −1.01 0.00292
   scc2-1 Scc2-1B 445865 −0.95 0.01224
   zmynd8 Zinc finger, MYND-type containing 8 733267 −0.94 0.01584
   hmgn1/MGC64236 High mobility group nucleosome binding domain 1 379516
   −0.94 0.00244
   [122]Open in a new tab

   Using these differential expression data, we conducted several
   enrichment analyses, allowing us to classify the global gene regulation
   changes into several general categories (general biological process
   regulation, metabolism, cellular components, adhesion, immune
   signaling, cell signaling, development, cell division and neurogenesis,
   and others) and highlighting several biological processes or pathways
   of interest. The enrichment map in Figure [123]3B shows these data:
   enriched biological process GO terms (p-value < 0.15), KEGG pathways
   (p-value < 0.15), and KEGG modules. We validated a subset of the
   induced genes by RTqPCR (Figure [124]4).

Figure 4.

   [125]Figure 4
   [126]Open in a new tab

   Validation of leptin-induced genes in Nieuwkoop–Faber stage 54 Xenopus
   laevis tadpole preoptic area/hypothalamus by reverse transcriptase
   quantitative real-time PCR (RTqPCR). Tadpoles received an injection
   intracerebroventricular of 0.6% saline or recombinant Xenopus leptin
   (rxLeptin) (20 ng/g BW) and were killed 2 h later for tissue harvest
   for RNA isolation. Gene expression was analyzed by SYBR Green RTqPCR
   and normalized to the reference gene rpL8 which was not affected by
   rxLeptin injection (data not shown). Asterisks indicate statistically
   significant differences from saline injected controls (*p < 0.05;
   unpaired Student’s t-test).

   The top ten GO terms involved developmental processes (Figure [127]3B;
   Table [128]4; Table S2 in Supplementary Material). Noteworthy is the
   Wnt/β-catenin signaling pathway, which was found by each enrichment
   analysis (biological process GO, KEGG pathway, KEGG module; Figure
   [129]5). Also, signaling by two TGFβ family members, bone morphogenetic
   protein (BMP) and activin, was among the enriched KEGG modules (Figure
   [130]6; Table S3 in Supplementary Material; tab KEGGmodules.filt). The
   hedgehog and insulin signaling pathways were also found to be enriched
   (Figures S1 and S2 in Supplementary Material).

Table 4.

   Top ten gene ontology (GO) terms corresponding to developmental
   processes.
   ID Description Set size Enrichment score NES p-Value p.adjust q-Values
   GO:0044767 Single-organism developmental process 470 0.298665447
   1.479435427 0.00101833 0.159221311 0.159221311
   GO:0048856 Anatomical structure development 452 0.305758564 1.512476805
   0.00101833 0.159221311 0.159221311
   GO:0032502 Developmental process 473 0.305340626 1.513106572
   0.001019368 0.159221311 0.159221311
   GO:0044707 Single-multicellular organism process 433 0.301770432
   1.490562662 0.001023541 0.159221311 0.159221311
   GO:0032501 Multicellular organismal process 463 0.29984464 1.483930907
   0.00102459 0.159221311 0.159221311
   GO:0007275 Multicellular organism development 407 0.300744558
   1.475210668 0.003089598 0.400102987 0.400102987
   GO:0030154 Cell differentiation 203 0.319354548 1.47945519 0.004429679
   0.491694352 0.491694352
   GO:0009790 Embryo development 84 0.391329957 1.634661027 0.006157635
   0.598060345 0.598060345
   GO:0048513 Animal organ development 137 0.342563144 1.530163684
   0.007900677 0.649743161 0.649743161
   GO:0048869 Cellular developmental process 242 0.301733778 1.42896268
   0.008583691 0.649743161 0.649743161
   [131]Open in a new tab

Figure 5.

   [132]Figure 5
   [133]Open in a new tab

   Gene expression changes in the Wnt/β-catenin signaling pathway. Shown
   is the Kyoto Encyclopedia of Genes and Genomes Wnt/β-catenin signaling
   pathway with differential gene expression values plotted for genes with
   false-discovery rate <0.05. The color of each gene represents the
   direction of regulation (red = positive; gray = no change;
   green = negative). log[2]FC = log[2] fold change. The intensity of the
   color is the value relative to the most highly regulated gene
   (log[2]FC = 2.6) in the entire dataset.

Figure 6.

   [134]Figure 6
   [135]Open in a new tab

   Gene expression changes in the TGFβ signaling pathway. Shown is the
   Kyoto Encyclopedia of Genes and Genomes TGFβ signaling pathway with
   differential gene expression values plotted for genes with false
   discover rate <0.05. The color of each gene represents the direction of
   regulation (red = positive; gray = no change; green = negative).
   log[2]FC = log[2] fold change. The intensity of the color is the value
   relative to the most highly regulated gene (log[2]FC = 2.6) in the
   entire dataset.

Wnt/β-Catenin Signaling Is Activated in Premetamorphic Tadpole Brain by
i.c.v. rxLeptin Injection

   To test if leptin can activate the canonical Wnt/β-catenin signaling
   pathway in tadpole brain in vivo, we conducted EM gene transfer with
   different reporter plasmids, and injected saline or rxLeptin i.c.v.
   Injection of rxLeptin did not alter luciferase activity in
   pGL4.23-empty vector-transfected brain, but caused a strong increase
   (12.9-fold; p < 0.0001, unpaired Student’s t-test) in luciferase driven
   by the GAS-luciferase vector, which reports pSTAT3 signaling induced by
   leptin binding to the LepR (Figure [136]7) ([137]23, [138]24). This
   confirmed activation of LepR signaling in tadpole brain after i.c.v.
   rxLeptin injection. We observed a threefold increase in luciferase
   activity (p < 0.001) driven by the pGL4.23-6TCF (Wnt/β-catenin pathway)
   reporter vector following injection of rxLeptin. Forced expression of
   constitutively active β-catenin confirmed the activity of the
   pGL4.23-6TCF reporter (47-fold increase; p < 0.0001).

Figure 7.

   [139]Figure 7
   [140]Open in a new tab

   The canonical Wnt/β-catenin signaling pathway is activated by leptin
   signaling in Xenopus laevis tadpole brain. We injected plasmids into
   the region of the third ventricle of premetamorphic (Nieuwkoop–Faber
   stage 50) tadpoles and transfected them by biopolar
   electroporation-mediate gene transfer. Twenty-four hours after
   transfection, we screened tadpoles for EGFP expression, and then
   separated them into eight groups. The reporter vector is given at the
   top left of each panel. Tadpoles received intracerebroventricular
   (i.c.v.) injections of 0.6% saline or recombinant Xenopus leptin
   (rxLeptin) (20 ng/g BW); a separate group was cotransfected with the
   pGL4.23-6TCF reporter vector and either empty expression vector
   (pCMVneo-empty) or a vector that expresses constitutively active
   β-catenin (pcDNA3-S33Y β-catenin). Two hours after i.c.v. injection,
   tadpoles were killed and brains harvested for dual-luciferase assay.
   Asterisks indicate statistically significant differences (*p < 0.001,
   **p < 0.0001; n = 8 tadpoles/treatment).

Discussion

   Leptin has well-established roles in adult physiology, but its
   developmental actions are less understood. Here, we show that lep
   expression increases strongly during tadpole metamorphosis in parallel
   with an increase in mitosis in tadpole brain. Also, i.c.v. injection of
   rxLeptin induced mitosis in neurogenic zones of premetamorphic tadpole
   brain. Gene expression screening identified genes regulated by leptin
   signaling in early premetamorphic tadpole brain, and highlighted
   several signaling pathways (Wnt/β-catenin, TGFβ, hedgehog, and insulin
   signaling) through which leptin may effect its regulatory role in
   neurogenesis. We also show that leptin activates Wnt/β-catenin pathway
   signaling in tadpole brain in vivo, as evidenced by activation of a
   Wnt/β-catenin pathway reporter vector.

Leptin Promotes Neurogenesis in Xenopus Tadpole Brain

   We observed a strong induction of mitosis in neurogenic zones of the
   premetamorphic tadpole brain following i.c.v. injection of rxLeptin.
   The rapid increase in pSTAT3-ir in cells of these regions 1 h after
   rxLeptin injection supports that they express functional LepR, and
   therefore that the action of leptin on mitosis is likely to be direct.
   In rodent embryonic/fetal brain, LepR mRNA is expressed within the
   VZ/SVZ of the 3V ([141]18, [142]20). The LepR mRNA level in the VZ/SVZ
   declines through development, after which time it appears in the
   arcuate nucleus and ventromedial hypothalamus ([143]18). These LepR
   mRNA-expressing NSCs may be precursors of hypothalamic feeding control
   and hypophysiotropic neurons of the adult ([144]21). The LepR is also
   expressed in the VZ/SVZ (progenitor cell niches) of adult monkey brain
   ([145]53).

   Several lines of evidence from studies in rodents support that leptin
   controls cell proliferation in developing brain and can also induce
   neurogenesis in adults. For example, the reduced brain weight and DNA
   content in ob/ob mice is restored by leptin injection ([146]4, [147]8),
   and leptin has been found to induce mitosis in rodent brain in vivo
   ([148]8–[149]10), and in tissue culture ([150]11, [151]12). The large
   increase in lep mRNA in tadpoles during metamorphosis, a postembryonic
   developmental period that has been compared to the neonatal/early
   postnatal period in direct developing species like mammals ([152]54),
   may be similar, both phenomenologically and functionally, to the
   postnatal leptin surge that occurs in rodents ([153]17–[154]19). It has
   been hypothesized that this postnatal increase in leptin plays a
   pivotal role in the development of the hypothalamic feeding control
   circuitry ([155]13, [156]15, [157]16, [158]55–[159]56). Leptin has also
   been shown to promote neurogenesis in the hippocampus of adult mammals
   ([160]57), which may depend on Wnt/β-catenin signaling ([161]58). The
   extra-hypothalamic actions of leptin on adult neurogenesis and neural
   plasticity may improve cognition and mood in animal models of
   depression and anxiety, and circulating leptin concentration is
   negatively correlated with Alzheimer’s disease in humans ([162]59), and
   promotes neurogenesis in a mouse model of Alzheimer’s disease
   ([163]60). Leptin has also been shown to be neuroprotective and induces
   neurogenesis and angiogenesis after stroke ([164]61–[165]63).

   Cell proliferation in tadpole brain during metamorphosis depends on
   thyroid hormone ([166]30). However, other mitogens such as leptin,
   activators of the TGFβ pathway, neurotrophins, and insulin-like
   peptides likely also play important roles in this developmental
   process. Indeed, there may be synergy between different signaling
   pathways, some that are affected by nutritional state like leptin and
   insulin-like peptides, that determine cell expansion and development of
   neural structures and pathways. Leptin has been found to synergize with
   thyroid hormone to induce proliferation of chondrocytes in growth
   plates, and also to promote terminal differentiation ([167]64). Whether
   similar synergy occurs in the developing brain, which is critically
   dependent on thyroid hormone for its development, requires further
   study.

Leptin Activates Canonical Wnt/β-Catenin Signaling in Xenopus Tadpole Brain

   Using gene expression screening, we discovered sets of genes that are
   rapidly induced or repressed by leptin signaling in the tadpole
   preoptic area/hypothalamus. The major pathways regulated by leptin
   included the Wnt/β-catenin and TGFβ signaling pathways. Notably, we
   identified several genes involved in the Wnt/β-catenin signaling
   pathway, including β-catenin, the central component of the canonical
   Wnt/β-catenin pathway. The Wnt proteins, and the canonical
   Wnt/β-catenin intracellular signaling pathway, play central roles in
   development and disease ([168]65), including development of the central
   nervous system, and are known to promote cell proliferation ([169]66).
   The Wnt ligands bind to cell surface receptors of the Frizzled (Fz) and
   low-density lipoprotein-related protein families ([170]67). In
   canonical Wnt/β-catenin signaling, the absence of Wnt ligand causes
   cytoplasmic signaling components such as glycogen synthase kinase 3β
   (GSK3β) to phosphorylate β-catenin, leading to the latter’s
   degradation. Activation of Wnt receptors leads to phosphorylation of
   GSK3β, allowing β-catenin to accumulate in the cytoplasm. The
   accumulated β-catenin translocates to the nucleus, where it interacts
   with lymphoid enhancer-binding factor 1 with lymphoid enhancer-binding
   factor 1 (also known as TCF) to activate transcription of Wnt/β-catenin
   target genes ([171]67, [172]68).

   In addition to the Wnt receptor Fzd10 and β-catenin (ctnnb1), one of
   the TCFs, Tcf7l1 (also known as TCF-3) was induced by leptin in tadpole
   brain. This transcription factor is a transcriptional repressor
   ([173]67) and was recently found to promote growth of colorectal
   cancers ([174]69). Myc was also identified in our screen and is a
   Wnt/β-catenin target gene that functions in mitosis ([175]70). The
   cyclin-dependent kinase 10 was induced by leptin and is known to be
   modulated by Wnt/β-catenin signaling ([176]66, [177]71).

   There is mounting evidence from different systems and tissues that
   leptin induction of mitosis and cell survival depends on Wnt/β-catenin
   signaling ([178]72, [179]73). For example, the level of β-catenin in
   the cytoplasm is maintained low through continuous proteasome-mediated
   degradation controlled by a protein complex of GSK3/APC/Axin ([180]65).
   Phosphorylation of GSK3 on serine 9 by activated Wnt/β-catenin
   signaling leads to destruction of this complex and the accumulation of
   β-catenin. β-Catenin translocates to the nucleus to regulate gene
   transcription ([181]65). Leptin acts as a growth factor for different
   kinds of tumor cells ([182]73, [183]74), causes rapid nuclear
   translocation of β-catenin, and activates other components of the
   Wnt/β-catenin pathway ([184]74–[185]76). Leptin-dependent activation of
   Wnt/β-catenin signaling has also been shown to play a role in leptin
   action in the adult hypothalamus to modulate glucose homeostasis and
   energy balance ([186]77–[187]80).

Leptin Modulates TGFβ, Hedgehog, and Insulin Signaling in Xenopus Tadpole
Brain

   After the Wnt/β-catenin pathway, the next most enriched pathway
   activated by leptin in tadpole brain was that regulated by the TGFβ
   superfamily of ligands, in particular bone BMP and activin. The TGFβ
   signaling pathway plays central roles in animal development, including
   cell proliferation, cell differentiation, and apoptosis ([188]81,
   [189]82). Several components of this pathway were modulated by leptin
   in tadpole brain, including ligands, cell surface receptors, and
   receptor-activated transcription factors of the SMAD family (see Figure
   [190]6).

   The hedgehog signaling pathway was also found to be activated by leptin
   (Figure S1 in Supplementary Material). A proposed mechanism of
   leptin-induced neurogenesis in murine transient amplifying neuroblasts
   involves hedgehog signaling regulation ([191]83). We also found that
   leptin modulated components of the insulin signaling pathway (see
   Figure S2 in Supplementary Material). Interactions between leptin and
   insulin signaling, and potential therapeutic uses for leptin in
   normalizing type 2 diabetes have been described recently
   ([192]84–[193]86). The signal transduction pathways initiated by
   insulin and leptin are both distinct and overlapping. For example,
   leptin activates the JAK2–STAT pathway, while insulin activates the
   mitogen-activated protein kinase pathway. Both insulin and leptin
   appear to activate the PI3K pathway. Recent findings show that insulin
   can potentiate leptin signaling ([194]87).

Leptin and Developmental Programming

   Early life nutrition (from maternal source—placenta or yolk, or from
   feeding—larva) can influence adipocyte production of leptin in the
   fetus ([195]88, [196]89) or larva (Xenopus, Melissa Cui Bender and
   Robert J. Denver, unpublished data). Alterations in hormone production,
   influenced by nutrition during critical periods of development can
   affect the timing of development, and exert lasting effects on the
   structure and function of hypothalamic feeding and neuroendocrine
   circuits, a phenomenon termed developmental programming
   ([197]88–[198]93). There is mounting evidence that early life nutrition
   is an important determinant for risk of obesity ([199]94), and
   modulation of leptin signaling during critical developmental periods
   can have long-term consequences for adult physiology ([200]95–[201]99).
   In animal models, undernutrition during pregnancy leads to a premature
   leptin surge, and offspring develop leptin resistance as adults,
   especially following a high-fat diet ([202]100). A decrease or loss of
   leptin signaling in early postnatal life impairs development of the
   feeding circuit, and also predisposes individuals to leptin resistance
   and obesity as adults ([203]95–[204]99, [205]101–[206]103).

   The cellular and molecular mechanisms by which leptin acts on the
   developing brain to “program” the hypothalamic feeding control circuit
   are poorly understood ([207]104). One possible mechanism of action is
   for circulating leptin in the neonate/tadpole to act within neurogenic
   zones of the developing brain to induce expansion of a LepR expressing
   cell population, which ultimately establishes the leptin-responsive
   network in the hypothalamus and other brain regions. Mammals develop
   competence to respond to leptin signaling during early postnatal
   development ([208]15, [209]16, [210]105); amphibians develop competence
   to respond to leptin during early premetamorphosis (Melissa Cui Bender
   and Robert J. Denver, unpublished data). Functional LepR is detected in
   the VZ/SVZ during early postnatal development in rodents ([211]18) and
   premetamorphosis in Xenopus (Figure [212]2D). Based on our findings and
   those in the literature, we hypothesize that leptin acts on the neural
   progenitor population via Wnt/β-catenin signaling to induce mitosis and
   promote cell survival.

   Future fate mapping studies can investigate if cells born in the
   ependymal layer following leptin injection migrate to and populate the
   preoptic area and ventral hypothalamus. It will also be interesting to
   investigate the consequences of aberrant leptin signaling during early
   postembryonic development on later-life physiology and hypothalamic
   feeding control centers using the Xenopus model system. Leptin
   signaling in early stage Xenopus tadpole brain can be easily activated
   by i.c.v. injection of rxLeptin. Furthermore, cells in the tadpole
   VZ/SVZ can be transfected by EM gene transfer with expression plasmids
   (e.g., pCS2-xLepR) to force LepR expression in stem/progenitor cells,
   followed by injection of rxLeptin i.c.v. to activate LepR signaling. We
   predict that forced expression of LepR in progenitor/stem cells in the
   developing brain will promote proliferation followed by differentiation
   of these cells into the LepR expressing lineage.

Ethics Statement

   All procedures involving animals were conducted under an approved
   animal use protocol (PRO00006809) in accordance with the guidelines of
   the Institutional Animal Care and Use Committee at the University of
   Michigan.

Author Contributions

   MB participated in the design of experiments, conducted the leptin mRNA
   analysis, immunohistochemistry for pH3, DNA microarray analyses and
   electroporation-mediated gene transfer, and participated in writing the
   manuscript. CS did the bioinformatics analyses of the DNA microarray
   data and participated in writing the manuscript. RD participated in the
   design of experiments, analysis of the data, and in writing the
   manuscript.

Conflict of Interest Statement

   The authors declare that the research was conducted in the absence of
   any commercial or financial relationships that could be construed as a
   potential conflict of interest. The handling editor declared a shared
   affiliation, though no other collaboration, with the authors, and the
   handling editor states that the process met the standards of a fair and
   objective review.

Acknowledgments