ABSTRACT

   The opportunistic pathogenic fungus Candida albicans can cause
   devastating infections in immunocompromised patients. Its ability to
   undergo a morphogenetic transition from yeast to filamentous forms
   allows it to penetrate tissues and damage tissues, and the expression
   of genes associated with a number of pathogenetic mechanisms is also
   coordinately regulated with the yeast-to-hypha conversion. Therefore,
   it is widely considered that filamentation represents one of the main
   virulence factors of C. albicans. We have previously identified
   N-[3-(allyloxy)-phenyl]-4-methoxybenzamide (compound 9029936) as the
   lead compound in a series of small-molecule inhibitors of C. albicans
   filamentation and characterized its activity both in vitro and in vivo.
   This compound appears to be a promising candidate for the development
   of alternative antivirulence strategies for the treatment of C.
   albicans infections. In this study, we performed RNA sequencing
   analysis of samples obtained from C. albicans cells grown under
   filament-inducing conditions in the presence or absence of this
   compound. Overall, treatment with compound 9029936 resulted in 618
   upregulated and 702 downregulated genes. Not surprisingly, some of the
   most downregulated genes included well-characterized genes associated
   with filamentation and virulence such as SAP5, ECE1 (candidalysin), and
   ALS3, as well as genes that impact metal chelation and utilization.
   Gene ontology analysis revealed an overrepresentation of cell adhesion,
   iron transport, filamentation, biofilm formation, and pathogenesis
   processes among the genes downregulated during treatment with this
   leading compound. Interestingly, the top upregulated genes suggested an
   enhancement of vesicular transport pathways, particularly those
   involving SNARE interactions.

   IMPORTANCE These results from whole-genome transcriptional profiling
   provide further insights into the biological activity and mode of
   action of a small-molecule inhibitor of C. albicans filamentation. This
   information will assist in the development of novel antivirulence
   strategies against C. albicans infections.

INTRODUCTION

   The opportunistic pathogenic fungus Candida albicans is a common member
   of the human microbiota ([39]1, [40]2). However, this otherwise normal
   commensal of humans is also capable of causing a range of diseases in
   immunocompromised and medically compromised individuals, as well as
   those on heavy doses of antibiotics. Candidiasis carries mortality
   rates of 40 to 60% ([41]3) and current therapeutic options are few,
   mostly restricted to polyenes, azoles, and echinocandins. Use of these
   antifungals is limited by toxicity, drug-drug interactions, and the
   emergence of resistance ([42]4[43]–[44]6). Clearly, novel approaches to
   antifungal drug development are urgently needed ([45]7, [46]8).

   C. albicans is able to undergo reversible morphogenetic conversions
   between yeast and filamentous morphologies, which are intimately linked
   to the pathogenesis of candidiasis, as filaments can invade tissues and
   cause damage ([47]9[48]–[49]12), and filamentation also plays a central
   role in biofilm formation ([50]13[51]–[52]18). Moreover, a number of
   other pathogenetic properties of C. albicans, such as adhesive
   interactions and production of proteolytic enzymes and toxins, are also
   coordinately regulated with the morphological conversion to hyphae
   ([53]1, [54]19[55]–[56]26). Altogether, it is now widely accepted that
   filamentation constitutes one of the main virulence factors associated
   with the pathogenesis of C. albicans, thereby representing an
   attractive, yet unexploited, target for the development of a novel
   antivirulence strategy for the treatment of candidiasis ([57]7,
   [58]27[59]–[60]29). We have previously reported on the in vitro and in
   vivo activities of compound 9029936 ([61]30, [62]31). This compound,
   with a biaryl amide core structure, was originally identified as one of
   the top hits in a screen of 30,000 small-molecule compounds from a
   commercially available chemical library in a search for inhibitors of
   C. albicans filamentation ([63]30, [64]31). Interestingly, compound
   9029936 inhibits filamentation of all C. albicans strains tested
   (including collection strains and clinical isolates) and in all
   different media used to induce the yeast-to-hypha transition,
   indicating that it probably impacts a common node of the multiple
   signaling pathways that control hypha formation under different
   environmental conditions ([65]30, [66]31). It displays a good safety
   profile and potent in vivo activity in different animal models of C.
   albicans infections, and therefore, it represents a promising candidate
   for the development of novel antifungal approaches targeting virulence
   instead of cell proliferation or viability (as current fungistatic or
   fungicidal drugs do). In this study, we used RNA sequencing (RNA-seq)
   to investigate the impact of treatment with compound 9029936 on the
   whole transcriptome of C. albicans. Our results indicate that exposure
   of cells to the compound leads to a downregulation of genes and
   pathways associated with C. albicans virulence, providing further
   insights into the antivirulence mode of action of this small-molecule
   compound.

RESULTS AND DISCUSSION

Global transcriptomic changes of C. albicans in response to treatment with
compound 9029936.

   We investigated changes in C. albicans gene expression under
   filament-inducing conditions as a result of treatment with compound
   9029936 through the use of RNA sequencing. To that end, C. albicans
   SC5314 was grown under strong filament-inducing conditions (yeast
   extract-peptone-dextrose [YPD] containing 10% fetal bovine serum [FBS]
   at 37°C) in the presence or absence of compound 9029936 at 5 μM. Cells
   were harvested after 90 min, since prior experiments have indicated
   that compound 9029936 exerts its inhibitory effects during the early
   stages of the morphological transition ([67]30). The efficacy of
   treatment with this leading compound was monitored by microscopic
   examination, which corroborated the fact that compound 9029936 was able
   to block filamentation, while the untreated samples filamented normally
   (data not shown). Experiments were conducted in triplicate and RNA was
   extracted from the different cultures. Samples were then subjected to
   RNA sequencing using an Illumina HiSeq 2000 platform (as described in
   Materials and Methods). [68]Table S1 in the supplemental material shows
   the sequence reads produced from all samples, with an average of
   38,090,680 reads produced per sample and with 90% or more successfully
   mapped to the C. albicans strain SC5314 reference genome (assembly 21,
   downloaded from the Candida Genome Database
   [[69]http://www.candidagenome.org/]). Principal-component analysis
   (PCA) and hierarchical clustering were applied to provide a visual
   representation of the transcriptomic similarities between samples
   treated with compound 9029936 and the untreated controls. Samples from
   different conditions (presence or absence of compound 9029936)
   clustered separately, while those from the same conditions clustered
   together, indicating a high level of correlation among samples, as well
   as distinctive transcriptome profiles ([70]Fig. 1A and [71]B). Analyses
   of the RNA sequencing data clearly indicate that compound 9029936 has a
   profound effect on C. albicans gene expression leading to vast
   alterations in the transcriptome. For this analysis, genes that showed
   greater than a 2-fold (up or down) change in their level of expression
   were considered differentially expressed, and the cutoff for
   statistical significance used a Benjamini-Hochberg adjusted P value of
   <0.05. A total of 1,320 genes showed a significant difference in
   expression between samples treated with 5 μM compound 9029936 and those
   left untreated under filament-inducing conditions ([72]Fig. 1C). Among
   these differentially expressed genes (DEGs), 618 were upregulated and
   702 were downregulated in the compound-treated samples (relative to the
   untreated controls).

FIG 1.

   [73]FIG 1
   [74]Open in a new tab

   Overall transcriptomic changes of C. albicans growing under
   filament-inducing conditions in response to treatment with compound
   9029936. (A) Principal-component analysis (PCA) plot showing the level
   of correlation and reproducibility among control untreated samples
   (purple) and samples treated with 5 μM compound 9029936 (orange). (B)
   Hierarchical-clustering heat map of gene expression data. The color
   scale indicates the degree of correlation (red, high correlation; blue,
   low correlation), while the height of the dendrogram branches
   represents the variability in gene expression between samples. (C)
   Volcano plot showing the significantly upregulated (red) and
   downregulated (blue) genes in samples treated with compound 9029936. A
   cutoff absolute value of log fold change >1 (2-fold change) was used.
   Adjusted P value < 0.05.
   TABLE S1

   Sequenced reads obtained from the sample set from RNA sequencing
   experiments. Download [75]Table S1, PDF file, 0.2 MB^ (252.1KB, pdf) .

   Copyright © 2019 Romo et al.

   This content is distributed under the terms of the [76]Creative Commons
   Attribution 4.0 International license.

Treatment with compound 9029936 results in downregulation of genes associated
with C. albicans pathogenetic processes.

   We first focused our attention on those genes whose expression was
   downregulated during treatment with our leading compound. [77]Figure 2A
   shows a heat map of the top 50 downregulated genes. This list of most
   downregulated genes includes some uncharacterized open reading frames
   (ORFs), such as orf19.4749 and orf19.6282, whereas orf19.4972 (OFI1)
   encodes a putative transcription factor that has been shown to be
   involved in the regulation of white-opaque switching and filamentous
   growth ([78]32, [79]33). Two genes (FET31 and FET34), encoding the
   major multicopper oxidases (MCOs) that form part of the high-affinity
   iron uptake system, are normally activated in response to iron-limited
   conditions inside the host and have been shown to play important roles
   in hyphal development and virulence ([80]34, [81]35). Interestingly,
   FTR2 and, to a lesser extent, FTR1, encoding high-affinity iron
   permeases with essential roles in virulence ([82]34,
   [83]36[84]–[85]38), were also in this list of most-downregulated genes,
   as was RBT5 (PGA1), encoding a glycosylphosphatidylinositol
   (GPI)-anchored cell wall protein involved in the utilization of hemin
   and hemoglobin for iron in the host ([86]36, [87]39[88]–[89]41).

FIG 2.

   [90]FIG 2
   [91]Open in a new tab

   The top 50 downregulated genes and overrepresented GO terms for
   biological processes downregulated in response to treatment with
   compound 9029936 under filament-inducing conditions. (A) Heat map
   displaying the top 50 downregulated genes in C. albicans cells treated
   with 5 μM compound 9029936 versus untreated control cultures. (B) Bar
   graph representation of significantly overrepresented GO terms for
   biological processes with downregulated genes in RNA sequencing
   analysis in response to treatment with 5 μM compound 9029936.

   Besides iron uptake, both morphogenetic conversions and invasion of
   tissues by C. albicans require phosphate transporters ([92]42), and of
   note, the eighth most downregulated gene was PHO84, which encodes a
   high-affinity phosphate transporter that intersects with the TOR
   pathway and was recently suggested as a potential antifungal target
   ([93]43, [94]44). PHO84 and two other PHO genes (PHO89 and PHO100) in
   the 50 most significantly downregulated genes are induced during
   phosphate starvation ([95]45), indicating that treatment with compound
   9029936 leads to downregulation of genes associated with phosphate
   acquisition with important roles in oxidative stress and virulence.

   As expected from a filamentation inhibitor, featured prominently in
   this group of top 50 genes downregulated during treatment with compound
   9029936 are well-characterized genes associated with filamentation and
   pathogenetic mechanisms of C. albicans (i.e., adhesion and production
   of proteolytic enzymes and toxins), including SAP5, and a majority of
   genes that form part of the C. albicans core filamentation response
   network ([96]46), such as ECE1, ALS3, IHD1, and HGT2. Sap5 is a
   well-known secreted aspartyl proteinase important for virulence and
   pathogenesis during filamentation and biofilm formation by C. albicans
   ([97]47[98]–[99]50). Ece1p, long associated with C. albicans hypha
   formation, with its internal small peptide candidalysin, is a vital
   virulence factor via which C. albicans permeabilizes host epithelial
   membranes, enabling tissue invasion ([100]21). Als3 (a member of the
   agglutinin-like sequence adhesins) is utilized by C. albicans during
   filamentation for epithelial and endothelial adhesion, and null mutants
   are defective in these adhesive properties ([101]51). Furthermore,
   Als3p is also known to play a role in iron acquisition, which, as
   mentioned previously, is crucial for fungal pathogenesis ([102]19).
   Interestingly, although not in the top 50 list, levels of expression of
   all other members of the ALS gene family were significantly
   downregulated too. IHD1 encodes a relatively poorly characterized
   GPI-anchored protein induced during hypha formation ([103]52, [104]53).
   Little information is available for HGT2, except that it constitutes
   part of the core filamentation response network in C. albicans
   ([105]46); it is homologous to the high-affinity glucose transporter
   HGT1, which also plays multiple roles in virulence and in the evasion
   of immune defenses ([106]54) and, interestingly, was also among the top
   50 genes most downregulated by treatment with our compound. Also in
   this list of top 50 downregulated genes were PLB5, encoding a
   phospholipase with a role in virulence ([107]55), and HYR1, encoding a
   prototypical hypha-specific cell wall protein ([108]56). Other genes
   encoding surface adhesins, such as PGA32 (also induced in high iron),
   PGA59, and MSB2, were also downregulated, pointing to potential
   secondary effects on the cell surface as a consequence of the
   inhibition of hypha formation. Of note, although absent from the top 50
   downregulated genes, expression of all other genes coding for the other
   members of the core filamentation response network was also
   significantly downregulated during treatment with compound 9029936.
   These included HWP1, encoding a hypha-specific adhesin complementary to
   Als3p ([109]57), RBT1, encoding a hyphal adhesin related to Hwp1p
   involved in mating and filamentation ([110]58), and DCK1, coding for a
   putative guanine nucleotide exchange factor required for embedded
   filamentous growth ([111]59), as well as the uncharacterized
   orf19.2457. The data were also used to generate a protein interaction
   network using the STRING (Search Tool for the Retrieval of Interacting
   Genes) database; results are shown in [112]Fig. 3. This figure depicts
   protein-protein associations for genes in the C. albicans core
   filamentation response, based on both known and predicted interactions
   of their corresponding protein products. The gradient of colors
   indicates differential levels of expression from RNA sequencing results
   for each different gene in cells treated with compound 9029936.

FIG 3.

   [113]FIG 3
   [114]Open in a new tab

   Network visualization for predicted protein-protein interactions and
   expression levels of genes involved in the core filamentation response
   network. The STRING database is a curated knowledge database of known
   and predicted protein-protein associations. The genes whose protein
   products are known or predicted to have direct protein-protein
   interaction are highlighted. The eight genes identified as forming part
   of the C. albicans core filamentation response network are represented
   by ovals. All other interacting genes are represented by circles. The
   relative expression levels of genes in C. albicans cells treated with 5
   μM compound 9029936 versus untreated control cultures are represented
   by a gradient of colors from green (downregulation) to red
   (upregulation) indicating log2 fold changes. The input genes are drawn
   as filled nodes when their protein structures are known or predicted,
   while unfilled nodes are used for the additional genes with unknown
   protein structures.

   Importantly, the set of genes that is downregulated in response to
   treatment with compound 9029936 shows significant overlap with the set
   of genes previously shown to be strongly upregulated by C. albicans in
   response to serum and temperature ([115]60), one of the strongest
   filament-inducing conditions. Many of these genes are involved in a
   diverse array of processes important for pathogenicity. These findings
   confirm our previous results ([116]30, [117]31) suggesting that
   compound 9029936 may target an upstream regulator (i.e., transcription
   factor) that controls expression of the C. albicans filamentous growth
   program.

   To identify larger patterns in differential gene expression and obtain
   overall insight into the impact of compound 9029936, Gene Ontology (GO)
   terms were assigned to all of the genes in the C. albicans genome and
   we then compared terms for the downregulated genes to a background of
   all terms. We found a total of 37 GO terms that were overrepresented
   (enriched) in this analysis ([118]Fig. 2B). Somewhat unsurprisingly due
   to the antivirulence nature of the compound, filamentation, biofilm
   formation, cell adhesion, and pathogenesis were among the most enriched
   gene classes found to be downregulated. These results further support
   the finding that the morphogenetic transition is the main biological
   process affected by treatment with this compound. Other notable
   overrepresented GO terms for downregulated genes were those involved in
   response to starvation, oxidation reduction, and iron homeostasis and
   transport, all of which have been linked to C. albicans pathogenesis
   ([119]Fig. 2B).

   C. albicans displays a high degree of metabolic plasticity that greatly
   contributes to virulence by allowing it to rapidly adapt to different
   niches within the host where nutrient availability may be limited. This
   capacity to sense its surroundings and adapt to changing
   microenvironments in the human host is critical for both C. albicans
   survival as a commensal and as an opportunistic pathogen ([120]61,
   [121]62). Moreover, morphological transitions in C. albicans are
   accompanied by changes in metabolism, giving each morphological state
   its own metabolic fingerprint ([122]63[123]–[124]66). Thus, we also
   performed Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis based
   on the sequencing data in order to detect which metabolic pathways were
   impacted by treatment with compound 9029936. This analysis detected a
   total of 20 KEGG pathways that were significantly downregulated by
   treatment with our leading compound under filament-inducing conditions
   ([125]Table S2). These overwhelmingly included pathways involved in
   carbon metabolism, biosynthesis and metabolism of amino acids, and
   biosynthesis of secondary metabolites. Thus, it would seem that
   treatment with compound 9029936 leads to the downregulation of a
   multitude of metabolic and biosynthetic pathways associated not only
   with the morphogenetic yeast-to-hypha transition but also with the
   pathogenesis of candidiasis, since induction of these pathways is
   required for C. albicans to adapt to different environments and display
   its full virulence potential within the host ([126]60,
   [127]67[128]–[129]74). Interestingly, we did not observe an overall
   downregulation of genes involved in endocytosis pathways, indicating
   that compound 9029936 functions differently from or has a mechanism of
   action different from those of some previously described inhibitors of
   C. albicans filamentation ([130]75).
   TABLE S2

   Significantly overrepresented KEGG pathways downregulated in C.
   albicans cells during treatment with compound 9029936. Download
   [131]Table S2, XLSX file, 0.01 MB^ (11.9KB, xlsx) .

   Copyright © 2019 Romo et al.

   This content is distributed under the terms of the [132]Creative
   Commons Attribution 4.0 International license.

Treatment with compound 9029936 upregulates the expression of C. albicans
genes required for vesicular transport.

   In the analysis of the top 50 genes upregulated in response to
   treatment with compound 9029936 under filament-inducing conditions
   ([133]Fig. 4A), a large number of uncharacterized genes (indicated by
   open reading frame numbers) with unknown functions emerged. In fact, of
   the top most upregulated genes, two are completely uncharacterized
   (orf19.1353 and orf19.5287), while one is predicted to play a role in
   mRNA splicing (orf19.4875) and one is predicted to be a putative
   v-SNARE of the endoplasmic reticulum (ER) membrane (orf19.2940/BOS1).
   Interestingly, several of the products encoded by upregulated genes are
   involved in vesicular transport within the cell. These included Bos1p
   (described above), Orf19.5875p, and Tlg1p/Tlg2p, all of which are
   predicted to encode syntaxin-like vacuolar t-SNAREs involved in
   vacuolar inheritance, and Orf19.2888p, which is predicted to play a
   role in protein complex assembly as well as early endosome-to-Golgi
   transport. Additionally, Orf19.5539p is also predicted to be involved
   in retrograde vesicle-mediated transport as well as Golgi-to-ER
   transport and SNARE complexes, whereas Gos1p is predicted to play a
   role in vesicle transport and fusion as well as SNARE complex
   localization. Orf19.841p is predicted to be involved in Golgi vesicle
   transport and Golgi membrane localization, while Sys3p plays a role in
   Golgi vesicle docking. Among the others, Kip99p is predicted to have
   microtubule motor activity and protein homodimerization activity and
   plays a role in kinesin complex localization. Vps20p is involved in
   multivesicular body trafficking, and Sec9p is a t-SNARE protein
   required for secretory vesicle-membrane fusion. The theme that emerged
   during this analysis points to the upregulation of genes whose products
   play a role in vesicle transport, localization, and fusion, all of
   which are required for hyphal tip elongation since cell membrane and
   wall components are transported via motor proteins to the growing tip
   to meet the demands of filamentation ([134]76, [135]77). This could
   indicate a compensatory mechanism being utilized by C. albicans in an
   attempt to overcome the potent inhibition of filamentation exerted by
   compound 9029936 or, alternatively, an attempt to remove the compound
   from the cell.

FIG 4.

   [136]FIG 4
   [137]Open in a new tab

   The top 50 upregulated genes and overrepresented GO terms for
   biological processes upregulated in response to treatment with compound
   9029936 under filament-inducing conditions. (A) Heat map displaying the
   top 50 upregulated genes in C. albicans cells treated with 5 μM
   compound 9029936 versus untreated control cultures. (B) Bar graph
   representation of significantly overrepresented GO terms for biological
   processes with upregulated genes in RNA sequencing analysis in response
   to treatment with 5 μM compound 9029936.

   GO analysis identified 28 GO terms enriched (overrepresented) in the
   upregulated gene set in the presence of compound 9029936 under
   filament-inducing conditions. The most enriched terms included
   processes such as hyphal growth and filamentation in response to
   abiotic stimuli (most likely due to the inclusion of genes involved in
   the negative regulation of filamentation), cellular response to drug,
   regulation of transcription, and DNA repair ([138]Fig. 4B).

   As with the downregulated data set, KEGG pathway impact analysis was
   also performed on the list of genes upregulated by treatment with our
   leading compound. This analysis detected eight KEGG pathways that were
   significantly impacted ([139]Table S3). Of these, SNARE interactions in
   vesicular transport proved to be the pathway most significantly
   affected. These results support our initial observation based on the
   heat map of upregulated DEGs ([140]Fig. 4A). Indeed, the morphological
   transition from yeast to hyphae requires the constant transport and
   fusion of vesicles into the growing hyphal tip to deliver the
   components required for the expansion of the membrane as well as the
   necessary enzymes for cell wall synthesis ([141]76). Furthermore, these
   results support our previous findings from cytological profiling
   experiments, in which we observed that the vacuole integrity was
   compromised by treatment with compound 9029936 ([142]31). A map of
   SNARE interactions in vesicular transport was generated from the KEGG
   analysis and is shown in [143]Fig. 5. Genes whose expression is
   upregulated by treatment with compound 9029936 are shown in red. It is
   apparent that a large proportion of the components of this pathway show
   enhanced gene expression in response to this treatment, which again
   suggests a possible compensatory mechanism used by C. albicans in an
   attempt to overcome the inhibitory effects of compound 9029936 on
   filamentation/hypha formation.

FIG 5.

   [144]FIG 5
   [145]Open in a new tab

   Upregulation of genes in the SNARE interactions in vesicular transport
   pathway during treatment with compound 9029936. KEGG analysis indicated
   that a total of 20 genes involved in the SNARE interactions in
   vesicular transport pathway, indicated in red in the map, were
   significantly upregulated in C. albicans cells treated with 5 μM
   compound 9029936 versus untreated control cultures.
   TABLE S3

   Significantly overrepresented KEGG pathways upregulated in C. albicans
   cells during treatment with compound 9029936. Download [146]Table S3,
   XLSX file, 0.01 MB^ (11.3KB, xlsx) .

   Copyright © 2019 Romo et al.

   This content is distributed under the terms of the [147]Creative
   Commons Attribution 4.0 International license.

   In summary, this study provides a comprehensive view of transcriptomic
   changes associated with the treatment of C. albicans with a novel
   small-molecule inhibitor of filamentation. Major changes in the
   expression of key genes and pathways associated with C. albicans
   pathogenesis processes, including filamentation, iron and phosphate
   acquisition, metabolic processes, and vesicular transport, among
   others, provide further information and insight into the antivirulence
   mode of action of compound 9029936.

MATERIALS AND METHODS

Strains, media, and culture conditions.

   The wild-type C. albicans strain SC5314 was utilized for these studies.
   Cell stocks were stored at –80°C, propagated by streaking onto yeast
   extract-peptone-dextrose (YPD) agar plates (1% [wt/vol] yeast extract,
   2% [wt/vol] Bacto peptone, 2% [wt/vol] dextrose, and 1.5% agar), and
   incubated overnight at 30°C. From these, a loopful of cells was
   inoculated into flasks (150 ml) containing 25 ml of YPD liquid medium
   in an orbital shaker at 180 rpm and grown overnight for 14 to 16 h at
   30°C. Under these conditions, C. albicans grows as a budding yeast.

Drugs.

   Milligram quantities of the lead small-molecule compound 9029936 were
   obtained from hit resupply stocks available at Chembridge Corporation
   (San Diego, CA). Concentrated stock solutions were prepared in dimethyl
   sulfoxide (DMSO) and stored at −20°C. Working dilutions of the compound
   at the appropriate final concentration were prepared fresh before each
   experiment.

RNA isolation, purification, and sequencing.

   The C. albicans SC5314 strain was grown overnight as described above,
   washed with phosphate-buffered saline (PBS), used to inoculate YPD
   containing 10% fetal bovine serum (FBS) at a 1:30 dilution, and
   incubated at 37°C for 90 min in the presence or absence of compound
   9029936 at 5 μM as previously described ([148]30). RNA was extracted by
   using a hot-acid-phenol protocol ([149]78). Three biological replicates
   were obtained for each condition (treated and untreated). To determine
   the final RNA concentration and quality, samples were analyzed using a
   2100 series bioanalyzer (Agilent Technologies, CA).

   RNA sequencing was performed at the Genome Sequencing Facility at the
   Greehey Children’s Cancer Research Institute at the University of Texas
   Health Science Center at San Antonio. Briefly, cDNA libraries for
   RNA-seq analysis were prepared from total RNA samples using an Illumina
   TruSeq stranded mRNA-seq kit. RNA sequencing was performed using an
   Illumina HiSeq 2000 machine (San Diego, CA) to obtain 100-bp paired-end
   reads. After the sequencing run, demultiplexing with CASAVA was
   employed to generate a fastq file for each sample.

Transcriptomic analysis.

   For analyses of data, the RNA sequencing reads were processed using CLC
   Genomics Workbench 10.0 (Qiagen). Quality trimming and adapter trimming
   were performed using default parameters. Reads were mapped to the C.
   albicans strain SC5314 reference genome (assembly 21)
   ([150]http://www.candidagenome.org/). Only the uniquely mapped reads
   were used as the raw expression value, followed by the trimmed mean of
   M-values (TMM) normalization ([151]79) to eliminate RNA composition
   bias. Differential gene expression profiling was carried out using the
   edgeR package implemented in R ([152]79). The Benjamini and Hochberg
   false-discovery rate (FDR) procedure was used for multiple-hypothesis
   testing correction ([153]80). Genes with FDR-adjusted P value (<0.05)
   and expression fold changes of more than 2 or less than −2 were
   considered to be differentially expressed. To validate the RNA
   sequencing data, we performed quantitative reverse transcription-PCR
   (qRT-PCR) to measure changes in the amount of mRNA of selected genes
   between treated and untreated samples ([154]Fig. S1).
   FIG S1

   Confirmatory qRT-PCR analysis of hypha-specific genes differentially
   expressed during treatment with compound 9029936. Levels of expression
   of PHO84, ALS3, and HWP1 were measured by qRT-PCR in order to confirm
   results from RNA-seq experiments. The primers used were
   TTTGTTGGGTTTGTTCGTCA (forward) and GCAATAATGGCACCGACTTT (reverse) for
   PHO84, CAACTTGGGTTATTGAAACAAAAACA (forward) and
   AGAAACAGAAACCCAAGAACAACCT (reverse) for ALS3, and TCAGCCTGATGACAATCCTC
   (forward) and GCTGGAGTTGTTGGCTTTTC (reverse) for HWP1. **, P < 0.0015;
   ***, P < 0.0008; ****, P < 0.0001. Download [155]FIG S1, PDF file, 0.2
   MB^ (253.3KB, pdf) .

   Copyright © 2019 Romo et al.

   This content is distributed under the terms of the [156]Creative
   Commons Attribution 4.0 International license.

   Functional enrichment analysis was performed on the differentially
   expressed genes to identify overrepresented Gene Ontology (GO)
   biological processes using the Panther classification system ([157]81).
   Kyoto Encyclopedia of Genes and Genomes (KEGG) ([158]82) pathway
   enrichment analysis was performed using KOBAS 3.0 software ([159]83).
   The Benjamini and Hochberg procedure was used for multiple-testing
   correction for both GO and KEGG pathway analyses, with the cutoff
   criterion of an FDR of <0.05 ([160]80). Protein-protein association
   data for Candida albicans (taxon identifier [ID] 5476) were extracted
   from the STRING (Search Tool for the Retrieval of Interacting Genes)
   database ([161]84). STRING uses Bayesian models to integrate various
   sources of data, including genomic context (sequence similarity, genome
   organization, chromosome synteny, and phylogenetic reconstruction),
   gene coexpression, biochemical and genetic experimental data, pathway
   analysis, computational predictions, and literature text mining, to
   infer protein-protein associations. From a functional perspective,
   “association” can mean direct physical binding, but it can also mean
   indirect interaction, such as participation in the same cellular
   process. A confidence score (S) ranging from 0 to 1 was assigned to
   each predicted association. Cytoscape 3.7.1 ([162]85) and StringApp
   ([163]86) were used for the interactome network visualization. The
   relative expression levels of genes in C. albicans cells treated with 5
   μM compound 9029936 versus untreated control cultures are represented
   in [164]Fig. 3 by a gradient of colors from green (downregulation) to
   red (upregulation) for log2 fold change.

Data availability.

   The RNA sequencing data were deposited into the GEO database under
   accession number [165]GSE136116.

ACKNOWLEDGMENTS