Abstract

   Fungi, particularly yeasts, are known essential components of the host
   microbiota but their functional relevance in development of immunity
   and physiological processes of fish remains to be elucidated. In this
   study, we used a transcriptomic approach and a germ-free (GF) fish
   model to determine the response of newly hatched zebrafish larvae after
   24 h exposure to Pseudozyma sp. when compared to conventionally-raised
   (CR) larvae. We observed 59 differentially expressed genes in
   Pseudozyma-exposed GF zebrafish larvae compared to their naïve control
   siblings. Surprisingly, in CR larvae, there was not a clear
   transcriptome difference between Pseudozyma-exposed and control larvae.
   Differentially expressed genes in GF larvae were involved in host
   metabolic pathways, mainly peroxisome proliferator-activated receptors,
   steroid hormone biosynthesis, drug metabolism and bile acid
   biosynthesis. We also observed a significant change in the transcript
   levels of immune-related genes, namely complement component 3a,
   galectin 2b, ubiquitin specific peptidase 21, and aquaporins.
   Nevertheless, we did not observe any significant response at the
   cellular level, since there were no differences between neutrophil
   migration or proliferation between control and yeast-exposed GF larvae.
   Our findings reveal that exposure to Pseudozyma sp. may affect
   metabolic pathways and immune-related processes in germ-free zebrafish,
   suggesting that commensal yeast likely play a significant part in the
   early development of fish larvae.

   Keywords: immune system, commensal yeast, germ-free, transcriptome,
   Danio rerio, Pseudozyma sp.

Introduction

   Germ-free (GF) organisms are ideal research models to reveal the
   effects of exposure to either one selected microbial species or
   microbial consortia from a particular host. Even if fungi account for
   only a small proportion of the vertebrate microbiota, they play a
   significant role in shaping the microbial community structure,
   metabolic functions, and modulation of the host immune responses
   ([35]1). Fungi are particularly well known for their involvement in
   immunomodulatory processes and their health inducing properties ([36]2,
   [37]3). Accumulating evidence indicates that yeasts, its metabolites
   and cell wall components are key players in the physiology of all
   hosts, including fish ([38]4, [39]5). Until recently, only few yeast
   strains/species like Saccharomyces cerevisiae, Debaryomyces hansenii
   and Candida albicans were exploited for industrial and commercial
   purposes ([40]5–[41]7). However, studies have demonstrated the
   protective functions of non-Saccharomycetaceae species like Yarrowia
   lypolitica 242 (Yl242) in zebrafish (Danio rerio) against Vibrio
   anguillarum infection ([42]8). In addition, the extremophile strain
   Sterigmatomyces halophilus N16 has been labeled as a novel fish
   immunostimulant due to its beneficial effects on the growth and immune
   response of (Sparus aurata) gilthead seabream ([43]9).

   Comparison of GF mice with those colonized with normal microbiota has
   demonstrated that microbiota-induced alterations of gene expression are
   associated with immune homeostasis and are essential for ideal
   metabolic orientation of the host ([44]10, [45]11). Furthermore,
   colonization of GF mice with Bacteroides thetaiotaomicron and
   Bifidobacterium longum has altered the metabolic processes ([46]12).
   Similarly, exposure of GF mice to the same bacterial ecosystem as those
   of conventionally raised mice altered the lipid absorption-linked
   hepatic metabolites, which were found to interact with specific
   bacteria ([47]13). Another study in GF mice has demonstrated the
   importance of commensal yeasts in regulating metabolic pathways and
   affecting the expression of genes involved in intestinal barrier
   maintenance ([48]14). DNA microarray gene expression profiling of GF
   zebrafish larvae colonized with gut microbiota has provided the
   possibility to understand the role of bacteria in stimulating
   epithelial proliferation, nutrient metabolism and innate immune
   response ([49]15). In addition, it has been shown that early exposure
   of zebrafish larvae to commensal microbes can prime neutrophils, induce
   proinflammatory and antiviral genes and increase the resistance to
   viral infection ([50]16). In our previous study, we have shown that
   exposure to Pseudozyma sp. or Debaryomyces sp. during early ontogeny
   can remarkably alter the intestinal bacterial composition of zebrafish
   larvae ([51]17). Pseudozyma spp. are yeast-like fungi, related to the
   Ustilaginales order and belonging to the phylum Basidiomycota. Some
   species of Pseudozyma are known to secrete extracellular metabolites
   and biosurfactants with great potential for biocontrol applications
   ([52]18–[53]20). The cell wall of these yeasts consists mainly of
   β-glucans ([54]21) with immunomodulatory properties considered
   beneficial to fish health ([55]22).

   Thus, far, the influence of yeast on host transcriptomic responses has
   not been reported in fish. In order to elucidate how Pseudozyma sp.
   contact with external tissues and mucosal surfaces (excluding
   intestinal tissues) during early ontogeny influences metabolic and
   immunity-related pathways, we performed RNA-sequencing to analyze the
   transcriptomic response of germ-free (GF) and conventionally raised
   (CR) zebrafish larvae upon Pseudozyma exposure.

Materials and Methods

Ethics Statement

   All experimental procedures involving zebrafish were carried out in
   compliance with the Guidelines of the European Union Council (Directive
   2010/63/EU) and the Spanish RD 53/2013. Experiments that were conducted
   in Spain, were approved by the Bioethical Committee of the University
   of Murcia (licenses #537/2011, #75/2014, and #216/2014).

Pseudozyma sp. and Culture Conditions

   The yeast strain used in this study was originally isolated from the
   intestine of zebrafish (AB strain) that were reared in a recirculating
   system (Pentair Aquatic Eco-Systems, NC, USA) at Nord University, Bodø.
   The isolated yeast colonies were identified by PCR amplification and
   Sanger sequencing of the internal transcribed spacer 2 (ITS2) region of
   the fungal rDNA, using fITS7 (GTGARTCATCGAATCTTTG) and ITS4
   (TCCTCCGCTTATTGATATGC) primers ([56]23, [57]24). Identification at the
   species level was determined by BLASTN similarity searches against the
   National Centre for Biotechnology Information (NCBI) GenBank database
   using default parameters. Pure yeast cultures were prepared and stored
   in 30% (v/v) glycerol (Sigma-Aldrich, St. Louis, MO, United States) at
   −80°C. Prior to use in the exposure studies, the cultures were revived
   on yeast extract peptone dextrose agar (Sigma-Aldrich) plate and broth
   supplemented with 0.025% chloramphenicol (Sigma-Aldrich). A single
   colony from the agar plate was inoculated and further grown in yeast
   extract peptone dextrose broth at 28°C, shaking the culture flasks at
   180–200 rpm for 24 h. The cultured yeast cells were then harvested by
   centrifugation at 10,000 rpm for 10 min, washed and resuspended in
   sterile phosphate-buffered saline (PBS, Sigma-Aldrich) to a final
   concentration of 2 × 10^5 CFU/ml for the exposure study.

Zebrafish Husbandry and Preparation of Larvae

   Standard husbandry procedures ([58]25) were followed to maintain
   wild-type (AB strain) and Tg(mpx::eGFP)^i114 zebrafish in a
   re-circulation system (Aqua Medic GmBH, Bissendorf, Germany) at the
   Department of Cell Biology and Histology, University of Murcia.
   Germ-free (GF) and conventionally-raised (CR) zebrafish larvae for the
   exposure experiment were generated by following the method described by
   Pham et al. ([59]26) with slight modification, as previously detailed
   in Siriyappagouder et al. ([60]17).

Yeast Exposure Study

   Zebrafish larvae, both GF and CR, were aseptically divided into two
   groups (maintained in triplicate cell culture flasks): control (PBS)
   and yeast-exposed (Pseudozyma). Each group consisted of 60 larvae
   randomly distributed into the 25 mL rearing flasks, each holding 20
   larvae. The different study groups and their abbreviations are as
   follows: conventionally-raised control (CRC), conventionally-raised
   yeast-exposed (CRY), germ-free control (GFC), and germ-free
   yeast-exposed (GFY). At 2 days post-fertilization (dpf), GF and CR
   zebrafish larvae were exposed to 2 × 10^5 CFU/ml Pseudozyma sp. and
   incubated for 24 h (until 3 dpf) at 28°C. On the other hand, the
   control larvae were exposed to PBS. After the 24 h exposure, zebrafish
   larvae were washed (3×) with regular embryo medium and euthanized with
   an overdose of MS222 (Sigma-Aldrich, Madrid, Spain). Nine pools of five
   larvae per treatment group were collected in screw cap tubes on dry ice
   and immediately stored at −80°C for later use.

Live Imaging of Neutrophils

   At 72 hpf, larvae of the transgenic line Tg(mpx::eGFP)^i114 in which
   the GFP expression is driven by the myeloid-specific peroxidase (mpx)
   promoter and whose neutrophils are green fluorescent ([61]27), were
   anesthetized with tricaine methanesulfonate (200 mg/L, Sigma-Aldrich)
   and mounted in 1% (w/v) low melting point agarose (Sigma-Aldrich)
   dissolved in egg water. Fish were imaged with an epifluorescence
   stereomicroscope LeicaMZ16F (Leica, Germany) equipped with green
   fluorescent filters, while they were kept in their agar matrices with
   the medium at 28.5°C ([62]16). High-quality images were subsequently
   used to determine the number of fluorescent neutrophils (mpx::eGFP)
   present at the caudal hematopoietic tissue (CHT) in each fish per
   condition using the Cell Counter plugin in ImageJ
   ([63]https://imagej.nih.gov/ij/plugins/cell-counter.html).

RNA Isolation, Library Preparation and mRNA Sequencing

   Total RNA was extracted from pooled larvae following the QIAzol
   protocol (Qiagen, Hilden, Germany). RNA quality, purity and quantity
   were determined using the NanoDrop 1000 (Thermo Fisher Scientific,
   Waltham, MA, United States). Furthermore, RNA integrity was assessed
   using Agilent RNA high sensitivity screen tape kits on the 2200
   TapeStation system (Agilent Technologies, Santa Clara, CA, USA). Only
   samples with RIN ≥ 7 were used for library preparation.

   RNA-seq libraries were prepared using the NEBNext ultra II directional
   RNA library kit with the poly (A) mRNA magnetic isolation module (NEB
   #E7490), according to the manufacturer's protocol (New England, BioLabs
   Inc. UK). In brief, one microgram of total RNA was used for library
   preparation and mRNA was enriched using oligo-dT magnetic beads and
   fragmented to ~100–200 nt prior to synthesis of the first and second
   cDNA strands. The resulting cDNA was purified and the 3′ end was
   repaired for adapter ligation. PCR enrichment (eight cycle) was
   performed and the amplified libraries were cleaned with AMPure XP beads
   (Beckman Coulter, Inc. Brea, CA, United States) to ensure that they
   were free from residual adapter dimers and unwanted (smaller)
   fragments. In total, 16 libraries were prepared, i.e., four replicates
   per treatment group. Individual libraries were quantified, normalized,
   pooled at equimolar ratio, and sequenced as single-end reads (75 bp) on
   the Illumina NextSeq 500 sequencer (Illumina, San Diego, CA, United
   States) with NextSeq 500/550 high output v2 kit.

Bioinformatic Analysis of Differential Gene Expression

   Adapter sequences were removed from the raw reads using cutadapt with
   the following parameters: -q 25, 20 –quality-base = 33 –trim-n -m 20
   ([64]28). Quality of clean reads was further assessed using FastQC
   ([65]29) and reads with quality <30 were removed. Bowtie 2 ([66]30) and
   Tophat2 were used to build the index and align the reads. Cleaned reads
   were mapped to the zebrafish transcriptome (GRCz10.86.chr.gtf) and
   genome (GRCz10.dna.toplevel.fa) from Ensembl
   ([67]http://www.ensembl.org) with TopHat2, version 2.1.0 ([68]31). Gene
   expression values were computed by HTSeq
   ([69]http://htseq.readthedocs.io/en/release_0.9.1/). DESeq2 package
   ([70]32) was used to determine the differentially expressed genes;
   transcripts with more than 1.5-fold change in the treatment groups
   compared to the control group, and adjusted p < 0.05
   (Benjamini–Hochberg multiple test correction method) were considered
   significantly different, and they were used for downstream analysis.
   Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment was
   studied using clusterProfiler ([71]33). Transcriptome data were
   visualized using the R packages ggplot2 and pheatmap. The datasets
   generated in this study can be found in the Sequence Read Archive
   (NCBI) under the accession number [72]PRJNA579488.

Validation of RNA-Seq Data by Droplet Digital PCR (ddPCR)

   We selected 5 genes, fabp2, lgals2b, cyp7a1, aqp8a.2, and c3a.2 from
   the list of top DEGs ([73]Supplementary Table 1) for validation of the
   RNA-Seq data. Primers for the target genes were designed using NCBI
   Primer BLAST and NetPrimer ([74]Table 1). The primers for the reference
   genes (eef1a and actb) had been previously reported ([75]37). One
   microgram of total RNA from each sample, GFY (n = 4) and GFC (n = 4)
   was reverse transcribed using the reverse QuantiTect transcription kit
   (Qiagen), according to the manufacturer's protocol. The obtained cDNA
   was further diluted 10 times with nuclease free water and used as PCR
   template. ddPCR was performed on a QX200™ Droplet Digital™ PCR System
   (Bio-Rad Laboratories, Inc., Hercules, CA, USA). In brief, the ddPCR
   reaction mixture consisting of 10 μl of QX200™ ddPCR EvaGreen Supermix
   (Bio-Rad), 1 μl of gene-specific primer pair, 4 μl of the cDNA sample
   was made up to a total volume of 20 μl with 5 μl of nuclease-free
   water. Purified distilled water was used as no template control.
   Droplets were prepared using a droplet generator with 70 μL of droplet
   generating oil and 20 μL of ddPCR reaction mixture. The thermocycling
   reaction was performed in a C1000 thermal cycler (Bio-Rad) with the
   following conditions: initial denaturation at 95°C for 10 min, followed
   by 40 cycles of 94°C for 30 s, 60°C for 1 min and a final elongation at
   98°C for 10 min with 2°C/s ramp rate. The fluorescence intensity of
   each droplet was measured on the QX200 Droplet Reader (Bio-Rad).
   Positive and negative droplet cluster signals were manually separated
   by setting the threshold level of each gene based on the fluorescence
   level of the negative control. Relative expression of selected genes
   was determined based on the geometric mean of reference genes (eef1a
   and actb). After confirming that the data complied with normality
   (Shapiro-Wilk) and equal variance (F-test) assumptions, the Welch two
   sample t-test was used to detect significant differences between GFC
   and GFY groups.

Table 1.

   Details of the primers used for ddPCR.
   Gene Forward primer (5′-3′) Reverse primer (5′-3′) Amplicon (bp)
   Accession or references