Abstract

Background

   Xihuang Pill (XHP) is mainly used to treat “Ru Yan (breast cancer)”.
   Evidence-based medical evidence and showed that XHP improves the
   efficacy of chemotherapy and reduced chemotherapy-induced toxicity in
   breast cancer patients. However, the mechanism of XHP against breast
   cancer is not clear.

Methods

   The effect of XHP extract on cell half-inhibitory concentration (IC50)
   and cell viability of MD-MB-231 cells was detected by CCK-8 method. The
   cell inhibition rate of MDA-MB-453 cells were detected by MTT method.
   Apoptosis was detected by flow cytometry, cell transfer ability was
   detected by Transwell method, and cell proliferation ability was
   detected by colony formation assay. The expression of Notch1, β-catenin
   and c-myc mRNA in MDA-MB-453 cells were detected by real-time
   fluorescence quantitative PCR. Then, chemical informatics and
   transcriptomics methodology was utilized to predict the potential
   compounds and targets of XHP, and collect triple negative breast cancer
   (TNBC) genes and the data of Olibanum and β-boswellic acid intervention
   MD-MB-231 cells (from [35]GSE102891). The cytoscape software was
   utilized to undergo network construction and network analysis. Finally,
   the data from the network analysis was imported into the DAVID database
   for enrichment analysis of signaling pathways and biological processes.

Results

   The IC50 was 15.08 g/L (for MD-MB-231 cells). After interfering with
   MD-MB-231 cells with 15.08 g/L XHP extract for 72 h, compared with the
   control group, the cell viability, migration and proliferation was
   significantly decreased, while early apoptosis and late apoptosis were
   significantly increased (P < 0.01). After interfering with MDA-MB-453
   cells with 6 g/L XHP extract for 72 h, compared with the control group,
   the cell inhibition and apoptosis rate increased, while the expression
   of Notch1, β-catenin and c-myc mRNA decreased. (P < 0.05). The chemical
   informatics and transcriptomics analysis showed that four networks were
   constructed and analyzed: (1) potential compounds-potential targets
   network of XHP; (2) XHP-TNBC PPI network; (3) DEGs PPI network of
   Olibanum-treated MD-MB 231 cells; (4) DEGs PPI network of β-boswellic
   acid -treated MD-MB 231 cells. Several anti-TNBC biological processes,
   signaling pathways, targets and so on were obtained.

Conclusion

   XHP may exert anti-TNBC effects through regulating biological
   processes, signaling pathways, targets found in this study.

   Keywords: Xihuang Pill, triple negative breast cancer, transcriptomics,
   chemical informatics, MDA-MB-231 cell, high-throughput omics,
   bioinformatics, Chinese medicine

Introduction

   Breast cancer is the leading cause of death among women worldwide, and
   the incidence rate has increased significantly in recent years, which
   seriously threatens women’s health ([36]Fan et al., 2014; [37]Desantis
   et al., 2017). Breast cancer is currently divided into five subtypes by
   coding sequence microarray technology ([38]Prat et al., 2015;
   [39]Cejalvo et al., 2018): (1) Luminal-A type; (2) Luminal-B type; (3)
   human epidermal growth factor receptor 2 (HER2) overexpression type;
   (4) base-like type; (5) normal type. Basal-like breast cancer is
   non-specific invasive ductal carcinoma ([40]Jiang et al., 2019), and
   its ER, PR and HER2 are negative, also known as triple negative breast
   cancer (TNBC). At present, TNBC accounts for 10 to 17% of all breast
   cancers ([41]Warner et al., 2015; [42]Kulkarni et al., 2019). The vast
   majority of TNBCs are highly invasive ductal carcinomas with nuclear
   polymorphism, high mitotic rate, and minimal tubule formation
   ([43]Kulkarni et al., 2019). TNBC is generally classified into basal
   cell-like type 1, basal cell-like type 2, immunoregulatory,
   interstitial and mesenchymal stem cell types, and luminal androgen
   receptor type ([44]Shi et al., 2018; [45]Jiang et al., 2019). TNBC is a
   poorly differentiated tumor with strong invasive and metastatic
   ability, easy to invade blood vessels, and increased recurrence rate
   ([46]Jiang et al., 2019).

   At present, the management and treatment measures for triple-negative
   breast cancer are mainly: (1) local treatment: surgery is still the
   first choice for local treatment ([47]Li et al., 2019a); (2) systemic
   therapy: combination chemotherapy of taxane and anthracycline is
   currently the common choice for TNBC neoadjuvant chemotherapy, but
   anthracyclines have irreversible toxicity to the heart ([48]Mangone et
   al., 2019); (3) targeted therapy ([49]Jhan and Andrechek, 2017).
   However, due to the ineffectiveness of traditional endocrine therapy
   and targeted therapy, patients with TNBC sometimes have tumor
   metastasis very early, which seriously affects their physical and
   mental health ([50]McCann et al., 2019). At present, in order to find
   new chemotherapy or sensitizing drugs, plants and natural products are
   gradually becoming the source of new TNBC drug development ([51]Szarc
   Vel Szic et al., 2017). The current study found that some traditional
   Chinese medicine compounds and natural medicines can inhibit the
   proliferation, metastasis, and drug resistance of TNBC cells in a
   variety of ways ([52]Baraya et al., 2017; [53]Szarc Vel Szic et al.,
   2017).

   Xihuang Pill (XHP) is from the Wai Ke Quan Sheng Ji by Wang Weide in
   1740, which is mainly used to treat “Ru Yan (breast cancer)” and so on.
   XHP is compose of Myrrha, Bovis Calculus, Olibanum and Moschus.
   Systematic reviews and meta-analysis showed that XHP combined with
   chemotherapy significantly enhanced tumor response in breast cancer
   patients, improved Karnofsky performance scores and reduced
   chemotherapy-induced toxicity ([54]Guo et al., 2018; [55]Mao et al.,
   2019). He et al. found that XHP-containing serum increased TP53 and Bax
   (P < 0.05), and decreased the ratio of Bcl-2/Bax in MDA-MB-435 cells
   ([56]He et al., 2018). The mechanism of anti-TNBC of XHP has been
   reported in many studies, such as improving the immunosuppressive state
   of the tumor microenvironment and reversing immune escape, thereby
   inhibiting tumor growth. XHP reduces the number of Treg cells by
   inhibiting the expression of PI3K and AKT and up-regulating the
   expression of AP-1 in Treg cells, thereby promoting Treg cell apoptosis
   ([57]Li et al., 2018a). Other study found that the mechanism of XHP
   inhibition of tumors may be related to the up-regulation of gene and
   protein expression of MEKK1, SEK1, JNK1 and AP-1 in Treg cells in the
   tumor microenvironment ([58]Su et al., 2018). Zheng et al. found that
   XHP can block the cell cycle of the Hs578T cell line and promote its
   apoptosis ([59]Zheng et al., 2016).

   Recent studies showed that the main anti-breast cancer herbs in XHP are
   Myrrha and Olibanum, especially Olibanum ([60]Cheng et al., 2016;
   [61]Hao et al., 2018). Although the above studies have described some
   of the mechanisms of XHP against TNBC, the mechanism remains unclear.
   In our previous studies, we successfully used multiple bioinformatics
   techniques and transcriptomics to analyze the mechanisms by which
   traditional Chinese Medicine interferes with different types of breast
   cancer ([62]Zeng and Yang, 2017; [63]Yang et al., 2018; [64]Yang et
   al., 2019). Therefore, this study will use a multi-directional
   pharmacology strategy based on chemical informatics and transcriptomics
   to clarify the mechanisms by which XHP and Olibanum treat TNBC. The
   research process is shown in [65]Figure 1.

Figure 1.

   [66]Figure 1
   [67]Open in a new tab

   The process of this research.

Material and Methods

Experimental Material Preparation

Experimental Drugs

   Xihuang Pill (XHP) was purchased from Tianjin Tianshili (Liaoning)
   Pharmaceutical Co., Ltd. (Batch number: 20140726; Specification: 0.1g *
   30 bottles/box; The composition ratio of Moschus, Bovis Calculus,
   Myrrha and Olibanum is 15: 15: 550: 550). Reference substance:
   acetyl-11-keto-β-boswellic acid (batch number: 111760-201502, mass
   fraction >98%) was purchased from China Food and Drug Research
   Institute.

   Preparation of XHP solution: XHP was immersed in DMEM medium pre-cooled
   at 4°C for 24 h (mass concentration 0.1 g/mL) in a sterile sealed
   container; use ultrasonic vibration to help dissolve for 2 h and
   continue to soak for 48 h at 4°C. The supernatant was filtered through
   a 0.22 μm micropore filter to obtain an XHP leaching solution. The XHP
   solution is stored at 4°C (or −20°C); during the experiment, it was
   diluted to the desired concentration with DMEM medium.

   Preparation of XHP solution required for High Performance Liquid
   Chromatography (HPLC): 1.00 g of XHP powder was accurately weighed and
   placed in a 50 ml Erlenmeyer flask. Pipet 20 ml of methanol accurately,
   sonicate in an ice bath for 20 min, extract twice, and place at room
   temperature. Centrifuge at 4,000 r/min for 5 min. The supernatant was
   placed in a pear-shaped bottle and concentrated under reduced pressure.
   Reconstitute with methanol and transfer to a 25 ml volumetric flask.
   Finally, make up to volume with methanol and shake well.

   Preparation of acetyl-11-keto-β-boswellic acid reference substance:
   Take an appropriate amount of acetyl-11-keto-β-boswellic acid,
   accurately weigh it, place it in a measuring flask, add methanol to
   volume, and make it to a mass concentration of 1.22 mg/mL.

Cell Line

   Human triple-negative breast cancer (TNBC) cell line MDA-MB-231 and
   MDA-MB-453 were provided by the Cell Center of Xiangya School of
   Medicine, Central South University. While experimenting, the MD-MB-231
   cells and MDA-MB-453 cells were cultured in high glucose DMEM medium
   containing 10% FBS in an incubator at 37°C, 5% CO2, and the medium was
   changed every other day. The group without XHP was the control group,
   and the group with XHP extract was the experimental group (XHP group),
   and each group had three duplicate wells.

Reagent and Instrument

   DMEM medium and Transwell kit were purchased from Corning Inc.; Fetal
   bovine serun (FBS) was purchased from Ausbian Inc., Australia; CCK-8
   kit and Giemsa dye solution were purchased from Sigma Inc., USA; The
   Annexin V-FITC/PI double-stained cell apoptosis assay kit was purchased
   from eBioscience Inc., USA.

   Ultra-clean workbench (Sujing Antai Company), CO2 incubator (Hitachi
   Company). LC-20A HPLC, including SPD-M20A detector, DGU-20A quaternary
   pump (Shimadzu company); KQ-300DE ultrasonic cleaner (Kunshan
   Ultrasonic Instrument Co., Ltd.)

HPLC Detection

   Shimadzu LC-20A HPLC, Waters Symmetry C18 column (250 mm × 4.6 mm, 5
   μm); injection volume 20 μl; column temperature 30°C; volume flow 0.8
   ml/min; mobile phase is methanol-0.5% acetic acid aqueous solution.

   The elution procedure is 0 to 10 min, 75% methanol; 10 to 45 min, 75 to
   87% methanol; 45 to 75 min, 87% methanol; 75 to 85 min, 87 to 90%
   methanol; 85 to 115 min, 90% methanol; 115 to 120 min, 90 to 97%
   methanol; 120 to 150 min, 97% methanol. The detector is an evaporative
   light scattering detector, the drift tube temperature is 45°C; the air
   volume flow is 1.5 L/min, and the gain value is 2.

Experimental Methods for MD-MB-231 Cell

Detection of XHP Half-Inhibitory Concentration (IC50) and Cell Viability

   Some 96-well plates were seeded at 3,000 cells (100 μl) per well. Nine
   (9) groups were set according to the concentration of added XHP, and
   the concentrations of XHP were 0, 1, 2, 5, 10, 20, 50, 75 and 100 g/L.
   After treatment for 72 h, 10 μl of CCK-8 reagent was added 2 to 4 h
   before the termination of culture, and the OD value was detected by a
   microplate reader at 450 nm. After logarithmic processing, a scatter
   plot was prepared to calculate the IC50 value of XHP. Using this IC50
   value as the drug concentration of XHP intervention in MD-MB-231 cells
   in subsequent experiments (including cell viability detection).

   After treatment with XHP extract for 72 h, the culture was continued
   for 5 d with the control group. 10 μl of CCK-8 reagent was added 2 to 4
   h before the termination of the culture, and the cell viability was
   measured daily for 5 days via the above procedure.

MD-MB-231 Cell Apoptosis Detection by Flow Cytometry

   Some 6-well plates were seeded at a minimum of 5 × 10^5 cells per well
   (2 ml) and plated for 24 h. Apoptosis detection was performed by flow
   cytometry according to the procedure in the instructions of Annexin
   V-FITC/PI double-stained cell apoptosis assay kit.

Transwell Detection

   The cells were cultured in 24-well plates. About 100 μl of serum-free
   medium was added to each well of the Transwell’s inner chamber, and 600
   μl of medium containing 30% FBS was added to each well of the
   Transwell’s outer chamber, and plated for 18 h at a cell number of 1 ×
   105 per well. Transfer cells, fix, stain with Giemsa stain, photograph
   with fluorescence microscopy, and count cells at a magnification of
   200×.

Cell Clone Detection

   Some 6-well plates were seeded at 800 cells (2 ml) per well, and
   continue to culture for 10 days, and change the solution once every 3
   days. Cell clones were photographed under a fluorescent microscope
   before termination of the experiment. Fix the cells with 4%
   paraformaldehyde, crystal violet staining, photograph.

Experimental Methods for MDA-MB-453 Cell

Determination of Cell Inhibition Rate by MTT Method

   The MDA-MB-453 cells in the logarithmic growth phase were used for
   experiments. The cell concentration was adjusted to 1 × 10^5 cells/mL
   and inoculated in 96-well culture plates; 90 μl of cell suspension was
   added to each well, and then 10 μl of different concentrations of XHP
   (0, 4, 6, 8, 10, 12, 14 g/L) were added. Six (6) duplicate wells were
   set for each group, and after incubating in a cell incubator at 37°C
   and 5% CO2 for 72 h, 20 μl MTT (5mg/mL) was added to each well. After
   continuing the culture for 4 h, the supernatant was discarded, and DMSO
   solution (DMSO) 150 μl/well was added to each well. After shaking for
   10 min to fully dissolve the crystals, the OD value of each well was
   measured with a microplate reader at a wavelength of 490 nm.

MDA-MB-453 Cell Apoptosis Detection by Flow Cytometry

   Apoptosis detection was performed by flow cytometry according to the
   procedure in the instructions of Annexin V-FITC/PI double-stained cell
   apoptosis assay kit.

The Expression of Notch1, β-catenin and c-myc mRNA Detection by Real-Time
Fluorescence Quantitative PCR

   The total RNA of each group of cells was extracted with Trizol
   according to the kit instructions. The OD260/OD280 ratio is calculated,
   and the ratio ≥1.8 means the purity and concentration of the RNA meet
   the experimental requirements. After detecting the integrity of RNA by
   agarose gel electrophoresis, the primers of Notch1, β-catenin, c-myc
   and internal reference GAPDH were added to amplify the corresponding
   target fragments. Finally, the real-time fluorescence quantitative PCR
   program was performed on the machine. The primers were designed by
   Primer 3.0 software and synthesized by Yuantai Bio-Technology Co.,
   Ltd., see [68]Table 1.

Table 1.

   The primers.
   Gene Primer sequence (5′->3′) Product size (bp) Annealing temperature
   (°C)
   GAPDH F: CAATGACCCCTTCATTGACC
   P: GACAAGCTTCCCGTTCTCAG 106 59/60
   Notch1 F: ACCAATACAACCCTCTGCGG
   P: GGCCCTGGTAGCTCATCATC 141 59
   β-catenin F: ATGAC TCGAGCTCAGAGGGT
   P:ATTGCACGTGTGGCAAGTTC 99 60
   C-myc F:CGTCCTCGGATTCTCTGCTC
   P:GCTGCGTAGTTGTGCTGATG 186 60
   [69]Open in a new tab

Statistical Analysis

   Statistical analysis was performed using SPSS 19.0 software. The
   measurement data were normally distributed, expressed as mean ±
   standard deviation, and t-test was used for comparison between groups.
   The difference was statistically significant at P < 0.05.

Chemical Informatics Methods

XHP Active Compounds Prediction

   With the development of computer technology, Chinese medicine-related
   laboratories have built several large-scale Chinese medicine databases,
   which contain the components of commonly used Chinese medicines.
   Traditional Chinese Medicine Systems Pharmacology Database (TCMSP)
   ([70]http://tcmspw.com/tcmsp.php) ([71]Chen et al., 2014), Traditional
   Chinese Medicine Database@Taiwan (TCM@Taiwan)
   ([72]http://tcm.cmu.edu.tw/zh-tw/) ([73]Ru et al., 2014), Traditional
   Chinese Medicines Integrated Database (TCMID)
   ([74]http://119.3.41.228:8000/tcmid/) ([75]Lin et al., 2018) is a
   commonly used database. Oral bioavailability (OB), Caco-2 permeability
   and drug-likeness (DL) were utilized to identify the potential
   bioactive compounds of XHP ([76]Walters and Murcko, 2002; [77]Ano et
   al., 2004; [78]Hu et al., 2009; [79]Xu et al., 2012; [80]Zeng and Yang,
   2017; [81]Yang et al., 2018; [82]Yang et al., 2019). The compounds with
   OB ≥30%, Caco-2 > −0.4 and DL ≥0.18 were regard as oral absorbable
   compounds with biologically active ([83]Walters and Murcko, 2002;
   [84]Ano et al., 2004; [85]Hu et al., 2009; [86]Xu et al., 2012;
   [87]Zeng and Yang, 2017; [88]Yang et al., 2018; [89]Yang et al., 2019).
   Finally, a lot of compounds were collected:
   (13E,17E,21E)-8-hydroxypolypodo-13,17,21-trien-3-one,
   (13E,17E,21E)-polypodo-13,17,21-triene-3,18-diol, (16S,
   20R)-dihydroxydammar-24-en-3-one,
   (20R)-3β-acetoxy-16β-dihydroxydammar-24-ene,
   (20S)-3β,12β,16β,25-pentahydroxydammar-23-ene,
   (20S)-3β-acetoxy-12β,16β,25-tetrahydroxydammar-23-ene,
   (3R,20S)-3,20-dihydroxydammar- 24-ene, (8R)-3-oxo-8-hydroxy-polypoda
   -13E,17E,21-triene, 11α-hydroxypregna-4,17(20)-trans-diene-3,16-dione,
   15α-hydroxymansumbinone, 16-hydroperoxymansumbin-13(17)-en-3β-ol,
   1α-acetoxy-9,19-cyclolanost-24-en-3β-ol,
   28-acetoxy-15α-hydroxymansumbinone, 2-methoxyfuranoguaia-9-ene-8-one,
   35833-62-6, 3-methoxyfuranoguaia-9- en-8-one, 3β- hydroxydammar-24-ene,
   3β-acetoxy-16β,20(R)-dihydroxydammar-24-ene,
   4,17(20)-(cis)-pregnadiene-3,16-dione, 7β,15β-
   dihydroxypregn-4-ene-3,16-dione, beta-Sitosterol, Cabraleadiol
   monoacetate, Cabraleone, Chondrillasterol, Diayangambin,
   Epimansumbinol, Guggulsterol IV, Guggulsterol VI, Guggulsterone,
   Isofouquierone, Mansumbin-13(17)-en- 3,16-dione, Mansumbinoic acid,
   MOL001019, MOL001164, Myrrhanol C, Myrrhanone A, Myrrhanones B,
   Naringenin, Pelargonidin, Petunidin, Phellamurin, Quercetin,
   Stigmasterol, 3-oxo-tirucallic acid, Acetyl-alpha-boswellic acid,
   alpha-Boswellic acid, beta-Boswellic acid, Incensole,
   O-acetyl-α-boswellic acid, Phyllocladene, Tirucallol.

   Since the application of biological models to predict XHP compounds has
   limitations ([90]Metodiewa et al., 1997), in order to avoid missing
   active compounds during the pre-screening process, we searched a large
   number of references and selected oral absorbable compounds with