Abstract Cracks in the skin of jujube fruit reduce freshness and quality; thus, greater understanding of the molecular mechanism that underlies cracking is required to improve fruit production. In this study, we profiled genes that are differentially expressed between cracked and normal jujube fruits through RNA sequencing (RNA‐seq). We selectively confirmed differentially expressed genes (DEGs) using quantitative RT‐PCR. Among 1036 DEGs, 785 genes were up‐regulated and 251 genes were down‐regulated in cracked jujube fruits. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis indicated that some of these DEGs encode proteins involved in metabolic processes (including growth hormone and surface wax production) in cracked jujube fruits. In summary, we have identified differentially expressed metabolic genes between cracked and normal jujube fruits, which may serve as the basis for further studies of fruit quality control. __________________________________________________________________ Abbreviations AOC allene oxide cyclase AOS allene oxide synthase DEG differentially expressed gene ECR trans‐2,3‐enoyl‐CoA reductase GO Gene Ontology HCD 3‐hydroxyacyl‐CoA dehydratase JA jasmonic acid KCR 3‐ketoacyl‐CoA reductase KCS 3‐ketoacyl‐CoA synthase KEGG Kyoto Encyclopedia of Genes and Genomes LOX lipoxygenase OPR3 12‐oxophytodienoate reductase 3 qPCR quantitative PCR qRT‐PCR quantitative RT‐PCR RNA‐seq RNA sequencing VLCFA very long‐chain fatty acid Ziziphus jujuba Mill. is a deciduous tree plant of the Rhamnaceae Ziziphus Mill. Jujube is native to China, with an extensive history of cultivation dating back more than 7000 years. It is important to note that jujube has high nutritional value, consisting of essential amino acids, such as histamine and arginine [[32]1], as well as mineral elements, including potassium (K), phosphorous (P), calcium (Ca) and manganese (Mn) [[33]2, [34]3]. Because jujube is potentially linked to anticancer and antiallergy effects [[35]4, [36]5], it has been officially included as a Chinese herbal medicine in the Pharmacopoeia of the People’s Republic of China (2015 edition) [[37]6, [38]7]. China is currently the world’s largest market for jujube production and consumption [[39]8]. However, fruit cracking is a major problem in the jujube industry. It is striking, for instance, that the annual loss of jujube production due to cracking is usually around 30% and that it has reached more than 90% in some years [[40]9]. Research regarding fruit cracking has been primarily focused on three aspects: the change of tissue structure during the development and cracking of jujube fruit [[41]10, [42]11], the way in which water enters the fruit [[43]12, [44]13] and the genetic characteristics that predispose certain fruit to cracking [[45]14, [46]15, [47]16]. Other than these processes, key molecular events that drive fruit cracking remain poorly studied. Fruit cracking profoundly affects a wide range of fruits, such as Malm pumila Mill., Pmnus salicina Lind., Pmnus persica L., Pyrus spp., Pmnus avium L., Litchi chinensis Sonn. and Vitis vinifera L. As such, understanding the mechanism of fruit cracking would lead to better control of fruit quality overall. With the development of new generation sequencing technology, transcriptome sequencing has become highly used because of its simple technique and rapid turnaround. Transcriptome sequencing can determine altered gene expression in response to different conditions. It can reveal the dynamics of gene networks and their respective functions, as well as the steady‐state level of all expressed transcripts in each particular state [[48]17]. In 2014, Liu et al. [[49]18] completed the entire genome sequencing of winter jujube for the first time and preliminarily revealed the molecular mechanism of drought resistance, fruit branch detachment, and additional fruit properties through comparative genome and transcriptome analysis. The aim of this study is to profile differentially expressed genes (DEGs) in cracked and normal jujube fruits. Materials and methods Test materials and sample processing ‘Huping’ jujube was used for this experiment. Healthy jujube plants obtained from the resource garden of Shanxi Agricultural University consisted of both normal and cracked fruit at their mature stage (Fig. [50]1). Three biological replicates were used, and these were quickly stored in liquid nitrogen before being transported to Beijing Baimaiker technology Co., Ltd. (Beijing, China) for RNA extraction and transcriptome sequencing analysis. Three samples of normal fruit were numbered T01, T02 and T03; three samples of cracked fruit were numbered C01, C02 and C03. All plant tissues were immediately frozen in liquid nitrogen and stored at −80 °C for later research. Fig. 1. Fig. 1 [51]Open in a new tab Samples of normal jujube versus cracked jujube fruits. Representative images of normal (left panel: 30 mm) versus cracked (right panel: 40 mm) jujube fruits. Extraction and library construction of total RNA Total RNA was extracted from the normal and cracked jujube fruit using the RNA extraction kit (Polysaccharides Pure Polyposis‐rich) from Tiangen Biochemical Technology (Beijing) Co., Ltd. Capture beads for mRNA were added to the total RNA samples. After two rounds of binding, mRNA was eluted with Tris–HCl and incubated with the first strand synthesis reaction buffer and random primers. These short sequences were used as templates, consisting of six bases of random hexamers, to synthesize the first cDNA strand. Next, the buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second strand of cDNA. cDNA was purified by AMPure XP beads. End repair reaction buffer and end repair enzyme mix were added to cDNA for end repair. Polyadenylation was performed through addition of poly(A) tails. The sequencing joints were subsequently connected, and USER enzyme was added to open the linker. The reaction products were supplemented with nuclease‐free water, reaching a volume of 50 μL. They were then transferred to a 1.5‐mL centrifuge tube for fragment selection. PCR amplification and product purification were performed, and finally, the cDNA library was enriched by PCR amplification. Transcriptome sequencing and comparison with reference genomes The high‐throughput sequencing of the transcriptome was conducted by Beijing Baimaiker technology Co., Ltd. The cDNA library was sequenced on the Illumina X‐TEN PE150 (San Diego, CA, USA), thereby generating the maximum 300‐bp pair‐end reads. Raw data in fastq format were first processed through in‐house perl scripts to obtain clean data by removing the adapter, ploy‐N and low‐quality sequences (Q < 20). At the same time, Q20, Q30, GC content and the sequence duplication level of the clean data were calculated. All of the downstream analyses were based on clean data with high‐quality clean reads. The clean reads were aligned with hisat2 ([52]http://ccb.jhu.edu/software/hisat2) with default parameters to the Ziziphus jujuba (assembly ZizJuj_1.1) [[53]18] on National Center for Biotechnology Information. Transcripts were assembled and quantified with stringtie ([54]http://ccb.jhu.edu/software/stringtie). Identification of DEGs DEGs were identified and analyzed using the EBSeq platform. FPKM (fragments per kilobase of exon per million reads mapped) was calculated as follows: [MATH: FPKM=cDNAFragmentsMappedFragments(Millions)×TranscriptLength(kb). :MATH] Genes were considered differentially expressed if |log2FoldChange| > 2 and an adjusted P value using Benjamini–Hochberg procedure (false discovery rate) was <0.01 [[55]19]. Gene annotation and Kyoto Encyclopedia of Genes and Genomes functional enrichment analysis To analyze the functional annotation and pathway enrichment of DEGs, we performed differential expression analysis based on the expression levels of genes in different samples, according to the Gene Ontology (GO) database ([56]http://www.geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG; [57]http://www.genome.jp/kegg/). Quantitative RT‐PCR verification of DEGs Quantitative RT‐PCR (qRT‐qPCR) was used on nine DEGs with significantly different expression. The fluorescent quantitative PCR (qPCR) primers (Table [58]1) were designed using primer premier 5.0 (Primier company, Toronto, Canada). The jujube endogenous gene GATA binding protein 6 (Gene ID: 29300) with highly stable expression was used for reference [forward (F): 5′‐TGGCTGGAAGATGGAAGATG‐3′, reverse (R): 5′‐ATGAAGTCTATCCCCAATCGC‐3′]. The TransScript II All‐in‐One First‐Strand cDNA Synthesis SuperMix for qPCR (One‐Step gDNA Removal) reverse transcription kit was used for reverse transcription into cDNA. The components and conditions for the reverse transcription reaction system were as follows: * Components: Total RNA, 1 μg; 5× TransScript II All‐in‐One SuperMix for qPCR, 4 μL; gDNA Remover, 1 μL; RNase‐free water, up to 20 μL. * Reverse transcription conditions: 55 °C for 30 min; 85 °C for 5 s; addition of 80 μL RNase‐free water after the reaction to dilute the cDNA. Table 1. Primers for qRT‐PCR verification of DEGs in jujube fruits. Primer Primer sequence (5′–3′) Ju‐10633‐F TTGGAATTGGAGGTCAGAAGG Ju‐10633‐R CTAAGTGAACCTGCTCCCATC Ju‐18952‐F ATTACTCTATCAAGGCGGTCAG Ju‐18952‐R AAATCCACTTCCCGTCGTAC Ju‐19193‐F ACAGAAACTTCAAGGCCAGTG Ju‐19193‐R CTGCACCCATCTGAGTCTATTC Ju‐2163‐F GCATCACAAAACCCACAATCC Ju‐2163‐R AACCCATTACACAGCTCACC Ju‐22913‐F TTCACCAATACCAGCACCAG Ju‐22913‐R CAAATCCCAAGCTCAACAGTG Ju‐244‐F AGGCAAGGGAAACAGAGAAC Ju‐244‐R TCATTGGCTGGTTCTTTGGG Ju‐246‐F TCTTCCACCTCCTCCACCAG Ju‐246‐R TTAGGACATGCTGCATTCTG Ju‐30106‐F AAGTGTTCCCAGTACGATGC Ju‐30106‐R TCTAAAAGCCCAGCACGAC Ju‐67‐F TTCCATTCCCAAAGAGCCAG Ju‐67‐R GAGGACCAAACACAAGCATTG [59]Open in a new tab Two samples of normal fruit and cracked fruit were detected by real‐time fluorescence qPCR, and the detection of each gene in each sample was repeated three times. The qPCR system consisted of forward primer (10 μm), 0.4 μL; reverse primer (10 μm), 0.4 μL; 2× TransStart Top Green qPCR SuperMix, 10 μL; template (diluted cDNA), 2 μL; and ddH[2]O to a final volume of 20 μL. The PCR conditions were as follows: 94 °C for 2 min, 94 °C for 5 s, 45 cycles of 60 °C for 15 s and 72 °C for 10 s. For the dissociation stage, the [MATH: 2ΔΔCT :MATH] method was used to determine the relative expression of the sample to be tested. Results are expressed as the mean ± standard deviation. The experimental data were analyzed with the Student’s t‐test using spss (V18.0) statistical software (IBM SPSS, Amonk, NY, USA). Results Transcriptomic analysis of jujube fruits To identify molecular events possibly associated with fruit cracking, we performed comparative transcriptome analysis on cracked and normal jujube fruits (Fig. [60]1). cDNA libraries were generated and subsequently sequenced using the Illumina X‐TEN platform. After quality control, 51.81 Gb of clean data was obtained, yielding approximately 26 269 299–34 063 751 clean reads. In the jujube transcriptome, GC content made up 45.52% (Table [61]2). A fold change of 2 (false discovery rate < 0.01) was the cutoff for the detection of DEGs. Our analysis collectively identified 1036 DEGs, including 785 up‐regulated and 251 down‐regulated genes, that were differentially expressed between cracked jujube fruits and normal jujube fruits (Fig. [62]2A). Table 2. Summary of transcript sequencing in jujube fruits. Sample Total reads Mapped reads Clean reads Clean bases GC content ≥Q30 HJU‐1 68 127 502 61 129 374 (89.73%) 34 063 751 10 152 619 972 45.54% 94.31% HJU‐2 48 760 590 43 728 773 (89.68%) 24 380 295 7 265 822 642 45.75% 94.86% HJU‐3 56 606 168 50 524 460 (89.26%) 28 303 084 8 450 170 744 45.32% 93.91% CJU‐1 52 538 598 46 863 458 (89.20%) 26 269 299 7 843 398 644 45.58% 94.54% CJU‐2 59 440 920 53 399 582 (89.84%) 29 720 460 8 875 766 446 45.34% 94.89% CJU‐3 61 755 972 55 589 982 (90.02%) 30 877 986 9 224 361 284 45.56% 94.75% Mean 57 871 625 51 872 605 (89.62%) 28 935 813 8 635 356 622 45.52% 94.54% [63]Open in a new tab Fig. 2. Fig. 2 [64]Open in a new tab Identification of DEGs by RNA‐seq. (A) The volcano plot demonstrates that genes are differentially expressed in cracked jujube fruits compared with normal jujube fruits. Differential expression analysis was performed using DESeq2 from three biological replicates (|Fold change| > 2, adjusted P < 0.01). (B) qRT‐PCR analysis showed that selected DEGs were significantly differentially expressed in cracked jujube fruits compared with normal jujube fruits (n = 3 independent biological repeats) (mean ± standard error of the mean; Student’s t‐test). To validate the RNA‐seq results, we used qRT‐PCR to assess DEGs. Eight up‐regulated genes and one down‐regulated gene found in cracked fruits were randomly selected. These DEGs were mainly involved in the biosynthesis of pectin methylesterase, swollenin and Xyloglucan endotransglucosylases (XET). The expression levels of these DEGs were significantly different between cracked and normal fruits, which was consistent with the results of transcriptome analysis (Fig. [65]2B). GO annotation was performed to explore the possible functions of DEGs. As shown in Fig. [66]3, DEGs were significantly assigned to the metabolic process, cellular process and single‐organism process in the biological process category. In the cell component category, DEGs were significantly enriched in cell and cell parts, followed by organelles and membranes. In the molecular function category, DEGs were mainly assigned to catalytic activity and binding. Two to three times as many genes that were up‐regulated than those that were down‐regulated were associated with most categories, including metabolic process, cellular process, single‐organism process, response to stimulus, biological regulation, cell and cell parts, and nucleic acid binding transcription factor activity (Fig. [67]3 and Table [68]S1). Fig. 3. Fig. 3 [69]Open in a new tab Functional annotation of DEGs based on GO categories. Classification analysis of KEGG metabolic pathways To further examine genes possibly involved in fruit cracking, we carried out significant enrichment analysis of the KEGG pathway, which allows systematic analysis of the metabolic pathways of gene products in cells. Among them, there were 13 metabolic pathways exhibiting significant differences between cracked and normal jujube (P < 0.05) (Table [70]3 and Fig. [71]4). Notably, the biosynthetic metabolic pathways annotated as plant–pathogen interactions had the most DEGs. Moreover, amino acid and nucleotide sugar metabolism were annotated by 14 biosynthetic pathways. Twelve DEGs were enriched in the metabolism of α‐linolenic acid associated with the biosynthesis of jasmonic acid (JA), seven DEGs in fructose and mannose metabolism, and five DEGs in plant endogenous hormone abscisic acid–related carotenoid biosynthesis pathways (Fig. [72]5A). The allene oxide cyclase (AOC) gene K10525 (EC: [73]5.3.99.6), allene oxide synthase (AOS) gene ko1723 (EC: [74]4.2.1.92) and 12‐oxophytodienoate reductase 3 (OPR3) gene ko5894 (EC: [75]1.3.1.42) were up‐regulated, whereas lipoxygenase 2 (LOX 2) genes (ko0454, EC: [76]1.13.11.12) were down‐regulated in cracked jujube fruits compared with normal jujube fruits. Furthermore, four DEGs were enriched in the synthetic pathway of cutin, a subepidermal and wax biosynthesis related to the biosynthesis of pericarp cells (Fig. [77]5B), among which 3‐ketoacyl‐CoA synthase (KCS; EC: [78]2.3.1.199) (ko00062; ko01100; ko01110) was dramatically elevated in the cracked fruits. Table 3. Summary of KEGG pathway analysis for DEGs of jujube fruits. Metabolic pathway Count P Pathway ID Plant–pathogen interaction 28 5.62E−8 ko04626 α‐Linolenic acid metabolism 12 6.20E−7 ko00592 Photosynthesis–antenna proteins 4 0.000925659 ko00196 Amino sugar and nucleotide sugar metabolism 14 0.003612874 ko00520 Porphyrin and chlorophyll metabolism 6 0.009728098 ko00860 Riboflavin metabolism 3 0.010254331 ko00740 Fructose and mannose metabolism 7 0.01283576 ko00051 Vitamin B[6] metabolism 3 0.021920369 ko00750 Carotenoid biosynthesis 5 0.024435524 ko00906 Arginine and proline metabolism 6 0.029460626 ko00330 Synthesis and degradation of ketone bodies 2 0.031697946 ko00072 Cutin, suberin and wax biosynthesis 4 0.043515195 ko00073 Thiamine metabolism 2 0.048580236 ko00730 Cysteine and methionine metabolism 8 0.051757432 ko00270 Fatty acid biosynthesis 5 0.069002897 ko00061 Anthocyanin biosynthesis 1 0.071196465 ko00942 Taurine and hypotaurine metabolism 2 0.100795311 ko00430 Glycolysis/Gluconeogenesis 8 0.123256277 ko00010 Phenylalanine, tyrosine and tryptophan biosynthesis 4 0.124521724 ko00400 Linoleic acid metabolism 2 0.124629945 ko00591 [79]Open in a new tab Fig. 4. Fig. 4 [80]Open in a new tab Functional annotation of DEGs in the KEGG database. KEGG pathway analysis identified significantly altered metabolic processes between cracked and normal jujube fruits. Fig. 5. Fig. 5 [81]Open in a new tab Transcriptomics links fruit cracking to differentially expressed metabolic gene expression. This diagram illustrates the transcriptional changes of genes mediating the JA pathway (A) and surface wax synthesis pathway (B). Genes and their relative transcriptional changes in cracked and normal jujube fruits are shown (cutoff: P < 0.05). For genes up‐regulated in cracked fruits, the top 20 metabolic pathways were enriched (Table [82]4). The pathways with the highest number of up‐regulated genes were those involved in plant–pathogen interactions, amino acid and nucleotide sugar metabolism, and alpha‐linolenic acid metabolism (Fig. [83]4). Additional top‐ranked pathways included metabolism of riboflavin, arginine and proline, cysteine and methionine, vitamin B[6] and thiamine; biosynthesis of keratin, subepithelium and wax, as well as phenylalanine, tyrosine and tryptophan; and synthesis and degradation of ketone bodies (Fig. [84]4). Table 4. Up‐regulation of DEGs enrichment of the KEGG pathway of jujube fruits. Metabolic pathway Count P Pathway ID Plant–pathogen interaction 27 3.92E−10 ko04626 α‐Linolenic acid metabolism 11 2.74E−7 ko00592 Amino sugar and nucleotide sugar metabolism 12 0.002440878 ko00520 Riboflavin metabolism 3 0.004676306 ko00740 Arginine and proline metabolism 6 0.008247456 ko00330 Vitamin B[6] metabolism 3 0.01026376 ko00750 Cutin, suberin and wax biosynthesis 4 0.017563046 ko00073 Synthesis and degradation of ketone bodies 2 0.018641963 ko00072 Anthocyanin biosynthesis 1 0.053915095 ko00942 Taurine and hypotaurine metabolism 2 0.061726118 ko00430 Fatty acid biosynthesis 4 0.084489265 ko00061 Cysteine and methionine metabolism 6 0.088048329 ko00270 Sphingolipid metabolism 2 0.16748863 ko00600 Butanoate metabolism 2 0.16748863 ko00650 Inositol phosphate metabolism 4 0.174474525 ko00562 Phenylalanine, tyrosine and tryptophan biosynthesis 3 0.175687401 ko00400 Phosphatidylinositol signaling system 4 0.179913142 ko04070 Ether lipid metabolism 2 0.187225032 ko00565 Phagosome 4 0.190958543 ko04145 Fatty acid metabolism 4 0.213664657 ko01212 [85]Open in a new tab For genes down‐regulated in cracked fruits, the top 20 metabolic pathways were enriched (Table [86]5). The pathways with the highest numbers of down‐regulated genes included antenna proteins involved in photosynthesis, porphyrin and chlorophyll metabolism, fructose and mannose metabolism, thiamine metabolism, carotenoid biosynthesis and metabolism of ubiquinone and other terpenoids. Quinone biosynthesis, photosynthesis and the amount of gene expression of the pentose phosphate pathway were restrained, and the expression level was decreased. Table 5. Down‐regulation of DEGs enrichment of the KEGG pathway of jujube fruits. Metabolic pathway Count P Pathway ID Photosynthesis–antenna proteins 4 0.00000376E−6 ko00196 Porphyrin and chlorophyll metabolism 4 0.001025742 ko00860 Fructose and mannose metabolism 4 0.00332498 ko00051 Thiamine metabolism 2 0.003352723 ko00730 Carotenoid biosynthesis 3 0.007737558 ko00906 Ubiquinone and other terpenoid‐quinone biosyntheses 3 0.008707174 ko00130 Photosynthesis 3 0.012030176 ko00195 Pentose phosphate pathway 3 0.015991172 ko00030 Propanoate metabolism 2 0.053556638 ko00640 Tryptophan metabolism 2 0.055856523 ko00380 Pentose and glucuronate interconversions 3 0.082345406 ko00040 β‐Alanine metabolism 2 0.102441332 ko00410 Glycolysis/Gluconeogenesis 3 0.122404494 ko00010 Galactose metabolism 2 0.131669638 ko00052 Valine, leucine and isoleucine degradation 2 0.137730867 ko00280 Linoleic acid metabolism 1 0.141535622 ko00591 Other glycan degradation 1 0.186645751 ko00511 Cyanoamino acid metabolism 2 0.240690341 ko00460 Starch and sucrose metabolism 4 0.246451331 ko00500 Sesquiterpenoid and triterpenoid biosynthesis 1 0.249991082 ko00909 [87]Open in a new tab Discussion In the market, consumers prefer juicy, crispy, and large jujube fruits. Not only is the overall quality reduced by cracks over the fruit, but consumer satisfaction is reduced as well. As noted, Liu et al. [[88]18] have previously annotated the genome and gene families of jujube [[89]21, [90]22]. However, little is known about the change in gene expression that contributes to fruit cracking. Using RNA‐seq and bioinformatic analysis, we collectively identified 785 up‐regulated genes and 251 down‐regulated genes that were differentially expressed in cracked jujube fruits compared with normal jujube fruits. To our knowledge, we provide the first transcriptome dataset and comparative gene expression analysis of cracked and normal jujube fruits. The results of the GO term and KEGG pathway enrichment analysis demonstrated that several genes related to metabolic and hormone signaling pathways exhibit differential expression between normal and cracked jujube fruits. Previous results indicated that phytohormones, especially JA, play essential roles in fruit cracking in plants. Our data indicate that genes related to α‐linolenic acid metabolism are significantly enriched in cracked fruits. As noted, α‐linolenic acid is the original metabolic precursor of JA. JA, a new type of growth hormone, and its precursors and derivatives, referred to as jasmonates (JAs), play important roles in the regulation of many physiological processes and synthesis of metabolites in plant growth and development, and especially the mediation of plant responses to biotic and abiotic stresses [[91]23, [92]24]. In the biogenesis of JA, OPR3 is formed via AOS and subsequently AOC. The intermediate produced is further catalyzed by OPR3 to form (+)‐7‐iso –JA. Methyl jasmonate is formed when hydrogen (‐H) on the carboxyl group of JA is replaced by methyl (‐CH3) [[93]25]. We observed that the AOC gene K10525 (EC: [94]5.3.99.6), AOS gene ko1723 (EC: [95]4.2.1.92) and OPR3 gene ko5894 (EC: [96]1.3.1.42) are elevated, whereas LOX 2 gene (ko0454, EC: [97]1.13.11.12) is down‐regulated in a time‐course manner with fruit cracking development. The dynamic changes of these genes in this study suggest that phytohormone regulation may be related to fruit cracking. However, further metabolic analysis of hormone production is required to confirm a potential link between JA synthesis and fruit cracking. KEGG analysis also revealed that the cutin, suberin and wax biosynthesis pathways were significantly enriched (P = 0.017563046; ko00073) for genes up‐regulated in cracked fruits. It is important to note that surface waxes play protective roles against pathogen infection, herbivorous insects and environmental stresses, such as drought, UV damage and frost. Plant very long‐chain fatty acids (VLCFAs) are known to be involved in the process of biofilm membrane lipid synthesis and serve as precursors for the biosynthesis of stratum corneum waxes. The synthesis of VLCFAs is catalyzed by fatty acyl‐CoA elongase, which is a multienzyme system composed of KCS, 3‐ketoacyl‐CoA reductase, 3‐hydroxyacyl‐CoA dehydratase (HCD) and trans‐2,3‐enoyl‐CoA reductase. The synthesized VLCFAs enter the stratum corneum waxy synthesis pathway by decarbonylation and acyl reduction to form various waxy components. KCS is a rate‐limiting enzyme in the endoplasmic reticulum that catalyzes the first step of the condensation reaction in the synthesis of VLCFAs. It has been studied in the fruit‐setting stage of sweet cherry fruit [[98]26] that PaKCS 6 exhibits higher expression in rip‐prone compared with rip‐resistant varieties. In this study, we support this idea by providing evidence that the gene encoding KCS (EC: [99]2.3.1.199) (ko00062; ko01100; ko01110) is dramatically changed in cracked fruits (Fig. [100]5B), which might lead to altered synthesis of cuticle wax and consequently jujube cracking. Our findings from transcriptome analysis are in congruence with a previous study regarding the outer skin and pulp tissue of tomatoes by Mintz‐Oron Mintz‐Oron et al. [[101]27]. Conclusions Our study provides an atlas of DEGs between cracked and normal jujube fruits. Our data may serve as a valuable resource for investigation into the mechanisms by which jujube fruits undergo cracking. Conflict of interest The authors declare no conflict of interest. Author contributions YL and PW conceived and designed the experiments. YL, YG and XX performed the experiments. YL and PZ analyzed the data. PZ and PW contributed reagents, materials and analysis tools. YL, YG and XX wrote the manuscript. All authors read and approved the final manuscript. Supporting information Table S1. Up‐regulated and down‐regulated DEGs in the GO terms. [102]Click here for additional data file.^ (16.6KB, docx) Acknowledgements