Abstract

Simple Summary

   The study of chicken embryonic stem cells (ESCs) and primordial germ
   cells (PGCs) showed the potential application of developmental biology
   and translational medicine. However, the difference between amphoteric
   ESCs and PGCs is still elusive, limiting the accuracy of correlative
   research. In this paper, chicken amphoteric ESCs and PGCs were
   isolated, separated, and sequenced to explore their dynamic
   transcriptomes. Our results provide a knowledge base of transcriptomes
   in chicken amphoteric ESCs and PGCs, which will help other researchers
   interested in studying relative biological processes.

Abstract

   Chicken (Gallus gallus) pluripotent embryonic stem cells (ESCs) and
   primordial germ cells (PGCs) can be broadly applied in the research of
   developmental and embryonic biology, but the difference between
   amphoteric ESCs and PGCs is still elusive. This study determined the
   sex of collected samples by identifying specific sex markers via
   polymerase chain reaction (PCR) and fluorescence activated cell sorter
   (FACS). RNA-seq was utilized to investigate the transcriptomic profile
   of amphoteric ESCs and PGCs in chicken. The results showed no
   significant differentially expressed genes (DEGs) in amphoteric ESCs
   and 227 DEGs exhibited in amphoteric PGCs. Moreover, those 227 DEGs
   were mainly enriched in 17 gene ontology (GO) terms and 27 pathways
   according to Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis.
   Furthermore, qRT-PCR was performed to verify RNA-seq results, and the
   results demonstrated that Notch1 was highly expressed in male PGCs. In
   summary, our results provided a knowledge base of chicken amphoteric
   ESCs and PGCs, which is helpful for future research in relevant
   biological processes.

   Keywords: differentially expressed genes, transcriptome analysis,
   amphoteric ESCs, amphoteric PGCs, chicken (Gallus gallus)

1. Introduction

   Chicken (Gallus gallus) is a classical model in developmental and
   embryonic biology [[38]1]. For decades, chickens have played a vital
   role in animal research as alternatives and outbred experimental
   species to humans to compensate for ethical constraints
   [[39]2,[40]3,[41]4]. It works especially well when isolating and
   gaining a considerable number of pluripotent embryonic stem cells
   (ESCs) and primordial germ cells (PGCs) is much easier and convenient
   in chickens than other species due to the in ovo embryonic development
   [[42]5,[43]6]. This unique advantage accelerates the application of
   chicken ESCs and PGCs in studying the mechanism of human germ cell
   development and differentiation [[44]7,[45]8]. Many groups have
   recently focused on the practical application of chicken ESCs and PGCs
   in human medicine-related research, including germ cell tumor and drug
   target screening [[46]9,[47]10].

   In chickens, ESCs have been derived from cultures of chicken
   blastoderms taken from stage X-XII and PGCs can be obtained from the
   genital ridge (the precursor of gonad) at stage 28–30 embryos
   [[48]6,[49]11]. ESCs (blastoderms) represent the earliest accessible
   post-laying developmental stage prior to primitive streak formation and
   gastrulation; PGCs (genital ridge) represent the time when gonads are
   still morphologically identical in each sex (“bipotential”)
   [[50]12,[51]13]. These ESCs are positive for telomerase activity,
   alkaline phosphatase, and the antigen SSEA-1 or pluripotent genes
   (SOX2, OCT4 and NANOG), while PGCs exhibit the ability of migration and
   positiveness for the antigen SSEA-1 or germ cell gene (CKIT and CVH)
   [[52]14,[53]15]. Moreover, PGCs are the precursor of germline cells
   that differentiate into male or female gametes that give rise to
   progeny [[54]6,[55]16]. Although many studies focus on chicken ESCs and
   PGCs and the collection method has been established, no research has
   been reported to reveal the difference between amphoteric ESCs and
   PGCs.

   As a powerful way to describe dynamic changes in gene expression,
   transcriptome analysis provides crucial clues to help understand the
   process of embryogenesis and embryonic development, and it has been
   used for studying chicken germ cells and embryogenesis [[56]17].
   Studies on male and female differences in chickens have traditionally
   focused on tissue levels (blastoderm or gonad) instead of comprehensive
   transcriptome dynamics in amphoteric ESCs and PGCs
   [[57]18,[58]19,[59]20].

   Therefore, in this study, RNA-seq was performed to investigate the
   profile of chicken amphoteric ESCs and PGCs through characterizing
   differentially expressed genes (DEGs), significant gene ontology (GO)
   terms, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways
   enriched in amphoteric ESCs and PGCs. This work will provide a better
   understanding of the expression pattern of chicken amphoteric ESCs and
   PGCs, which will aid in further studies of relative biological
   processes.

2. Materials and Methods

2.1. Materials and Ethics

   The chicken eggs were collected from the Rugao Yellow Chicken (Poultry
   Institute, Chinese Academy of Agricultural Sciences, Yangzhou, China).
   All eggs were incubated under the environment of 37 °C and 75% relative
   humidity for 4.5 days. The animal experiments were approved by the
   Institutional Animal Care and Use Committee of the Yangzhou University
   Animal Experiments Ethics Committee (Permit Number: SYXK [Su] IACUC
   2012-0029).

   All experimental procedures were performed in accordance with the
   Regulations for the Administration of Affairs Concerning Experimental
   Animals approved by the State Council of the People’s Republic of
   China.

2.2. Determination of Sex of Chicken Embryos by PCR

   Cell or tissue samples were collected and used as PCR templates. CHD1
   gene on the sex chromosome (Z/W) was amplified by PCR using Mighty Amp
   DNA Polymerase. The gel electrophoresis was performed to validate the
   PCR amplified products. The band of PCR products amplified was at 580
   bp, and the bands in females (ZW) were at 580 and 423 bp.

   The primer sequences were as follows:
     * CHD-Forward: CTGCGAGAACGTGGCAACAGAGT;
     * CHD-Reward: ATTGAAATGATCCAGTGCTTG.

2.3. Cells Isolation and Culture

   Isolation and culturing of amphoteric ESCs and PGCs were described in a
   previous report [[60]21]. The medium contained 43.5 mL Knockout-DMEM
   (Gibco, New York, NY, USA, 10829018), 100 μL gentamicin (Solarbio,
   Beijing, China, G8170), 0.2 μL β-mercaptoethanol (Sigma, MI, USA,
   M3148), 200 μL non-essential amino acids (Sigma, MI, USA, M7145), 1 mL
   chicken serum (Gibco, New York, NY, USA, 16110-082), 100 μL SCF (Sigma,
   MI, USA, 300-07-10), 100 μL bFGF (Sigma, MI, USA, F0291), 50 μL LIF
   (Millipore, MA, USA, ESG1106), and 500 μL penicillin (Solarbio,
   Beijing, China, P1400-100). The induction medium was Dulbecco’s
   Modified Eagle Medium (DMEM) supplemented with10 mM RA (Solarbio,
   Beijing, China, IR0060) and 15% Fetal Bovine Serum (FBS) (Gibco, New
   York, NY, USA, 26140).

2.4. Fluorescence Activated Cell Sorter (FACS)

   Cells harvested from amphoteric ESCs and PGCs were blocked with
   blocking buffer (Phosphate Buffered Saline containing 10% fetal bovine
   serum) (Gibco, New York, NY, USA, 10270-106) for 2 h at 37 °C. Samples
   were incubated with antibodies against cell surface epitopes (SSEA-1,
   abcam, Cambridge, UK, ab16285,1:100; SOX2, abcam, Cambridge, UK,
   ab93689,1:100; CKIT, Thermo Fisher Scientific, Shanghai, China,
   14-1172-81,1:100) at 4 °C overnight and washed with PBS containing 0.1%
   Tween-20 (Solarbio, Beijing, China, T8220) three times, followed by
   fluorescence coupled secondary antibody (Goat Anti-Rabbit IgG FITC
   Conjugated, CWBIO, Shanghai, China, CW0114S, 1:100; Goat Anti-Mouse IgG
   H & L (TRICT), abcam, Cambridge, UK, ab6786, 1:100) incubation at 37 °C
   for 2 h. Then, the cells were washed with PBS containing 0.1% Tween-20
   three times. The staining signal was analyzed by fluorescence activated
   cell sorter (FACS) LSRFortessa (BD Biosciences, San Jose, CA, USA) with
   a minimum of 10,000 events in each experiment, and sorted cells were
   collected for further experiments.

2.5. RNA Extraction and Sequencing

   RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA)
   according to the manufacturer’s instructions. To effectively remove the
   genomic DNA, we added RNase-free DNase I (Takara, Dalian, China) to the
   reaction mixture for at least 10 min. The extracted RNA was quantified
   with the Nanodrop system (Thermo, Wilmington, DE, USA), and the
   fragment size distribution was checked by 1.5% agarose gel
   electrophoresis. RNA concentration was assessed using a Thermo
   NanoDrop2000TM spectrophotometer (Thermo Fisher Scientific, Wilmington,
   DE, USA), and the RNA integrity number (RIN) was determined using an
   Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA)
   ([61]Table 1). The extracted RNA was stored for reverse-transcription
   and sequencing. The RNA Libraries pools of four kinds of cells were
   established following the protocol of Illumina mRNA-seq with 50 ng RNA,
   and the experiments were performed by the Shanghai OE Biotech Co., Ltd.
   (Shanghai, China).

Table 1.

   The purity and competencies of RNA.
   Cell Type Gender Sample Number Concentration
   (μg/μL) Purity Volume
   (μL) Total
   (μg) 28S/18S ^5 Completeness
   (RIN ^6)
   A260/280 ^3 A260/230 ^4
   ESCs ^1 Male rep1 0.7313 1.85 1.43 25 18.28 2.2 9.3
   rep2 0.8399 1.92 1.47 35 29.40 1.5 9
   Female rep1 0.9090 1.99 1.59 25 22.73 1.7 9.8
   rep2 0.6299 1.91 1.55 35 22.05 1.7 8.8
   PGCs ^2 Male rep1 1.1936 1.90 1.72 25 29.84 1.62 10
   rep2 0.8278 1.90 1.7 35 28.97 1.5 10
   Female rep1 1.2127 1.91 1.78 25 30.32 1.8 10
   rep2 0.9808 1.99 1.93 35 34.33 1.9 10
   [62]Open in a new tab

   ^1 embryonic stem cells; ^2 primordial germ cells; ^3 the ratio of
   absorbance at 260 and 280 nm; ^4 the ratio of absorbance at 260 and 230
   nm; ^5 the ratio of 28S/18S ribosomal RNA; ^6 RNA integrity number.

2.6. Differential Expression Analysis and Functional Enrichment

   Filtering and quality control checks of raw reads from RNA-seq were
   done by FastQC [[63]22]. The clean reads were mapped to reference
   sequences using SOAP2 [[64]23]. The gene expression levels were
   quantified by calculating the RPKM (Reads Per kb transcriptome per
   Million reads) values. The gene expression pattern and PCA analyses
   were performed on R [[65]24]. The expression of genes with a fold
   change > 2 and FDR < 0.001 were filtered as differentially expressed
   genes (DEGs). The functional analysis of DEGs was carried out by GO
   analysis and KEGG pathway enrichment analysis using DAVID [[66]25].

2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

   Tissues and cells were homogenized in TRIzol Reagent, and total RNA was
   isolated according to the manufacturer’s instruction (QIAGEN, Beijing,
   China, DP424). qRT-PCR was performed using the FastKing One-Step RT-PCR
   Kit with SYBR green (QIAGEN, Beijing, China, KR123). mRNA levels of
   related genes were determined by CFX-Connect Real-Time PCR detection
   system (BIO-RAD, California, USA, 7500fast). Results were represented
   as quantification normalized to relative housekeeping genes (β-Actin)
   using the 2-ΔΔCt method. The sequences of qRT-PCR primers are listed in
   [67]Table 2.

Table 2.

   The primers for qRT-PCR.
   Gene Name Primer Sequence (5′-3′)
     AQP1    F  AAATGTTCTGGAGGGCGGTG
             R  AAGCCAGCGAAACCTTCACG
      LOX    F  ACTTGTTAGACGCCAGCTCG
             R CGCGTATCGTCTGTAATACCCG
     NPAS2   F  AGGGGAAGTCGTGCTGCTAT
             R  TGCACACGATGAACTCTGGC
     OPCML   F  CCCTCATGTGCTTGGCCTTT
             R  TGTGATGCCCGTGATCTCCA
     PAQR8   F  CTTCCAGAAGCACAACGAGGT
             R  CAAAGGCAGAGACCACGCAT
   LOC768388 F  TAAAGGCGTGGCTACTGGGA
             R  TCCGTGTCCTGGCTTGTCTT
   LOC417233 F  TATCCCGGCATCACAGGTGT
             R  GCAATACACACAGGCTGCCA
   LOC417465 F  AACCGTGTGCTGCTTCAACT
             R  TGAACACAACTGCTGCCTGT
   LOC424525 F  TGGGAGGTGACAGAGGCAAA
             R  CAACACCCGCAGCTGTACAT
   LOC418146 F  AACAACGAGACGGGGCAAAG
             R  GGATCATGGCTTGCAGTGCT
   LOC770648 F  TCTGAAAACTCCAGCACGCC
             R  GCAACCGCCTCCACAACTAT
   LOC777315 F   CGCTGTTGCTGCGTGCCA
             R   CGCTTTCTGCGGGGACAGA
   LOC418840 F  AGTTCGACTCTGCAGCTCCA
             R  AGGGTGGCATGCAGTACAGA
     DLX5    F  GTGAGGATGGTGAACGGCAA
             R  AGGGCGAGGTATTGGGTCTT
     AREG    F  TGGTGAACGCTGTGGTGAAC
             R CCTGACCTGCACTATCACAATGA
    SEMA3B   F  CGCACTTTGATGAGCTCCGT
             R  GGCCATGGTGTAAACGCAGA
     GJB1    F  GTGCTCAACATGGCCGAGTT
             R  CAGCAGCTGGTTGATCTCGT
    β-actin  F  CAGCCATCTTTCTTGGGTAT
             R  CTGTGATCTCCTTCTGCATCC
   [68]Open in a new tab

3. Results

3.1. Amphoteric ESCs and PGCs Confirmation

   For sample preparation for transcriptome analyses, the blastoderms and
   gonads were collected from incubated chicken eggs at day 0 and day 4.5
   ([69]Figure 1a). The sex of collected tissues was identified by PCR as
   described previously. PCR products with two bands (600 and 450 bp) were
   observed in tissues collected from females (ZW) and only one band (600
   bp) in males (ZZ). In total, ESCs were isolated from 9699 eggs,
   including 4845 females and 4854 males; PGCs were obtained from 3150
   eggs, including 1594 males and 1556 females. Samples of same-sex eggs
   from each stage were collected for isolation and culturing. The result
   showed that no morphological differences between the cultured
   amphoteric ESCs and PGCs. To further confirm the cell type, different
   cell surface markers (SSEA-1& SOX2 for ESCs; SSEA-1 &CKIT for PGCs)
   were used to isolate different types of cells by the FACS. FACS results
   showed the efficiency is 0.78+/−0.04% (ESCs female), 0.94+/−0.03% (ESCs
   male), 0.92+/−0.02% (PGCs female), and 0.93 + 0.01% (PGCs male),
   respectively ([70]Figure 1b).

Figure 1.

   [71]Figure 1
   [72]Open in a new tab

   Experimental design and confirmation of amphoteric ESCs and PGCs in
   chicken. (a) Tissue collection of the amphoteric blastoderm (for ESCs)
   and gonads (for PGCs); (b) experimental design of RNA-seq analysis
   (left) and amphoteric ESCs and PGCs confirmation by PCR (right-top),
   morphology (right medium, the red arrow points to typical ESCs clones,
   and the black arrow points to emblematic PGCs mass), and fluorescence
   activated cell sorter (FACS) (right bottom).

3.2. Transcriptome Characterization of Amphoteric ESCs and PGCs in Chickens

   Eight sequencing libraries were constructed for the Illumina platform
   with two biological repeats to obtain the genome-wide gene expression
   profile of amphoteric ESCs and PGCs. In total, 36,221 transcripts could
   be detected in combined transcriptomes, and gene expression was
   quantified by calculating RPKM values. A heatmap illustrating the
   hierarchical clustering of RPKM values was generated to visualize the
   overall gene expression pattern ([73]Figure 2a). The PCA analysis was
   utilized to explore gene expression patterns among amphoteric ESCs and
   PGCs, revealing different patterns between ESCs and PGCs. Moreover, it
   showed that amphoteric ESCs clustered together closely, while
   amphoteric PGCs were relatively dispersed, indicating amphoteric ESCs
   exhibit similar patterns, but PGCs exhibit different patterns
   ([74]Figure 2b). Differential analysis of transcriptome data
   demonstrated no DEGs in amphoteric ESCs, while 227 DEGs were found in
   amphoteric PGCs ([75]Figure 2c and [76]Figure S1). Among 227 DEGs, 52
   DEGs were highly expressed in female PGCs and 172 in male PGCs
   ([77]Table S1). Furthermore, no known or putative regulator of gonadal
   sexual determination and differentiation was identified among 227 DEGs,
   which implied that major components of sex determination and
   differentiation pathways are activated after this stage, but the
   amphoteric PGCs initiated the differentiated expression.

Figure 2.

   [78]Figure 2
   [79]Open in a new tab

   Transcriptome characterization of amphoteric ESCs and PGCs in chicken.
   (a) Heatmap showing differentially expressed genes (DEGs) in amphoteric
   ESCs and PGCs. Blue represents weakly expressed genes, and red
   represents highly expressed genes; (b) principal component analysis for
   eight samples. The first two principal components are displayed on the
   graph; (c) volcano plot where the x-axis represents the level of
   differential expression and the y-axis shows significant differences in
   expression as negative log values. The horizontal line is the threshold
   of corrected FDR < 0.001(−log10(FDR) > 3). In ovaries, downregulated
   genes are indicated by green dots, upregulated genes in ovaries are
   indicated by red dots, and other genes are indicated by blue dots.

3.3. Enrichment Analysis of DEGs in Amphoteric PGCs in Chickens

   The gene ontology database [[80]26] was used to perform functional
   annotation on DEGs transcripts’ three components, including biological
   processes (BP), molecular function (MF), and cellular component (CC).
   The clusterProfiler R package was used to analyze GO enrichment of DEGs
   transcripts. GO terms (corrected p-value < 0.05) were considered
   significantly enriched. The 17 significantly enriched GO terms were
   annotated as biological processes (9; 52.9%), cellular component (3;
   17.64%), and molecular function (5; 29.41%), as shown in [81]Figure 3a
   and [82]Table S2. Interestingly, almost all GO terms in biological
   processes (8/9) were sub-terms of the developmental process, which
   indicated the developmental-difference process is active in amphoteric
   PGCs ([83]Figure 3b). Moreover, we concluded that Notch1 is a key gene
   in developmental process terms according to all genes’ interaction
   prediction analysis ([84]Figure 3c). Pathway significant enrichment
   analysis was performed to identify host genes involved in major
   biochemical metabolic pathways and signal transduction pathways in KEGG
   database [[85]27]. The clusterProfiler R package was used to analyze
   the statistical enrichment of genes differentially expressed in KEGG
   pathways. Specifically, 24 KEGG terms were significantly enriched in
   chicken amphoteric PGCs ([86]Figure 3d and [87]Table S3). In addition,
   the Notch pathway was also significantly enriched in amphoteric PGCs,
   which is consistent with the interaction prediction analysis results.

Figure 3.

   [88]Figure 3
   [89]Open in a new tab

   Enrichment analysis of DEGs in amphoteric PGCs in chicken. (a)
   Significant GO terms in amphoteric PGCs; (b) the directed acyclic graph
   (DAG) of biological processes (BP) GO term in amphoteric PGCs; (c)
   prediction of protein–protein interaction (PPI) relationship of DEGs in
   amphoteric PGCs; (d) the KEGG enrichment analysis of the DEGs in
   amphoteric PGCs. The red arrow points to the Notch signal.

3.4. Validation of Transcriptome Data by Real-Time qRT-PCR and Notch1
Specific Expression in Male PGCs

   A total of 17 genes were selected to validate the result obtained from
   RNA-Seq data ([90]Figure 4a). Consistent qPCR results indicated the
   reliability of RNA-Seq data and quantified gene expression accuracy in
   amphoteric PGCs.

Figure 4.

   [91]Figure 4
   [92]Open in a new tab

   Validation of transcriptome data by real-time qRT-PCR and Notch1
   specific expression in male PGCs. (a) Expression comparisons of
   selected genes detected by RNA-Seq and qRT-PCR between amphoteric ESCs
   and PGCs. The y-axis shows log2 (fold differences) determined by
   RNA-Seq and qRT-PCR. The experiments were repeated three times and
   provided consistent results. The mean values and error bars were
   obtained from three biological and three technical replicates; (b) the
   expression of Notch1 in amphoteric PGCs: the RPKM values of RNA-seq
   result (left), the expression level of RNA (RT-qPCR, medium) and
   protein (Western blot, right) results of amphoteric PGCs. All
   experiments were repeated three times and provided consistent results.
   The mean values and error bars were obtained from three biological and
   three technical replicates. The red number in Western Blot presents
   normalized intensity. **: means differ significantly (p ≤ 0.05)

   High expression of Notch1 was found in male PGCs at both mRNA and
   protein levels, which demonstrated the Notch1 is a differential
   expression factor in amphoteric PGCs ([93]Figure 4b).

4. Discussion

   In this study, we conducted the transcriptomic gene expression analysis
   of amphoteric ESCs and PGCs in chickens. No genes were differentially
   expressed in amphoteric ESCs; however, differentially expressed genes
   were identified in amphoteric PGCs and also found to be highly enriched
   in significant GO terms and KEGG pathways. Moreover, we confirmed that
   Notch1 is highly expressed in male PGCs.

   Genetic sex determination in mammals and birds occurs at fertilization
   with the differential inheritance of sex chromosomes. However, sex
   determination and differentiation are complicated processes that occur
   during embryonic development [[94]28,[95]29]. As omnipotent or
   pluripotent cells, ESCs, especially chicken ESCs, have been reported to
   resemble mice ESCs, which retain the stage of naive and primed
   [[96]30,[97]31,[98]32]. Regarding mice, expression patterns in males
   and females vary in germ cells, which indicated that sexual dimorphisms
   occur in mouse ESCs [[99]33]. However, our finding showed that chicken
   amphoteric ESCs share a great number of genes and have similar
   expression patterns, which indicates the homogeneity and highly
   undifferentiated stages of chicken amphoteric ESCs. Although the sex of
   both chickens and mice is controlled by sex chromosomes (W/Z or X/Y
   system), the sex determination in chickens is still elusive because of
   the absence of X chromosome inactivation [[100]34,[101]35,[102]36]. We
   propose that might exhibit a potential specific mechanism cause the
   different expression patterns in amphoteric ESCs between chickens and
   mice.

   Genital ridges are precursor organs of gonads (ovary and testis)
   containing PGCs and somatic cells [[103]37,[104]38,[105]39]. In gonads,
   the transition of germ cells from PGCs to sperm cells or eggs is not
   determined by the genotype but by the somatic cell type of gonads
   [[106]40,[107]41]. The RNA-seq data revealed sexually dimorphic gene
   expression in gonad (genital ridge) tissues (day 4.5) before gonadal
   differentiation (day 6), including some sexual differentiation genes
   such as FOXL2 [[108]19]. In this paper, the amphoteric PGCs initiate
   dimorphic gene expression, but these DEGs not including known or
   putative sex genes. Compared with gonad tissues at day 4.5, amphoteric
   PGCs represent lower heterogeneity, suggesting the uninitiated germ
   cell sex determination. A recent study has demonstrated that the
   amphoteric chicken PGCs could be induced by spermatogonial stem cells
   (SSCs) or oocytes via co-culture with sertoli cells or granulosa
   [[109]42,[110]43,[111]44], which showed that PGC sex differentiation
   could be activated by somatic cells; this may explain different
   expression patterns of amphoteric gonad tissues with PGCs.

   Furthermore, according to our gene ontology analysis, many DEGs are
   involved in the developmental process and KEGG pathways showed much
   cell-to-cell interaction and restructuring of the gonad into the
   morphologically distinct cytokine–cytokine receptor interaction,
   Toll-like receptor signaling pathway, focal adhesion, and ECM-receptor
   interaction. Chicken gonadal sexually dimorphic gene expression has
   been reported to be involved in ECM and cytoskeleton formation and
   regulation to facilitate testis or ovary formation [[112]20].
   Therefore, we conclude that amphoteric PGCs could interact with gonad
   somatic cells to drive the amphoteric morphological change in E4.5.
   Moreover, we identified the notch signal key factor, Notch1, is highly
   expressed in male PGCs and plays a critical role in the interaction
   network of DGEs. It is well known that Notch1 and notch signal are
   essential in cell–cell communication and further regulate embryonic
   development. In mice, Notch1 was reported to induce Sox9 expression
   during the early stages of embryo differentiation, and Sox9 is a
   crucial regulator through the process of masculinity [[113]45].
   Similarly, constitutive activation of Notch1 signaling in sertoli cells
   causes the exit of gonocytes from quiescence, indicating Notch1
   promotes masculinity during sex differentiation [[114]46]. In chickens,
   our previous study showed that the Notch1 and notch signal plays a
   crucial role in chicken PGC formation and production of spermatogonium
   [[115]47]. Thus, our future studies will be focusing on investigating
   the effect of amphoteric PGCs and gonad somatic cells during sex
   differentiation and the functional role of Notch1 in amphoteric PGCs.

5. Conclusions

   Chicken amphoteric ESCs and PGCs were isolated, separated, and
   sequenced to explore their dynamic transcriptomes. According to our
   results, amphoteric ESCs share many genes and exhibit similar
   expression patterns, implying that chicken amphoteric ESCs are
   homogenous and still in highly undifferentiated stages. In contrast,
   chicken amphoteric PGCs are heterogeneous and exhibit differentially
   expressed genes enriched in GO terms and the KEGG pathway involved in
   developmental processes. High expression of Notch1 in male PGCs might
   play a key role in amphoteric PGC differentiation. Overall, our results
   provide a knowledge base of transcriptomes in chicken amphoteric ESCs
   and PGCs, which would help other researchers interested in relevant
   biological processes.

Acknowledgments