Abstract

   Pear is one of the most important economic fruits worldwide. The
   productivity is often negatively affected by drought disaster, but the
   effects and adaptive mechanism of pear in response to drought stress
   has not been well understood at the gene transcription levels. Using
   Illumina HiSeq 2500, the transcriptome from ’Yulu Xiang’ Pear leaves
   were sequenced and analyzed to evaluate the effects of long-term
   drought stress on the expression of genes in different biosynthetic
   pathways. Results showed that long-term drought stress weakened
   antioxidant systematization and impaired the synthesis of
   photosynthetic pigment in ’Yulu Xiang’ Pear leaves. The reduced light
   utilization and photosynthetic productivity finally resulted in the
   inhibited fruit development. The transcriptome survey and expression
   analysis identified 2,207 differentially expressed genes (DEGs) which
   were summarized into the 30 main functional categories. DEGs analysis
   showed that the enzyme genes involved in phenylpropanoid biosynthesis
   under drought stress were up-regulated, and the promoted process of
   phenylpropanoid synthesis may be beneficial to reduce the transpiration
   rate and increase water use efficiency of ’Yulu Xiang’ Pear leaves.
   Up-regulated malate dehydrogenase expression were also observed in
   drought stress groups, and the activated soluble sugar biosynthesis
   could be helpful to promote osmotic regulation and increase antioxidant
   capacity to enhance drought resistance of leaves. The mRNA expression
   of enzyme genes associated with hormones including ethylene, abscisic
   acid, and gibberellin were higher in drought stress groups than that in
   control, indicating a promoted cell proliferation under drought stress.
   Long-term drought stress significantly decreased photosynthetic
   productivity, and negatively affected development of ’Yulu Xiang’ Pear.
   Transcriptome survey and expression analysis reveals that the inhibited
   photosynthesis could be closely related with drought-induced
   lignification and hormones synthesis, and the present dataset can
   provide more valuable information to analyze the function of drought
   stress-related genes improving plant drought tolerance.

Introduction

   Pear is one of the most widely grown fruit species worldwide, but the
   unpredictable reduction from adverse weather (such as drought disaster)
   is an urgent problem [[34]1, [35]2]. The drought disaster is a
   uncertainty and dangerous climatic hazard threatening fruits production
   in many areas of the world [[36]3–[37]5]. Plants is inseparable from
   water, and lack of water can significantly inhabit the normal
   physiological function, such as photosynthesis. Studies found that
   water deficiency was second only to the shortage of illumination
   causing the reduced photosynthetic rate [[38]6, [39]7]. Water
   deficiency may promote transpiration by increasing temperature of plant
   leaves, and the contradiction between supply of water and demand of
   plant body may result in the reduced photosynthetic rate. Maes et al.
   [[40]8] reported that the water potential, relative water content, leaf
   area, stomatal conductance of fruit seedlings leaves under drought
   stress was reduced, which finally caused the decline of leaf
   photosynthetic rate. Down-regulated stomatal conductance induced by
   drought stress inhibited the entry of carbon dioxide from the external
   environment into leaves, and increased resistance of mesophyll cells,
   and weakened carboxylase activity [[41]9].

   The above effects may result from the plant adaptation to drought
   stress, and it is necessary to clear mechanism of plant tolerance on
   drought stress. Studies found that drought stress related genes
   alterations were induced by plants perceptived and transmited drought
   signal. Many molecular components responsive to drought stress have
   been identified, and these stress-responsive genes were involved in
   intracellular osmotic pressure, transcriptional regulation, protein
   phosphatases, and antioxidant system. These suggest that responses of
   plants on drought stress is a complex process and connection, but the
   highly complex and interconnected network is still not understood.
   Sequencing of the pear genome provides a possibility for gene
   prediction and annotation. ’Yulu Xiang’ Pear, one the most widely fruit
   in China, were chosen in our present study. Drought stress treatment
   groups and normal watering control groups were set up, respectively.
   Transcriptome sequencing and analysis techniques were used to reveal
   the regulation mechanism of drought stress on the growth and
   development of ’Yulu Xiang’ Pear at the transcriptome level. The
   knowledge about the expression patterns of genes in ’Yulu Xiang’ Pear
   under drought stress may be helpful in narrowing down on candidate
   genes, which can be used as a foundation to improve the quality of
   ’Yulu Xiang’ Pear during cultivation in breeding in the future.

Materials and methods

Plant material and growth conditions

   ’Yulu Xiang’ Pear were investigated in pear germplasm resources of
   Institute of Fruit (Shanxi Academy of Agricultural Science) located in
   the southwest of Taigu County, Shanxi Province (latitude 37°23’0”N,
   longitude 112°32’0”E). The garden is a warm temperate continental
   climate with an average annual temperature of 10.6°C and sunshine hours
   of 2300 hours/year, and annual precipitation and evaporation of is
   about 450 and 1800 mm/year, respectively.

Test design

   The 10-year-old healthy ’Yulu Xiang’ Pear trees were used in the
   present research, and the test was carried out during October 21, 2017
   to October 21, 2018. Pear trees of control groups were watered for four
   times in October (2017), March (2018), May (2018) and July (2018),
   respectively. For drought treatment groups, there was no water spray in
   the orchard. The soil moisture content was detected by the method of
   weighting and replenishing water after 12 months of plant growth, and
   the soil relative water content of pear trees cultivation in control
   groups and drought stress groups were 80% and 30%, respectively.

Detection of photosynthetic characteristics, chlorophyll content, soluble
solids, antioxidant indicators, malondialdehyde (MDA) and osmoregulation
substance in ’Yuluxiang’ Pear leaves

   After long-term drought treatment, photosynthetic indexes including net
   photosynthetic rate (Pn), stomatal conductance (Gs), intercellular
   CO[2]concentration (Ci) and transpiration rate (Tr) were measured by
   LI-6400 Portable Photosyntometer ((Licor, USA)). Chlorophyll was
   extracted using 95% ethanol, and the contents of chlorophyll a,
   chlorophyll b and carotenoids in the extract were determined according
   to the method of Li et al. [[42]10]. The soluble solids was measured by
   the PAL-1 digital display sugar meter. The content of malondialdehyde
   (MDA) was determined by thiobarbituric acid method (TBA), the activity
   of superoxide dismutase (SOD) was determined by nitrogen blue tetrazole
   reduction method, the activity of peroxidase (POD) was determined by
   guaiacol method, and the activity of catalase (CAT) was determined by
   ultraviolet absorption method. The content of soluble protein was
   determined by Coomassie brilliant blue method, and the content of
   proline was determined by acid ninhydrin method. There were six
   replicates for each treatment and the above experiments were repeated
   three times.

Total RNA extraction, cDNA library construction, and deep sequencing

   Total RNA in six replicates leaf samples from different pear trees for
   each treatment were isolated following the protocols of Trizol
   (Invitrogen, Carlsbad, CA, USA). RNA content was detected by ND2000
   (NanoDrop 2000, Thermo., USA), and RNA samples that had 260/280 ratios
   above 2.0 were used for subsequent experiments. The sequencing library
   was constructed by Personal Biotechnology Co., Ltd. (Shanghai, China)
   via an Illumina MiSeq instrument., and the transcriptome double
   terminal sequencing was performed by using Illumina hiseq 2500
   sequencing platform (Illumina, CA, USA). Clean reads was obtained after
   that the low-quality reads were discarded by using the Seq-Prep program
   ([43]https://github.com/jstjohn/SeqPrep), and the clean reads were
   further de novo assembled by Trinity software [[44]11].

Differentially expressed genes (DEGs) and functional annotation

   The RPKM method (reads per KB per million reads) was used to calculate
   the expression level of genes. The differential expressed genes (DEGs)
   were defined as the genes with false discovery rate (FDR) P<0.05 and
   multiple difference ≥ 2. Gene function was annotated by using BlastX
   with an E value less than 10^−5 against NCBI non-redundant (Nr)
   databases ([45]http://www.ncbi.nlm.nih.gov), Swiss Prot
   ([46]http://www.uniprot.org), the Protein family (Pfam) database
   ([47]http://pfam.sanger.ac.uk), Cluster of Orthologous Groups databases
   (COG) ([48]http://www.ncbi.nlm.nih.gov/COG), Gene Ontology (GO)
   ([49]http://www.geneontology.org), and the Kyoto Encyclopedia of Genes
   and Genomes pathway database (KEGG)
   ([50]http://www.genome.jp/kegg/pathway). GO and KEGG pathway enrichment
   analysis were carried out to further understand the biological
   functions of DEGs by using the Blast2GO and KOBAS2.0 programs,
   respectively [[51]12, [52]13].

qRT-PCR analysis

   RNA were isolated from leaves with Trizol, and reverse transcription
   was performed with MMLV reverse transcriptase (TaKaRa, Dalian, China).
   qRT-PCR primers were designed with Primer Premier 6 ([53]Table 1), and
   their specificity was verified by PCR. Expression of mRNA was
   determined by quantitative real-time PCR (qRT-PCR) using TIB8600
   real-time PCR system (Triplex International Biosciences Co., LTD) and
   AceQ® qPCR SYBR® Green Master Mix (Vazyme) according to the
   manufacturers’s instructions. The qRT-PCR reaction mixture consisted of
   10 μL of 2×SYBR real-time PCR premixture, 0.4 μl each forward and
   reverse primers (10 μM), 1 μL cDNA template and RNase free dH[2]O to
   adjust to 20 μL. A reaction mixture of 20 μL was loaded into TIB8600
   real-time PCR system and subjected to the following cycling: 5 min at
   95°C to denature DNA and activate Taq polymerase; 40 cycles of 15 s at
   95°C and 30 s at 60°C. The Tubulin gene ([54]AB239681) was amplified in
   parallel as an internal reference gene. Using the 2^-ΔΔCt method
   [[55]14], relative quantification of each gene mRNA expression was
   calculated by concurrent amplification of the Tubulin endogenous
   control. Three technical replicates were used for each sample and the
   data are shown as means ± standard deviation (S.D.).

Table 1. Specific primer pairs for genes from ’Yulu Xiang’ Pear used in
quantitative real-time polymerase chain reaction analysis.

   Pathways Genes name Specific primers (5’to3’)
   Phenylpropanoid biosynthesis Peroxidase ATTTCAACGGCACTGGCAAC[56]^a
   CTGATCGGTCTGGAGAAGCC[57]^b
   Caffeic acid 3-O-methyltransferase AACTCACATCGGCACCAAGA[58]^a
   GTGCAATCGAGGACGGAGTT[59]^b
   Shikimate O-hydroxycinnamoyltransferase GCGTGGTTGCTAAACTGAGG[60]^a
   CAAACCCACAACGGCTTTCC[61]^b
   Cinnamyl-alcohol dehydrogenase CTTGGTGGTCTCGGACACTT[62]^a
   TTAGCCAGGGCCGTCATTTC[63]^b
   Ferulate-5-hydroxylase GACACTACGACTCCACCCAC[64]^a
   CTTTTGGGAATGCGGTAGCC[65]^b
   Cysteine and methionine metabolism Methionine-gamma-lyase
   GCCTGCAACATAACGACGAC[66]^a
   GTATGTTGGCGACGGTGAGA[67]^b
   Cysteine synthase GGATCTTCCTGCCACCCAAA[68]^a
   CTAGCCGTGGGTTGGAACAT[69]^b
   Glycometabolism Malate dehydrogenase AAACAACCAGCTCGCATCCT[70]^a
   AGCATGATTCCCCTTGCGAT[71]^b
   Monoterpenoid biosynthesis (3S)-linalool synthase
   AAGCGCGATGGTTTAGTTGC[72]^a
   GCACGCCTGAACTGATGAAC[73]^b
   Sesquiterpenoid and triterpenoid biosynthesis Lupeol synthase 2
   GGTACGGGAATTGGGGTGTT[74]^a
   CCCCAACCACCGTTCTCATT[75]^b
   Ethylene synthesis 1-aminocyclopropane-1-carboxylate synthase
   AGTTATGAGTGGCGGAGGAG[76]^a
   TGTCCCCTCACCGTAACATC[77]^b
   Aminocyclopropanecarboxylate oxidase GCGACCTTCCCAGTTGTTGA[78]^a
   AACCCCAGTTCTCACAAGCA[79]^b
   Gibberellins biosynthesis Gibberellin 2beta-dioxygenase
   AAGTGTGAGGCACAGGGTTT[80]^a
   GCTTTCCTCCTCTCCGTTCA[81]^b
   Abscisic acid biosynthesis 9-cis-epoxycarotenoid dioxygenase
   CCAGACTCAATCCAAGGCGT[82]^a
   GTAGCTGGCGGTTCCATCTT[83]^b
   Reference gene Tubulin AGAACAAGAACTCGTCCTAC[84]^a
   GAACTGCTCGCTCACTCTCC[85]^b
   [86]Open in a new tab

   ^a Forward primer.

   ^bReverse primer.

Statistical analysis

   Data statistical analysis was carried out with SPSS 17.0 (SPSS,
   Chicago, IL, USA), and the one-way analysis of variance (ANOVA) and
   Student-Newman-Kreuls test at p < 0.05 were used for the statistical
   analysis between the control and drought stress groups.

Results

Effects of drought stress on multiple indicators of ’Yulu Xiang’ Pear

   Fruit quality analysis showed that the contents of fruit soluble solids
   in drought treatment groups ([87]Fig 1A) were lower than that in
   control groups, and similar result about fruit weight ([88]Fig 1B)
   could be observed, indicating that the long-term drought stress
   negatively affected the nutrients accumulation and fruit development.
   The nutrients accumulation in fruit greatly depends on the
   transportation from photosynthesis products, and it was quite possible
   that the reduced fruit soluble solids may be resulted from the impaired
   photosynthesis in leaves induced by drought stress. The detection of
   photosynthetic characteristics showed that the Ci and Gs levels in
   leaves of drought treatment groups significantly decreased ([89]Fig 1C
   and 1D). It indicated that drought stress weakened the capacities of
   carbon fixation and CO[2] exchange between plants and atmospheric
   environment, which partly resulted in the lower Pn and negatively
   affected the photosynthetic process in leaves ([90]Fig 1E). The
   down-regulation of soluble protein ([91]Fig 1G) and proline ([92]Fig
   1H) in leaves of drought treatment groups were also found, which
   further confirmed the inhibited photosynthetic process under drought
   stress. In plant stress tolerance system, soluble protein and proline
   are very important osmoregulation substance, and are closely related to
   the function of regulating osmotic pressure and protecting cell
   membrane structure. The reduction of soluble protein and proline
   suggested that plant regulation on osmotic pressure was incontrollable
   under drought stress, and the weakened tolerance negatively affected
   the capacity to absorb and/or retain water of ’Yulu Xiang’ Pear which
   would result in the impairments of cell membrane structure.
   Fortunately, the stress protection in plants was still working. The
   down-regulated Gs blocked the process of water exchange, resulting in
   the reduced Tr levels in leaves under drought stress to reduce the the
   water loss rate ([93]Fig 1F). Moreover, the photosynthetic process is
   closely related to the levels and composition of photosynthetic
   pigments. Compared to that in control groups, the levels of chlorophyll
   a, chlorophyll b, and carotenoid in leaves of drought stress groups
   were lower ([94]Fig 1I, 1G, 1K and 1M), indicating that light
   utilization and photosynthetic productivity in leaves were seriously
   weakened by drought stress. However, the higher rates of chlorophyll
   a/b drought stress groups ([95]Fig 1L) were observed, and the relative
   more content of chlorophyll a could enhance light utilization
   efficiency to improve photosynthesis under drought stress. The
   impairments of dought stress on photosynthetic pigments were mainly
   caused by the increased oxidative stress which was confirmed by the
   increased malondialdehyde ([96]Fig 1N). The activities of SOD, POD, and
   CAT in leaves of drought stress treatment groups was down-regulated
   ([97]Fig 1O–1Q), indicating that the weakened antioxidant
   systematization resulted in the enhanced oxidative stress under drought
   stress. These results showed that drought stress significantly reduced
   photosynthetic productivity, and seriously damaged physiological
   metabolism in leaves of ’Yulu Xiang’ Pear.

Fig 1. Effects of long-term drought stress on fruit quality, photosynthetic
indexes, antioxidant system, and osmotic adjustment system in leaves of ’Yulu
Xiang’ Pear.

   [98]Fig 1
   [99]Open in a new tab

   Drought stress significantly decreased the content of fruit soluble
   solids (A), and reduced fruit weight (B) of ’Yulu Xiang’ Pear.
   Photosynthetic characteristics including Ci (C), Gs (D), Pn (E), and Tr
   (F) in leaves of ’Yulu Xiang’ Pear. Drought stress reduced the content
   of soluble protein (G) and proline (H) content. Levels of chlorophyll a
   (I), chlorophyll b (J), Chlorophyll a+b (K), Chlorophyll a/b (L), and
   carotenoids (M) in leaves of ’Yulu Xiang’ Pear. Drought stress
   increased MDA (N) levels, but decreased the activities of SOD (O), POD
   (P), and CAT (Q). All data are expressed as mean ± standard deviation
   (n = 3), and statistical significance is denoted by * between different
   groups (P < 0.05).

Read mapping

   Transcriptomic raw data is available on Sequence Read Archive (SRA)
   database, and the SRA accession is PRJNA655255. According to the
   assembled pear genome of ’Dangshansuli’ [[100]15], reads of RNA-Seq
   data were mapped in this study. In total, two RNA-Seq libraries were
   sequenced from ’Yulu Xiang’ Pear leaves of control and drought
   treatment groups, and there were 204,157,258 and 209,344,612 clean
   reads including 30,827,745,958 and 31,611,036,412 nucleotides in
   control and drought treatment groups, respectively ([101]Table 2). The
   low-quality reads with connectors in above sequencing data would cause
   great interference to the subsequent information analysis, and it was
   necessary to further filter the sequencing data. Finally, 189,653,068
   and 194,811,350 reads were obtained after splice and redundancy check.

Table 2. Summary of read numbers based on the RNA-Seq data from ’Yulu Xiang’
Pear leaves.

       Summary        Control     Drought stress
      Reads No.     204,157,258    209,344,612
     Bases (bp)    30,827,745,958 31,611,036,412
      Q30 (bp)     28,252,595,080 24,352,878,562
        N (%)        0.0043574      0.0044588
       Q20 (%)         96.316         96.542
       Q30 (%)         91.644         92.066
   Clean Reads No.  189,653,068    194,811,350
   Clean Data (bp) 28,637,613,268 29,416,513,850
    Clean Reads %      92.888         93.050
    Clean Data %       92.888         93.050
   [102]Open in a new tab

   Note: Reads No.: total number of reads; Bases (bp): total number of
   bases; Q30 (bp): the total number of bases whose recognition accuracy
   is more than 99.9%; N (%): percentage of fuzzy bases; Q20 (%): the
   percentage of bases whose recognition accuracy is more than 99%; Q30
   (%): percentage of bases with accuracy over 99.9%; Clean reads No:
   number of high-quality sequence reads; Clean data (bp): base number of
   high quality sequence; Clean reads %: the percentage of high-quality
   sequence reads in sequencing reads; Clean data %: the percentage of
   high-quality sequence bases to sequence bases.

Differentially expressed genes (DEGs) and functional annotation of
transcriptome sequencing based on public databases

   In present study, differences of gene expression between control and
   drought treatment groups were analyzed. 2,207 differentially expressed
   genes (DEGs) with expression fold change of at least 2 fold up or
   down-regulation (FDR < 0.05) were identified from RNA-Seq by DESeq. To
   clear the functions of these DEGs, Gene Ontology (GO) term enrichment
   analysis were performed to classify the functions of DEGs in different
   categories. Based on sequence homology, the assigned GO terms were
   summarized into the three main GO categories, biological process (BP),
   cellular component (CC), and molecular function (MF), and then into 88
   main functional categories including biological process,
   oxidation-reduction process, microtubule-based process, and etc
   ([103]Fig 2). According to GO annotation and functional enrichment
   analysis of DEGs, biological process comprised 45 GO annotations
   (51.14%) and was the largest one, followed by molecular function 25 GO
   annotations (28.41%), and cellular component 18 GO annotations
   (20.45%). Among, 290 and 55 DEGs involved in biological process and
   oxidation-reduction process, indicating that the synthesis of
   metabolites and antioxidant capacity in leaves were significantly
   affected by drought stress.

Fig 2. Summary of deferentially expressed genes in leaves of ’Yulu Xiang’
Pear under drought stress by gene ontology classification.

   [104]Fig 2
   [105]Open in a new tab

   The genes were annotated into three main categories: biological
   process, cellular component and molecular function (X-axis). Y-axis
   (left) represents the number of deferentially expressed genes.

   The metabolic pathway P ≤ 0.05 was defined as the Kyoto Encyclopedia of
   Genes and Genomes (KEGG) pathway with significant enrichment of DEGs
   using a BLAST search against the KEGG database. 58 DEGs involved in
   biosynthesis of secondary metabolites were found ([106]Table 3), which
   was consistent with results through GO term enrichment analysis. 17,
   12, 8, 6, 6, 5, and 4 DEGs were annotated from phenylpropanoid
   biosynthesis pathway, cysteine and methionine metabolism pathway,
   flavonoid biosynthesis pathway, diterpenoid biosynthesis pathway,
   carotenoid biosynthesis pathway, monoterpenoid biosynthesis pathway,
   sesquiterpenoid and triterpenoid biosynthesis pathway and
   brassinosteroid biosynthesis pathway, respectively. To validate the
   reliability of the drought responsive gene expression profiles for
   DEGs, 16 genes encoding Peroxidase, Caffeic acid 3-O-methyltransferase,
   Shikimate O-hydroxycinnamoyltransferase, Cinnamyl-alcohol
   dehydrogenase, Cinnamoyl-CoA reductase, Ferulate-5-hydroxylase,
   aminocyclopropane-1-carboxylate synthase, Aminocyclopropanecarboxylate
   oxidase, Methionine-gamma-lyase, Cysteine synthase, Malate
   dehydrogenase, Gibberellin 2beta-dioxygenase, cis-epoxycarotenoid
   dioxygenase, and (3S)-linalool synthase, Lupeol synthase 2 were
   randomly selected and confirmed by quantitative real-time PCR using
   gene-specific primers. Even there was the difference in the fold change
   between the two methods, results of relative expression patterns from
   the drought stress responsive genes carried out by quantitative
   real-time PCR were consistent with these from DEGs data ([107]Fig 3).
   The high correlation in relative expression patterns between qPCR and
   RNA-Seq suggests that the present DEGs data are reliable, which could
   be an efficient tool for further study to investigate the functions of
   drought stress responsive genes.

Table 3. Summary of deferentially expressed genes in leaves of ’Yulu Xiang’
Pear under drought stress by KEGG classification.

   Pathway ID Pathway DEG number UP regulated DOWN regulated FDR
   ko00940 Phenylpropanoid biosynthesis 17 15 2 0.008
   ko00270 Cysteine and methionine metabolism 12 5 7 0.002
   ko00941 Flavonoid biosynthesis 8 8 0 0.001
   ko00904 Diterpenoid biosynthesis 6 4 2 0.002
   ko00906 Carotenoid biosynthesis 6 6 0 0.006
   ko00902 Monoterpenoid biosynthesis 5 5 0 0.000
   ko00909 Sesquiterpenoid and triterpenoid biosynthesis 4 3 1 0.020
   [108]Open in a new tab

Fig 3. Reliability and consistency verification of DGE by quantitative real
time PCR.

   [109]Fig 3
   [110]Open in a new tab

   The x-axis represents individual genes and the y-axis fold-change in
   expression by RPKM method (gray bars) or qRT-PCR (white bars).

Discussion

   Drought stress, known as water deficit stress, is the most common
   environmental stress with many characteristics including high
   frequency, wide distribution, long duration and great harm. Drought
   stress negatively affects normal physiological function and development
   of plants, and seriously threatens agricultural production. Present
   study found that long-term drought stress decreased the levels of fruit
   soluble solids and fruit weight, and caused seriously impairments on
   the fruit quality of ’Yulu Xiang’ Pear ([111]Fig 1A and 1B). The
   similar results could be found in other plants, such as strawberry,
   cantaloupe, and cotton [[112]16–[113]18], suggesting that the nutrients
   accumulation and fruit development were severely inhibited by drought
   stress. The nutrients accumulation in fruit are closely related with
   photosynthesis in leaves [[114]19]. In present study, the
   down-regulation of Ci and Gs was observed. The lower intercellular
   CO[2]concentration and blocked CO[2] exchange between plants and
   atmospheric environment would reduce carbon fixation, and result in a
   lower Pn levels ([115]Fig 1E), and finally block photosynthetic process
   in leaves [[116]20]. Moreover, we also found that the levels of soluble
   protein and proline in leaves of drought treatment groups was reduced,
   which would negatively affect the stress tolerance system in leaves. In
   plant stress tolerance system, soluble protein and proline are very
   important osmoregulation substance, and play the key role in regulating
   osmotic pressure and protecting cell membrane structure [[117]21]. The
   reduction of soluble protein and proline under long-term drought stress
   could cause that the plant regulation on osmotic pressure was seriously
   impaired, which would negatively affect the capacity to absorb water in
   leaves of ’Yulu Xiang’ Pear and finally induce oxidative
   stress.resulting in the impairment of cell membrane structure.
   Fortunately, plants have gradually formed unique growth habits and
   physiological characteristics in respond to drought stress during the
   long-term evolution process [[118]22]. Under drought stress, the
   down-regulated Gs blocked the process of water exchange between plants
   and atmospheric environment. The reduced Tr and slowed photosynthesis
   process in ’Yulu Xiang’ Pear leaves could effectively reduce water loss
   to adapt to drought conditions.

   The photosynthetic process also depends on the the contents and
   composition of photosynthetic pigments [[119]23]. Our study found that
   the levels of chlorophyll a, chlorophyll b, and carotenoid in drought
   stress groups were lower than that in control groups, and the weakened
   light utilization indicated a reduced photosynthetic productivity in
   leaves. However, a higher rates of chlorophyll a/b were also observed
   in leaves of drought stress groups, and it indicated a relatively more
   chlorophyll a which was helpful to increase light utilization
   efficiency and improve photosynthesis to adapt to the drought stress
   [[120]24]. The impairments of long-term dought stress on photosynthetic
   pigments were closely related to the oxidative stress [[121]25], which
   was confirmed by the increased level of lipid peroxidation in drought
   treatment groups ([122]Fig 1N). Sharma et al. [[123]26] found that the
   oxidative stress induced by mild drought stress could promote the
   antioxidant activities, but the concentration glutathione and the
   activities of total superoxide dismutases (SODs) were inhibited under
   severe drought stress. The results of our study were similar to those
   found, and the activities of SOD, POD, and CAT in leaves under
   long-term drought stress was down-regulated ([124]Fig 1O–1Q),
   indicating that long-term drought stress severely impaired the
   antioxidant systematization and the damage induced by increased
   oxidative stress was uncontrollable.

   Studies on the drought resistance mechanism of plants found variety of
   molecular mechanisms including up-regulating the cell osmotic
   regulation ability by the induced synthesis of aquaporin and small
   molecule soluble organic matter, increasing the stability of
   biomembrane and protein by induced synthesis of LEA protein and
   membrane protein, clearing free radicals by induced antioxidant
   protection enzyme system under moderate drought stress [[125]27,
   [126]28]. However, we found a reduced soluble protein and proline in
   leaves of ’Yulu Xiang’ Pear, and the down-regulated osmotic potential
   indicated a greatly damaged ability of cell to absorb or retain water.
   The severe oxidative stress induced by the lack of water in plants
   could severely impair cell membrane system, and negatively affect the
   photosynthetic pigment synthesis, finally resulting in the reduction of
   light utilization and photosynthetic productivity in leaves. A vicious
   circle involving osmotic pressure and photosynthate was created under
   drought stress ([127]Fig 4).

Fig 4. The model proposing the effects and adaptive mechanism of ’Yulu Xiang’
Pear in response to long-term drought stress.

   [128]Fig 4
   [129]Open in a new tab

   Arrows (→) and truncated lines (—|) indicated promoting and inhibiting
   effects, respectively.

   Drought stress could induce the accumulation of secondary metabolites
   (such as terpenes and flavonoids) in plant roots to enhance osmotic
   regulation and clear free radicals to adapt the drought environment
   [[130]29, [131]30]. Indeed, the analysis of KEGG pathway enrichment of
   DEGs in present study showed that drought stress up-regulated the
   expression of key enzyme genes related to terpenoids, flavonoids,
   methionine, and cysteine biosynthesis pathway ([132]Table 2),
   indicating that drought stress induced these substances synthesis to
   enhance osmotic stress and relieve oxidative stress in ’Yulu Xiang’
   Pear leaves. The osmotic regulation and antioxidant capacity of leaves
   in drought treatment groups were achieved by up-regulated expression of
   malate dehydrogenase, indicating a tolerance to a drought stress by the
   promoted biosynthesis of malate and soluble sugar. Similar results were
   found in wheat investigated by Cui et al. [[133]31]. The soluble sugar
   not only could regulate osmotic stress and relive free radicals, but
   also provide energy for the basic physiological function of leaves
   cells by respiration [[134]32]. We also found that drought stress
   increased the gene expression of limiting enzymes phenylpropanoid
   biosynthesis including peroxidase, caffeic acid 3-O-methyltransferase,
   shikimate O-hydroxycinnamoyltransferase, cinnamyl-alcohol
   dehydrogenase, cinnamoyl-CoA reductase, ferulate-5-hydroxylase. The
   enhanced phenylpropanoid biosynthesis would be helpful to the synthesis
   of lignin, indicating that cell wall synthesis was promoted under
   drought stress to strengthen the water transportation system and
   osmotic pressure in leaves [[135]33].

   Plant hormone is an important factor regulating various physiological
   processes including cell division, elongation, differentiation, and
   plant germination, rooting, flowering, fruiting, sex determination,
   dormancy and abscission [[136]34]. The DEGs analysisin transcriptome of
   ’Yulu Xiang’ Pear leaves showed significant effects of drought stress
   on ethylene, abscisic acid, gibberellin, brassinolide and other plant
   hormone biosynthesis or signal transduction pathways. Among, the mRNA
   expression levels of key enzyme genes related to ethylene biosynthesis
   (1-aminocyclopropane-1-carboxylic acid synthetase, and
   aminocyclopropanecarboxylate oxidase) and abscisic acid biosynthesis
   (9-cis-epoxycarotenoid dioxygenase) were promoted, and these hormones
   could significantly quicken cell division and leaf abscission to reduce
   transpiration rate and improve the water use efficiency of plants
   during drought stress. Arraes et al. [[137]35] also found that the
   expression multiple genes involved in the biosynthesis of phytohormones
   including ethylene and ABA were up-regulated under drought stress, and
   responses to drought stress could be regulated by a crosstalk network
   among phytohormones signaling pathways.

Conclusion

   Present study found that long-term drought stress caused the reduction
   of nutrients accumulation and inhibition of fruit development. The
   impairments of the fruit quality of ’Yulu Xiang’ Pear mainly resulted
   from the inhibited antioxidant systematization and increased oxidative
   stress induced by drought stress. Reduced protective effects against
   oxidative stress inhibited the synthesis of photosynthetic pigment, and
   reduced light utilization and photosynthetic productivity, finally
   negatively affected the osmotic pressure. All of the data presented
   here suggests that a network consisting of multiple secondary
   metabolites and phytohormones signaling pathways is involved in the
   regulation of adaptive mechanism of ’Yulu Xiang’ Pear in response to
   long-term drought stress ([138]Fig 4).

Data Availability

   All relevant data are within the paper.

Funding Statement

   This work was partially supported by the China Agriculture Research
   System (CARS-28-28), The Research Subject of Agricultural Science and
   Technology Innovation of Shanxi Academy of Agricultural Sciences
   (YCX2018D2YS14), Shanxi Province Natural Science Foundation
   (201801D121255), The Project of Scientific and Technological Innovation
   research of Shanxi Academy of Agricultural Sciences (YCX2020SJ10).

References