Abstract

   Acute ruminal acidosis (ARA) occurs after an excessive intake of
   rapidly fermentable carbohydrates and is characterized by the
   overproduction of D-lactate in the rumen that reaches the bloodstream.
   Lameness presentation, one of the primary consequences of ARA in
   cattle, is associated with the occurrence of laminitis and aseptic
   polysynovitis. Fibroblast-like synoviocytes (FLS) are predominant cells
   of synovia and play a key role in the pathophysiology of joint
   diseases, thus increasing the chances of the release of
   pro-inflammatory cytokines. Increased D-lactate levels and disturbances
   in the metabolism of carbohydrates, pyruvates, and amino acids are
   observed in the synovial fluid of heifers with ARA-related
   polysynovitis prior to neutrophil infiltration, suggesting an early
   involvement of metabolic disturbances in joint inflammation. We
   hypothesized that D-lactate induces metabolic reprogramming, along with
   an inflammatory response, in bovine exposed FLS. Gas
   chromatography-mass spectrometry (GC-MS)-based metabolomics revealed
   that D-lactate disrupts the metabolism of bovine FLS, mainly enhancing
   glycolysis and gluconeogenesis, pyruvate metabolism, and galactose
   metabolism. The reverse-transcription quantitative PCR (RT-qPCR)
   analysis revealed an increased expression of metabolic-related genes,
   including hypoxia-inducible factor 1 (HIF-1)α, glucose transporter 1
   (Glut-1), L-lactate dehydrogenase subunit A (L-LDHA), and pyruvate
   dehydrogenase kinase 1 (PDK-1). Along with metabolic disturbances,
   D-lactate also induced an overexpression and the secretion of IL-6.
   Furthermore, the inhibition of HIF-1, PI3K/Akt, and NF-κB reduced the
   expression of IL-6 and metabolic-related genes. The results of this
   study reveal a potential role for D-lactate in bFLS metabolic
   reprogramming and support a close relationship between inflammation and
   metabolism in cattle.

   Keywords: bovine fibroblast-like synoviocyte, D-lactate, metabolic
   reprogramming, inflammation, hypoxia inducible factor 1

Introduction

   Acute ruminal acidosis (ARA) is a well-known metabolic syndrome in
   cattle caused by excessive intake of rapidly fermentable carbohydrates,
   which alters ruminal microbiota composition ([39]1, [40]2). As such,
   the proliferation of lactate-producing bacteria, primarily
   Streptococcus bovis and Lactobacillus spp., leads to excessive
   production of D-lactate and L-lactate and a consequent drop in ruminal
   pH ([41]1, [42]3). During ARA episodes, sufficient L-lactate is
   absorbed into the forestomach and from more distal portions of the
   digestive tract into the bloodstream ([43]4, [44]5). L-Lactate is
   rapidly oxidized to pyruvate by L-lactate dehydrogenase, primarily in
   cardiac tissues and hepatic tissues ([45]3). Nevertheless, D-lactate
   can be metabolized, albeit less efficiently, by a mitochondria-derived
   enzyme, D-2-hydroxy acid dehydrogenase (D-LDH dehydrogenase) ([46]6,
   [47]7), in such a way that it accumulates in the blood system at a
   concentration greater than 5 mM, thereby causing D-lactic acidosis
   ([48]4, [49]5). D-lactic acidosis impairs animal welfare and the
   economic performance of cattle, as it affects feed intake and ruminal
   digestion, causing rumen mucosa damage (ruminitis), liver abscesses,
   diarrhea, inflammation, and lameness ([50]2, [51]3, [52]8). Distension
   of the tarsocrural joints in dairy heifers with ARA has been observed
   ([53]9–[54]12) and is characterized by generalized sterile neutrophilic
   polysynovitis ([55]9). This acute joint reaction is considered to be a
   part of the clinical complex interpreted as acute laminitis, and
   although the clinical consequence is still unclear, it most likely
   contributes to claw pain and lameness ([56]9–[57]11).

   Fibroblast-like synoviocytes (FLS) are the predominant cell types of
   synovial intima and assure the structural and physiological dynamic
   integrity of diarthrodial joints, controlling the composition of
   synovial fluids and the extracellular matrix of the joint lining
   ([58]13). Moreover, FLS play a central role in defining and maintaining
   an inflammatory environment during joint diseases ([59]13, [60]14).
   Furthermore, activated FLS exhibit metabolic disturbances and produce
   mediators that can induce angiogenesis, cell growth, leukocyte
   recruitment, and immune cell activation ([61]14–[62]16).

   High levels of D-lactate and significant changes in the metabolism of
   carbohydrates, pyruvates, and amino acids have been detected in the
   synovial fluid of heifers with polysynovitis associated with ARA prior
   to subsequent neutrophil infiltration, suggesting an extremely early
   involvement of metabolic disturbances in bovine joint inflammation
   ([63]17). Similarly, increased levels of lactate and high rates of
   glucose consumption have been detected in human joints with aseptic
   inflammation, which is primarily attributed to the activation of
   hypoxia-inducible factor 1 (HIF-1) ([64]14, [65]18). Lactate has also
   been identified as a pro-inflammatory agent in FLS and macrophages,
   inducing prostaglandin E[2] (PGE[2]) release into the medium ([66]19).
   Furthermore, lactate induces the secretion of interleukin (IL)-6,
   tumoral necrosis factor-α (TNF-α), and IL-1β in stimulated chondrocytes
   ([67]20) and increased the production of PGE[2] and the activity of
   gluconeogenic in lactate-exposed monocytes ([68]21) through a
   HIF-1-dependent mechanism, suggesting that the lactate-induced
   inflammatory response is dependent on these co-induced metabolic
   adaptations. Additionally, lactate has been identified to be
   responsible for TNF-α-induced IL-6 production in human rheumatoid FLS
   through the activation of nuclear factor kappa B (NF-κB) ([69]22).

   Based on the abovementioned findings, we hypothesized that D-lactate
   might be able to induce metabolic disturbances and inflammatory
   responses in bovine FLS (bFLS). The present study demonstrates that
   D-lactate caused significant metabolic changes, which primarily
   involved the metabolism of carbohydrates and amino acids. In
   association with this metabolic reprogramming, we observed that
   D-lactate induced the mRNA expression of relevant pro-inflammatory
   genes and metabolic genes in a phosphatidylinositol 3-kinase
   (PI3K)/protein kinase B (Akt)-dependent manner, as well as in a
   HIF-1/NF-κB-dependent manner.

Materials and Methods

bFLS Cell Culture

   Bovine FLS (#CDD-B-2910, Articular Engineering, Northbrook, IL, USA)
   were cultured in sterile 25 cm^2 plastic tissue culture flasks (#70025,
   SPL Life Sciences, Pocheon-si, Korea) with Dulbecco's Modified
   Eagle/Ham's F-12 (DMEM/F-12; #12400016, Gibco, Thermo Fischer
   Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum
   (FBS; #S1810, Biowest, Nuaillé, France) at 37°C under an atmosphere
   with 5% CO[2]. Cell linage was confirmed by the presence of Vimentin
   and the absence of CD14, according to Manosalva et al. ([70]23). During
   passages 3–6, bFLS were cultured in DMEM/F-12 supplemented with 10% FBS
   in sterile 21.5 cm^2 plastic tissue culture plates (#20060, SPL Life
   Sciences, Pocheon-si, Korea) for metabolomics and lactate and
   immunoblot analyses, while sterile 6-well plates (#31006, SPL Life
   Sciences, Pocheon-si, Korea) were used for reverse
   transcription-quantitative PCR (RT-qPCR) and ELISA analysis.

Experimental Design

   Inhibitory assays were performed at 37°C and under 5% CO[2] for 30 min
   using the following pharmacological inhibitors: (a) 40 μM YC-1
   (#sc-202856, Santa Cruz Biotechnology, Santa Cruz, CA, USA) to inhibit
   the HIF-1 activity; (b) 10 μM BAY 11-7082 (#10010266, Cayman Chemicals,
   Ann Arbor, MI, USA) to inhibit the NF-κB activity; and (c) 10 μM
   LY294002 (#V1201, Promega, Madison, WI, USA) to inhibit the PI3K/Akt
   signaling pathway. DMSO (0.1%) was used as vehicle control. bFLS were
   stimulated with 5 mM D-lactate (#L0625, Sigma-Aldrich, St. Louis, MO,
   USA) or 100 ng/ml bovine TNF-α (bTNF-α; #RBOTNFAI, Thermo Fisher
   Scientific, Waltham, MA, USA) at 37°C and under 5% CO[2] for 1 h for
   metabolomics and lactate analysis and 6 h for immunoblot analysis and
   RT-qPCR and ELISA experiments. Water was used as vehicle control.
   Furthermore, for immunoblot analysis, hypoxic conditions (1% O[2], 94%
   N[2], 5% CO[2]) were achieved using a hypoxia incubator chamber
   (#27310, Stemcell Technologies, Vancouver, Canada). For HIF-1α
   stabilization control, 300 μM cobalt chloride (CoCl[2]) was added to
   bFLS under normoxic conditions.

Sample Preparation for Gas Chromatography-Mass Spectrometry (GC-MS)
Metabolomics

   Metabolites from bFLS were extracted with 1 ml/sample of extraction
   buffer (37.5% vol/vol HPLC-grade acetonitrile; 37.5% vol/vol HPLC-grade
   isopropanol; 25% vol/vol HPLC-grade water) containing 1 mM ribitol
   (#A5502, Sigma-Aldrich, St. Louis, MO, USA) as an internal standard.
   Samples were vortexed for 2 min and then centrifuged at 14,000 × g at
   4°C for 2 min. Later, 450 μl-supernatant from each sample was dried in
   a SpeedVac concentrator (Savant^® SPD131DDA, Thermo Fisher Scientific,
   Waltham, MA, USA) at 45°C for 90 min under 1.5 atm of pressure. Once
   dried, 450 μl/sample of wash buffer (50% vol/vol HPLC-grade
   acetonitrile; 50% vol/vol HPLC-grade water) was added, which were then
   vortexed and centrifuged at 14,000 × g at 4 °C for 2 min; then, the
   supernatants were evaporated to dryness in a SpeedVac concentrator at
   45°C for 90 min under 1.5 atm of pressure. As retention index markers,
   2 μl of a fatty acid methyl ester (FAME) standard mixture C8-C30
   (#400505, Fiehn GC/MS Metabolomics Standards Kit, Agilent Technologies,
   Santa Clara, CA, USA) was utilized. Additionally, 10 μl methoxyamine
   hydrochloride/pyridine (20 mg/ml; #226904, Sigma-Aldrich, #107463,
   Merck KGaA, Darmstadt, Germany) was added to each of the samples and
   incubated at 30°C for 90 min under shaking conditions. Subsequently, 90
   μl N-methyl-N-(trimethylsilyl)-trifluoroacetamide (MSTFA) with 1%
   trimethylchlorosilane (TMCS) derivatization agent (#TS-48915, Thermo
   Fisher Scientific, Pierce Biotechnology, Rockford, IL) was added, and
   samples were incubated at 37°C for 30 min under shaking conditions.
   Finally, samples were transferred to 250-μl glass vial inserts
   (#5181-8872, Agilent Technologies) in 2-ml glass vials with screw caps
   (#8010-0543, Agilent Technologies) for analysis.

Metabolomics by GC-MS

   Samples were injected in an Agilent 7890B GC system coupled to an
   electron impact ionization mode 5977 A Mass Selective Detector system
   (Agilent Technologies, Palo Alto, CA, USA), using an Agilent 7693
   Series Autosampler (Agilent Technologies, Palo Alto, CA, USA).
   Derivatized samples (2 μl) were injected in the splitless injector mode
   on a 30 m × 0.25 mm × 0.25 μm DB-5 column (Agilent Technologies, Palo
   Alto, CA, USA). Temperature of the injector port was maintained at
   250°C, and the flow rate of helium carrier gas was set up at 1 ml/min
   with an initial oven temperature of 60°C. Then, the oven temperature
   was increased at 10°C/min until it reached 325°C, with a final running
   time of 37.5 min. After a 5.9 min solvent delay, full spectra (50–600
   m/z; 1.7 scans/s) with a digital scan rate of 20 Hz, with MS ion source
   temperature of 250°C and quadrupole temperature of 150°C, was acquired.
   All samples were analyzed within 24 h after derivatization. To
   calculate the Fiehn retention index of metabolites, retention times
   were obtained by injecting a FAME standard mixture C8-C30 (#400505,
   Fiehn GC/MS Metabolomics Standards Kit, Agilent Technologies, Santa
   Clara, CA, USA).

   Before carrying out data analysis, raw MS data (.D files) were
   transformed into the Analysis Base File (.ABF) format using the Reifycs
   ABF Converter (Reifycs Inc., Tokyo, Japan). Metabolite identification
   was performed following the methods described by Fiehn ([71]24).
   Briefly, peak detection, deconvolution, and peak alignment were
   performed using MSDIAL 2.83 (RIKEN Center for Sustainable Resource
   Science: Metabolome Informatics Research Team. Yokohama, Japan) to
   process the total ion chromatogram and the electron ionization-MS
   (EI-MS) spectra of each GC peak. The resulting mass spectrum of the
   trimethylsilyated metabolites was identified, and the deconvoluted
   peaks were matched against mass spectral libraries imported by the
   National Institute of Standards and Technology (NIST) MSP format.
   Library matches were ranked against experimental data based on the
   total retention index and mass spectral similarity across all batch
   samples. The Fiehn retention index based on FAME was used.
   Identification of metabolites was performed by matching the EI-MS
   spectra with those of the reference compounds from the NIST or Fiehn
   libraries. For analysis, the retention index tolerance of 2,000, a EI
   similarity cutoff of 65%, an identification score cutoff of 70%, a mass
   scale tolerance of 0.5 Da, and the retention time tolerance of 0.5 min
   were used.

Quantification of Intracellular D-Lactate and L-Lactate by High-Performance
Liquid Chromatography (HPLC)

   Lactate stereoisomers from bFLS were extracted with 1 ml/sample of
   extraction buffer (37.5% vol/vol HPLC-grade acetonitrile; 37.5% vol/vol
   HPLC-grade isopropanol; 25% vol/vol HPLC-grade water) by vortexing for
   2 min and performing centrifugation at 14,000 × g at 4°C for 2 min.
   Next, 450 μl-supernatant from each sample was dried in a SpeedVac
   concentrator (Savant^® SPD131DDA, Thermo Fisher Scientific, Waltham,
   MA, USA) at 45°C for 90 min under 1.5 atm of pressure. Once dried, the
   samples were resuspended in 250 μl mobile phase (1 mM CuSO[4]) and
   centrifuged at 21,000 × g at 4°C for 10 min. Finally, 200 μl-aliquots
   of the supernatants were used for D- and L-lactate quantification. For
   the calibration curves, 2–400 μM of D- and L-lactate standards were
   used. Twenty-microliter aliquots of samples were analyzed by HPLC using
   an Astec CLC-D cationic exchange column (15 cm × 4.6 mm; Sigma-Aldrich,
   St. Louis, MO, USA) at a flow rate of 1 ml/min at 30°C. The detection
   wavelength was set at 254 nm ([72]25) using LaChrom Elite HPLC Diode
   Array Detector (VWR Hitachi, Radnor, PA, USA).

Western Blot Analysis

   Total proteins were extracted with 2 × Laemmli sample buffer (0.125 M
   Tris-HCl, pH 6.8; 4% SDS; 20% glycerol; 10% β-mercaptoethanol; 0.004%
   bromphenol blue). Total proteins were separated by electrophoresis
   using 7.5% SDS-PAGE gels and transferred electrophoretically into
   nitrocellulose membranes. After blocking with 5% skim milk in TBS-T (20
   mM Tris-HCl, pH 7.5; 137 mM NaCl; 0.1% Tween 20), the membranes were
   incubated overnight with an anti-HIF-1α monoclonal antibody (H1alpha67)
   (#MA1-16504; Invitrogen, Thermo Fischer Scientific) and an anti-β-actin
   [horseradish peroxidase (HRP)] antibody (#sc-47778; Santa Cruz
   Biotechnology) at 4°C. Finally, the membranes were incubated with a
   HRP-conjugated anti-mouse IgG antibody (#115-035-003; Jackson
   Immunoresearch, West Grove, PA, USA). Specific bands were visualized
   using the Odyssey Fc Dual-Mode Imaging System (LI-COR Biosciences,
   Lincoln, NE, USA), and its intensity was quantified using the Image
   Studio Lite v5.2 software (LI-COR Biosciences).

RT-qPCR Analysis of Inflammatory and Metabolic Genes

   Total RNA of bFLS was extracted with an E.Z.N.A. Total RNA Kit I
   (#R6834-01, Omega Bio-Tek, Norcross, GA, USA) following the
   instructions of the manufacturer. To remove genomic DNA, the extracted
   RNA was treated using a Turbo DNase-Free^® kit (#AM1907, Ambion™,
   Thermo Fischer Scientific, Waltham, MA, USA). For cDNA synthesis, 300
   ng of total RNA was reverse transcribed using M-MLV reverse
   transcriptase (#M5313, Promega, Madison, WI, USA) according to the
   protocol of the manufacturer. RT-qPCR assays were performed using
   Takyon™ Rox SYBR^® MasterMix (#UF-RSMT-B0701, Eurogentec, Seraing,
   Belgium), and the primers are indicated in [73]Table 1. RT-qPCR was
   performed in a StepOne Plus Real-Time PCR System (Applied Biosystems™,
   Thermo Fisher Scientific, Waltham, MA, USA) using the following cycling
   conditions: 1 cycle at 95°C for 10 min, followed by 40 cycles at 95°C
   for 30 s, 60°C for 30 s (annealing), and 72°C for 30 s (extension). The
   changes in expression were calculated using the 2^−(ΔΔCt) method,
   according to Livak and Schmittgen ([74]26), using StepOne™ v2.3
   (Applied Biosystems™, Thermo Fisher Scientific). For normalization, the
   40S ribosomal protein S9 (RPS9) as a housekeeping gene and as
   unstimulated cells as a reference sample were used.

Table 1.

   Target genes, forward and reverse primer (5′-3′) sequences, amplicon
   size (pb), regression coefficient (R^2) value, slope, and amplification
   efficiency (%).
   Gene Forward primer, 5′-3′ Reverse primer, 5′-3′ Size (bp) R^2 Slope
   Efficiency (%)
   rps9 GCTGACGCTGGATGAGAAAGACCC ATCCAGCACCCCGATACGGACG 85 0.995 −3.612
   89.164
   il-6 ACTGGCAGAAAATAAGCTGAATCTTC TGATCAAGCAAATCGCCTGAT 89 0.998 −3.523
   92.239
   il-8 ATGACTTCCAAGCTGGCTGTTG TTGATAAATTTGGGGTGGAAAG 149 0.998 −2.920
   120.040
   hif-1α GGAGTTGGACCTCTGCGATT GAGGGGAGAAAAGGCACGTC 102 0.995 −3.267
   102.331
   glut-1 GCGGACCCTACGTCTTCATC GGCCTTTTGTCTCGGGAACT 87 0.999 −3.304
   100.749
   pdk-1 CTCATCGGAAACACGTCGGA TCACACAGACGCCTAGCATT 91 0.996 −3.484 93.643
   l-ldha AGGCCTGAGAAGTCGGAGTG GGAACCTGTCCTACCTGCC 118 0.983 −3.512 92.633
   [75]Open in a new tab

   rps9, 40S ribosomal protein S9; il-6, interleukin 6; il-8: interleukin
   8; hif-1α, hypoxia inducible factor-1 subunit alpha; glut-1, solute
   carrier family 2 (facilitated glucose transporter), member 1; pdk-1,
   pyruvate dehydrogenase kinase 1; l-ldha, L-lactate dehydrogenase
   subunit A; bp, base pairs.

IL-6 and IL-8 Quantification by ELISA

   After D-lactate stimulation for qPCR assay, conditioned media were
   centrifugated at 500 × g for 5 min and thereafter used to estimate the
   concentration of cytokines by using bovine IL-6 (#ESS0029, Thermo
   Fisher Scientific) and IL-8 (#3114-1A-6, Mabtech, Nacka, Sweden) ELISA
   kits, according to instructions of the manufacturer. Briefly, the
   capture antibody was incubated overnight, and wells were then blocked
   for 1 h (4% BSA, 5% sucrose in PBS). Subsequently, 100 μl of the sample
   was added and incubated for 1–2 h. After two washes, the detection
   antibody was incubated for 1 h. Plates were washed twice and
   streptavidin was added and incubated again for another 0.5–1 h.
   Finally, the tetramethylbenzidine (TMB) substrate solution or
   p-nitrophenyl phosphate (pNPP) was added and incubated for 20–30 min in
   the dark. For IL-6 ELISA kit, the reaction was stopped with 0.16 M
   H[2]SO[4]. All procedures were performed at room temperature. Plates
   were analyzed at 450 and 550 nm for the IL-6 ELISA kit and at 405 nm
   for the IL-8 ELISA kit using an automatic Varioskan Flash Reader
   (Thermo Fischer Scientific, Waltham, MA, USA).

Statistical Analyses

   For metabolomic analysis, all multivariate analyses were statistically
   analyzed using MetaboAnalyst v4.0 (Xia Lab, McGill University, Canada;
   [76]http://www.metaboanalyst.ca) according to previously published
   protocols ([77]27). Metabolites which were more than 50% below the
   detection limit or with at least 50% missing values were excluded from
   the analysis. Metabolite concentrations were normalized using ribitol
   as an internal standard, and to obtain a Gaussian distribution,
   logarithmic transformation and auto scaling were performed before the
   statistical analysis ([78]27). The partial least squares-discriminating
   analysis (PLS-DA) and variable importance in projection (VIP) scores
   were determined. The PLS-DA model was estimated by cross-validation and
   permutation tests, as the sum of squares captured by the model (R2) >
   0.9 and p-value = 0.0295 (59/2000), respectively. Heat maps were
   represented by Euclidean distance measure and Ward's clustering
   algorithm. Metabolites exhibiting significantly different levels (p <
   0.05) by the Mann–Whitney test were considered for pathway topology
   analyses. Bos taurus (cow) was used as the model organism. Pathway
   topology analysis was performed using the B. taurus pathway library and
   a hypergeometric test was used for overrepresentation analysis. To
   identify potential metabolomic pathways, the Kyoto Encyclopedia of
   Genes and Genomes (KEGG; [79]http://www.genome.jp/kegg) and the Bovine
   Metabolome Database ([80]http://www.cowmetdb.ca) were used. For other
   experimental settings, data are presented as means ± SEM. For
   comparisons between two treatments, the Mann–Whitney test was applied.
   In addition, for comparisons between three or more groups, after
   variance homoscedasticity evaluation, the one-way ANOVA followed by
   Fisher's least significant difference test, or the Kruskal–Wallis test
   followed by Dunn's test, was applied as the appropriate method. Values
   of p < 0.05 were considered significant. PRISM v8.4.2 (GraphPad, San
   Diego, CA, USA) was used for statistical analyses.

Results

Metabolome Overview of Untreated- and D-Lactate-Treated bFLS

   A total of 1,306 unique m/z values with retention indices were
   integrated after GC-MS analysis of bFLS, including internal standards.
   After deconvolution and alignment, 93 metabolites were identified and
   classified according to chemical classes ([81]Supplementary Figure 1A).
   Metabolites were identified by the Fiehn retention index according to
   the FAME standard and the Fiehn library. The chemical structure of the
   derivative product was also used for metabolite identification.
   Carbohydrates and their metabolites were the primary compounds detected
   in bFLS ([82]Supplementary Figure 1A), with 30 (32.6%) carbohydrates
   identified, including arabinose, fructose, galactitol, gluconic acid,
   glucose, glucose-1-phosphate, glucose-6-phosphate, glycerol, hexose,
   lactose, mannitol, mannose, melibiose, N-acetyl-D-hexosamine, sucrose,
   and UDP-N-acetylglucosamine. Amino acids and their derivatives were the
   second most important metabolites detected in the study
   ([83]Supplementary Figure 1A), with 27 (29.3%) compounds identified,
   including 21 amino acids, such as alanine, aspartate, cysteine,
   glutamate, glycine, leucine, methionine, phenylalanine, proline,
   serine, threonine, tyrosine, and valine. Additionally, six amino acid
   derivatives, including 3-aminoisobutyric acid, ethanolamine,
   oxoproline, and putrescine, were detected. Seventeen (18.5%) lipidic
   compounds were identified, including arachidic acid, arachidonic acid,
   heptadecanoic acid, lauric acid, linoleic acid, myristic acid, oleic
   acid, palmitic acid, pentadecanoic acid, and stearic acid
   ([84]Supplementary Figure 1A). Nine (9.7%) organic acids, including
   citric acid, fumaric acid, lactic acid, pyruvic acid, and succinic
   acid, were detected ([85]Supplementary Figure 1A). One (1.1%)
   nucleoside was identified, corresponding to uracil ([86]Supplementary
   Figure 1A). Other organic compounds, including 2.6-di-tert-butylphenol,
   methylamine, phosphate, and isothreonic acid, were also identified
   ([87]Supplementary Figure 1A). Based on their relative abundances,
   hexose, ethanolamine, and mannitol were the three most predominant
   metabolites detected in bFLS, with other predominant metabolites
   including phosphate, myristic acid, leucine, myo-inositol, oxoproline,
   1.2-anhydro-myo-inositol, and stearic acid ([88]Supplementary Figure
   1B). Detected metabolites with the lowest levels in bFLS were
   2.6-di-tert-butylphenol, norleucine, fructose,
   inositol-4-monophosphate, arabinose, glucose-6-phosphate, tyrosine,
   palmitic acid, methylamine, and linoleic acid ([89]Supplementary Figure
   1C).

D-Lactate Induces Metabolomic Changes in Exposed bFLS

   To evaluate the metabolic changes induced by D-lactate in exposed bFLS,
   we constructed a heatmap considering 50 metabolites with the lowest
   p-values, as determined by ANOVA. A distinctive hierarchical separation
   between control and D-lactate-treated bFLS was detected ([90]Figure
   1A). Furthermore, the PLS-DA showed a noticeable separation associated
   with D-lactate treatment, as axes 1 and 2 accounted for 34.1 and 12.4%
   of the total variation, respectively ([91]Figure 1B). In this analysis,
   nine metabolites (3-aminoisobutyric acid, myristic acid, stearic acid,
   inositol-4-monophosphate, linoleic acid, arachidic acid, lauric acid,
   isothreonic acid, and N-acetyl-D-hexosamine) with the highest VIP
   scores (>1.6) contributed most significantly to the detected separation
   ([92]Supplementary Figure 2). After univariate analysis, we observed 17
   metabolites which were significantly altered by D-lactate treatment
   ([93]Figure 2), with markedly increased levels of glucose (3.7-fold),
   inositol-4-monophosphate (3.7-fold), and pyruvic acid (2.8-fold).
   Gluconic acid, threonine, isothreonic acid, and 3-aminoisobutyric acid
   levels were also markedly increased (>1.7-fold) after stimulation with
   D-lactate. Finally, the treatment moderately (>1.3-fold) increased the
   levels of fumaric acid, galactitol, N-acetyl-D-hexosamine, arachidic
   acid, linoleic acid, myristic acid, and stearic acid, while a slight
   (>1.2-fold) increase in succinic acid, heptadecanoic acid, and lauric
   acid levels was observed ([94]Figure 2). Overall, these results suggest
   that D-lactate induces significant changes in the metabolome of exposed
   bFLS.

Figure 1.

   [95]Figure 1
   [96]Open in a new tab

   Metabolomic profile of bovine fibroblast-like synoviocytes (bFLS) after
   D-lactate treatment. (A) Hierarchical clustering analysis of 50
   metabolites from the control untreated and 5 mM D-lactate-stimulated
   bFLS. The red and blue colors indicate that the metabolite level is
   increased and decreased compared to the mean metabolite relative
   abundance, respectively. Each column represents a sample clustered
   according to treatment, and each row represents an individual
   metabolite. n = 4. (B) The partial least squares-discriminant analysis
   (PLS-DA) score plot based on metabolomic analysis of D-lactate
   stimulated (green) and control (red) bFLS. The explained variances of
   the selected components are shown in brackets. n = 4.

Figure 2.

   [97]Figure 2
   [98]Open in a new tab

   D-Lactate alters the intracellular concentration of several
   metabolites. The concentrations of metabolites significantly altered
   after 1 h stimulation with 5 mM D-lactate are expressed as relative
   abundance with respect to ribitol. Each bar represents the mean ± SEM.
   Each point represents an independent experiment, n = 4. *p < 0.05.

   Additionally, intracellular levels of L-lactate were quantified by HPLC
   in control and 5 mM D-lactate-treated bFLS. L-lactate concentrations
   were significantly higher in bFLS stimulated with D-lactate compared to
   control ([99]Figure 3A). Intracellular D-lactate levels were also
   quantified by HPLC, which were three times greater than those observed
   in the bFLS control group ([100]Figure 3B). These results show that
   intracellular levels of D-lactate increased after stimulation, which
   was also associated with an increase in intracellular production of
   L-lactate and LDHA expression ([101]Figure 3C).

Figure 3.

   Figure 3
   [102]Open in a new tab

   D-Lactate treatment increases the intracellular levels of both lactate
   stereoisomers as well as the L-lactate dehydrogenase subunit A (L-LDHA)
   expression. bFLS were treated with 5 mM D-lactate for 1 h. (A)
   L-lactate and (B) D-lactate were quantified at the intracellular level
   by high-performance liquid chromatography (HPLC). Each bar represents
   the mean ± SEM. Each point represents an independent experiment, n = 5.
   (C) The relative mRNA expression of L-LDHA was assessed by RT-qPCR.
   Bovine tumore necrosis factor-α (TNF-α) was used as the positive
   control. Each bar represents the mean ± SEM, n = 5. *p < 0.05; **p <
   0.01.

D-Lactate Modifies Intracellular Metabolic Pathways in bFLS

   We performed a metabolic pathway analysis with MetaboAnalyst v4.0 using
   a hypergeometric test for overrepresentation analysis of all
   significantly modified metabolites after D-lactate stimulation
   ([103]Figure 4). The metabolic pathways that were most significantly
   modified and had a higher impact value were
   “glycolysis/gluconeogenesis;” “pyruvate metabolism;” “galactose
   metabolism;” “citrate cycle (TCA cycle);” “alanine, aspartate, and
   glutamate metabolism;” and “glycine, serine, and threonine metabolism”
   ([104]Figure 4). These results showed that carbohydrate and amino acid
   metabolism were the primary metabolic pathways disturbed in bFLS after
   D-lactate treatment.

Figure 4.

   [105]Figure 4
   [106]Open in a new tab

   D-Lactate reprograms bFLS metabolism. bFLS were stimulated with 5 mM
   D-lactate for 1 h. Metabolic pathway analysis was performed using
   MetaboAnalyst v4.0 based on the Kyoto Encyclopedia of Genes and Genomes
   (KEGG) using all metabolites significantly altered after D-lactate
   treatment. All matched pathways are shown as circles. The color of the
   circles is based on p-values from pathway enrichment analysis, where
   darker colors indicate more significant metabolites changes in the
   corresponding pathway. The size of the circles represents the pathway
   impact score. The most impacted pathways with high statistical
   significance (p < 0.05) are labeled. n = 4.

D-Lactate Increases Expression of IL-6, HIF-1α, Glut-1, and PDK-1 in bFLS

   To evaluate the direct proinflammatory role of D-lactate, we measured
   the expression of IL-6 in D-lactate-treated bFLS and detected a
   significant increase in the mRNA levels of this inflammatory gene at 6
   h after stimulation ([107]Figure 5A). bTNF-α, which was used as the
   positive control for pro-inflammatory cytokine expression, also
   significantly increased the mRNA levels of IL-6 ([108]Figure 5A). Next,
   we evaluated the expression of HIF-1α, glucose transporter 1 (Glut-1),
   and pyruvate dehydrogenase kinase 1 (PDK-1). D-Lactate stimulation
   significantly increased the mRNA expression of HIF-1α, Glut-1, and
   PDK-1 in bFLS at 6 h after treatment ([109]Figures 5B–D). Additionally,
   bTNF-α also increased the mRNA levels of these three metabolic genes
   ([110]Figures 5B–D). Taken together, these results showed the ability
   of D-lactate to increase the expression of genes associated with both
   the inflammatory response and the cellular metabolism.

Figure 5.

   [111]Figure 5
   [112]Open in a new tab

   D-Lactate increases the expression of inflammation and
   metabolism-associated genes in bFLS. Relative mRNA expression of (A)
   IL-6, (B) hypoxia-inducible factor-1 subunit α (HIF-1α), (C) glucose
   transporter 1 (Glut-1), and (D) pyruvate dehydrogenase kinase 1 (PDK-1)
   in bFLS stimulated with 5 mM D-lactate for 6 h. bTNF-α was used as the
   postitive control. Each bar represents the mean ± SEM, n = 5. *p <
   0.05; **p < 0.01.

D-Lactate Increases HIF-1α Protein Levels Under Normoxic Conditions in bFLS

   Since D-lactate increased the mRNA expression of HIF-1α in bFLS, we
   also evaluated the ability of D-lactate to induce HIF-1α protein
   accumulation. Under normoxic conditions (20% O[2]), treatment of bFLS
   with D-lactate for 6 h significantly increased the HIF-1α protein
   levels compared to untreated cells ([113]Figure 6). In addition, HIF-1α
   accumulation was also significantly higher in bTNF-α-treated bFLS
   relative to unstimulated control cells ([114]Figure 6). Similar results
   were observed in bFLS exposed to D-lactate and bTNF-α under hypoxic
   conditions (1% O[2]), although the differences were not significant
   compared to the unstimulated cells in hypoxia ([115]Figure 6). These
   results show the ability of D-lactate to induce HIF-1α protein
   accumulation in bFLS under normoxic conditions.

Figure 6.

   [116]Figure 6
   [117]Open in a new tab

   D-Lactate induces HIF-1α protein accumulation under normoxic conditions
   in bFLS. bFLS were stimulated with 5 mM D-lactate for 6 h under
   normoxic (20% O[2]) and hypoxic (1% O[2]) conditions. bTNF-α was used
   as the positive control. HIF-1α stabilization was detected in total
   protein extracts by Western blot using cobalt chloride (CoCl[2]) as the
   hypoxia-mimetic agent. (A) Representative HIF-1α immunoblot is shown.
   (B) Densitometry HIF-1α values were quantified using Image Studio Lite
   v5.2 software and normalized to β-actin. Each bar represents the mean ±
   SEM, n = 3. **p < 0.01; ****p < 0.0001; n.s., not significant.

D-Lactate-Induced IL-6, HIF-1α, Glut-1, and PDK-1 Expression in bFLS Is
Dependent on the HIF-1 Activity

   The possible role of HIF-1 in the pro-inflammatory response induced by
   D-lactate in bFLS was evaluated by preincubating cells with YC-1, a
   synthetic compound with an inhibitory effect on HIF-1 activity
   ([118]28, [119]29). Upon stimulation with D-lactate and bTNF-α, the
   mRNA levels of IL-6 were significantly lower in bFLS preincubated with
   YC-1 ([120]Figure 7A). Similarly, the inhibition of HIF-1 also
   significantly decreased extracellular secretion of IL-6 induced by
   D-lactate and bTNF-α ([121]Figure 7B). Since D-lactate and bTNF-α also
   increased the mRNA expression and secretion of IL-8 ([122]23), we
   assessed the involvement of HIF-1 in this pro-inflammatory response.
   However, preincubation with YC-1 did not decrease the IL-8 expression
   or secretion ([123]Supplementary Figure 3). We also evaluated the
   participation of HIF-1 in the mRNA expression of HIF-1α, Glut-1, PDK-1,
   and L-lactate dehydrogenase subunit A (L-LDHA). Preincubation of cells
   with YC-1 significantly reduced the mRNA levels of HIF-1α, Glut-1,
   PDK-1, and L-LDHA induced by D-lactate stimulation ([124]Figures 7C–E;
   [125]Supplementary Figure 4). In addition, YC-1 also significantly
   reduced the mRNA expression of HIF-1α and PDK-1 induced by bTNF-α
   treatment ([126]Figures 7C,E). These results suggest that
   D-lactate-induced IL-6 mRNA expression and secretion are dependent on
   the HIF-1 activity. Similar to IL-6, D-lactate-mediated mRNA expression
   of HIF-1α, Glut-1, and PDK-1 was dependent on the HIF-1 activity.

Figure 7.

   [127]Figure 7
   [128]Open in a new tab

   HIF-1 is involved in the D-lactate-induced overexpression of
   inflammation- and metabolism-associated genes in bFLS. bFLS were
   preincubated with 40 μM YC-1 and then stimulated with 5 mM D-lactate
   for 6 h. The relative mRNA expression levels of (A) IL-6, (C) HIF-1α,
   (D) Glut-1, and (E) PDK-1 are shown. (B) IL-6 levels in conditioned
   media were measured by ELISA. bTNF-α was used as the positive control.
   Each bar represents the mean ± SEM, n = 5. *p < 0.05; **p < 0.01; n.s.,
   not significant.

PI3K/Akt Signaling Pathway and the NF-κB Activity Mediate D-Lactate-Induced
Expression of HIF-1α, Glut-1, and PDK-1 in bFLS

   We used the pharmacological PI3K inhibitor LY294002 ([129]30) to
   evaluate the involvement of the PI3K/Akt signaling axis in mRNA
   overexpression of metabolism-associated genes, such as HIF-1α, Glut-1,
   and PDK-1, induced by D-lactate and bTNF-α. Preincubation of cells with
   LY294002 significantly decreased the mRNA levels of HIF-1α ([130]Figure
   8A), Glut-1 ([131]Figure 8C), and PDK-1 ([132]Figure 8E) induced by
   both D-lactate and bTNF-α. Finally, we also used BAY 11-7082, a
   synthetic inhibitor of IκB-α phosphorylation ([133]31), to evaluate the
   involvement of NF-κB activity in the altered mRNA expression of HIF-1α,
   Glut-1, and PDK-1 induced by D-lactate and bTNF-α. Inhibition of NF-κB
   activity also significantly decreased the mRNA expression of HIF-1α
   ([134]Figure 8B), Glut-1 ([135]Figure 8D), and PDK-1 ([136]Figure 8F)
   induced by both D-lactate and bTNF-α. Taken together, these results
   suggest that D-lactate induces the expression of metabolic genes,
   namely HIF-1α, Glut-1, and PDK-1, via PI3K/Akt-dependency, as well as
   the NF-κB activity, in exposed bFLS.

Figure 8.

   [137]Figure 8
   [138]Open in a new tab

   The PI3K/Akt pathway and the NF-κB pathway regulate the overexpression
   of metabolic genes induced by D-lactate in bFLS. bFLS were preincubated
   with 10 μM LY294002 or 10 μM BAY 11-7082 and stimulated with 5 mM
   D-lactate for 6 h. The relative mRNA expression levels of (A,B) HIF-1α,
   (C,D) Glut-1, and (E,F) PDK-1 are shown. bTNF-α was used as positive
   control. Each bar represents the mean ± SEM, n = 5. *p < 0.05; **p <
   0.01; ***p < 0.001; ****p < 0.0001.

Discussion

   Lameness and its adverse implications for animal welfare and health
   have become recognized as problems in recent years, particularly in the
   intensive dairy cattle farming industry ([139]32, [140]33). High energy
   diets rich in easily available carbohydrates favor acidotic states, the
   consequences of which include the occurrence of laminitis, a diffuse,
   aseptic inflammation of the corium, and aseptic polysynovitis, which
   also contributes to lameness ([141]3, [142]9). In addition, neutrophil
   recruitment in the joints of heifers with ARA has been reported,
   although its pathophysiology has yet to be studied in more detail
   ([143]9, [144]10). Alarcon et al. reported high concentrations of
   D-lactate (~5 mM) and metabolic disturbances in the synovial fluid
   extracted from heifers with ARA ([145]17). Given the central role of
   bFLS in maintaining the synovial fluid composition and contributing to
   inflammatory and metabolic changes during joint diseases ([146]14), we
   first evaluated the effect of D-lactate on bFLS metabolome.

   Concentrations of several carbohydrates were significantly higher in
   bFLS exposed to 5 mM D-lactate than that observed in untreated cells.
   Based on these metabolites, primary metabolic pathways altered after
   D-lactate treatment were “glycolysis/gluconeogenesis” as well as
   “galactose metabolism.” GC-MS metabolomic profiling of the synovial
   fluid of heifers with ARA at 9 h post oligofructose overload primarily
   included the “starch and sucrose metabolism,” “galactose metabolism,”
   and “glycolysis or gluconeogenesis” pathways ([147]17). Comparative
   metabolomic analysis of cultured FLS from patients with rheumatoid
   arthritis (RA) and osteoarthritis (OA) showed that the altered primary
   metabolic pathways were “glycolysis and gluconeogenesis,” “galactose
   metabolism,” and “fructose and mannose metabolism” ([148]16).
   Supporting our results, disturbances of carbohydrate metabolism appear
   to be key in the aseptic inflammatory joint ([149]34).

   The levels of several amino acids, including threonine, were
   significantly increased by D-lactate treatment. Threonine is one of the
   most abundant amino acids present in the bovine synovial proteins and
   fluid ([150]35, [151]36), and its augmented levels have been observed
   in the joints of patients with OA ([152]16, [153]37). Threonine is
   considered to be a glucogenic amino acid that can be converted into
   pyruvic acid for energy supply in organisms ([154]38, [155]39). In
   addition, its putative role in glucose and pyruvate metabolism during
   the inflammatory response has also been previously reported ([156]16,
   [157]40).

   A significant increase in the level of several saturated long-chain
   fatty acids was observed in bFLS treated with D-lactate. Linoleic acid,
   an omega-6 polyunsaturated fatty acid, was also higher in stimulated
   cells. Interestingly, increased levels of fatty acids were also
   detected in the synovial fluid of heifers with ARA at 24 h after
   oligofructose overload ([158]17), suggesting that lipid metabolism may
   be a metabolic pathway involved during inflammatory processes in
   synovial cells. Supporting the above hypothesis, Ahn et al. suggested
   that significantly higher levels of fatty acids in RA-FLS than OA-FLS
   were due to increased lipolysis in inflamed tissues for energy
   production ([159]16). Additionally, omega-6 polyunsaturated fatty acids
   are precursors to several pro-inflammatory eicosanoids and
   prostaglandins through the arachidonic acid cascade, which actively
   participates in the pro-inflammatory process ([160]41). Furthermore,
   Hidalgo et al. reported high levels of PGE[2] in the synovial fluid of
   heifers at 9 and 24 h after oligofructose overload ([161]42).

   In the present study, increased levels of glucose, pyruvic acid,
   succinic acid, and fumaric acid were detected by GC-MS in bFLS
   stimulated with D-lactate. Additionally, we also detected a significant
   increase in the intracellular levels of L-lactate in stimulated bFLS by
   HPLC analysis together with an intracellular accumulation of D-lactate,
   which was attributable to transport mechanisms via monocarboxylate
   transporter 1 ([162]43). These metabolites were associated with
   alterations in “pyruvate metabolism” and “citrate cycle (TCA cycle).”
   According to our results, high levels of lactate have been detected in
   the synovial fluid of patients with aseptic inflammatory conditions,
   such as RA ([163]44–[164]46) and gouty ([165]47). In addition,
   Borenstein et al. also reported higher levels of lactic, fumaric, and
   succinic acids in non-septic inflammatory synovial fluids than in
   non-inflammatory fluids ([166]48). Alarcon et al. also reported higher
   levels of D-lactate, L-lactate, and pyruvic acid in the synovial fluid
   of heifers with ARA at 9 h after oligofructose overload, which was
   associated with an upregulation of the “pyruvate metabolism” and
   “glycolysis or gluconeogenesis” pathways ([167]17). Thus, our results
   demonstrate the ability of D-lactate to induce metabolic reprogramming
   in bFLS and support the hypothesis that it has a central role in the
   metabolic changes detected in the synovial fluid of heifers with ARA.

   During inflammation, cells need to generate energy and biomolecules to
   support growth, proliferation, and pro-inflammatory molecule
   production, resulting in cell metabolism shifts toward glycolysis
   ([168]49, [169]50). Moreover, a metabolic shift toward anaerobic
   glycolysis enables cells to better cope with metabolically restrictive
   conditions during inflammation, such as those that occur in the
   transition from normoxia to hypoxia ([170]49). FLS from patients with
   RA have increased glycolytic activities characterized by an elevated
   expression of glycolytic markers, such as hexokinase 2 and Glut-1
   ([171]51). In these cells, a metabolic switch to anaerobic glycolysis
   is essential to support angiogenesis, cellular invasion, and pannus
   formation ([172]52). Indeed, glycolysis blockade has been shown to
   ameliorate inflammation and subsequent cartilage damage in several
   models of arthritis ([173]51, [174]53). Similarly, studies on
   macrophages and dendritic cells focusing on metabolic adaptations have
   highlighted the key role of glycolysis in the initiation and
   development of inflammation induced by danger signals ([175]54).

   Supporting the above, D-lactate treatment increased the mRNA expression
   of IL-6 in bFLS, a response also observed in bFLS treated with bTNF-α.
   IL-6 is a key pro-inflammatory cytokine in numerous joint diseases
   ([176]55, [177]56). Indeed, the expression of IL-6 and the severity of
   lesions in aseptic joint diseases are correlated ([178]55, [179]57).
   Furthermore, IL-6 levels were shown to be increased in the synovial
   fluid of heifers with ARA at 9 and 24 h after oligofructose overload
   ([180]17, [181]42), and incubating bFLS with 2 and 5 mM D-lactate
   significantly increased the mRNA expression of IL-6 ([182]17).

   HIF-1 is a master regulator of the transcription of hundreds of genes
   required to maintain a balance between oxygen supply and metabolic
   demand ([183]58). HIF-1 is a heterodimeric protein complex comprising
   an oxygen-sensitive α subunit (HIF-1α), which is degraded by the
   proteasomal pathway under normoxic conditions, and an
   oxygen-insensitive β subunit (HIF-1β) ([184]59, [185]60). Under hypoxic
   conditions, accumulation of HIF-1α induces HIF-1-regulated adaptive
   responses that facilitate the production of glycolytic ATP, including
   the transcription of Glut-1, hexokinase (HK), PDK-1, and enzymes of the
   glycolytic pathway ([186]61–[187]63). In the present study, treatments
   with D-lactate and bTNF-α induced the accumulation of HIF-1α protein
   under normoxic conditions in bFLS. Consistent with our findings, HIF-1
   activation under normoxic conditions has also been reported after
   cellular exposure to pro-inflammatory agents, including growth factors;
   bacteria; and their compounds, namely TNF-α, IL-1β, and lactate, among
   other agents ([188]20, [189]21, [190]64–[191]68). In addition,
   D-lactate treatment also increased the mRNA expression of HIF-1α,
   Glut-1, PDK-1, and L-LDHA in stimulated bFLS. To assess the role of
   HIF-1 in this response, we used the HIF-1-inhibitor YC-1, which
   enhances the binding of factor inhibitor of HIF-1 (FIH) to the
   transactivation domain COOH-terminal (C-TAD) in the HIF-1α subunit,
   dissociating the binding of the latter to the p300 coactivator and
   leading to the functional repression of HIF-1 ([192]29). YC-1
   significantly reduced the gene expression of HIF-1α, Glut-1, PDK-1, and
   L-LDHA, suggesting the involvement of HIF-1 in the metabolic
   reprogramming induced by D-lactate in bFLS under normoxic conditions.
   Similarly, YC-1 also significantly decreased the gene expression of
   bTNF-α-induced HIF-1α, PDK-1, and Glut-1. Consistent with the results,
   previous reports also showed the involvement of HIF-1 in the mRNA
   expression of HIF-1α ([193]69), Glut-1 ([194]70), and PDK-1 ([195]62).
   Interestingly, YC-1 also decreased the IL-6 mRNA expression, suggesting
   the involvement of HIF-1 in the upregulation of gene expression of this
   relevant pro-inflammatory cytokine induced by D-lactate and bTNF-α in
   bFLS. Based on the results, findings of other related studies also
   showed an increased production of IL-6 through a HIF-1-dependent
   mechanism in synoviocytes and chondrocytes using an experimental model
   of ischemic osteonecrosis ([196]56), while the ability of lactate to
   induce IL-6 secretion through a HIF-1-dependent pathway was also
   reported by other researchers in chondrocytes ([197]20). In contrast,
   in bFLS, D-lactate and bTNF-α induced the expression and secretion of
   IL-8 in a HIF-1-independent manner, suggesting a selective role of
   HIF-1 in the expression of pro-inflammatory genes in synovial cells. In
   support of this, HIF-1α knock-down in RA-FLS did not reduce the
   expression of IL-8 and MMP-1 induced by hypoxia ([198]71).

   The PI3K/Akt pathway has a central role in the regulation of cell
   growth and metabolism in different host cell types ([199]72).
   Consequently, Akt regulates several processes associated with glucose
   metabolism, including Glut-1 localization to the cell membrane, pentose
   phosphate shuttle activity, and the activation of various glycolytic
   enzymes such as HK and phosphofructokinase ([200]73, [201]74). We
   recently described that D-lactate induced Akt phosphorylation, and
   inhibition of the PI3K/Akt pathway reduced the mRNA expression and
   secretion of IL-6 and IL-8 ([202]23). In the present study, PI3K/Akt
   pathway inhibition by LY294002 ([203]30) significantly reduced the mRNA
   levels of IL-6, HIF-1α, Glut-1, and PDK-1 induced by D-lactate and
   bTNF-α. Similarly, the PI3K inhibitor LY294002 interfered with
   TNF-α-induced activation of OA-FLS, attenuating the overexpression of
   cadherin-11 and reducing the invasive ability of these cells ([204]75).
   Similarly, Jia et al. demonstrated that the PI3K/Akt pathway inhibition
   by LY294002 or cucurbitacin E significantly reduced the TNF-α-induced
   production of IL-1β, IL-6, and IL-8 mRNA and the protein expression in
   human synoviocytes ([205]76). A dependence on the PI3K/Akt pathway for
   the expression of pro-inflammatory cytokines, namely IL-6, IL-8,
   IL-17a, and IL-1β, was also reported by Li et al. in synovial
   fibroblasts isolated from rats with experimental OA ([206]77).
   Similarly, in human tumoral cell lines, pharmacological inhibition of
   the PI3K/Akt pathway was shown to reduce the mRNA expression of Glut-1
   ([207]78–[208]80) as well as the protein levels of HIF-1α and PDK-1
   ([209]81).

   The results of previous studies suggest that the PI3K/Akt pathway
   regulates the nuclear translocation of NF-κB ([210]76, [211]82). Thus,
   to evaluate the role of NF-κB in inflammatory and metabolic responses
   induced by D-lactate, we preincubated bFLS with the pharmacological
   inhibitor BAY 11-7082, which inhibits IκB-α phosphorylation and
   interferes with NF-κB nuclear translocation, functionally inactivating
   the pathway ([212]31). The results of the study demonstrated that
   inactivation of the NF-κB pathway strongly decreased mRNA levels of
   IL-6 induced by D-lactate and bTNF-α in exposed bFLS. Recently, we
   demonstrated that D-lactate and bTNF-α induced the degradation of IκBα
   after 30 min of stimulation in bFLS, and treatment with BAY 11-7082
   significantly reduced the expression and secretion of IL-6 and IL-8
   induced by both stimuli, supporting that the NF-κB pathway is induced
   by D-lactate in bFLS ([213]23). The NF-κB activity was also shown to be
   key for the expression of several pro-inflammatory cytokines in
   bovines, including IL-6, TNF-α, and IL-1β ([214]83–[215]87). Similarly,
   the NF-κB activity is strongly involved in the mRNA expression of IL-6,
   IL-8, and IL-1β induced by TNF-α in human FLS ([216]82, [217]88,
   [218]89). Interestingly, the gene expression of HIF-1α, Glut-1, and
   PDK-1 induced by D-lactate and bTNF-α was also significantly inhibited
   by BAY 11-7082. The role of NF-κB in cell metabolic reprogramming has
   been poorly investigated, although it was reported that the RelA
   subunit of NF-κB upregulates the transcription of Glut-3, increasing
   glucose uptake and glycolytic flux ([219]90), as well as upregulates
   mitochondrial respiration ([220]91) in murine primary cultured cells.
   Furthermore, the role of the NF-kB pathway in HIF-1 mRNA expression in
   RA-FLS stimulated with IL-17A has also been demonstrated ([221]92),
   suggesting its participation in metabolic reprogramming during
   inflammation.

   Nonetheless, although we demonstrated the role of HIF-1 in metabolic
   and inflammatory responses induced by D-lactate in FLS, we cannot rule
   out the involvement of other upstream signaling pathways that could be
   activated by D-lactate, thus regulating HIF-1 activity. Several studies
   have described involvement of extracellular-regulated kinase (ERK),
   PI3K/Akt, and mammalian target of rapamycin (mTOR) pathways in the
   regulation of HIF-1α mRNA and protein levels after stimulation with
   proinflammatory cytokines and growth factors ([222]64,
   [223]93–[224]99). Therefore, additional studies are required to
   elucidate precise mechanisms involved in HIF-1 activation induced by
   D-lactate in bFLS of joints.

   In conclusion, D-lactate induces an inflammatory response along with
   metabolic reprogramming in bFLS. Both processes are dependent on
   activities of transcription factors, such as HIF-1 and NF-κB, as well
   as the activation of the PI3K/Akt signaling pathway, which contribute
   to an increased expression of IL-6, HIF-1α, Glut-1, PDK-1, and L-LDHA
   ([225]Figure 9). These results support the pivotal role of D-lactate in
   bovine joint inflammation and glycolytic metabolic disturbances
   observed in synovitis induced by ARA in cattle.

Figure 9.

   [226]Figure 9
   [227]Open in a new tab

   Metabolic reprogramming supports the inflammatory response induced by
   D-lactate in bFLS. D-Lactate induces the PI3K/Akt pathway activation
   and downstream activation of NF-κB and HIF-1. Through this signaling
   pathway, D-lactate induces the gene expression of IL-6, with the
   pro-inflammatory cytokine involved in the synovial inflammatory
   response. HIF-1 activation also increases the expression of the Glut-1
   transporter, which increases glucose uptake for use in glycolysis.
   Glycolysis is also favored by the HIF-1-dependent overexpression of
   L-LDH, which oxidizes pyruvate to L-lactate. In addition, an increased
   PDK-1 expression blocks the mitochondrial utilization of pyruvate
   through the TCA cycle, contributing to the glycolytic fate of glucose.
   Overexpression of the HIF-1α subunit would favor the accumulation of
   HIF-1 heterodimers, maintaining glycolytic metabolic reprogramming.
   IL-6, interleukin 6; Glut-1, solute carrier family 2 (facilitated
   glucose transporter) member 1; L-LDH, L-lactate dehydrogenase; PDK-1,
   pyruvate dehydrogenase kinase 1; HIF-1α, hypoxia inducible factor 1
   subunit alpha; PDH, pyruvate dehydrogenase; TCA, tricarboxylic acid
   cycle; PI3K, phosphatidyl inositol 3-kinase; Akt, protein kinase B;
   NF-κB, nuclear factor kappa B; HIF-1, hypoxia-inducible factor 1.

Data Availability Statement

   The original contributions presented in the study are included in the
   article/[228]Supplementary Material, further inquiries can be directed
   to the corresponding author/s.

Ethics Statement

   The animal study was reviewed and approved by Ethical committee of
   Universidad Austral de Chile #0023/18; Valdivia, Chile.

Author Contributions

   JQ, PA, MC, and RB designed the experiments. JQ, PA, CM, and ST
   performed the experiments. JQ, PA, and RB prepared the manuscript. AT,
   CH, MH, and RB analyzed the data. All authors have read and approved
   the final version of this manuscript.

Conflict of Interest

   The authors declare that the research was conducted in the absence of
   any commercial or financial relationships that could be construed as a
   potential conflict of interest.

Acknowledgments