Abstract

   Post-translational modifications of cardiac proteins could participate
   to left contractile dysfunction resulting in heart failure. Using a rat
   model of ischemic heart failure, we showed an accumulation of
   phosphorylated desmin leading to toxic aggregates in cardiomyocytes,
   but the cellular mechanisms are unknown. The same rat model was used to
   decipher the kinases involved in desmin phosphorylation and the
   proteolytic systems present in rat and human failing hearts. We used
   primary cultures of neonate rat cardiomyocytes for testing specific
   inhibitors of kinases and for characterizing the autophagic processes
   able to clear desmin aggregates. We found a significant increase of
   active PKCζ, no modulation of ubitiquitin-proteasome system, a defect
   in macroautophagy, and an activation of chaperone-mediated autophagy in
   heart failure rats. We validated in vitro that PKCζ inhibition induced
   a significant decrease of GSK3β and of soluble desmin. In vitro
   activation of ubiquitination of proteins and of chaperone-mediated
   autophagy is able to decrease soluble and insoluble forms of desmin in
   cardiomyocytes. These data demonstrate a novel signaling pathway
   implicating activation of PKCζ in desmin phosphorylation associated
   with a defect of proteolytic systems in ischemic heart failure, leading
   to desmin aggrephagy. Our in vitro data demonstrated that
   ubiquitination of proteins and chaperone-mediated autophagy are
   required for eliminating desmin aggregates with the contribution of its
   chaperone protein, α-crystallin Β-chain. Modulation of the kinases
   involved under pathological conditions may help preserving desmin
   intermediate filaments structure and thus protect the structural
   integrity of contractile apparatus of cardiomyocytes by limiting desmin
   aggregates formation.

   Subject terms: Heart failure, Immunochemistry

Introduction

   Left ventricular (LV) remodeling following myocardial infarction (MI)
   is one of the main causes of cardiac dysfunction leading to heart
   failure (HF) [[46]1, [47]2]. To date, several mechanisms implicated in
   LV remodeling such as infarct size, fibrosis, and apoptosis as well as
   alterations in contractile proteins and in intracellular calcium
   handling have been identified, however, the exact mechanisms underlying
   HF remain imperfectly known.

   Using an experimental rat model of ischemic HF and phosphoproteomic
   technologies, we previously identified increased levels of serine
   phosphorylated desmin in the LV of ischemic HF rats [[48]3, [49]4].
   Desmin is a 53kDa muscle-specific intermediate filament protein, which
   forms a three-dimensional scaffold around the myofibrillar Z-disk and
   interconnects the contractile apparatus to the cellular organelles
   [[50]5]. Desmin is the target of post-translational modifications
   (PTM), such as phosphorylation as well as nonenzymatic modifications
   such as glycation [[51]6–[52]8]. The major effect of phosphorylation is
   the disassembly of desmin filaments [[53]6] that impacts the
   solubilization of insoluble intermediate filaments [[54]9]. Glycogen
   synthase kinase 3 (GSK3) β has been described to be involved in desmin
   phosphorylation [[55]10], which was shown recently to induce
   calpain-1-mediated muscle desmin depolymerization [[56]11].

   We previously showed the presence of most of the phosphorylated desmin
   in the insoluble LV protein fraction of ischemic HF rats [[57]4]
   suggesting that desmin phosphorylation, could promote the formation of
   desmin aggregates in failing heart, as already observed in a canine
   pacing model of desynchronous HF [[58]10, [59]12] as well as in
   desminopathies. In the latter case, the majority of desmin causative
   mutations lead to cardiac conduction abnormalities and to the
   accumulation of insoluble desmin-containing aggregates [[60]13,
   [61]14]. Desmin phosphorylation cause disturbance of the cytoskeletal
   network, thus leading to loss of function of desmin linked to
   cardiomyocyte death and development of cardiomyopathy [[62]15].
   Interestingly, it has been previously shown that desmin expression and
   its pattern of striation correlated with the level of myocardial injury
   in patients with idiopathic dilated cardiomyopathy [[63]16]. Thus,
   desmin and more particularly its phosphorylation and aggregation may
   contribute to cardiac toxicity and account for heart dysfunction during
   LV remodeling following MI [[64]17]. The aggregates of
   hyperphosphorylated desmin present in HF hearts are proteotoxic
   [[65]18] and may be due to inefficient autophagy processes [[66]19].

   The aim of the present study was therefore to decipher the kinases
   involved in the phosphorylation of desmin and to investigate the
   contribution of the different proteolytic systems such as the
   ubiquitin-proteasome system (UPS), macroautophagy, and
   chaperone-mediated autophagy (CMA) [[67]20] in the accumulation of
   hyperphosphorylated desmin aggregates in human and experimental HF.

Results

Phosphorylated desmin is associated with active PKCζ and GSK3β in LV of
HF-rats 2 months after MI

   Phosphorylation is a dynamic process resulting from changes in
   phosphatases or kinases activities. As previously shown, neither the
   activity nor the protein levels of PP2A, a central cardiac phosphatase
   involved in the dephosphorylation of cardiac proteins [[68]21] was
   significantly modulated in the LV of HF-rats [[69]22]. Consequently, we
   selected four kinases by in silico screening (Fig. [70]1A), potentially
   involved in desmin phosphorylation, calmodulin-dependent protein kinase
   II (CaMKII), Aurora B, PKC (ε and ζ isoforms), and GSK3 (α and β
   isoforms). We investigated their expression in our rat HF model and
   excluded CaMKII and Aurora B. Indeed, active CaMKII (CaMKII
   pT286/CaMKII ratio) was completely decreased in the LV of HF-rats (Fig.
   S[71]1A), in accordance with the decreased levels of phosphorylated
   phospholamban (PLB) (Fig. S[72]1B). Aurora B was not significantly
   modulated in the LV of HF-rats (Fig. S[73]1C) as confirmed by the
   phosphorylation levels of desmin at serine 60 [[74]23] not modulated
   between the 2 groups of rats (Fig. S[75]1C). This was validated by the
   nuclear localization of Aurora B without colocalization with desmin
   (Fig. S[76]1C). We also excluded PKCε since its expression was
   decreased in the LV of HF-rats [[77]22]. Then, we first evaluated GSK3
   levels, recently shown to be involved in desmin phosphorylation in an
   experimental canine model of dyssynchronous HF [[78]10], especially
   GSK3β for which its role in cardiac biology is well recognized
   [[79]24]. GSK3β phosphorylation levels at S9 were significantly
   decreased in LV of HF-rats without any modulation of GSK3β levels,
   corresponding to a decrease of the inactive form (Fig. [80]1B). We also
   showed a significant decrease of the inactive form of GSK3α
   phosphorylated at S21 without any modulation of GSK3α levels (Fig.
   S[81]1D). Finally, we showed an increase of PKCζ phosphorylated on T560
   without any modulation of PKCζ levels (Fig. [82]1C) in the LV of
   HF-rats. These results suggest an increase of PKCζ active form in the
   LV of HF-rats validated by the increase of one of its scaffold protein,
   Receptor for Activated C Kinase 1 (RACK1) levels (Fig. [83]1D).
   Immunofluorescence staining showed a weak colocalization of desmin with
   PKCζ (Fig. [84]1E and Table S[85]3) and with its anchoring protein
   RACK1 in HF-rats (Fig. S[86]1E and Table S[87]3). We observed by
   transmission electron microscopy (TEM) a stronger alteration of LV
   structure with sarcomeres disruption and mitochondrial structural
   abnormalities characterized by a loss of electron-dense matrix at 2
   months post-MI (Fig. [88]1F). Desmin was mainly expressed in the
   insoluble fraction, suggesting the formation of hyperphosphorylated
   desmin aggregates, as highlighted by immunofluorescence staining in LV
   of 2 months post-MI rats (Fig. [89]1G). Interestingly, the levels of
   one of its chaperone protein, α-crystallin Β-chain (CryAB), were
   unchanged in both fractions (Fig. S[90]1F), suggesting that desmin
   aggregates are not the results of CryAB defect. These results suggest
   that the presence of desmin aggregates may participate to myofilament
   architecture disruption and local cardiomyocyte function alteration as
   recently suggested [[91]25].

Fig. 1. Desmin is phosphorylated by active PKCζ and GSK3β in the LV of
HF-rats 2 months after MI.

   [92]Fig. 1
   [93]Open in a new tab

   A In silico screening of kinases potentially involved in desmin
   phosphorylation with GeneGo pathways software selected CaMKII, Aurora
   B, and PKC (ε and ζ isoforms). GSK3 was previously described to be
   involved in desmin phosphorylation [[94]10]. B Representative western
   blots (top panel) and quantification of inactive GSK3β (GSK3β pS9/GSK3β
   ratio) (bottom left panel) and GSK3β levels (bottom right panel) in the
   LV of sham- (n = 11) and HF-rats 2 months post-MI (n = 11). C
   Representative western blots (top panel) and quantification of active
   PKCζ (PKCζ pT560/ PKCζ ratio) (bottom left panel) and PKCζ levels
   (bottom panel) in the same samples. D Representative western blot (top
   panel) and quantification of RACK1 levels (right panel) in the same
   samples. The loading controls (GAPDH and α-tubulin) are indicated on
   the graphs. Graphs show individual and mean ± SEM values expressed in
   arbitrary units (A.U.). Significant P values are indicated on the
   graphs. E Double immunofluorescence staining for desmin (green) with
   PKCζ (red) in the LV of sham- and HF-rats 2 months post-MI. Arrows
   indicate the colocalisation of desmin with PKCζ. Scale bar represents
   60 µm. F LV ultrastructure of sham- and 7 days post-MI rats (top panel)
   and sham- and HF-rats 2 months post-MI (bottom panel). Higher
   magnifications of mitochondria from LV of 2 months sham- and post-MI
   rats are shown as insert. Scale bar represents 1 µm. G
   Immunofluorescence staining for desmin aggregates indicated by arrows
   only in LV of HF-rats compared to sham-rats with nuclei stained in
   blue. Scale bar represents 60 µm.

Dysregulated autophagy contributes to phosphorylated desmin aggregates in LV
of heart failure rats

   We explored the different proteolytic pathways (e.g., macroautophagy,
   CMA, and ubiquitin proteasome) in order to decipher their contribution
   in phosphorylated desmin clearance in our experimental model of HF. We
   showed an alteration of macroautophagy by a significant decrease of the
   LC3II/LC3I ratio with no modulation of p62, beclin-1, and LC3II levels
   in the LV of HF-rats (Fig. [95]2A and Fig. S[96]2A). These data are
   correlated with the absence of double-membrane vesicles (Fig. [97]1F).
   We did not observe any modulation of ubiquitinated protein levels (Fig.
   S[98]2B), TRIM32 [[99]26] (Fig. S[100]2C), and ASB2β [[101]8] (Fig.
   S[102]2D) between sham- and HF-rats. Interestingly, we found 4
   KFERQ-like CMA motifs [[103]27] in desmin sequence, conserved between
   species, suggesting that desmin may be a new CMA substrate. We found a
   significant increase of Hsp90 and Hsc70 levels but no modulation of
   LAMP2a levels in the LV of HF-rats (Fig. [104]2B). Altogether, our data
   show an impaired macroautophagy process in LV at 2 months post-MI and
   activation of CMA during the development of HF. The presence of
   KFERQ-like CMA motifs suggests that CMA may be involved in desmin
   clearance in the heart. This hypothesis was supported in part by a weak
   colocalization of desmin with LAMP2a (Fig. [105]2C).

Fig. 2. LV autophagy response to HF following MI.

   [106]Fig. 2
   [107]Open in a new tab

   A Representative western blots and quantification of macroautophagy
   markers, p62 (top panel), beclin-1 (middle panel), and LC3 II/LC3 I
   ratio (bottom panel) in LV of sham- (n = 11) and HF-rats 2 months
   post-MI (n = 11). B CMA markers: Hsp90 (top panel), LAMP2a (middle
   panel), and Hsc70 (bottom panel) were quantified by western blots in
   the same samples. The loading controls (GAPDH) are indicated on the
   graphs. Graphs show individual and mean ± SEM values expressed in
   arbitrary units (A.U.). Significant P values are indicated on the
   graphs. C Double immunofluorescence staining for desmin (green) with
   Hsc70 (red) (top panels) and for desmin (green) with LAMP2a (red)
   (bottom panels) in LV of sham- and HF-rats 2 months post-MI. Nuclei are
   stained in blue. Arrows indicate the colocalization of desmin with
   respectively Hsc70 and LAMP2a. Scale bar represents 30 µm.

   Based on these new in vivo data about the potential implication of PKCζ
   on desmin phosphorylation and the modulation of macroautophagy and CMA
   on clearance of soluble and insoluble forms of desmin, we investigated
   these mechanisms in primary culture of rat neonatal cardiomyocytes
   (NCM).

PKCζ modulate desmin phosphorylation in in vitro culture of cardiomyocytes

   For inhibiting specifically PKCζ, we used a cell-penetrating
   myristoylated (myrPS) peptide (^114-IYRRGARRWRKL-^125) [[108]28].
   Treatment of NCM by myrPS induced significant PKCζ inhibition with a
   decrease of PKCζ levels without any modulation of PKCζ pT560/PKCζ ratio
   (Fig. [109]3A). We observed a significant decrease of soluble desmin
   levels while insoluble desmin levels were unchanged upon PKCζ
   inhibition (Fig. [110]3B). Both soluble and insoluble (but to a lower
   extent) desmin phosphospecies, visualized by Phos-tag gels, showed less
   phosphorylated desmin in myrPS-treated NCM, suggesting less
   phosphorylation of desmin upon PKCζ inhibition (Fig. [111]3B, Fig.
   S[112]3). Interestingly, we also observed a modulation of GSK3β upon
   PKCζ inhibition with a significant increase of the inactive form of
   GSK3β, leading to increased inactive GSK3β (Fig. [113]3C).

Fig. 3. PKCζ modulates desmin phosphorylation in vitro in cardiomyocytes.

   [114]Fig. 3
   [115]Open in a new tab

   A Representative western blots and quantification of PKCζ levels (left
   panel) and active PKCζ (PKCζ pT560/PKCζ ratio) (right panel) in control
   and NCM treated with 10 µmol/L of PKCζ inhibitor, myrPS for 1 h
   (n = 8). B Soluble (top left panel) and insoluble (top right panel)
   desmin levels and their phosphorylation profiles (Phos-tag gel, bottom
   panels) were analyzed in response to PKCζ inhibition in the same
   samples. Each band of the desmin immunoblot of Phos-tag gels represents
   a phosphorylated form of desmin, the upper band being the most
   phosphorylated and the lower band the less or no phosphorylated form of
   desmin. C Representative western blots and quantification of GSK3β
   levels (left panel) and inactive GSK3β (GSK3β pS9/GSK3β ratio) (right
   panel) in the same samples. The loading control (S Actin) is indicated
   on the graphs. Graphs show individual and mean ± SEM values expressed
   in arbitrary units (A.U.). Significant P values are indicated on the
   graphs.

   Interestingly, GSK3β inhibition with 6-Bromoindirubin-3’-oxime
   inhibitor (BIO, 2 and 5 µM), for which we verified specific inhibition
   of GSK3β by the significant modulation of GSK3β pS9/GSK3β ratio (Fig.
   S[116]4A) without any modulation of GSK3β and of active PKCξ (PKCξ
   pT560/PKCξ ratio and PKCξ) (Fig. S[117]4B), did not modulate soluble
   desmin levels (Fig. S[118]4C, left and top panel) but induced only
   significant increase of insoluble desmin levels (Fig. S[119]4C, right
   and top panel) for 2 µM of BIO. The phosphospecies distribution of
   soluble desmin was modulated with upper molecular weight desmin species
   upon GSK3β inhibition in contrast with the phosphospecies distribution
   of insoluble desmin which was not modulated (Fig. S[120]4C, bottom
   panels). Another attractive feature is that the soluble and insoluble
   desmin phosphorylation profiles were different depending on whether
   PKCξ or GSK3β was inhibited (Fig. S[121]4C, bottom panels) suggesting
   that the two kinases may directly phosphorylate desmin at different
   serine residues.

   Altogether, our in vitro results suggest that PKCζ may regulate
   indirectly GSK3β as recently suggested [[122]29] and that both kinases
   are involved on desmin phosphorylation in cardiomyocytes.

Impact of macroautophagy and CMA modulation on desmin clearance in
cardiomyocytes

   Macroautophagy was induced by nutrient starvation with HBBS treatment
   with or without a 2 h pretreatment with bafilomycin to inhibit
   macroautophagic flux and thus increase its efficiency (Fig. S[123]5).
   Under HBSS treatment, we found efficient macroautophagy activation
   quantified by a significant increase of LC3II and LC3II/LC3I ratio
   which was significantly increased with bafilomycin pretreatment (Fig.
   S[124]5A). Soluble desmin levels were significantly degraded by
   nutrient starvation-induced autophagy (Fig. S[125]5B). Interestingly,
   insoluble desmin levels were not modulated by HBSS treatment (Fig.
   S[126]5C). These results confirmed the efficiency of macroautophagy in
   the degradation of soluble desmin in cardiomyocytes.

   To decipher the contribution of CMA in desmin clearance in
   cardiomyocytes, CMA was induced by either 2 or 5 µmol/L of geldanamycin
   (GA) for 17 h (Fig. [127]4 and Fig. S[128]6A–B) as previously described
   [[129]30]. Under GA treatment, we found a significant increase of Hsc70
   (Fig. [130]4A), with a significant decrease of LAMP2a and soluble
   desmin levels (Fig. [131]4B) and no effect on its chaperone, CryAB
   (Fig. [132]4C). Interestingly, insoluble desmin levels were not
   modulated by GA treatment (Fig. [133]4D). Immunofluorescence staining
   showed a weak colocalization of desmin with LAMP2a in CMA-activated NCM
   (Fig. [134]4E), despite the significant decrease of LAMP2a in the
   whole-cell extract (Fig. [135]4A) that could be explained by its
   restricted lysosomal localization. To strengthen the demonstration that
   desmin is a CMA substrate, we isolated lysosomes from H9c2 cells
   treated or not with GA. In isolated lysosomes, verified by LAMP1
   expression, we showed, as expected, an increase of LAMP2a and Hsc70 in
   isolated lysosomes upon GA treatment (Fig. [136]4F). Interestingly, the
   classical 53 kDa form and a cleaved form of 39 kDa of desmin were found
   in the lysosomes, which were strongly increased upon CMA activation
   (Fig. [137]4F). The cleaved form may be due to calpain proteolytic
   cleavage as previously described [[138]31]. We also verified that
   desmin can interact with Hsc70 by immunoprecipitation of cardiac cells
   (Fig. [139]4G), showing the ability of Hsc70 to target desmin to the
   lysosomes.

Fig. 4. Clearance of soluble desmin by inducing CMA in vitro in
cardiomyocytes.

   [140]Fig. 4
   [141]Open in a new tab

   A Representative western blots and quantification of CMA markers: Hsc70
   (left panel) and LAMP2a (right panel) in control (n = 8) and NCM
   treated with 2 and 5 µmol/L of geldanamycin (GA) during 17 h (n = 10).
   B, C The impact of CMA induction was evaluated by western blot on
   soluble protein fractions in the same samples for desmin (B) and CryAB
   (C). D The impact of CMA induction on insoluble desmin was evaluated by
   western blot in the same samples. The loading controls (GAPDH and S
   Actin) are indicated on the graphs. Graphs show mean ± SEM values
   expressed in arbitrary units (A.U.). Significant P values are indicated
   on the graphs. E Representative immunofluorescence staining of desmin
   (green) and LAMP2a (red) in control and NCM treated with 5 µmol/L of GA
   during 17 h. Nuclei are stained in blue. Arrows show the colocalization
   points. Scale bar represents 30 µm. F Representative western blots of
   lysosome marker (LAMP1), CMA markers (LAMP2a and Hsc70), and desmin in
   isolated lysosomes of H9c2 cells treated or not with 5 µmol/L of GA
   during 17 h. Arrows show the different desmin entities. G Detection of
   interaction between desmin and Hsc70 in H9c2 cells by
   immunoprecipitation of desmin followed by western blot for desmin and
   Hsc70. Crude: crude cells sample; Sur IP: supernatant of desmin
   immunoprecipitation. IP Des: immunoprecipitation of desmin; Efficiency
   of Des IP was verified with desmin western blot; M: size markers are
   indicated on the left side of red ponceau (RP) staining membrane.

   We also checked the specificity of CMA activation in cardiomyocytes by
   analyzing the impact of GA on other protein degradation pathways. We
   found no modulation of the ubiquitin-proteasome pathway (Fig.
   S[142]6A), but a significant decrease of macroautophagy markers in
   cardiomyocyte (Fig. S[143]6B). Then, we used a combined pharmacological
   treatment with MG132, a proteasome inhibitor, and 3-methyladenine
   (3MA), a macroautophagy inhibitor. We verified that the co-treatment
   induced specifically CMA activation by the significantly increased
   Hsc70 levels as previously shown (Fig. [144]5A) and significant
   inhibition of macroautophagy assessed by LC3II/LC3I ratio (Fig.
   [145]5A), and LC3II, with no modulation of Beclin-1 and p62 levels
   (Fig. S[146]6C). As expected, the inhibition of proteasome induced
   significantly increased levels of ubiquitinated proteins exacerbated
   upon inhibition of macroautophagy (Fig. [147]5B). With this other
   pharmacological treatment, we observed a significant decrease of
   soluble desmin levels induced by ubiquitination and CMA activation
   (Fig. [148]5C). Interestingly, CryAB expression was also significantly
   decreased (Fig. [149]5D) as well insoluble desmin levels (Fig.
   [150]5E). These data showed the role of desmin co-chaperone, CryAB for
   the clearance of insoluble desmin in cardiomyocyte. We observed low
   levels of ubiquitinated desmin, independently of proteasome inhibition,
   validated by the increased levels of ubiquitinated proteins in NCM
   treated by MG132 and the specificity of desmin immunoprecipitation by
   western blot (Fig. [151]5F). Immunofluorescence stainings using PLA
   suggested that desmin is a CMA substrate with a significantly increased
   colocalization of desmin with Hsc70 and LAMP2a and a significantly
   decreased colocalization of desmin with CryAB in NCM treated with MG132
   (Fig. [152]5G). Despite a lack of modification of desmin ubiquitination
   levels found in the in vivo model, it is well known that proteasome
   impairment in the context of cardiac stress may induce aberrant protein
   aggregation in the heart nutrient starvation.

Fig. 5. Clearance of soluble desmin in vitro in cardiomyocytes co-treated
with 3MA and MG132.

   [153]Fig. 5
   [154]Open in a new tab

   A Representative western blots and quantification of Hsc70 levels and
   LC3 II/LC3 I ratio in untreated/control cells (n = 12), NCM treated
   either with MG132 (10 µmol/L) (n =12 ) or 3-MA (10 mmol/L) (n = 12) for
   18 h, and NCM pre-treated with 3-MA (10 mmol/L) for 1 h and then
   co-treated with 3-MA (10 mmol/L) and MG132 (10 µmol/L) for 18 h
   (n = 12). B Representative western blots and quantification of
   ubiquitylated protein levels in the same samples. C Representative
   western blots and quantification of soluble desmin levels in the same
   samples. D Representative western blots and quantification of soluble
   CryAB levels in the same samples. E Representative western blots and
   quantification of insoluble desmin levels in the same samples. The
   loading controls (GAPDH and S Actin) are indicated on the graphs.
   Graphs show individual and mean ± SEM values expressed in arbitrary
   units (A.U.). Significant P values are indicated on the graphs. *in
   panel A shows the significance of 3MA treatment vs untreated cells. F
   Detection of ubiquitinated desmin in control and NCM treated with MG132
   (10 µmol/L) for 18 h by immunoprecipitation of desmin followed by
   western blot for ubiquitin and desmin. Crude: crude LV sample; IP Des:
   immunoprecipitation of desmin; Sur IP: supernatant of desmin
   immunoprecipitation. Efficiency of Des IP was verified with desmin
   western blot. G Representative PLA immunofluorescence staining of
   desmin-Hsc70, desmin-LAMP2a, and desmin-CryAB in control and NCM
   treated with MG132 (10 µmol/L) for 18 h. Nuclei are stained in blue.

Dysregulated autophagy associated with the levels of desmin and kinases in
human heart failure patients

   Our studies based on the in vivo experimental rat model and the in
   vitro cardiomyocyte model prompted us to assess levels of desmin, as
   well as the kinases selected to be involved in desmin phosphorylation
   and the chaperone proteins such as CryAB and CMA markers in the failing
   hearts of patients (Fig. [155]6 and Fig. S[156]7). Ubiquitination and
   macroautophagy markers were not modulated as previously described
   [[157]32]. We found significantly increased desmin levels with no
   modulation of CryAB levels in soluble protein fractions in the failing
   hearts compared to non-failing human hearts (Fig. [158]6A). On the
   other hand, both insoluble desmin and CryAB levels were significantly
   increased in the failing hearts (Fig. [159]6B). Surprisingly, we showed
   no significant modulation of PKCζ and of active PKCζ (Fig. [160]6C), of
   inactive GSK3β (Fig. S[161]5A) and, of active CaMKII (Fig. S[162]5E)
   between the two groups of patients. As in the experimental rat model of
   HF, we observed a significant strong colocalization of desmin with PKCζ
   in failing human hearts compared to the non-failing hearts (Fig.
   [163]6C and Table S[164]3). Among CMA markers, despite the low number
   of human samples analyzed and the inter-individual heterogeneity,
   LAMP2a levels tended to be increased in failing hearts while the levels
   of Hsc70 and Hsp90 were unchanged (Fig. [165]6D). Interestingly, Hsp90
   and soluble desmin levels significantly correlate negatively in the
   failing hearts (Fig. [166]6D). We also observed a weak colocalization
   of desmin with Hsc70 and with its chaperone CryAB in failing and in
   non-failing human hearts (Fig. [167]6E, Fig. S[168]7C, and Table
   S[169]3). As also observed in rat model there is only a weak
   colocalization between desmin and LAMP2a in human hearts (Fig.
   S[170]7D). Our data showed that the increase of insoluble desmin and
   CryAB, corresponding to desmin aggregates might be explained by
   alteration of both proteasome and autophagy activities.

Fig. 6. Desmin presents a scaffold defect and accumulates in the failing
human hearts.

   [171]Fig. 6
   [172]Open in a new tab

   A, B Representative western blots and quantification of soluble (A) and
   insoluble (B) desmin (left panels) and CryAB (right panels) levels in
   the heart of non-failing (NF) (n = 6) and failing (HF) patients
   (n = 6). C Representative western blots (top left panel) and
   quantification of PKCζ (bottom left panel) and active PKCζ (PKCζ
   pT560/PKCζ ratio) (bottom right panel) in the same samples. Double
   immunofluorescence staining for desmin (green) and PKCζ (red) (top
   panels) in frozen myocardial sections from non-failing (NF) and failing
   (HF) patients. Scale bar represents 20 µm. Nuclei are stained in blue
   as shown in the merge staining. Arrows indicate colocalization of
   desmin with PKCζ. D Representative western blots and quantification of
   LAMP2a (left panel), Hsc70 (middle panel), and Hsp90 (right panel) in
   the hearts of non-failing (NF) (n = 6) and failing (HF) patients
   (n = 6). Correlation analysis of Hsp90 expression levels with soluble
   desmin expression levels in the heart of failing patients (n = 6) is
   shown (bottom panel). The loading controls (GAPDH and S Actin) are
   indicated on the graphs. Graphs show individual and mean ± SEM values
   expressed in arbitrary units (A.U.). Significant P values are indicated
   on the graphs. E Double immunofluorescence staining for desmin (green)
   with Hsc70 (red) (left panels) and for desmin (red) with CryAB (green)
   (right panels) in frozen myocardial sections from failing patients.
   Scale bar represents 50 µm. Nuclei are stained in blue as shown in the
   merge staining. Arrows indicate colocalization of desmin with Hsc70 or
   CryAB.

Discussion

   The present study aimed to describe a novel signaling pathway
   implicating PKCζ as an upstream actor of GSK3β, in desmin
   phosphorylation in ischemic HF, leading to accumulation and aggregation
   of desmin.

   In the experimental rat model of HF, we have previously shown a
   modulation of soluble phosphorylated desmin levels [[173]4]. Here, we
   found a significant increase of the desmin levels in hearts of patients
   with end-stage ischemic HF, as previously shown [[174]10, [175]16,
   [176]33, [177]34] but also a significant increase of insoluble CryAB.
   It is well known that desmin is subjected to many PTM such as
   phosphorylation, that severely impacts its ability to polymerize into
   myofilaments, resulting in desmin filament depolymerization and even
   desmin aggregation [[178]10, [179]14, [180]23]. Desmin intermediate
   filament destructuration, supported by TEM showing disruption of
   sarcomeres, could alter the structural and mechanical integrity of the
   contractile apparatus of cardiomyocytes resulting in the decrease of
   the cardiac contractile capacity. In this context, we postulated that
   the phosphorylated forms of desmin could be a key step for downstream
   maladaptive desmin assembly and thus, for adverse LV remodeling
   post-MI. We then aimed to identify the molecular mechanisms responsible
   for the modulation of phosphorylated desmin levels during HF and to
   understand the defective processes leading to the accumulation of
   desmin aggregates in failing hearts of rats and patients.

   An in silico screening of kinases along with an assessment of their
   activity and/or expression in an experimental rat model of ischemic HF
   allowed us to highlight the implication of PKCζ and GSK3α/β in the
   modulation of desmin phosphorylation, as suggested by previous
   publications [[181]10, [182]35, [183]36]. Both were activated when the
   profile of phosphorylated desmin was modulated in the LV of HF-rats.
   The role of PKCζ in the heart is poorly understood; however, PKCζ
   appears to be involved in the hypertrophic response of cardiomyocytes
   through the regulation of atrial natriuretic factor re-expression
   [[184]37]. The role of GSK3 α/β in the heart is, however, much better
   understood. Indeed, GSK3β has been shown to be involved in the
   anti-hypertrophic processes in the heart [[185]38]. Its inactivation
   via the phosphorylation of its serine 9 in response to hypertrophic
   stimuli promotes cardiac hypertrophy and HF development [[186]39].
   Using primary cultures of rat neonate cardiomyocytes, we confirmed that
   PKCζ is able to phosphorylate desmin, in agreement with previous
   publications [[187]36].

   In response to a severe and prolonged stress such as MI, protein
   homeostasis also called “proteostasis” is disturbed, leading to an
   accumulation of protein aggregates with consequent proteotoxicity
   [[188]40]. The heart is particularly susceptible to proteotoxicity
   because sustained and severe proteotoxic stress leads to cell death,
   due to its limited self-renewal capacity for maintaining cardiomyocyte
   homeostasis and integrity [[189]18]. Autophagy mechanisms and the UPS
   are the major and complementary proteolytic pathways required to
   eliminate misfolded proteins and defective organelles in most of cells
   including cardiomyocytes [[190]41]. Alterations of autophagy and/or UPS
   functions are often associated with the accumulation of proteotoxic
   species in the heart [[191]42, [192]43]. We have therefore explored the
   dynamics of autophagy (macroautophagy and CMA) and UPS in the rat
   experimental HF model in order to decipher whether altered autophagy
   occurs during HF development, leading to desmin aggrephagy.

   As expected, UPS was not modulated in LV of HF-rats and human failing
   hearts as previously shown in human failing hearts [[193]32]. We
   observed a defect in macroautophagy in LV of HF-rats as confirmed by
   the absence of double-membrane vesicles analyzed by TEM and as
   previously shown in human failing hearts [[194]32]. Recently, inability
   of complete autophagy leading to disorganization of cardiomyocyte
   desmin/mitochondrial network has been described in an experimental rat
   model of pressure overload-induced HF [[195]25]. More interestingly, we
   demonstrated for the first time an induction of CMA during LVR post-MI,
   which may be involved in desmin clearance via its 4 KFERQ-like CMA
   motifs [[196]27]. Our data showed a switch between macroautophagy and
   CMA in rats at 2 months post-MI as shown during aging process
   [[197]44].

   We used several modulators of UPS, macroautophagy, and CMA in
   cardiomyocytes in order to determine the autophagic processes able to
   eliminate toxic desmin aggregates in order to understand the
   physiopathological mechanisms during HF development. We observed that
   activation of macroautophagy or CMA is sufficient for clearance of
   soluble desmin without any effect on the insoluble form and in its
   chaperone, CryAB. To strengthen our data, we verified the increased
   targeting of desmin in purified lysosomes under CMA activation and the
   presence of a cleaved form of desmin which may result from a cleavage
   carried out by cathepsin B [[198]31].

   Interestingly, ubiquitination of proteins associated with CMA
   activation are required to prevent desmin aggregates with clearance of
   both forms of desmin (soluble and insoluble) associated with a decrease
   of CryAB. This effect is independent of macroautophagy activation as
   the same effect was observed with combination of UPS and macroautophagy
   inhibition. Our data are in agreement with publications showing cleaved
   form of desmin in cytoplasmic aggregates [[199]34, [200]45]. Our data
   suggest that despite the ability of CMA to mediate clearance of desmin
   in vitro in cardiomyocytes, in the in vivo model of ischemic HF, CMA is
   unable to clear phosphorylated desmin which forms aggregates, mainly
   detected in the insoluble protein fraction, suggesting the difficulty
   of the KFERQ motifs to be accessible to Hsc70 [[201]44] but also the
   requirement of ubiquitination of proteins.

   We confirmed in human failing hearts a defect in autophagic processes
   leading to the presence of insoluble desmin aggregates. Only a trend
   increase of LAMP2a levels was observed but no modulation of Hsc70 and
   Hsp90 levels, in accordance with data showing that Hsc70 become
   limiting when LAMP2a is in excess [[202]44]. Interestingly,
   significantly increased levels of insoluble CryAB, were found in
   failing human hearts, and it has been shown that desmin and its
   chaperone can interplay in the maintenance of mitochondrial homeostasis
   and cardiomyocyte survival [[203]46, [204]47]. Our data suggest that
   CryAB as co-chaperone associated with Hsc70, interacts with
   hyperphosphorylated desmin aggregates and mediates their degradation
   through a process named chaperone-assisted selective autophagy (CASA)
   [[205]48]. Degradation of damaged components through CASA has been
   described to be activated when CMA is malfunctioning like in LAMP2 k/o
   mice leading to accumulation of autophagic vacuoles in cardiac muscles
   [[206]48]. This hypothesis is strengthened by recent publication
   showing that desmin generate amyloid-like oligomers in a proteotoxic
   mice model [[207]12]. In the failing human hearts, representing
   end-stage of the disease, CASA through Hsc70 and CryAB may act as
   compensatory and adaptative autophagic mechanism for
   hyperphosphorylated desmin aggregates [[208]49].

Conclusion and perspectives

   HF remains a leading cause of mortality and morbidity and during its
   development there is an accumulation of toxic aggregates in the heart
   due to a defective autophagy. Our data demonstrate a novel signaling
   pathway involved in desmin phosphorylation in ischemic HF. They suggest
   for the first time that desmin is new substrate of CMA and that CMA is
   able to clear monomeric phosphorylated soluble desmin. Desmin
   phosphorylation is complex, being an event that participates in the
   depolymerization of desmin intermediate filaments and in improper
   desmin assembly into aberrant aggregates [[209]12]. In
   pathophysiological conditions, CMA alone without the cooperation of
   other proteolytic systems, in particular ubiquitination and CASA, is
   not sufficient for intracellular clearance of phosphorylated desmin but
   requires the contribution of its chaperone protein, CryaB. Transient
   soluble phosphorylated desmin may gradually accumulate as insoluble
   amyloid-like oligomers after MI and thus participate to contractile
   dysfunction leading to HF. We could speculate that improving autophagy
   processes earlier after MI by early CMA activation associated with the
   contribution of CryAB to stimulate desmin clearance might be a
   therapeutic approach to fight against desmin aggregates in order to
   maintain cardiomyocyte survival.

Materials and methods

Pathway network analysis

   Integrated pathway enrichment analysis was performed by using the
   knowledge-based canonical pathways and endogenous metabolic pathways
   MetaCore pathway analysis software (GeneGo). The differentially
   expressed [[210]50] or phosphorylated [[211]3] proteins were mapped
   into biological networks by using a manually curated proprietary
   database (MetaCore, GeneGo, St. Joseph, MI, USA), a pathway analysis
   tool. UniProt protein accession numbers provided from the UniProtKB
   database ([212]http://www.uniprot.org) were uploaded into the database.
   For network analysis, expand by one interaction algorithm was used with
   phosphorylation/dephosphorylation filters. We also used advanced
   options by selecting both directions, disconnected root nodes, and
   discarding low trust interactions, functional interactions, and binding
   interactions.

Experimental rat model of ischemic heart failure

   All animal experiments were performed according to the Guide for the
   Care and Use of Laboratory Animals published by the US National
   Institutes of Health (NIH publication NO1-OD-4-2-139, revised in 2011).
   Randomized animals were used and experimental protocols performed under
   the supervision of a person authorized to perform experiments on live
   animals (F. Pinet: 59-350126). Approval was granted by the
   institutional ethics review board (“Comité d’Ethique pour
   l’Experimentation Animale Nord Pas-de-Calais” N°242011, January 2012).
   In brief, rats were anesthetized (xylazine 5 mg/kg intraperitoneally)
   as previously described [[213]51]. MI was induced in 10-week-old male
   Wistar rats (Janvier, Le Genest St Isle, France) by ligation of the
   left anterior descending coronary artery according to the method
   previously described [[214]1, [215]51]. Hemodynamic and
   echocardiographic measurements were performed 2 months after surgery as
   previously described [[216]50] and are summarized in Table S[217]1.
   After sacrifice of rats by an overdose of pentobarbital, their hearts
   were excised and dissected, the right and left ventricles were
   separated and the infarcted area was removed. Tissues were kept at
   −80 °C until analysis.

Transmission electronic microscopy

   Rat LVs were immediately fixed in 4% paraformaldehyde and 1%
   glutaraldehyde in 0.1 mol/L phosphate buffer for 3 h. LV were then
   rinsed with PBS 1X, cut into 1-mm thickness pieces, and incubated for
   1 h in 0.1 mol/L sodium cacodylate containing 1% glutaraldehyde. The
   samples were post-fixed in the dark for 1 h in 1% osmium tetroxide/1.5%
   potassium hexacyanoferrate. Several washes with deionized water were
   performed before incubation of samples in the dark for 1 h in 4% uranyl
   acetate. The tissues were then rinsed in deionized water and dehydrated
   through increasing concentrations of ethanol (50%, 70%, 95%, 100%, and
   100%, 10 min each) before overnight incubation in a 1:1 mixture of
   ethanol/epoxy resin. The tissue pieces were embedded in fresh 100%
   epoxy resin containing 1.7% dimethylaminoethanol for 3 days before
   epoxy resin polymerization for 24 h at 60 °C. The blocks were trimmed
   and 80-nm sections cut using a diamond knife, were collected on 100
   mesh copper grids. Sections were observed using a Hitachi H7500
   transmission electron microscope at 80 kV and photographed using an AMT
   digital camera.

Human hearts

   Tissues from failing (n = 6) and non-failing (n = 6) human hearts were
   obtained respectively from Lille University Hospital (France) and from
   Catholic University of Leuven (Belgium). Explanted heart tissues were
   obtained from patients undergoing heart transplantation for end-stage
   ischemic heart failure and from patients died of non-ischemic causes
   including suicide (n = 1), car crash (n = 1), polytrauma (n = 1), and
   trauma (n = 3). Samples were quick-frozen and stored at −80 °C. All
   materials from patients and controls were recovered as surgical waste
   with informed consent of the donors and with approval of the local
   ethical boards (“Centre Hospitalier et Universitaire de Lille”, Lille,
   France and Pole of Pharmacology and Therapeutics of “Université
   Catholique de Louvain” and “Cliniques Universitaires Saint-Luc”,
   Brussels, Belgium) and according to the Declaration of Helsinki.

Cell culture

Primary cultures of neonatal rat cardiomyocytes

   Primary cultures of rat neonatal contractile cardiac myocytes (NCM)
   were prepared from heart ventricles of 1- or 2-day-old rats as
   previously described [[218]22]. Briefly, cardiac cells of newborn rats
   ventricles were dissociated by enzymatic digestion with 0.04%
   collagenase II (Worthington, Lakewood, NJ, USA) and 0.05% pancreatin
   (Sigma-Aldrich). Non-NCM cells were removed by 30 min centrifugation at
   1600 × g in a discontinuous Percoll gradient (bottom 58.5%, top 40.5%,
   Sigma-Aldrich). NCM were then seeded at a density of 4 × 10^5 cells per
   well in six-well plates coated with 0.01% of collagen (Sigma-Aldrich)
   and cultured in a medium containing DMEM/Medium199 (4:1), 10% horse
   serum (Life Technologies), 5% fetal bovine serum (FBS) (ATCC), 1%
   penicillin and streptomycin (10,000 U/mL, Life Technologies) for 7 days
   at 37 °C under 5% CO[2] atmosphere.

   To inhibit protein kinase C (PKC) ζ, NCM were serum starved for 1 h and
   then incubated with 10 µmol/L of the myristoylated PKCζ pseudosubstrate
   (^114-IYRRGARRWRKL-^125, myrPS, Enzo Life Sciences) for 1 h.

   To induce macroautophagy, NCM were treated by HBSS (Hank’s Balanced
   Salt Solution) (Sigma-Aldrich, 55037C) for 2 h and compared to cells
   cultured in 10% FBS medium. To inhibit the autophagosome-lysosome
   fusion, NCM were pre-treated with bafilomycin (Baf, 50 nmol/L) for 2 h
   before co-treatment of the cells with HBSS and Baf for 2 h.

   To induce CMA, two pharmacological treatments were used: 2 and 5 µmol/L
   of geldanamycin (GA, Sigma-Aldrich) for 17 h [[219]30] and pretreatment
   for 1 h with 10 mmol/L of a macroautophagy inhibitor (3-methyladenine,
   3MA, Sigma-Aldrich), and then co-treatment for 18 h with 10 mmol/L 3MA
   and 10 µmol/L of a proteasome inhibitor (MG132, Sigma-Aldrich).

H9c2 cells

   Cells were cultured at 37 °C in the presence of 5% CO[2] in DMEM
   GlutaMax-1 (Life Technologies) supplemented into 10% FBS. Isolation of
   lysosomes was performed according to the method previously described
   with minor modifications [[220]52].

   Isolation of lysosomes from H9c2 cells was performed according to the
   method previously described with minor modifications [[221]52].
   Briefly, 8 × 10^6 H9c2 cells were washed twice with PBS and collected
   in 1 mL of homogenization medium (HM; 0.25 mol/L sucrose, 1 mmol/L
   Na[2]EDTA, 10 mmol/L HEPES, pH 7.4) before 10 min centrifugation at
   500 × g. Cells were then lysed with a Potter-Elvehjem in 1 mL of HM and
   centrifuged 10 min at 800 × g. The supernatant was kept on ice and the
   pellet was suspended in 500 µL of HM and again centrifuged. The
   supernatants were pooled and mixed with 120 µL 10% FBS, 670 µL of
   Percoll solution (90% Percoll, 0.25 mol/L sucrose, 1 mmol/L Na[2]EDTA,
   10 mmol/L HEPES, pH 7.4) and HM to a final volume of 3 mL before 45 min
   ultracentrifugation at 36,000 × g and 4 °C. The gradient
   dense-end-first was collected and supplemented with Igepal CA-630 at a
   final concentration of 0.5% before pelleting the Percoll by
   ultracentrifugation for 2 h at 100,000 × g and 4 °C. The supernatant
   was then diluted in 8 volumes of cold acetone and incubated overnight
   at −20 °C to precipitate the proteins. After a 10 min centrifugation at
   15,300 × g and 4 °C, the lysosomal proteins were suspended in Laemmli
   buffer and analyzed by western blot.

Immunofluorescence

   Frozen rat LV tissues and human heart tissues were included in
   Richard-Allan Scientific™ Neg-50^TM (ThermoFisher Scientific Inc). The
   LV tissue sections (10 µm thickness) and cultured NCMs were fixed for
   20 min with 4% paraformaldehyde/PBS and then permeabilized with 0.1%
   Triton/PBS for 20 min before 30 min incubation in 1% FBS/PBS. After
   overnight incubation with primary antibodies (see below the detailed
   list) in 1% FBS/PBS at 4 °C, the samples were incubated for 30 min at
   room temperature (RT) with a fluorescent conjugated secondary antibody
   (Alexa Fluor 488 or 555 coupled anti-mouse or anti-rabbit secondary
   antibodies) diluted 1/500 in 1% FBS/PBS. The LV tissue sections were
   rinsed with PBS before 10 min nuclei staining with Hoechst 33258
   (10 µg/mL) (ThermoFisher Scientific Inc). After washing with PBS,
   coverslips were mounted with glycerol/PBS 10X (90/10, v/v). Staining
   was visualized with the ×40 and ×63 objectives of LSM710 confocal
   microscope followed by Zen image acquisition and software analysis
   (Zeiss). Images were acquired with a resolution of at least 1024 × 1024
   and analyzed with ImageJ software. At least 10 fields are photographed,
   corresponding to ~100 (×40 objective) −200 (×63 objective) cells
   depending on the magnification and the type of cells. Photographs shown
   are representative of the staining observed. Colocalization was
   quantified by Pearson’s coefficient, describing the correlation between
   the intensities of 2 proteins with the JACoP plugins on ImageJ
   software.

   We performed proximity ligation assay (PLA) following manufacturer’s
   instructions (Olink Bioscience, Uppsala, Sweden). Briefly, after
   primary antibody incubation as described before, samples were incubated
   1 h at 37 °C with secondary antibody coupled to oligonucleotidic probes
   (Duolink® In Situ PLA® Probe anti-mouse PLUS et anti-Rabbit MINUS,
   Sigma-Aldrich), diluted at 1/5 in BSA 1%. After two washes with PBS 1X,
   samples were incubated for 30 min at 37 °C with ligase (1/40 in
   ligation solution). After two washes with PBS 1X, samples were
   incubated for 1 h 40 min at 37 °C with polymerase (1/80 in
   amplification solution). After washing with PBS, coverslips were
   mounted with glycerol/PBS 10X (90/10, v/v). Staining was visualized
   with the ×40 objectives of LSM710 confocal microscope followed by Zen
   image acquisition. Images were acquired with a resolution of at least
   1024 × 1024 and analyzed with ImageJ software. Number of spots by cells
   was quantified by a “home-made” plugin write on ImageJ software.

Proteins extraction

   Proteins from human hearts and rat LVs were extracted from frozen
   tissues (after removing the infarcted area) with Dounce-Potter
   homogenization into ice-cold RIPA buffer (50 mmol/L Tris pH 7.4,
   150 mmol/L NaCl, 1% Igepal CA-630, 50 mmol/L deoxycholate, and 0.1%
   SDS) containing antiproteases (complete EDTA-free, Roche Diagnostics),
   serine/threonine and tyrosine-protein phosphatase inhibitors
   (Phosphatase inhibitor Cocktail 2 and 3, Sigma-Aldrich) and 1 mM
   Na[3]VO[4]. After 1 h incubation at 4 °C, the homogenate was
   centrifuged at 15,300 × g for 15 min at 4 °C and the supernatant
   containing soluble proteins was collected. The pellet containing
   insoluble proteins was solubilized in urea-thiourea buffer (5 mol/L
   urea, 2 mol/L thiourea, 50 mmol/L DTT, 0.1% SDS in PBS pH 7.4) and
   sonicated three times for 6 s at 20 Hz (Vibra Cell, Bioblock Scientific
   72442) before 15 min centrifugation at 15,300 × g and 4 °C. The
   supernatant containing insoluble proteins was collected and samples
   were stored at −80 °C. After pharmacological treatments, cells were
   rinsed twice with PBS before being mechanically scraped from the plate
   in 50 µL of ice-cold RIPA buffer. Soluble and insoluble proteins were
   extracted as described above. Protein concentrations for all samples
   were determined with a Bradford-based method protein assay (Biorad,
   Marnes-la-Coquette, France).

Immunoprecipitation, western blot, and Phos-tag gels

Immunoprecipitation

   Immunoprecipitation was performed with 50 μg of NCM proteins or LV
   proteins pre-cleared by incubation with protein A/G magnetic beads
   (88802, Pierce) for 1 h at 4 °C with gentle shaking. The pre-cleared
   proteins were then mixed with 5 μL of anti-desmin antibody diluted in
   100 μL of RIPA 1X buffer as previously described [[222]4]. After
   overnight incubation at 4 °C on a rotating device, immune complexes
   were precipitated at 4 °C for only 2 h on a rotating device with 35 μL
   of protein A/G magnetic beads washed three times in RIPA 1X buffer
   (Pierce™ Protein A/G Magnetic Beads Thermo Scientific). The supernatant
   (Sur) was recuperated and the immunoprecipitated (IP) complexes were
   then washed four times with 750 μL of RIPA 1X buffer before
   denaturation of both in Laemmli buffer at 70 °C for 10 min and western
   blot analysis.

Western blot

   Soluble (5–50 μg) and insoluble proteins (1–20 μg) were analyzed on
   SDS-PAGE gels (8, 10, 12, or 15%, depending on the protein analyzed).
   Proteins were transferred to nitrocellulose membranes and blocked for
   1 h in Tris-buffered saline with 0.1% Tween-20 (TBS-T) containing 5%
   skim milk or FBS with constant shaking. Membranes were then incubated
   with primary antibodies (see Table S[223]2) diluted in TBS-T with 5%
   skim milk or FBS overnight at 4 °C with constant shaking. The blots
   were then washed with TBS-T and incubated at RT with horseradish
   peroxidase-labeled secondary antibodies diluted in 5% skim milk or
   FBS/TBS-T for 1 h. Following the secondary incubation, the membranes
   were washed with TBS-T before blots imaging. Equal protein loading was
   confirmed using GAPDH, α-tubulin, or sarcomeric actin immunoblotting.

Phos-tag gels

   Soluble and insoluble proteins were analyzed on 10% gels containing
   40 µmol/L of Phos-tag (Wako, Osaka, Japan) and 100 µmol/L of Mn^2+ for
   detection of the phosphorylated forms of desmin as previously described
   [[224]53]. At equivalent phosphorylation levels, the position of the
   phosphate group can also influence the apparent molecular weight of a
   protein in a Phos-tag gel.

Blots imaging

   The Chemidoc XRS+ camera (Biorad) and the Image Lab software were used
   for blots imaging and densitometry analysis. Membranes were incubated
   for 5 min with Clarity Western ECL Substrate (Biorad) before imaging.
   The signal was quantified from the image obtained just before
   saturation. The band corresponding to the protein of interest was
   framed within a defined area to express the signal intensity depending
   on the area. This value was related to the intensity value of the
   reference protein (GAPDH, α-tubulin, or sarcomeric actin). The values
   were expressed in arbitrary units (A.U.).

mRNA isolation and quantitative reverse transcription PCR

   Total RNA isolation was prepared from LV tissues using TRI Reagent®
   (Sigma-Aldrich). Tissues were homogenized with an Ultra-Turrax® at 4 °C
   and then incubated for 5 min at RT. After 10 min centrifugation at
   12,300 × g the supernatant containing RNA was collected. One part of
   chloroform was added for 5 parts of TRI Reagent® containing RNA.
   Samples were shaked and centrifuged for 12 min at 12,000 × g. The
   supernatant was collected and one volume of isopropanol was added for
   overnight incubation at −20 °C. After 30 min centrifugation at
   13,000 × g the pellet was washed with ethanol 70% and centrifuged for
   10 min at 12,000 × g. The pellet was air dried in ice before RNAse-free
   water solubilization. RNA samples were heated for 5 min at 85 °C and
   then stored at −80 °C. Sample RNA quality was checked with a
   bioanalyzer (Agilent 2100 Bioanalyzer, Agilent Technologies) to
   determine the RNA integrity number. Total RNA (500 ng) was subjected
   for first stand cDNA synthesis with the miScript II RT kit (Qiagen)
   according to the manufacture’s recommendations. After cDNA synthesis,
   the ASB2β expression was evaluated by quantitative PCR with the miSYBR
   Green PCR kit (Qiagen) on an Mx3000P Q-PCR System (Agilent
   Technologies). Hypoxanthine-guanine phosphoribosyltransferase (HPRT)
   was used as an internal control. The relative ASB2β mRNA expression was
   quantified using the method 2−ΔΔCt, where −ΔΔCt = ΔCt (HF sample) − ΔCt
   (Sham sample), and ΔCt = Ct (ASB2β) − Ct (HPRT). PCR primers were
   ATCTCTTTGTTGCCTAGACC (forward) - CAGAAGAGTGACTCAGCAG (reverse) for
   ASB2β [[225]8] and ATGGGAGGCCATCACATTGT (forward) and
   ATGTAATCCAGCAGGTCAGCAA (reverse) for HPRT.

Statistical analysis

   Data expressed as mean ± SEM were analyzed with GraphPad Prism version
   6.01 (GraphPad Software, San Diego, CA) and comparisons were performed
   by Mann–Whitney (two-tailed), one- or two-way analysis of variance
   (ANOVA) with Tukey’s post hoc test, as appropriate. Results were
   considered statistically significant if the P < 0.05.

Supplementary information

   [226]Figure S1^ (383.8KB, png)
   [227]Figure S2^ (43.2KB, png)
   [228]Figure S3^ (20.1KB, png)
   [229]Figure S4^ (90.4KB, png)
   [230]Figure S5^ (42.1KB, png)
   [231]Figure S6^ (70.8KB, png)
   [232]Figure S7^ (388.2KB, png)
   [233]Supplemental informations^ (38.5KB, docx)

Acknowledgements